JPS61502586A - Cloned genes and how to create and use them - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Cloned genes and how to create them and usage This application is part of U.S. Patent Application No. 627,811, filed July 5, 1984. This is a continuation application.

Emperor-1 Spheroidiasis is an intracellular parasite that invades the epithelial cells lining the gastrointestinal tract and the cells of its accessory glands. A disease caused by living protozoa that is common to all vertebrates, including humans. . Crowded conditions in which large numbers of livestock are kept contribute to the increased incidence of this disease. fruit All domestic animals are susceptible to infection, and the parasites are distributed all over the world. Therefore Therefore, coccoid sporodiosis can be said to be a cause of large economic losses throughout the world.

The poultry industry has been particularly hard hit, with coccoliosis affecting the most economically important poultry It is a parasitic disease. Since 1949, prophylactic antisporidial agents have been used. cannot be said to have an overall effect. Weight gain, decreased egg production and copper conversion Profits and losses continue to be caused by coccoid sporodiasis disease rates, including a decline in rates. broiler production The cost of coccoid sporophytes in is 172 to 1 cent per bond. usa annual The total profit and loss for 3 billion broiler chickens produced is 60 million to 120 million. It will be worth 10,000 dollars. Add to this amount an estimated $35 million in anti-sporidia costs. There is a need to. From such a huge number, it is possible to reduce the incidence of coccoliosis in chickens. The importance of this is being emphasized.

Of the nine globosporous genera known to infect birds, Eimeria spp. contains the most economically important species.

Although various species of the genus Eimeria infect a wide range of hosts (including mammals), Nine species have been recognized to have varying degrees of pathogenicity to chickens: Ei meria acervu man, E, m1va+L i:, m1tis, E, anus and grinding, E.

m■＋E, necatrix, E, maxilla, E, brune tti.

It can be used to explain the growth stages of the avian coccoid sporidia, which is the subject of the present invention. can.

The life cycle is that the host transforms the primordial eggs into spores during outdoor rearing or by inhaling dust. It begins when it is ingested. Primordial eggs are sporulated by mechanical and chemical actions in the gizzard and intestinal tract of chickens. are destroyed and the reproductive spores are released. Reproductive spores are carried along with the digesta It infects various parts of the gastrointestinal tract by entering epithelial cells. subsequent growth Multiple asexual divisions as stages, infection of other epithelial cells.

The zygote continues to grow, becomes fertilized, becomes a zygote, and is released dripping from the host. Served. The primordial egg undergoes nuclear and cytokinesis and becomes the spore primordial egg, but sporulation does not occur. Determined by surrounding environmental conditions. By ingestion of the spore-formed primordial egg by a new host disease is transmitted.

Of all the species of the genus Eimeria, E. tenella has attracted the most attention.

E. tenella is highly pathogenic and death occurs on the 5th or 6th day after infection. There are many things. Experimentally, the mortality rate is 100%, but in actual breeding sites, the mortality rate is over 20%. It has been tell.

Before the use of chemical agents, various management plans were the only means of preventing coccolidia in poultry farmers. Met. These plans aim at hygiene management through mechanical straw removal and disinfection. Met. Despite these efforts, there are usually not enough primordial eggs left for disease transmission. It was.

One of the preventive measures against coccophoric damage is immunization. In the tree method, poultry is aged 3 years old. Small amounts of primordial eggs of each of the 8 species of the coccoid sporozoites are ingested for a week.

Unfortunately, controlling the dosage proved difficult. That's because the chicken is Musumehara. After ingesting the starter eggs, some chickens developed severe coccoliosis; This is because sensitivity was maintained. This method also prevents mixed infections. As a result, sufficient immunity to all species administered may not be achieved. Sara However, it takes too long to acquire immunity, making it impossible to use in broiler production.

Another preventive measure against coccoidosis is drug treatment after poultry infection. It is. One of the drugs used is sulfonamide, which is Ryukyu sporidia activity against 6 species of . However, the problem with this method is that it The treatment is started after some chickens start showing symptoms, so the treatment is too late and may not be effective. This means that there are many cases where no results are obtained.

Ideally the best method is preventive medication. Since the beginning of the use of sulfonamide drugs, More than 40 compounds have been commercially available as prophylactic agents against coccoid sporidia. Spawning Contamination of chicken feed with Ryukyusporidium drugs, and excessive administration of anti-Ryukyosporidium drugs in feed These include toxicity to sly chickens and large outbreaks of coccolidia due to forgetting to administer drugs to feed. Overall, there are a number of problems with the use of such drugs.

In particular, a problem that has arisen as a result of this is drug resistance in coccoid sporozoites. more edible There is also the possibility of drug residue in the meat.

As is clear from the above, existing means of preventing coccoidosis are very incomplete. Safe, effective, and inexpensive measures are being sought.

The development of an effective Ryukyusporidian vaccine is an ideal solution to the problem of preventing this disease. This is a decisive decision. Vaccine production using traditional methods is thought to require considerable development. It will be done. Production of attenuated strains by passage of embryos and cultured cells has been reported. There is. Although this method may actually lead to successful vaccine production, All major species of the genus Eimeria complete their life cycles in cultured cells and embryos. It is not always possible to grow and adapt as you can. This is Eimeria This is a problem because cross-immunity does not occur between species of different genera. i.e. one species This is because even if one develops immunity against a species, infection by other species cannot be prevented.

Genetic engineering methods have presented a new approach to vaccine development. of pathogenic organisms It is possible to clone genes encoding antigenic proteins into microorganisms. Known. This allows the antigenic protein to be expressed at high levels, purified, and It can be used as a vaccine against things. This antigenic protein has no anger-infecting power at all. It has the potential of having the advantages of low production costs. Such “partial work” Kuchin” is a hepatitis virus.

Prepared from antigen genes of numerous viruses such as herpes simplex virus, hand-foot disease virus, etc. has been done. Another attempt is to create a ``synthetic vaccine,'' which uses the viral antigen DAN. It is the production of small chemically synthesized peptides whose sequences are based on amino acid sequence translation.

These “synthetic vaccines” are an alternative to traditional attenuated pathogen or killed vaccine injections. Lerner, Nature, Vol. 299, pp. 592-596 (19 82).

Currently, foreign proteins, including eukaryotic proteins, are treated as Durham-positive or Gram-positive. It has become possible to produce it in prokaryotes such as negative bacteria. The method is DNA (obtained by enzymatic degradation of cytoplasmic DNA or reverse transcription of mRNA) by integration into the vector. Such expression vectors can be plasmids or bacteria. +11 A replication agent derived from any of the lyophages that functions within the microbial host cell. a starting point, (2) a gene encoding a selectable marker, and [3) The promoter, oligonucleotide, which functions and directs subsequent transcription and translation into the introduced foreign ON. pellator, and control sequences including ribosome binding sites. Tan To increase protein production and stability, eukaryotic proteins are substituted for prokaryotic proteins. It is often produced as a fusion with the amino terminus. β-galactosidase One of the tryptophan operon gene products from Figure 3 was successfully used in this method. are doing. Expression vectors can be used in yeast or Chinese hamster ovary tissue culture cells. It has also been developed for the expression of foreign proteins in eukaryotic host cells such as

Host cells transformed with the expression vector produce the foreign protein contained in the vector. are grown under culture conditions that promote Such host cell/expression vector systems are designed to control the expression of foreign proteins by chemical or temperature induction. It is often Secreted proteins are separated from the growth medium and released into intracellular proteins. Proteins are isolated by collecting cells, lysing them, and separating intracellular components. child Relatively large quantities of substances that are otherwise difficult to purify from natural sources, such as It becomes possible to produce proteins.

In this way, microbiologically produced proteins are specifically identified with only one antigenic determinant. A monoclonal antibody that binds and exhibits a constant affinity for its determinant A number of well-known methods, including the use of infected birds (hereinafter referred to as MCAs), and The development of multivalent antibodies that react with a wide variety of antigens or with multiple antigenic determinants on a single antigen Features the use of

Another way to produce “synthetic” or “partial” vaccines is by using Foul Bottles. This is the use of chicken pox virus. Smallpox virus vaccine is a vaccine It has a long history of use and has been used virtually to treat smallpox in humans.

Fuchsia (cowpox) virus can be effectively used in genetic engineering to express foreign antigens. (Smith et al. Nature, Vol. 302, pp. 490-495) 1983), Pancali et al., ProC, Nat'l, Acad, 5ci-USA Vol. 80, pp. 5364-5368 (1983), Macke tt et al. J, of Viro-1ogy, Vol. 49, pp. 857-864 (198 4) The produced virus can be used against other viruses and infections other than smallpox. It has been proven that it can be used as a cutin. Fowlpox virus becomes cowpox virus Recombinant production expressing foreign antigens that are very similar and have been developed for cowpox virus. A number of methods for generation can also be applied to fowlpox virus. avian globosporidian From the above, the attenuated fowlpox virus prepared to produce antigens is an anti-spheroid virus. This is another method of producing larval vaccine. Live vaccines are cheap to produce It has the advantage of providing immediate immunity.

The second type of live vaccine presents antigens in the gastrointestinal tract, where coccoid sporozoites normally invade. be done. This method relies on harmless bacteria that are ingested with food and added to the intestinal flora. , making use of antigen expression on the external surface or secretion. Secretions are normally secreted proteins The antigen gene is added to the gene encoding the quality while keeping the signals necessary for secretion intact. It is obtained by merging the. Expression on the outer surface is usually localized to the outer surface. It is carried out by fusing an antigen gene to a gene that encodes a protein. (T, 5ilhavy, U.S. Pat. No. 4,336,336). This type of raw wax Cutin has the lowest production cost and the immune response it induces is less likely to cause coccoid sporozoites to invade the gastrointestinal tract. It can be said to be extremely advantageous in that it is a particularly effective type for entering.

11 standing 1 standing Monoclonal or polyvalent antibodies against antigenic proteins of avian coccoid sporozoites Discloses a cloned gene that determines which antigen proteins match. Furthermore, the gene for the production of antigenic proteins used in vaccines against avian coccoid sporidia. Disclose usage.

A simple amount of surface゛■ Figure 1 shows monoclonal or polyvalent antigen proteins for avian coccoid sporidia. The DNA sequence of the 5'-3' strand of cDNA that encodes the antigen protein that binds to the antibody. column and the amino acid sequence determined thereby.

゛　Hi, the i thin i゛ The present invention is directed to a specific antibody against the antigenic protein of avian cocclocosporidium obtained from infected chickens. A clone that encodes the antigenic protein that binds to monoclonal or multivalent antibodies. Concerning gene genes.

Eimeria There are nine species of the genus Avian coccolipids (i.e. -E, tenella+E, ac ervnlina, E, maxima+E, dandann+E, brunett i, E, m1vati, E.

m1tns, R,7 mltis, E, adenoides). A noclonal antibody (MCA) was prepared.

(Danforth, J. Paristol, Vol. 68, pp. 392-397 (19 82).

The MCA cell line injects mice with reproductive spores isolated from primordial eggs of the various species described above. Created by. These mouse lung cells were fused with mouse bone marrow cells. Cell lines derived from one type of cell can be isolated, characterized, and analyzed for species specificity. It was done.

The U.S. Department of Agriculture has also added polyvalent immunized chicken serum against E. tenelta to coccoid spores. This primordial egg (102-10S) is administered to chickens raised in the absence of insects to infect them and immunize them. and prepared by collecting chicken serum 4 to 14 days after infection.

This antiserum was determined to be E, tenel by enzyme-linked immunosorbent activity assay (ELISA). The antiserum was tested using E. la reproductive spore extract as an antigen, and the antiserum was E. It was revealed that the reproductive spore protein contains the reproductive spore protein antibody. For various MCAs Then, binding to air-dried reproductive spores was determined by indirect immunofluorescence immunoassay.

? The binding pattern of ICA can be attached to the tip of the parasite, the pellicle, the refractor, or a combination thereof. The more common internal fluorescence (similar to that seen in chicken antisera) was different.

(Danforth and Augustine, Poultry Science Volume 62, 2145-2151. Page (1983) Some of the MCAs refer to them as It binds to species other than the reproductive spore species used to make it, while others are species-specific. It was a target. In vitro tests were conducted on the 2.3 MCA, and They were found to inhibit the invasion and growth of parasites into epithelial cells to varying degrees. (D anforth, Amer, J, Vct+Res, Volume 44, 1722~ 1727 pages (1983).

Coccoid sporidian antigenic proteins had not been previously identified and isolated; Data regarding amino acid sequence were not available. For this reason, the coccoid sporozoite antigen Antibodies against the form containing DNA encoding coccoid sporozoite antigens by immunological methods It is used to identify transformed cells. MCA can be species-specific or common to nine species. as a means to identify cells containing DNA sequences encoding coccoid antigens. used. Screening of transformed cells with polyvalent chicken antiserum identification of DNA sequences encoding a wide range of coccoid sporidian proteins that are antigenic in used. The DNA sequence of the transformant thus identified can be introduced into the microorganism. and mass production of protein is carried out. Antigenic protein forces exist both in their natural form and in other forms. It can also be used in the form of a hybrid with the 2&R protein to immunize chickens to protect them from infection with 2&R. It can be used as a vaccine against cancer.

Monoclonal or polyvalent antibodies against antigenic proteins of Avian coccophorum Several methods are available to construct microorganisms that produce antigenic proteins that Can be used.

One of these methods can be roughly divided into the following, and each To explain a little bit: () m found in cells of the genus Eimeria. Recovery and isolation of RNA; (2) In vitro using coccoid sporidian mRNA as a template synthesis of complementary DNA (cDNA); (3) cDNA into a suitable expression vector; (4) Insertion of the cloned gene or transformation of bacterial cells with this vector; is the recovery and isolation of gene fragments.

This route can be called the mRN^ route. The advantage of this route is that the “expressed” gene Only the individual transformants needed to express the entire number of genes are cloned. This means that the number of can be reduced.

Another method can be divided into the following steps, which are explained below. (Recovery of each DNA found in cells of the genus Eimeria and ; (21 DNA fragmentation and insertion into an appropriate vector; (3) Appropriate microbial host (4) Selection of transformants containing the gene that determines the target antigen (5) Recovery and isolation of cloned genes or gene fragments. The main route is nuclear DNA It can be called a route.

The advantage of this route is that the entire gene is cloned, so at the time of isolating the mRNA, This means that genes that are not expressed can be identified. These remains There are genes expressed at different stages of the life cycle that are difficult to isolate as genes. .

After recovering and isolating the cloned gene obtained by the method described above, cloning D Advantageously, antigenic proteins can be prepared by transferring the NA sequence into a suitable expression vector/host cell system. Proteins are produced in large quantities.

The isolated DNA sequence, when administered to chickens, elicits an immune response and protects them from subsequent infection. encodes antigenic proteins such as encode proteins like this It is not necessary to isolate the entire coccoid sporidian gene. This is called an antigenic determinant. This is because only one portion of the protein is sufficient to elicit a protective immune response ( 1, erner+, supra). This antigenic determinant is folded to elicit an immune response. It is thought that it exists on the surface of microorganism-produced proteins. (Lerner+ (cited above).

In the mRNA route, sequences are isolated during the reproductive spore stage of the parasite. chicken It has been demonstrated that some of the protective immune responses of . Scientists from the U.S. Department of Agriculture have detected antibodies against reproductive spores in the serum of immunized chickens. This also indicates that reproductive spores are affected by life cycle stages affected by the chicken's immune response. This indicates that it is a page. Antigenic proteins isolated from other life cycle stages It is also believed that the quince is still effective as a vaccine.

Multivalent antibodies and 1'lcA that bind to various reproductive spore proteins are It can be used to identify cloned DNA sequences encoding proteins. These tampers Quercus can be isolated and used to induce a protective immune response in chickens.

Reproductive spores were prepared using the method of Doran and Vetterling, (Pro).

He1m1nthol Soc, Wash, Vol. 34, pp. 59-65 (1967 )) was obtained from the primordial egg by prolapse of the cyst, and Bon tewps and Yvo Leukopak filter method of re (Ann, Rech, Vet.

5, Vol. 109-113 (1974)).

Doran and Vetterling's method obtains reproductive spores from primordial eggs. However, any method that leaves the nucleic acid within the reproductive spore intact may be used. It's okay if it's off. In addition, the mRNA of reproductive spores is also an intact sporogen containing reproductive spores. It can be isolated from the first egg.

nRNA root Isolation of mRNA encoding the antigenic protein of interest is performed using a nuclease (nucleolytic enzyme). lysis of intact sporulated primordial eggs under conditions that minimize the activity of achieved more advantageously. This is what Pa5ternak et al. (Molec Bioch Improvement of the method of Em.Parisitol, Vol. 3, pp. 133-142 (1982)) It is carried out by law. Total RNA was prepared with sodium dodecyl sulfate (SDS) and protein. The primordial eggs are separated by crushing them with glass beads in a solution containing tinase K. Let go. After denaturing and decomposing the proteins of the primordial egg, the RNA is extracted with phenol and Decomposes by tanol precipitation. Next, oligo(dT)-cellulose chromatography 1fiRNA is isolated from the total RNA fraction by PCR.

The protein encoded by the isolated mRNA is subjected to cell-free translation in vitro. It can be synthesized using the system. A number of cell-free translation systems have been developed, and Bud extract (Martial et al., Proc, Nat'l, Acad, Sci , LISA, Volume 74, 1816-1820 (1977)), Rabbit Red Blood Cell Lysis Solution (Pelham and Jackson, Eur, J., Biochem, 67, pp. 247-256 (1976)) Frog primordial egg (Stoma et al., Me thods in Enzymology, Vol. 79, pp. 68-71 (1981)) Rabbit red blood cell lysates are suitable for testing m'RNA of reproductive spores. ing. Rabbit red blood cell lysates contain radioactive isotopes such as (2SS)-methionine. Since the body-labeled amino acids are supplemented, the protein produced does not contain tracers. There is. Various proteins and quality products react with the above-mentioned polyvalent chicken antiserum and MCA, and then In the case of multivalent antibodies, goat anti-chicken IgG and Staphylococcus aureus A protein; In the case of MCA, it reacts directly with A protein. A protein is rat and goat binds to any antibody to form an immunoprecipitated complex. Translation and immunoprecipitation The products of coalescence formation are visualized by agar electrophoresis and fluorescence radiography. . An mRNA fraction that was found to produce a protein that reacts with antiserum in this system is used for double-stranded cl) HA synthesis. On the other hand, 1nvitro efficiently synthesizes Prevents escape of antigens that may not be detected or immunoprecipitation reactions cannot be performed efficiently For this purpose, total mRNA is used for cDNA synthesis.

Avian myeloblastic leukemia virus reverse transcriptase is used to synthesize cDNA. . This enzyme converts single-stranded DNA from deoxynucleotide triphosphates onto an mRNA template. catalyze the synthesis of (acian and Myers, Proc, Nat'l , Acad, Sci.

11sA Vol. 13 pp. 2191-2195 (1976)) mRNl+ polyr( A) Use oligo(dT) (approximately 12 to 18 bases) as a primer for cDNA synthesis at the end. It becomes possible to use it as a market. Radioisotope-labeled deoxynucleosides The use of triphosphate makes it possible to monitor synthetic reactions. Generally, 32P - Containing deoxynucleoside triphosphate (e.g. °[α-5zp　) d(TP) is convenient for this purpose. cDNA synthesis is generally performed using mRNA + Deoxynucleoside triphosphate.

Incubate the solution of oligo(dT)r□~1□ and reverse transcriptase at 46°C for 10 minutes. This is done by The solution also contains a small amount to promote full-length synthesis. Contains amounts of actinomycin D and dithiothreitol (with acian) lyers, supra). After keeping warm, add ethylenediaminetetraacetic acid (EDTA) to the solution. and extract the solution with phenol:chloroform. Gel filtrate the aqueous phase Purify with Raffy and precipitate the cDNA/mRNA complex in the eluate with alcohol. Ru.

o+RNA becomes selective when the temperature is raised with dilute sodium hydroxide in the presence of cDNA. Can be hydrolyzed into 1 by neutralizing the alkaline solution and precipitating it with alcohol. This tlDNA copy is produced.

1 bottle 1! (The cDNA replica has a 5'-poly(dT) end and a partial short double strand. It is known that DNA has a certain 3'-terminal hairpin structure. CEfstr Aliadis et al., Ce1l, Volume 7 +111) 279-288 (1976) ), this 3′ hairpin structure serves as a primer in the synthesis of the second oNAtN. play a role. The synthesis of this second DNA strand is carried out using a surrogate fragment of reverse transcriptase (Kle Now et al. Eur, J, Bioches+, 22S pp371-381 ( cDNA DNA replication color synthesis except that 1971)) is used.

carried out under the same conditions. The double-stranded DNA generated by this operation is a single-stranded cDNA It has a 3' loop resulting from the 3' hairpin structure of the product. This 3' loop is Ull Rich et al.'s method (Science, Vol. 196, pp. 1313-1319 (19 77)) Cleaved by S■ nuclease using substantially the same method as be able to. The SI nuclease digest was extracted with phenol-chloroform. , the resulting double-stranded cDNA is precipitated from the aqueous phase with alcohol.

For amplification and selection, the double-stranded cDNA (ds cDNA) described above is generally into a clone vector, which can be used to transform suitable host cells. used.

There are various plasmids and phages that can be used as suitable loan vectors. Liophage lambda is preferred.

For cloning vectors that help express foreign proteins that you plan to detect with antibodies. are required to have various useful properties. Most importantly, the The presence of a cloning site in the expressed gene. Also gene expression They should also have the means to prepare food. In addition, the vector is used to express the protein product of interest. It is necessary to be able to accept DNA of the size required for synthesis and replicate it normally. . It is also useful to have selectivity to identify vectors that select inserts. Ru. A vector with such properties is bacteriophage λgt. 11 (ATCC 37194) (Young and Davis, Proc, Na t'l, Acad, Sci, tlsA vol. 80 pp. 94-1198 ( 1983)). This vector contains a bacterial gene encoding β-galactosidase. It has a unique EcoRI site near the end of the gene. This part is β-galact Inserting foreign DNA to create a hybrid protein between sidase and a foreign gene product It can be used freely. Expression of β-galactosidase is driven by the Iac promoter. isopropyl-β-D-thiogalactopyranoside (IPTG) ) can be induced by the addition of Agt 11 fage is 43.7Kb It contains DNA, which is much smaller than the wild strain λ. For this reason, DNA Only DNA fragments up to 8.3 Kb in length can be inserted within the range that can fit into the phage head. DNA cannot be inserted into the β-galactosidase gene. Therefore, transformants carrying the insert were determined by measuring β-galactosidase activity. can be easily distinguished from those without. Indicator dye 5-bromo-4-chloro-3-indo Lil-β-D-galactoside (Xgal) can be added to the agar plate.

β-galactosidase cleaves the tobacco molecule and produces a blue product; Cultures can be tested for the presence of active β-galactosidase. inserts Plaques containing This is because β-galactosidase is inactivated by the introduction of the enzyme.

ds-cDNA is obtained by adding an -EcoRI ligator to the DNA and converting it to EcoRI-cu t Agt 11 [Inserted into the phage by ligation to INA Can be done. After ligating cDNA^ to λDNA, the DNA is in vitro (Enquist and Sternberg, Me. thods in Enzymology Volume 68 pp 281-29B (1 979)) These phages are used to infect suitable highly susceptible hosts. suitable Sorting phages by plaque or lyticity (colonies) to select suitable hosts do.

In addition to the E. coli/bacteriophage λgt 11 series mentioned above, foreign genes A number of host/vector systems are available for cloning genes in E. coli. (Prin-ciples of Gene Manipula) tion 2nd edition, Old and Primrose, Univ, of Ca1ifo Published by rnia Press+ pp 32-35, pp 46-47 (198 1)) This includes the "open reading frame" vector described below. It is.

The above considerations focus on cloning operations within Gram-negative bacteria, E. coli. A dot was placed on it. Apart from this, the foreign gene is Bacillus 5ubti Durum-positive bacteria such as Bacillus subtilis (01d and Primrose+, supra) pp. 51-53) and eukaryotic microorganisms such as yeast (before Old Primrose) It can also be cloned into a plasmid vector that transforms and replicates (pp. 62-68). Can be converted into a A cloning vector that can transform both yeast and [i, coli]. A tar is being built.

This vector is called a "shuttle vector," and it can be used to transport two hosts together with the cDNA it carries. transfer between microorganisms (Stor++s et al., Journal of Bacte riology vol. 140 pp73-B2 (1979)); Blanc et al., M o1ec, Gen, Genet, Volume 176 pp335-342 (197 9)). Some shuttle vectors replicate in both E. coli and B. subtilis. . (01d and Primrose, supra pp53).

Other bacteriophage-derived vectors such as M13 can also be used to clone foreign genes. (Old and Primrose, supra, vol. 5). chapter). Any of these methods can be used in the present invention as necessary. Ru.

The DNA described here may be homopolymetrically terminated, plant-end joined, or can be inserted into the vectors described above in a variety of ways, including the use of linking molecules. (Old and Prim-r'OS e + supra, p. 92).

A large number of clones are used to select clones expressing the protein of interest from the clone bank. Immunological methods are known, including: Engvall and Pearlman.

Immunochemistry Volume 8 pp871-874 (1971); K oenen et al., The European Molecular Biolo Zy Organization Journal Volume 1 No. 4 pp509~ 512 (1982); Brooke and G11bert.

Proc Nat’l Acad, Sci, 1IsA+ Volume 75 pp274 6-2749 (1978); Villa Komaroff et al., Proc, N at'l Acad Sci.

USA, Vol. 75, pp. 3727-3731 (1978), Anders on et al. Methods in Enzymology Volume 68, pp428-4 36 (1979); C1arke; L.

Acad, Sci, US^, Vol. 78, pp. 4520-4524 (1981).

The outlined cloning procedure resulted in thousands of recombinant bacteriophages. So Two selection antibodies were used to select those suitable for producing coccoid sporidia antigens. I used my body. These two selection methods are based on the coccoid antigen protein alone or in cells. This is by expression in any form of fusion with fungal genes. In this example In some cases, the coccoid sporidian antigen is produced as a fusion with E. coli β-galactosidase. produced. Therefore, the selection method is based on the expression of the fusion product and the monochrome Detection of products by reaction with antibodies or polyvalent antibodies.

Recombinant bacteriophages form phage plaques on agar plates. It can be used to infect suitable E. coli hosts. The plaque is IP It can be transferred to a nitrocellulose membrane while being guided with TG.

The solid antibody then reacts with the filter. After reaction between first antibody and filter , a positive reaction (12513 Staphylococcus aureus A protein or horseradish peroxidase) Detection is detected by reaction with either of the second antibodies bound to the enzyme.

Apart from this, recombinant bacteriophages frequently produce soluble factors E, c It can be used to infect Oli hosts. In this case, the transformed cells are - Selected as Colonies were collected on cellulose acetate filters under non-induction conditions. grow on top. Once the colonies have reached a suitable size, filter them through a cellulose acetate filter. onto a nitrocellulose filter placed on an IPTG-containing agar plate. Increasing the temperature of the knee to induce phage production and at the same time induce β-galactosidase inheritance. Expression of offspring is induced by absorption of TPTG. Cellulose acetate after an appropriate heat retention time. Proteins are released from the base to the nitrocellulose filter and some of the colonies are ) After 8 hours, remove the cellulose acetate filter. nitrocellulose fi The router is processed for plaque screening as described above.

Phages that show positive results in the antibody selection method are those whose DNA was initially inserted into the phage DNA. Excise A and extract this DNA and coccoid sporidium mRNA or coccoid sporidian genome IIN By examining the ability to hybridize with A. It can be made clear that it contains columns. The nucleotide sequence of the cDNA insert is Sang er et al.'s method (Proc, Nat'IAcad, Sci, USA 74' ! ! pp5463-5467 (1977) or Maxam and G11bert method (Proc, Nat'l Acad, Sci, USA + 74 volumes pp 560-564 (1977)).

-Nuke 1 Shi" Knee 1- Another way to clone coccoid sporidian antigens is to isolate nuclear DNA from primordial eggs. It starts with that. This DNA is then suitable for insertion into a cloning vector. Fragment to size. To obtain such fragments, sonicate or in a blender. Making random cuts in the DNA using mechanical crushing force such as high-speed rotation be able to. The length of the fragment was reduced to approximately 300 base pairs by intense sonication. (Old and Primrose, supra, p. 20). Also, 1iDNA DNA5el generates random fragments, and restriction endonucleases cut at specific sites. crease, which produces DNA fragments containing intact genes in some related organisms Yaenari nuclease (McCut) in the presence of formamide, which is known to be chan T, F, et al. 5science Volume 225 pp625-628 (198 4)) It can be partially decomposed by methods such as 4)).

These nuclear DNA fragments were raised for cDNA cloning in the mRNA experiment method. It can be inserted into any cloning vector. Nuclear DNA is limited If it is cleaved by a endonuclease, it is digested by the same restriction enzyme and its Since it has only one recognition site, it can be advantageously inserted into a loan vector. can. If this is not the case, the DNA fragments can be separated using homovolume link ends or linking molecules. It can be inserted into the loan vector polygon as appropriate depending on the purpose (Old and Pri mrose, supra p.92) - More advantageously, nuclear DNA fragments and foreign genes or The aim is to simultaneously clone and express such fragments. Insert it into the “Cutting Frame” vector. Some of these vectors is known from the following literature: Weinstock et al., Proc, Nat'I Acad, Sci, USA+ Volume 80 pp4432-4436 (1983) j　Keonen et al., The’Enropean Molecular, Bi ology Organization Journal Volume 1 No. 4 pp509~ 512 (1982), Ruther et al., Proc. Nat'l Acad, Sci, USA? Volume 9 pp6852-6855 (1982), Young and Davis, supra; Gray et al., Proc. Nat'IAcad, Sc. i, USA, Vol. 79, pp. 6598-6602 (1982).

Open reading frame (ORF) vector is a prokaryotic or eukaryotic genome. It is used for cloning of muDNA or cDNA. These vectors are generally bacterial promoters that can be operably linked to amino-terminal fragments of prokaryotic genes. Contains tar. Genes encoding products for which activity assays are known (e.g. β -Carboxyl of E. coli IacZ gene encoding galactosidase The terminal fragment is located behind it. Between the amino terminal gene fragment and the 1acZ fragment contains restriction endonuclease recognition sites to aid in the insertion of foreign genes and possibly is an IacZ fragment that deviates from the translational open reading frame regarding the amino-terminal gene fragment. It is included. When foreign DNA is inserted into these vectors (plant end End-connection method.

(by use of homovolume linked ends, complementary end ligation, linking molecules, etc.) 1 recombinant A certain percentage of them start from the amino-terminal gene fragment of the IacZ gene. You will receive foreign DNA of a length that fits within the reading frame. This conclusion results, amino-terminal gene fragment, cloned DNA, and IacZ gene. A "tribrid" protein is created consisting of a polypeptide encoded by a polypeptide. child Recombinant forms such as MacConkey agar plates or rXgalJ (5-bromo- Identification on agar plates containing 4-chloro-3-indolyl-β-D-galactoside This is due to the β-galactosidase activity of the tribrid protein. The dye on these plates is cleaved and the colonies appear red (McConkey agar) or blue. This is because it changes to (xgal). β-galactosidase has biological activity It is possible to carry a wide range of protein sequences at its amine terminus.

In contrast, inactivation occurs if the insertion disrupts the sequence. inserts read If the framework is not disturbed, the genes inserted at the amino and carboxy termini of bacterial genes will Hybrid genes with sequences derived from offspring are generated.

Exons that are in reading frame with respect to the amino-terminal gene fragment (i.e., the stop cod) The only recombinant form detected by this method It will be done. ORF vectors can be Effective for cloning genes for which there is no data regarding A or protein sequence. be. Selection from clone banks is an immunization method that does not require RNA or DNA hybrid probes. This can be done using scientific methods. Immunological selection regarding mRNA route Alternative methods are available.

Plasmid DN^ was isolated from transformed cells and determined to be "positive" by the above-mentioned selection method. I made it clear. The nuclear DNA inserts of these plasmids are then sequenced. It will be done.

Once the nucleotide sequence is known, the entire cloned coccoid sporidian gene can be cloned using conventional methods. Part or portions can be chemically synthesized. Following synthesis of cloned gene fragments The gene fragment is inserted into the expression vector as shown below, and the generated polypeptide is The gene part that is the antigenic determinant can be detected by the reaction between peptide and MCA. can.

Cloned DNA encodes a protein that binds to antibodies against coccoid sporidia Once the target antigenic protein is identified, a plan is put in place to produce large amounts of the target antigenic protein. transferred into an expression vector. Expression vectors are used to produce antigenic proteins. Transform appropriate host cells.

The coccoid sporidian antigen is a combination of antigen and tryptophan synthase β-sub in E. coli. It is produced in large quantities as a fusion protein with the amino-terminal portion of the unit. This fusion In this case, the DNA sequence encoding the coccoid antigen is inserted into the troB gene (tryptophae). This is done by inserting the plasmid into a plasmid vector containing the It will be done.

The expression hector used is one in which the expression of the fusion antigenic protein is highly controllable. (e.g. by chemical induction, temperature change, etc.). With this kind of controllability The expression vector is plasmid pGX 2606, which was introduced in September 1983. Including the hybrid λ0LPR described in Application No. 534.982 filed on the 23rd. , a host expression vector system that can control the expression of foreign proteins has a high cell density. This has the advantage of preventing the risk of harmful effects due to the accumulation of foreign proteins.

Some researchers argue that genetic fragments that encode antigenic determinants are Currently, the deleterious effects on E. coli host cells when all antigenic determinants are expressed. can be prevented. (Helfman et al., Proc. Nat'l Acad, Sci, USA+, Vol. 80, pp. 31-35 (1983)).

The coccophoric antigen is a fusion to the carboxy terminus of E. coli β-galactosidase. They can also be produced in large quantities by compounding the cloning vector λg. This is because the use of t11 allows direct manual work. β-galactosidase, spherical The sporozoan antigen fusion gene is transferred to a small plasmid along with all relevant regulatory factors. , the lac protein transferred from the phage to the plasmid together with the fusion gene in the plasmid. Gene product synthesis is controlled by the promoter. As a small plasmid like this pGX1066 (plasmid pGX1066 is E, coli GX118 6 strains ATCC No. 39955), which have ampicillin resistance genes. It carries genes and has control sites that can be used to insert DNA fragments. Synthesis of fusion gene It is induced by the addition of IPTG, which is an inducer of the lac operon.

An effective subunit vaccine against avian coccoidosis is a vaccine of the genus Eimeria. It consists of a mixture of antigenic proteins from several species. On the other hand, manufacturing costs are The antigen protein is produced as a single fusion product, which reduces the number of fermentations and purifications required. This can be alleviated by reducing the

Such fusion proteins contain antigenic epitopes (exposed regions) of each antigenic protein. (or their repeats) and varying amounts of surrounding non-antigenic sequences. It is thought that it includes a column. Encoding such proteins in E. coli A hybrid gene that contains all antigenic epitopes fused within the same reading frame A bacterial control sequence (promoter) for efficient translation initiation precedes the coding sequence of -/operator) and E. coli gene 5' end (ribosome binding site and number It is thought to contain this ° code for amino acids).

E. col transformed with an expression vector carrying a cloned coccoborizoan antigen sequence. i cells are grown under conditions that promote expression of antigenic polypeptides. Then the antigen Eimeria proteins are purified from cells and used to protect chickens from subsequent Eimeria infection. The ability to induce immunity can be investigated. Purified protein can be used for bird immunization Wear. Combine purified protein with an appropriate carrier and adjuvant and mix it into feed or inject it. Administer to birds by injection. Separately, the DNA sequence encoding the coccoboridia antigen Chickens can also be fed live microorganisms containing . For such microorganisms, usually E. coli, rod-shaped bacteria, etc., which normally reside in the intestinal tract of birds, are preferable.

In a particularly desirable system, the microorganism has a gene sequence for a coccoboridia antigen such as E, c Host cell outer membrane proteins such as olilan+8 protein and λ receptor Expression vectors that are fused to proteins or secreted protein genes or fragments thereof - transformed by This allows antigenic proteins to become parasites within the host. present continuously at the site of infection. Outer membrane proteins and The foreign protein fused to the secreted protein is present on the cell surface or in its host. It is known that it is secreted from cells (Weinstock, supra; 5i lhavy.

U.S. Pat. No. 4,336.336).

Another desirable system for live vaccine development is an attenuated fowlpox virus expression vector. There is the use of vectors. Fowlpox is a species of coccoid sporozoite that allows the production of multivalent vaccines. It has the ability to contain genes. Recently, attenuated fowlpox virus has been introduced into commercial birds. It is used as a vaccine to protect against virus infections. Virus preparation and Infection of birds with fowlpox virus genetically engineered to produce coccoid antigens. The treatment is the same as the conventional method for MBIr vaccines that has been implemented in recent years.

Smallpox virus is a highly complex virus known for its high molecular weight double-stranded IINA genome. Regarding vaccinia, a smallpox-healing virus that is also being studied, OML, one of the The variola genome is a collection of foreign DNA that can encode foreign antigenic proteins. It has been found that insertion is easily accepted. (Smith et al., HPan, supra) 1cali et al., supra; Mackett et al., supra). Smallpox promoter control sequence When a foreign genome is regulated into the smallpox virus genome, the smallpox virus is released in the cytoplasm during infection. The rash virus replicates and foreign antigens are expressed. Later globophores within the fowlpox genome. Insertion and expression of larval antigens occur in an unknown region that corresponds to the insertion site of foreign antigen genes. We identified the active variola bromocou and located it on the 5' side of the target coccoid sporidian gene. It depends on whether you can do it or not.

Insertion of DNA into the smallpox genome is accomplished by in vivo recombination. pox f DNA is not infectious because it usually takes a period of time to exist in the cytoplasm. Smallpox virus-specific RNA and DNA polymers transported into cells by This is because the existence of DNA sequence information derived from cotton senior virus is ( Ileir and Mo5s, J, of Virology, volume 46, pp530 ~537 (1983); Venkatesan et al., Ce1l, vol. 125, pp. 80 5-813 (1981)) Specific to the vaccinia gene and recognized by enzymes on the cell side. This proves the arrangement pattern in the width f control region, which is unlikely to occur. Smallpox 1 DNA is non-infectious Because of the sexual nature of fowlpox, insertion of foreign DNA into the fowlpox genome occurs frequently in vaccinia. This has been proven inviv.

(Heir et al., Proc, Nat'IAcad, Sci, USA, Vol. 79, pp. 1210-1214 (1982)), Chicken embryo Fowlpox virus infection of fibroblasts results in infection of fibroblasts under the control of a promoter that functions in fowlpox. A plasmid [lNA Together with CaC1, precipitation method (Graham et al., Virology vol. 52 pp456-457 (1983), Stow et al., J. Virolog, y Transfection 9 using Volume 28, pp 182-192 (1978)) occurs. The 0-globular sporozoite DNA sequence that undergoes recombination during the infection process is transferred. recombination when inserted within the variola virus homologous sequence on the infected plasmid. During this process, coccoid sporidian DNA sequences may be inserted into the smallpox virus genome.

Freshly recombined infected cells and viruses are collected and grown as a monolayer in tissue culture. The individual plaques produced by this virus infection in chicken embryo fibroblasts are infection at low concentrations that can be detected by conventional methods. The desired recombinant Rus is a 1nsitn hybrid using a radioisotope-labeled coccoid sporidian DNA sequence as a probe. Species formation method (Villarreal and Berg, 5science+, vol. 196 , pp. 183-185 (1977)). Also, from plaque cells infected with purified virus or infected with a group of latent recombinant viruses. Viral DNA immobilized on nitrocellulose prepared from stained cells was It can also be used to identify a recombinant virus of interest. Immunological sorting of fixed cells ( Gremer et al., 5science, vol. 228, pp. 737-740 (1985) ) is an alternative method of hybridization.

The fowlpox DNA strand region contained in the plasmid vector is derived from a region non-essential for survival. The survival of the virus should be determined by randomly testing the fowlpox DN8 nodes. A region where recombinant formation can be performed using the above method without significantly affecting the choose. Purification of fowlpox virus DNA. Muller et al., J. Gen. Vir. ology vol. 38 p135 (1977); Gafford et al., Viro logy Vol. 89, p. 229 (1978)), approximately 30 with random cuts. 0Kb (kilobase) and small bacterial plasmids, such as pGX1066. to create several different products. Foreign DNA is recombined by viruses. Before examining the effect on survival, it must be inserted into the fowlpox DNA portion of the plasmid. stomach. To do this, E. coli transposon inserts, such as Tδ( Guyer, Methods in Enzywology, Volume 101, pp. 362-369 (1983) etc. in the fowlpox DNA part of the plasmid. It's easy to do. Co-transfection resulting in viable fowlpox recombinants containing Tδ sequences. Desirable non-essential components available in co-transfection plasmids by Fowlpox ONA is identified.

Hybridization experiments revealed a partial sequence homologous to the thymidine kinase gene of cotton cinnabar. The fowlpox DNA region identified in the fowlpox DNA region was also transferred into the cotransfection plasmid. This is because the thymidine kinase gene of cotton cinnabar is non-essential. (Weir, supra (1982); Ma ckett et al., Proc, Nat'1^cad, Sci, USA, +79 Volume pp4927-4931 (1982); Hruby and Ba1l, J , Virology+ Volume 43, p17403-408 (1982).

Placement of the coccoid sporidian gene under the control of the fowlpox promoter was carried out at the same time. Conventional in vitro plasmid manipulation prior to transfection and fowlpox infection. It is done according to etiquette. Promoters effective for initiating expression of coccoid sporidian antigens The tar sequence is identified by determining the DN^ sequence located 5' to the fowlpox gene.

This allows the promoter to be chemically synthesized and placed within the fowlpox homologous region of the plasmid. into a plasmid vector adjacent to the endonuclease cloning site do. Promoter sequence deduced by DNA sequencing of cotton cilia DNA ( Venka tesan et al., supra (1981); Weir and Mo5s, supra (1981); (1983) was chemically synthesized and compared for optimal effectiveness with the fowlpox virus promoter. Ru. The putative fowlpox promoter is a chloramphenicol promoter in bacterial plasmids. Assay genes that produce easily measurable translation products such as cetyltransferase It can be verified whether it is actually correct by cloning it to the 5' side of the child. CGorman et al., Mo1eculcLr and Ce1lular Bi ology, vol. 2, pp. 1044-1057 (1982)). The plasmid is It is used to transfect fowlpox-infected tissue-cultured cells, and the cells are transfected with the test gene. The activity related to the expression of symptoms is measured.

Cotton sinia virus has a wide host range and can also infect chickens. For this reason, The vectors and methods developed to date for Tascinia are limited to the host region of Cotton. It should be possible to use it for the development of vaccines against coccoid sporodiasis of all included genera. Ru. However, this research should be carried out with caution as cotton cinnabar is highly pathogenic to some humans. It is necessary to do it.

Turkey herpesvirus and Marek disease virus are good alternatives to smallpox vectors. There is the use of Lupes virus, like Luz. Weak versions of both viruses have recently been introduced into poultry. It is used as a live vaccine for the prevention of Marek's disease. Variola virus Similarly, the herpes virus has a large double tN DNA genome and is found in cotton. Favorable targets for genetic processing by invivo recombinant methods similar to those developed for It is. Marek's disease virus is treated to protect against coccoid infection. The advantage of this is that it costs more than the Marek's disease vaccines already in common use. This is because it can protect against coccoid sporozoites without causing any damage.

Globosporidian antigen production by recombinant fowlpox is induced in chicken embryo fibroblast tissue culture cells after infection. Immunological analysis of protein production in birds infected with recombinant fowlpox virus. Circulating antibodies are isolated from whole coccoid sporozoites or proteins isolated from appropriate species of coccoid sporozoites. This is confirmed by examining the cross-reaction with

The cloned washogenic protein used in the above-mentioned vaccine is injected into chickens with E, tene. lla + E, acervulina, E.

brunetti, E, m1vati, E, maxia+a and''.

immunity that prevents all infections by important Eimeria species such as necatrix. tested for whether it is able to induce an infectious response. Cloning the above The treatment involves DNA sequences that encode coccoid antigens that collectively protect chickens from coccoidosis. The cells are isolated and the method described above is repeated until used as a vaccine.

In addition to the cloned antigenic protein, it is effective as a vaccine to protect against coccoidosis. Another useful method derived from cloned antigen genes is to use small synthetic (Lerner, supra).

Once an antigenic protein has been sequenced, synthetic peptides can be created based on that sequence. I can do it. This bebutide is transported by proteins such as hemocyanin and serum albumin. etc.), and the conjugate can be used for immunity against coccoid sporozoites.

The method described above has not yet been used as a vaccine to protect other livestock from coccoid sporidia. It is considered that this method can also be used to isolate antigenic proteins derived from coccoid sporidia species other than those listed above. available.

The following examples are intended to be illustrative of the invention and are not intended to be limiting. stomach.

IL team-± IINA Oyo Pastern from Eimeria Tenella 13 ak et al. Molec, Biochem, Parasitol Volume 3 p133~ 142 (1981) from E. tenella primordial eggs. Total RNA was isolated. E, LeneLla primordial egg is 5, primordial muscle sodium chloride After treatment with the solution for 15 minutes at 0-4°C, the fine particles are removed by washing thoroughly with cold water. Removed fungi and fungal contamination. Next, layer the primordial eggs on top of 0.6 units of sucrose. Centrifuge for 5 minutes at 5,000 rpm at 4°C in an orvall-HB-40-tar. Removed debris and other residues.

The primordial egg is shi=! Most of the residue floated to the top layer of the sugar solution and settled at the bottom of the centrifuge tube. purification The primordial eggs were thoroughly washed with cold water again and treated with 10 units of penicillin/Maro 7 (hereinafter V/■l). ) and Hank's medium (Gibco, G The samples were stored at 4° C. in New York, New York.

To isolate total RNA, primordial eggs were spun down in 10mM Tris acetate, 75mM Sodium acetate, 2mM EDTA, 1% SO5, 200μg/*1 Resuspend in 5 ml lysis buffer/1 g wet weight of Tinase K (pH 7.5) did. Suspend 1/2 volume of pickled glass beads (0.45-0.55+n) added inside. Mixed on a rotary mixer for 2 minutes at room temperature.

Destruction of primordial eggs and reproductive spores was monitored microscopically. The resulting dissolved primitive non-solution was Centrifuge at 4°C for 15 minutes at 1500 rpm in a rvall 5M-24 rotor. I let go. Remove the supernatant, resuspend the precipitate in 5 ml of lysis buffer, and centrifuge as before. It was separated and the supernatant was combined with the previous one. Incubate this solution at 37°C for 30 minutes. Ta. The solution was diluted with an equal volume of phenol (lysis buffer without SDS and Brotinase K). (saturated) twice and once with chloroform, and the aqueous phase RNA was extracted with 2,4H sodium acetate. 0.1 volume of thorium pos,s and 2.5 volumes of ethanol were added for precipitation.

After incubating for 1 hour at -20°C, the RNA was extracted with 5 orvall HB-40-tar for 13 minutes. ．． Centrifuged and collected at 00 Orpa + 4°C. Dry the RNA in a vacuum dryer, It was dissolved in sterile water and stored at -80°C. The amount of 12N^ depending on the absorbance of 26Or+m was measured. ^t6°1.0 corresponds to an RNA concentration of 40 μgod. primordial egg 1g Approximately 0.5 mg of total RNA was obtained (wet weight).

"S" L twist - one 2′1 poly(A)′ mRNA of polyadenylated mRNA from total RNA is Obtained by hybridization with Rigo(dT)-cellulose. oligo(dT)-cell 10mM) Lis-tlcI pt17.4.1mM EDT A, equilibrated with binding buffer consisting of 500 mM NaC1, total R The NA preparation was applied to the column twice. Pour unbound RNA into several column volumes. It was removed by washing with a combination buffer. 10mM) Lis-HCl, pH 7 , 4. Poly(A)”RN bound by an elution buffer consisting of 1mM EDTA A was washed from the column and precipitated as before. Oligo(dT)-cell below The process of loin column chromatographic grafting is shown in more detail.

Already melted and materials Oligo (dT) binding buffer (IX): 10mM To’J-HCl pH 7.4゜l　mM EDTA, 0.5M NaCl oligo(dT) binding buffer (2X): 10mM)'J Su-HCl p) 17.4゜1mM E DTA, 1.0M NaCl oligo (dT) elution buffer: 10mM) HCl pH 7,4+1mM EDTA king-star 1. Completely remove ethanol from the precipitated RNA, dry it, and remove the oligo(dT) solution. It was suspended in extraction buffer and ^zbo and A211° were measured; Azho/Azao is approximately 2, and Agaol,O corresponds to an RNA concentration of approximately 40 μg/d.

2. Adjust the RNA solution to 5-10 mg/ml with elution buffer and incubate at 65 degrees for 5 minutes. After heating, it was rapidly cooled and mixed with an equal volume of 2X oligo(dT) binding buffer.

3. Prepare the RNA solution in advance with IX oligo (dT) binding buffer in an amount 5 times the column volume. Washed oligo(dT) cellulose column (1.5X 15cm column) 2 g of oligo(dT) cellulose).

The column elution rate was approximately 10-15 m//hr.

4. The column eluate was applied to the column again to adsorb polyA゛RNA.

5. IX oligo (d’I”) cellulose column in an amount 5 times the column volume (dT) Wash the RNA with binding buffer and add approximately 2-3 times (of the column volume) elution buffer. About 25-35 drops each using a G11son fraction collector. were collected in fractions.

6. Measure the absorbance of each fraction, pool the UV-absorbing substances, and add IX oligo (dT ) Purified "poly^" RNA J was obtained.

7. At this point, the pooled RNA fractions are subjected to oligo(dT) cellulose chromatography. to further purify the polyA'' RNA (step 7a). Ethanol-15 precipitated until use or further purified with oligo(dT) cellulose It was either saved until it was completed (step 7b).

a. Re-chromatography: After Stenov 6, measure the volume of the pooled fractions. , heat the solution for 5 min at 65°C, cool quickly and add an equal volume of 2x oligo(dT) binding buffer. Dilute and wash thoroughly beforehand with several column volumes of elution buffer and binding buffer. The sample was then passed through the same oligo(dT) column.

RNA was treated as in steps 3, 4, and 5.6, and added with 0.3M sodium acetate. and 2.5 volumes of 95% ethanol (-20°C to -80'C) until was added to precipitate. The resulting precipitate was purified by r2X oligo(dT) polyA'R. It was named NAJ.

b. Ethanol precipitation followed by re-chromatography Step 6 work-up If it is necessary to discontinue RNA >, = solution with 0.3M sodium acetate and 2 , 5 volumes of 95% ethanol were added. After incubating for at least 2 hours at -20°C, remove the RNA. Precipitate by centrifugation at 10,000g for 5 minutes and add 70% ether. Knoll was washed twice and dehydrated. The RNA was then processed sequentially from step l, just The initial concentration of polyA'' RNA was approximately 1 mg/d or less.

8. After use, the oligo(dT) cellulose column has a 0. Washed through IN NaOH. The column is then heated to 0.5 to 7 times the column volume. Wash with oligo(dT) binding relaxation solution containing 02% sodium azide and store at room temperature. did.

L use 1 mRNAj by in vitro translation, +l (7) ri source - Example The globosporidian mRNA isolated in nd, Nuclear, BoSton, Massachuse-tts (Commercially available from , etc.) Translated in erythrocyte lysate. Reagents were prepared according to the manufacturer's instructions and 0.1-0 ．． 5 μg of 1? NA was added. (”S　)-Methionine to radioisotope the translation product. Added for topographical labeling. Controls were water (no RNA) and rabbit globin. mRNA^, coccoid sporidian RNA lid product-derived RNA was used.

The sample was incubated at 30°C for 90 minutes. Label incorporation is (3SS)-methionine Trichloroacetic acid (TCA) - tracked by measuring incorporation into precipitable material . 0.5d NaOH, 0.5% HzO'z, casamino acids (hydrolysis of casein) 2μl of translation reaction was added to 20B/mf. It was kept warm at 37℃ for 30 minutes. Add 0.5 M I (CI O, 5 l) and add 2.5 l of 10% TCA. added. After 15 minutes in the water bath, the precipitate was poured into a 2.5 cm diameter nitrocellulose film. Filter and collect on a filter disc and wash the filter 3 times with 5% cold TCA 5m7. The filter was then dried under a heat lamp. Ics’ ( Amersham, ArliArlln Heights l1lino is) Place liquid scintillation and Yonka in a scintillation container with 5 ml. It was counted at the counter. Generally, an increase in uptake of approximately 5-20 times relative to the water control is observed. It was noticed.

The product of in vitro translation is Laem+wli, Nature 27 7, pp. 680-685 (1970), 12.5% SO3-Polyac Separated on a lylamide gel. The product was visualized by fluorescence photography (La Skey and Old IIs, Eur, J, Bio-chem, Volume 56, pp33 5-341 (1975)).

1 Hananey Y- 2　t゛′cDNA person First cDNA!! Solution and ingredients 0.5M Tris-HCI, pH 8.3 1,4M MCl 0.25 gates? IgC1゜ 0.05 dATP, pH 7.0 0.05M dGTP, pH 7.0 0.05M dCTP, pH 7.0 0.05 dTTP, pH 7.0 [α-”P　dCTP, 400Ci/nuaol, 1mC1/m7(Am ersham) stabilized aqueous solution 0, OIM dithiothreitol ([1TT) oligo (dT) 1□~8250 μg/rin! (Collaborative Re5earch) Actinoma Isin D, 500 μg/x/(Calbiochem) 0.2M ethylenedi Disodium aminetetraacetic acid (EDTA), pH 8.0 Avian myeloblastic leukemia virus (AMV) reverse transcriptase, approximately 10,0 OOV/m 1 (Life 5science, St. Petersburg, Florida) a) All buffer solutions and saline solutions were autoclaved and sterilized. Other solutions are sterile A glass of distilled water was prepared and stored in a sterile container. All ready-made solutions were stored frozen. 0 All enzymes described in this example and other examples are commercially available (from Nikko). Used according to manufacturer's instructions unless otherwise specified.

King-1 As a template for cDNA synthesis, lllRNA prepared in Example ① was used. synthesis A radioactive marker ([α-”P　dCTP) was used to track the This allows all steps to be monitored by counting Cerenkov radiation. This can prevent sample loss. Specific radiation per 1Mg of mRNA 2μCi of [α-”P]dCTP at 400Ci/mmol was used. Active substance 0.1M) Liss MCI, pH 8,3〜140mKCl, 20m M MgC1g+ 1mM dATP, 1mM dCTP, 1mM dGTP.

Added to a 2X reaction solution consisting of 1mM TTP, 0.4mM DTT.

Place this solution in water and add mRNA (50 μgoml, final concentration), oligo (d T)+z−+s(25,c+g/m/), actinomycin D(40Mg/*7 ), IMV reverse transcriptase (800V/d), and 2X reaction solution with IX. Added water to make it. After 5 minutes in water, the reaction solution was heated to 46°C for 10 minutes. It was kept warm for a while. After incubation, El)TA was added to a final concentration of 25mM. equal volume of solution Phenol: Extracted once with chloroform (1/l; v/v) and diluted the aqueous phase to 10mM ) Squirrel HCI, pH 8, 0, 1mM EDTA, 0.1M NaCl Equilibrated. 5ephadex G-100 column (0.7X20QI+) Chromatographed. mRNA:cDNA hybrid in exclusion volume Add 0.1 volume of sodium and 2 volumes of 95% ethanol (-20°C to 80°C). and precipitated it. To remove the mRNA portion, the precipitated hybrid was 0. IM NaOH3 00μ! It was soaked and kept warm at 70°C for 30 minutes. The solution was cooled in water and IN■C1 30μ! It was neutralized.

cDNA was precipitated as described above.

Ready-made for second wood cDNA synthesis? ? j　broiled h　h　U1〉0.5 and phosphoric acid Lucium, pH 7゜40.25M MgCl□ 0.1M dithiothreitol (DTT) 0.05M dATP pH 7.0 0.05M dGTP pl+7.0 0.05M dCTP pH7.0 0.05M dTTP pH7.0 E. coli DNA polymerase I (Frenara fragment), approximately 5.0 OOV/ m/　(Boehringer-Manheim) 10χ31 nuclease slow Solution: 0.5M sodium acetate.

p) 14.5; 10mM Zn5O; 2M NaCl, 5% glycerol ”-One play Radioisotope labeling is not necessary in the case of two-necked strands, since the first strand is labeled. This is because they are recognized.

0.2M calcium phosphate, pH 7.4; 20a+M MgCIz; 2+a M DTT; dATP, dGTP, dCTP, dTTP each 0.4mM A 2X reaction solution was prepared and placed in water. In addition, E. coli DNA polymer An aqueous cDNA solution containing the frenara fragment of Lase I (100 V/w 7. final concentration) was prepared. and diluted to IX with water. The solution was incubated at 15°C overnight. After keeping warm, add EDT^ Add up to 25mM and mix the solution with an equal volume of phenol:chloroform (1/1 n/v) The aqueous phase was extracted once with 10111M Tris HCI, pH 8,0,1a+M DTA, 0. IM 5epbadex G-100 color leveled with NaCl chromatography on 0.7×20C11). D in excluded volume j (A was precipitated with ethanol in the same manner as above.

-Dai 101-y- Expert support for cDNA Insert the cDNA into the EcoRI site of the λgt11 vector. For, Ec An oRI ligator was added to the end to the cDN octane. Cleavage of cDNA with EcoRI To prevent this, the cDNA was first methylated with EcoRI methylase.

Already? Yong・　and　Z 5X EcoF? Imethi) L/-7-ase buffer: 0.5M Tris HClp H8, O; 0.05M EDTA 8+++M S-adenosylmethioni 7 (SAM): 0. OIM HtSO, .

pH2: 1 volume solution of 10% ethanol 1mg/m/bovine serum albumin (BSA); aqueous solution filtered with a sterile filter 8 base pair EcoPI connector: 10 Azbo/ml, Co11aborat iveResearch, Ha1±tall+ Massachuse Obtained from tts 10mM ATP, pH 7.0 10X T4 polynucleotide kinase buffer: 0.7M Tris-HCI, P H7,6; 0.1M gcIz; 50+*M dithiothreitol (r　-”P　)　-ATP:10n+C4/m/　>2000　C11d　An Stabilized water total liquid 10X T4 ligase buffer: 0.5M) Lis HCI, p)! 7.8;0,I M MgCIt: 0.2M dithiothreitol 10X DNA polymerase Buffer: 0.5M Tris-HCl.

pH 7,2; o, i Mg5O.

2 IWM dATP, dCTP, dGTP, dTTP mixture, pi (7 ,01mM dithiothreitol 10X Shadow Liao R1 buffer: 1. OM) Squirrel HCI, pH 7.5; 0.5 Sodium C1; 0.05M MgCIz −Ichiichi Gekiichi 5X EcoRI methylase overload of cDNA from Example ①? Something like $20ttl. And SAM is 80μ? I. Add BSA to 0.4mg/wl and add water to bring it all together. Make the volume 99μl and add EcoRI methylase (20,000V/d, New 1 μl of Biolabs (England) was added. The reaction solution was heated to 37°C for 6 It was kept warm for 0 minutes. The solution was extracted twice with phenol and precipitated with ethanol. Methi The purified cDNA was collected by centrifugation and dried.

Before adding the ligators, the cDNA is cleaved into DNA in the presence of deoxynucleoside triphosphates. It was treated with polymerase ■ (Frenara fragment) to create cDNA plant ends.

dATR cDNA.

LX DNA polymerase containing 80μ each of dGTP, dCTP, and dTTP It was dissolved in 24 μl of buffer solution. Add 2 units of DNA polymerase (Frenara fragment) The reaction solution was kept at 23° C. for 10 minutes. Add EDTA to 20mM and add cDNA was extracted twice with phenol and once with CHCl, and precipitated with ethanol. cD NA is methylated with EcoRr and has a plant end, which is centrifuged. It was collected, washed once with cold 70% ethanol, and dried.

400 picomole 2 (lμci fr-”P) ATP and porine Phosphate in 1x polynucleotide kinase buffer containing 5 units of cleotide kinase. Oxidized. The reaction was carried out at 37°C for 15 minutes. Non-IJA tAdt+Tp 1m M was added and the mixture was further incubated at 37°C for 15 minutes. Heat the enzyme at 65°C for 10 minutes It was inactivated by doing this. Next, the phosphorylated linker 160 picomole is ligated to DNA. Add methylated cDNAΔ with plant end to 10 μl of water. Add 160 picomole of ligator and add 100ml of 10XT4 ligase buffer. x, ATP to 1mM, and T4-DNA ligase (Boehrin ger Maniatis) were added. Reaction solution (total volume of 20μ) It was kept warm at ℃ for 16 hours. The ligase was inactivated by heating at 65°C for 10 minutes.

At this point, the cDNA has many linkers at its ends and 1 μl of the reaction is added to the gel. Samples were collected for electrophoretic analysis.

EcoRI (New England Biolabs+ 10v/μm ) 10 units were added and the reaction mixture was kept at 37°C for 1 hour. 1 reactant with phenol Extracted twice, 10mM) Lis MCI, pH 81mM EDTA.

Applied to 5epharose CL-4B column equilibrated with 0.3M NaCl Ta. This removes excess connectors and DNA fragments (100 base pairs or less) did. Fractions containing cDNA were pooled and ethanol precipitated. cDNA is centrifuged separated and collected.

Heaven” 1%-1■- m bacteriophage, age DNA +1 standard method (Maniatis et al., M o1ecular Cloning, Col1dS pr i n g Har bacteriophage λgt 1 prepared by b o r publication (1982)) 1 DNA (^merican Type Culture Co11e-ct Available as Accession Nuo+bor 37194 from ion ) was linearized by cutting with EcoRl, extracted with phenol, and precipitated with ethanol. I set it. 5Ong of cDNA of Example ① was added to 5011I Tris) ICI pH 7, o; 10mM MgC1z, 20mM dithiothreitol: 1mATP In a spoon, mix with PI-cut λgtlllμg at a molar ratio of about 2:1), T 4-, 1 unit of DNA ligase was added. The ligation reaction was incubated at 15°C for 16 hours. . A small amount of the reaction was taken for agar gel electrophoresis analysis. The desired product is then It is a chain of DNA with a large molecular weight in between, and this is the empty space of bacteriophage This form is necessary for efficient sealing and insertion into the head.

No0 Annie M- Encapsulation of recombinant DNA into Bacteriopher 22 head and transfection into E. coli To introduce the recombinant ON^ prepared in Spfection Example ■ into E. coli Enquist and Stsrnberg Methods in Enzym Bacteria by the method described in vol. 68, pp. 281-298 (1979) It was encapsulated in the head of phage λ. Encapsulated extracts are commercially available (Promega Manufacturers such as Biotec, Madison, Wisconsin, etc. It was used according to the instructions in 1. The ligated DNA was mixed with the encapsulated extract (50 μl and heated at 23°C. Keep warm for 2 hours, )y - Shira 10mM Mg5L + 10mM)'J:A MCl, pH 7, 50, diluted to 9.5 m7 with 01% gelatin, chloroform 2 , 3 drops were added. Encapsulated phages were stored at 4°C.

E. coli Y2O2S strain (6ri) was used as a host for phage titration and propagation. U169 Engineering E Engineering F Shift, d R-hsd M”met B mRton A2 1-NagiC::dan5 (pMC9)) (A+wericanType Cu1t accession nu+wber37 from ure Co11ection 195) was used. Host strain LB containing 0.2% maltose The cells were grown overnight in a medium at 37°C to induce phage receptor synthesis within the host. cells It was collected by centrifugation and resuspended in 1/2 volume of 10mM MgSO4. this method The cells prepared above were used within 1 to 2 days.

Phage 1On+M Mg5On, 10mM) Lisu MCI, pH 7,5 Serial dilutions were made with 0.01% gelatin. Add 50 μl of diluted phage to E. coli cells. The mixture was added to 0.2 d of cells and incubated at 37° C. for 15 minutes to adsorb the phages. Feeling Mix the stained cells with a LB medium melt (47°C) containing 0.7% agar and transfer to LB agar. Pour onto a plate. After the top surface of the agar solidified, the plate was kept at 37°C for 5 to 6 hours. At this point, the plaque became clearly visible. Mi-mutable bacteriophage Add Xgal (0.04%) and rPTG (0.4mM) to the top of the agar. It was identified as a vector. After 6-8 hours, the non-recombinant fupuzi will turn blue. In contrast, phage containing the insert appeared colorless.

Recombinant phages were propagated before proceeding with selection.

Dilute the phage, mix with E. coli Y1088, and place in a 85-diameter veterinary dish. The seeds were sown in the same manner as above at a density of 10,000 fages. After growing for 6 hours, Transfer the rate to 4℃ and add 50mM) Rith HCI pH 7,54d, 10 mM Mg5O,, 100+mM NaCl゜0.01% gelatin (SM) added to the plate surface. Shake the plate gently for 2 hours to remove the phage suspension. Collected from pets. Combine the phage suspension, mix with chloroform, and Bacterial residue was removed by low-speed centrifugation, and the phages were stored at 4°C in the presence of chloroform. Ta.

recombinant bacteriophage present in the serum of chickens infected with Tenella The cells were screened for their ability to produce proteins recognized by antibodies. fur was selected as a lysogen. Lysogenic bacteria grow as colonies, and phages and β-ga Both production of lactosidase was induced.

E, coli Y1089 (ΔL!L 0169 degree 1.A’ Δton ar a 0139strA hflA (chr:: Tn 10) (PMC9) ) (American TypeCuHure Co11ection ac (available as session number 37196) overnight culture 25 m/(LB medium containing 0.2% maltose) was collected by centrifugation and the cells were incubated at 110 In Mg5Oa 12.51! resuspended in. The phages grown in Example cells at a multiplicity of infection of 2.5. Incubate cells at 30°C for 20 minutes and transfer to LB agar. A flat plate of light with a density of 851 mm was placed on a cellulose acetate filter placed on a flat plate. 000 to 10,000 colonies were sown. 8 to 1 colony at 30℃ It grew for 2 hours. Nitrocellulose filters to make replica filters - (from the ash pre-moistened with LB medium) on a cellulose acetate filter. After pressing it onto the upper surface of the knee, release it and place it on a fresh LB agar plate with the colony side facing up. and stored at 4°C. Pre-fill the cellulose acetate filter with colonies remaining. Nitrocellulose on a fresh LB agar plate (containing 0.4mM IPTG) placed on top of the base filter. Lysogenic bacteria were grown at 42°C for 2 hours to produce λ and β-galactosin. Sidase was induced.

During this time, some of the cells are lysed and proteins are released and filtered through the cellulose acetate filter. and bound to a nitrocellulose filter. After the induction period, the cellulose acetate film Remove the filter and remove the nitrocellulose filter, which is recognized by the antisporidium antiserum. The cells were screened for the presence or absence of antigens.

Remove the nitrocellulose filter from the plate and add Tris-buffered saline (T BS; 50mM Tris HCI pH 8,0゜0.5M NaCl) 5 Washed 4 times with 0 - each (use batch method if processing two or more filters) Then, the filter was blocked with gelatin in 3% TBS i8 solution. The filter is If placed back to back, they can block each other. In a Petri dish with a diameter of 850 mm, A 10M block solution was used per two filters. After 60 minutes, block solution was removed and the first antibody was added. The first antibody is a 1% TBS solution of gelatin 5d was prepared by adding 10 μl of chicken antisporidian antiserum and 0.5 ml of normal rabbit serum. Ru. The first antibody was allowed to react with the filter at room temperature for 4 hours with gentle shaking.

After the reaction was completed, the filter was washed 4 times with 100 wj of TBS (batch method). (Also possible). Positive transformed cells can be detected by reacting the second antibody with the filter. It was to so. The second antibody solution was rabbit anti-chicken IgG plus horseradish peroxy. Dase (commercially available) was combined and the volume was made up to 10 μl. Add the second antibody for 1 hour at room temperature. The mixture was shaken gently for a while to react with the filter. After the reaction is complete, remove the filter from TB. Washed 4 times with S 100 d each. , filter 4-chloro-1-naphtho- Jshi32rin1. Methanol 12*/, TBS 60m/, 30% H20□ 120! ! / to develop color. The coloring solution contains the above ingredients. Freshly prepared by adding in the order listed. Adjust the filter until the color reaches its maximum ( (approximately 5 minutes) in the coloring solution. Next, wash the filter with water, dry it, and then was used to identify positive colonies on mosquito nitrocellulose filters.

1a-IX- Derived from recombinant phage propagation of Example 6 of group 1 phage by plaque formation phages were transfected into the host where lysis and plaque formation occurred. P Transfer lark to a nitrocellulose filter and test for binding to anti-coccolipid antibodies. Selected.

The host is Dan, ■Dan Y1090 (Δ Tsuki Ao 016952 and A “Δri ara 0139 str A"L"LJλF (trpC::TnlO) (pMC9)< American Type Culture Co11ection ac session number 37197), and this is 2% After overnight growth in maltose-containing LB medium, centrifugation was performed to remove 10mM MgSO40. , 5 volumes. Cells were used for 1-2 days. Propagated phages in SM for 50 μ! The solution was diluted to 5,000 to 10,000 plaque-forming units per sample. Rare 50 μl of diluted phage was added to 100 μl of cell suspension. The reactants were heated to 1 at 37°C. The mixture was kept warm for 5 minutes to adsorb the phages. Melt infected cells with 8 medium containing 0.7% agar. 2.5 d of material was added. The suspension was mixed lightly and spread on an LB agar plate. The top surface of the agar solidifies After that, the plate was kept warm at 42°C for 5 to 6 hours. 0. OIM saturated with TPTG Cover the plaque with a nitrocellulose filter and keep the plate at 37°C for 2 hours. It was warm. Peel off the filter, wash it 4 times with 50 d of TBS at room temperature, and remove the gelatin. Incubate for at least 1 hour with gentle shaking at room temperature with 3% TBS solution to remove antibody. Reduced specific binding. Remove the block solution and add to 1% gelatin solution 4 and 5 d. One consisting of 10 μl of chicken immune serum and 5 ml of normal rabbit serum Q. The second antibody solution was added. The filter was gently shaken for over 1 hour. Next, the fi Wash the router 4 times with TBS 50 lids/each at room temperature and add a 1% TBS solution of gelatin. Two samples consisting of 10 μl of horseradish-conjugated rabbit anti-chicken IgG in 5 ml. The second antibody solution was added. Shake the filter gently for 1 hour and add TBS 50w. /washed 4 times. For the above coloring solution with a freshly prepared filter, Colored it. After a few minutes, positive plaques will turn dark blue and negative plaques will turn a lighter blue color. In fact, it was colorless.

The recombinant bacteriophage growth consisting of go, oOo individuals was plated or approximately 50 The seeds were sown at a density of 0.00 plaques. As a result of selection using anger-dyed chicken antiserum, the result was strongly positive (dark blue). ) A number of interval (pale blue) plaques, also known as 1 plaque, were obtained. containing these plaques. Take the area of the plate at the beginning of the process, put it in 5M1*/ and sow it on the plate again with various dilutions. An isolated plaque was obtained. Plates with isolated plaques were sorted as described above and individual positive plaques were identified. The larks were collected and the protein products and DNA produced were analyzed. Strongly positive The resulting bacteriophage was named λ5401 and was then infected with coli Y1089. A lysogenic bacterium was produced and this strain was named GX5401. This strain is American an Type Culture Co11ection (Rockville It was entrusted to e　MD (present) and the accession number was set as 53155. .

1iL5-group To bacteriophage λON and phage DNA, Maniatis et al. Positive lysogens or plaques were isolated according to the method described above. DNA frame First, the size of the insert within the vector was determined by restriction enzyme analysis.

To isolate from lysogens, colonies were picked from duplicate filters and grown in LB medium for 3 Grown at 0°C. 50μg/rin of this culture! B medium 2 containing ampicillin Used to inoculate 0.00ml, fresh culture at 30°C. =0.5 It was grown until The culture was then shaken vigorously for 15 minutes at 45°C and then transferred to 37°C. It was left for 2.5 hours. At this point, chloroform was added and the culture rapidly dissolved. It was infected. Transfer the cells to 5 orvall at 4°C in a G5-3 rotor for 0 minutes9. Collected by centrifugation at 000 rpm. Suspend the cell pellet in 3M5*/ and 2.3 drops of form were added and the mixture was stirred. The reaction mixture was left at room temperature for 30 minutes. 20□OOOrp for 20 minutes at 4℃ using a 5S-340-tar Collect the supernatant after centrifugation at m, and add pancreatic DNase and RNase to a final concentration of lμ. g/d and the solution was incubated at 37° C. for 30 minutes.

Next, phage particles were transferred to Beckmann 70. 2B, 0OO by ITi rotor Collected by centrifugation at rp+w for 1 hour. 50IIIM of sediment Suspended in HCI, 5mM EDT^, 0.1% SDS, pH 7.5, Heated at 68°C for 30 minutes. Solution once with phenol, phenol:chlorophos Extracted once with lum (1:1) and once with chloroform.

To isolate DIJA from plaques, phages were isolated from G. coli.

Y2O2S was infected, and approximately 50,000 infected cells per Petri dish with a diameter of 150. Plaque density was plated in 0.7% agar.

After 5-6 hours at 42°C, when lysis occurred at the same time, place SM on the plate.6. 5mZ was poured into the solution and kept at 4°C for 2 hours with gentle shaking. Plating the phage suspension Add 2.3 drops of chloroform and collect the residue from 5orva 11-5S-34. It was removed by centrifugation in a rotor at 5.00 rpm for 10 minutes at 4°C.

The supernatant was collected and filtered through a 0.45μ filter. Phages in the filtrate are separated by discontinuous glycation. Centrifuged on a serine density gradient and collected. Beckman glycerol gradient 40% glycerol with SM in a polyaromer tube for 5W40 rotor , 3 d, and 3 d of a 5% SM solution of glycerol was layered on the top surface. Phage Carefully layer the solution on top and incubate in a 5-40°C for 1 hour at 4°C. OO Centrifuged at Orpm. next? 8 solution was removed and the precipitated phage was transferred to SMo, 5d suspended in. Pancreatic RNase A at 10 μg/ml, pancreatic DNase at 1 Mg/d. The solution was incubated at 37° C. for 30 minutes. After keeping warm, 0.5M EDTA , 5 μl of pH 8.0 and 5 μl of 10% 5OS were added and kept at 68°C for 15 minutes. . The solution was mixed once with an equal volume of phenol, then an equal volume of phenol:chloroform (1:1 , v/v) and once with an equal volume of chloroform. equal volume of λDNA Isopropanol was added for precipitation. DNA was collected by centrifugation and diluted with 70% ethanol. After washing once with water and drying, add 10mM) Lith HC1, pH 8, 0, 0, 1. Suspended in mMEDTA. The average yield per 150m plate is DNA 1 The amount was 0 to 15 μg.

Degradation of phage DNA isolated from GX5401 by EcoRI Result 2 We obtained these fragments, one of about 1800 base pairs and one of about 80 base pairs. It was. Fragments obtained by DNA digestion with other restriction endonucleases or Eco The R1 fragment was secondarily cloned into bacteriophage old 3 and Sanger et al. DNA sequence analysis was performed using the method described above. The DNA sequence is shown in FIG.

DNA is B11n and 5tafford + NucIerc Ac1d Res , Vol. 3, pp. 2303-2308 (1976). Tenella primordial eggs. Primordial eggs with 0.5M EDTA.

100μg/Tomi! Add proteinase to O, 5% Sarcosyl suspension at 50℃ for 3 hours. Keep warm for a while. A solution containing lysed cell residue and high-molecular DNA was diluted with phenol three times. Extract 3 times with butanol to reduce the volume to 50mM) Lis HCI 10mM EDTA. Dialyze extensively against 10mM NaCI, I)H8.

Next, the DNA was treated with RNase 100 11 g/ml at 37°C for 30 minutes. After extracting twice with phenol:chloroform (1:1, v/v), Dialyzed again against 101M Tris) Ice, 1mM EDTA, pH 8.0 do.

E. Tenella DNA 3311M resource MCI, p) 17.6, 0. OIMMgCIz, in which DNase I (1 11 g/ DNA 10 11 g, Boehringer Mannheim) Keep warm at room temperature. 10, 20. After 30 minutes, add 173 volumes of reactants each to 178 volumes. 0.1 gate EDTA. Transfer to a tube containing pH 8.0 to stop the reaction. disassemble Fractions containing 6% polyacrylamide gel electrophoresis are suitable for large preparations. The gel region containing a 200-600 base pair fragment was cut out and the DNA was extracted. Electroelute in 0.1x TBE. The DNA was transferred to an Elntip-d column (Sch - Ieicher & 5chue11) according to the manufacturer's instructions: S-condens and purify. Precipitate the DNA with ethanol.

The purified and concentrated DNA was collected by centrifugation, dried, and resuspended in water. Prepared for insertion into λgttt according to the method described above. Methylated EcoRI series The DNA modified with a ligator is ligated to λgt 11 and encapsulated in the same manner as in Example ①.

Recombinant phages are selected in the same manner as in Examples ① and ②.

1st Emperor ■Once 1 DNA clone produced by Jaena nuclease degradation of genomic DNA conversion into Another method of genomic DNA cloning is that the gene-length fragment is McC Utchan et al.'s method (Science, 225" pp625-628) (1984)) to extract E. tenella DNA using Jaena nuclease. Produced by decomposition.

0.2? DNA isolated by the method described in Example XI. lNaC1,Im M Zn5O<, 30mM sodium acetate + pH 4-6 and various concentrations of hormonal 1 unit of Yae per 18g of DNA in Muamide (30, 35, 40, 45%) Incubate with Nari Nuclease (PL Biochemicals). Heat retention is carried out at 50°C for 30 minutes. DNA was subjected to agar gel electrophoresis and positive results as described in Example ■ Southern plot analysis using phage-derived 32p-labeled fragment as a probe Analyze more. Reaction solutions in which the presence of fragments containing the full length gene due to hybridization Dilute the solution 4 times with 10mM) Lis HCI pH 8, IO+++M EDTA. , extract with phenol and precipitate with ethanol ・Extract the DNA according to the method described in Example ■ Therefore, for insertion into λgt 11, methylate with EcoR’L and then add 21 connector. . Insert the DNA into λgt 11 and generate the recombinant phage according to the method described in Examples Analyze.

Emperor ■Once Transferring the DNA sequence encoding the coccoborozoan antigen to an expression plasmid vector The β-galactosidase globosporidian antigen fusion gene identified in Example The gene was transferred into a plasmid to produce the product.

GX5401λ DNA was analyzed using Shikoji, extracted with phenol, and precipitated with ethanol. I set it. Plasmid pGX3213 (Plasmid I) UCl3 (Pharmac jaP-L (commercially available from Biochemicals and others) pGX1066 (E, flat GX1186 strain (Ecoli GX1170) The transformant with strain pGX1066) is American Type Cu1. ture Co11ection (Rockville MD) disassembled and After the ale extraction, ethanol precipitation was performed. T4D two 92I cut DNA Ligate the DNA using NA ligase at a concentration of approximately 100 μgod, and add phenol. After extraction, the mixture was precipitated with ethanol. DNA incorporation of the ligation reaction product using standard methods Once set up, the shape of Mikasa Law JM 101 (ATCC33876) Used for quality conversion. Plasmid DNA prepared from transformed cells using standard methods. The presence or absence of the β-galactosidase/Globosporidium antigen fusion gene was determined by limited degradation. It was selected by Plasmids containing β-galactosidase/cocclocosporidium antigen fusion gene The code was named pGX3215. This plasmid is approximately 12 kilobases long and contains a fusion gene. It contains the E. coli lac operon regulator, and the synthesis of the fusion gene product. composition is regulated by these control factors. E. coli GX 5408 strain (p J? transformed with GX3215? 1101 stocks) is American Type Access-sion number to Culture Co11ection Commissioned as r53154. .

Last time [ Coccoid sporidian antigen/β-galactosidase fusion gene product and fabric E. coli GX5408 strain with ampicillin 100μg/Tomi! LB medium containing Grow overnight at 37°C in 10ml. LB medium containing 100 μg 7 ml ampicillin Earth II! 27 with ! Inoculate the flask with 10 d of overnight culture and incubate vigorously at 37°C. Cultured with shaking. A. . = 0.6, 0.1M IPTG 4d was added and kept warm for an additional 2 hours.

After 2 hours, cells were incubated in a 5-orvall G5-30-tar for 10 minutes at 4°C.7. OO It was centrifuged and collected using Orpm. Cell pellet (2-3 g wet weight per 11 cultures) was suspended in 0.0511 sodium phosphate pH 7, o 100 ml and centrifuged again. I let go. Cells were resuspended in 0.05M sodium phosphate, pH 7.9. 5. per weight. ml), ultrasound with a Branson sonicator Destroyed during processing. Ultrasonication was carried out four times at maximum power while cooling the cell suspension in water. The irradiation was performed for 30 seconds. Irradiation was performed at 1 minute intervals. 5 orvall cell debris 15. At 4°C for 20 minutes with a SW-24 rotor. Remove by centrifugation at OOOrpm. I left. The supernatant was collected and the gene product was partially purified therefrom.

The following treatments were performed at 4°C. 0.1 volume of 30% streptomycin sulfate (30% %-ha aqueous solution) was slowly added to a 5orvall 5S-34 rotor. Separate the nucleic acids from the extract by centrifugation at 10.00 rpm for 10 minutes. I let go. While stirring the ammonium sulfate crystals into the supernatant, slowly reduce the final concentration to 36. % (0.21 g (NH) z Son/ml. Add 5 or 10 with va l 1SS-34 rotor. Centrifuge for 10 minutes at OOOrpm. collected. The protein precipitate was dissolved in 0.05 ml HCI pH 7.5. .

The protein solution was equilibrated with 0.05 M l-LiCl p) 17.5 epl+acryl 5-300 (Pharmacia) column (1,5X5 0 gloss). Protein was pumped out in 7 volumes of the same buffer over 7 nights. Column fractionation is 5D β-galactosidase/spherical spores by S-polyacrylamide gel electrophoresis The presence or absence of insect antigen fusion proteins was monitored. Plot the fraction containing the fusion protein. The protein was precipitated as before by adding ammonium sulfate to 36%. . The proteins were collected and diluted with 0.2111 ml of 0.1 M sodium phosphate pH 7.5. Dissolved in minimal amount of thiothreitol additive and dialyzed extensively against the same buffer. . SDS-polyacrylamide gel electrophoresis shows that the fusion protein has a molecular weight of 1. It turns out that it is 40,000 to 160,000 Daltons, of which 115.0 00 daltons are for β-galactosidase and the rest are for coccoid sporidian antigens. culture The average yield of fusion protein per product 11 is 10-20 mg, of which β- Lactosidase/Globosporidium antigen fusion protein was 10-20%.

】U Rainbow” L-IL- 6 Antigenic protein purified in Example XIV as a vaccine for rogenic protein The ability of proteinaceous chickens to protect against infection by two sets of pyelids was determined by Harry Danfor. th and Pat August, 1ne (USOA Animal Parasitology Research Institute, Poultry Parasitology Laboratory) Laboratory, Beltsville, Maryland). now The purified antigen described in Example I planted a seed. A group of 10 4-week-old birds was treated with complete Freund's adjuvant. 0.600, 1200, 2400, and 4800 ng of each antigen were inoculated subcutaneously. Ta. After three weeks, the birds were given 75,000 E. tenella primordial eggs per bird. It was mixed with water and infected. Birds were assessed for infection severity on day 6 post-infection. It was measured Parameters include weight increment, food conversion rate (food consumption/weight gain), and lesion score. A (pathological examination of the cecum). The test results are shown in Table 1. In a similar experiment, antigen 2 Birds inoculated with 400 ng were infected with 75,000 primordial eggs and tested with similar parameters. was measured. However, in this case the primordial egg is older than in the former case and there are fewer living organisms. It was. The results are shown in Table ①.

The results based on all three parameters are Chickens inoculated with the antigen fusion protein showed reduced severity of coccoid infection. It shows.

■Table ■Table ””Flies 1-B stop E, tenella antigenic protein on the cell surface In order to express the coccoid sporidian antigen on the surface of the dish, it is present on the outer membrane. Fusion with E. coli law B protein, which is a maltose binding protein. The elamB sequence produced as a compound is (, Iellent and Ho[nung Buttan Volume 27 G! p507 (1981). Ben5on and 5i See also Lhavy, Ce1l, vol. 32, pp. 1325-1335 (1983). thing.

The DNA fragment encoding the coccoid sporidian antigen was excised from the vector with EcoRI and purified. make The ends of the coccoid sporidian antigen DNA fragments are treated with EcoRI-X + Lee receptor molecules. Modify it, cut the fragment with Xma I, and insert it into the law B fragment. Ru. Hybrid λ0LpH? # A protein with a lam 3 gene controlled by the I control region Lasmid pGX3216 is used. pGX-e-)-. These fragments When connected, the first 182 amino acids are lam B and the remaining amino acids are globular. Hybrids such as Sporozoan antigenic proteins - Jam B - Sporozoan antigenic proteins Produces a dry texture. Due to the presence of the law B sequence at the amino terminus, such The hybrid protein should be present on the surface of the host cell.

S"L twist-"ヱυ.

6. As an immunizing agent for shrimp-expressed coccoid antigens on the cell surface The Seri strain was grown into chickens by expressing a 11am B-coccoliosporidian antigen fusion on the cell surface. (102-106 cells/1g of feed) Allow the chickens to eat the feed ad libitum Ru. 1, 2, or 3 weeks after feeding, add tenella primordial eggs to the feed. Infect the patient and monitor the progress of the disease. Chicken food conversion 1 Weight gain, lesion score Monitor for up to 6 weeks. Chicken serum was also monitored for antibody production against antigenic proteins. do. Antigens that exhibit protective effects also have similar protective effects against other species of coccoid sporozoites. We will carry out a similar test.

Hl and - ■ Danshi 1 as a vaccine for synthetic peptides based on coccoid sporidian antigens. A synthetic peptide containing a portion of the coccoid sporidian antigen amino acid sequence (Figure 1) was added to a commercially available peptide. Using Tido synthesis @ (fliosearch Vega, Beckman, etc.) automatically synthesize.

All synthetic peptides have the potential to be immunogenic.

One of the useful ones is peptides homologous to repetitive regions found in the antigen (see Figure 1). There is a de. Others may be selected randomly, but the condition is that the content of woody residues is high. so that it is easily exposed to the cell surface. Peptides have a length of 6 or more amino acid residues do. Peptides were prepared using conventional methods (Peters and Richards, Am. Rev. Biochem, Vol. 46, pp. 523-555 (1977)) Binds to immunogenic carrier proteins such as bovine serum albumin and hemocyanin. The activity of the resulting protein is assayed by the method described in Example XV.

m-■L Construction of vaccinia virus that expresses avian cocclocosporidian antigen E. tenella genomic DNA λ phage described in Examples XI and XIT The clone population was nick-translated (R4gby et al., J. Mol.

GX5 radioactivated by Biol, Vol. 113, pp. 237 (1977)) 401 (see Example I? Hybridization with I fragment (Benton and [1avis 5science) 186, pp. 180-182 (1977)).

Restriction endonuclease mapping of ms-type phages identified by hybridization , Southern Blofting (Southern, J, Mo1. R4a1.9 Volume 6 Pp503 (1975)), DNA sequencing (Sanger et al., supra) The amino-terminal codon of the antigen gene was identified. The DNA sequence is a code sequence. An analysis is also performed to confirm the absence of introns within the sequence. Is there any evidence that these introns are processed by vaccinia virus? It is et al. Using mRNA (see Example Azematuping (Bark and 5harp).

Ce1l, Vol. 12, PF1721 (1977)).

Proceeding 15 to 20 base pairs to the 5' side from the amino terminal ATG of the coccoid sporidian antigen gene. The Sma1 site was mutagenic to oligonucleotides (Zolle r and Sm1th.

Methods in Enzymology Volume 100 pp468-500 (1983). Similarly, the same endonuclease site one of the DNA polyadenylation signal sequences (Wickens and 5teph enson, 5science 226 pp1045-1051 (1984 )) is inserted into the 3' end of the gene, a few base pairs in the 3' direction. in endonucleases by mutagenesis of oligonucleotides in vitro. The process of providing the enzyme site allows for further single-strand replication of the coccoid sporidian antigen gene. secondary clone into a plasmid or phage M13. gene 5 Restriction endonuclease sites added to the ’ and 3’ ends indicate that they are It is absent from the insect antigen gene and the cotransfection plasmid (in this case pGs20).

7. Vaccinia virus promoter of the gene followed by cotton thymidine Bag Hl and 15ma I cloned part embedded in the kinase gene Blasmi dopGs20. ATCC39249 (Macket et al. , Journal of V’iro-10gy, Volume 49 ppss’r~86 4) is decomposed using a C-shaped ■. A plasmid containing a modified coccoid antigen gene It is digested with a restriction endonuclease specific to the inserted endonuclease site, and Isolate the antigenic gene fragment. Next, insert this fragment into the gene promoter at 7.5 in pGs20. In the Ham Hl or Sea 1 site on the 3' side of the motor, this promoter is Insert it in such a way that it will be under the control of the target. The resulting “Globosporidian transfection” The ``transfection plasmid'' is a recombinant of the coccoid sporidian gene in an appropriate inviν0. Inserted into the TK genetic circle of cotton senior.

Globosporidium transfection plasmid (1 μg) and calf thymus carrier DNA (20 μg) was precipitated with calcium phosphate (Gram and Van der Eb, Virology 52Spp456-457 (1973); 5to ne et al. J, Vtology vol. 28 pp 182-192 (197B)), Wild strain cotton senior virus WR at a rate of 0.01 to 0.05 PFU/cell used to transfect TI[-143 cells 2 hours after infection. use Cells infected with virus and co-transfected with DNA were added to 10% Culture for 2 days in Eagle medium supplemented with fetal calf serum. 2% bovine fetal monolayer cells Collect in Eagle medium containing baby serum, freeze and thaw three times to release virus. After that, 25 μg 7 ml bromodeoxyuridine (Brd Urd’) containing Infect TK-143 cell monolayers with virus dilutions in the presence of 1% agar in culture medium. . TK-recombinant (Weir et al., Proc. Natl. Acad. Sci, Vol. 79, pp. 1210-1214 (1982); Macket et al. , supra)). In the presence of Brd Urd, TK-U Replicate only the virus. After 3 days, the monolayer cells were dyed o, oos% neutral red to incorporate the pigment. identify living cells that contain Collect plaques of non-staining dead cells containing cotton senior virus. The virus was then replicated again in the presence of 25 μg/d BrdUrd selective pressure. Speciation (Macket et al., Proc, Nat I Acad, Sci, 7 9, pp. 7415-7419 (1982)) Determination of coccoid antigens by related measurements and immunological methods (Cremer et al., supra). Perform measurements regarding production.

Infection of chickens using a recombinant cotton cilia virus TK-positive for coccoid sporidia antigen expression. Infect. After 2 weeks, live coccoid sporozoites are infected from drinking water. chicken weight gain .

Lesion scores and food conversion are analyzed according to the method described in Example XV.

1” [base-”J bird law) own - of Expression of coccoid sporidian antigens by n Roni and two S cerevisiae Therefore, a gene fusion between yeast invertase and the antigen is performed. This gene The sequence controlling the expression of the fusion protein encoded by the invertase gene is derived from the invertase gene. It will be something to come.

The invertase DNA sequence necessary for the present invention is YpGX containing the entire YEp13 sequence. 610 (Broach et al., Gene, Vol. 8, P. 121 (1797)). YEp13 plasmid is ^merican Type eCu1ture (ATCC catalog number 37 from the collection) 115, and this amino acid provides the signal and mature protein. This is the invertase gene segment that encodes quality. Invertase gene amino acid The amino acid sequence is from Taussig and Carlson, Nucleic Ac1dR. esearch, vol. 6, pp. 1943-1954 (1983)) This plasmid contains invertase derived from a pre-constructed yeast DNA population. It has been identified as a clone.

The fusion of the coccoid sporidian antigen and the gene encoding invertase was first performed in invertase. Add appropriate restriction endonuclease recognition sites to the enzyme and antigen gene segments and then The DNA fragments were ligated to create an expression vector using standard methods (Maniatis et al., supra). by assembling the vector. Invertase gene region starts from YpGX610 It is excised as a -3alUI fragment of approximately 6.8 kilobases. -5al 1 limit Endonucase bisects ypcX610. These glue↓1≠ fragments are M13mp8 (commercially available) has been linearized with Sal restriction endonuclease. Connect by. Cloning and transformation experiment records for phylum 13 have been previously described. (Messing, Meth, Enzymol, Volume 101 pp20-8 9 (1983)) The cloned Σal I invertase fragment is in the old 3mp8 It can exist in two directions. The preferred direction is clockwise. Single strand DNA is prepared from this recombinant M13 phage, the meaning of invertase DNA is There will also be arrays without . M1 with invertase sequence in the correct direction 3 To identify clones, the origin identical to part of the meaningless sequence of this gene was using gonucleotides. For example, oligonucleotide sequences GAA, GTG, G.A.C.

Generate the desired clone by standard DNA hybridization experiments using CAA, AGG. can be identified. Does it contain an invertase sequence? 113 Clone to MGX Name it 1200. Add the oligonucleotide primer to the MGX1200 model. Insert a HakiHI restriction endonuclease recognition site near the end of the invertase sequence. used for. Oligonucleotide 5' ATT GAA AAA CCCA CT　CGT　GTG　GAT　CCT　GTT　GTAATCAACCAC Used for this purpose. Includes mutagenesis of oligonucleotides and desired mutations. Selection of potential plaques is performed using standard laboratory methods (Zoller and Sm1th, supra). ). Potential mutant clones are grown from the same origin used to induce the mutation. Hybridization with oligonucleotides or double-stranded M13 DNA with Ba+mH1 restriction Select by cutting with an endonuclease. The desired clones are two Has Ram H1 recognition site. The correct sequence of the new restriction site is determined by DNA sequence analysis. Certified by Cleave double-stranded MGX1201 with added restriction endonuclease Cut out by this.

The gene sequence encoding the coccophorum antigenic protein is conjugated to an oligonucleotide. The following experimental methods can be used to change this by mutation. antigen gene 1.8 KiOhse (7) EcoRL from pGX3215 (Example XIII) It is excised as a fragment and ligated with M13+p8 linearized with EcoRl. This Ec The oRI fragment can exist in two orientations within M13Ilp8. Desirability of gene sequence The opposite direction is clockwise.

Recombinant phylum 13 plaques with genes in the correct orientation are oligonucleotide 5' Identified by DNA hybridization with GCCCTCTTCTCCG. This M13 The recombinant phage is named MGX1202.

The recognition sequence of the enzyme LIJIII was created by mutagenesis of the oligonucleotide. It is inserted at the start of the coccoid antigen protein coding region. oligonucleotide 5'CTCCGGTTTGGCCACAGATCTCAATT CGTAAT CATGG was used for mutagenesis. Was it mutagenized in vitro? Transformation of E. coli with IGX1202 followed by restriction endonuclease Identification of new BBj11 sites by degradation or mutagenic oligonucleotides Plaques are selected by hybridization selection. Using DNA sequence analysis to find the target Recognize array insertion. Name the new Hector -GX1203.

Which gene encodes the coccoid sporidian antigenic protein? 1°8 from IGX1203 KiOase 0) LLLIT-Hind II + restriction endonuclease fragment It is cut out.

The expression vector containing the coccophorum antigen-invertase fusion gene is as follows: It can be generated by MGX1201 vector was digested with Sal I and Baa HI The fragment containing the invertase partial sequence is then excised according to standard methods.

Similarly, MGX1203 was digested with b↓Ir and tlindIII to generate a fragment containing the antigen. Cut out pieces. a third DNA fragment, i.e., a yeast origin of replication and one or more yeast A fragment containing a selectable marker will also be required. This fragment is, for example, YpGXl (E .

coli HB 101 strain (YpGXl) is Aa+erican Type Entrusted to Curture Collection as ATCC39692 From the YEP13 vector in which the yeast chromosome-5a141 site called I can do it manually. This fragment contains a 2μ sequence and a chromosomal marker 1eu-2, and additional -Digest with Hind III to cut out the vector fragment containing these two fragments. I can put it out.

Various host strains with deletions in the chromosomal LE[I2 gene were isolated by YpGX611. According to the experimental method of Hinnen et al., PNAS Vol. 75, pp. 1929 (1978). Can be transformed. Yeast 2μ plasmid contained in YpGX611 The node allows independent replication of the vector within Sacc-haromyces. The LEU2 gene compensates for the chromosomal defect. Only transformed yeast cells are It can be grown in a medium lacking icin. When sucrose is the only carbon source, The invertase globosporidian antigen gene will be completely induced. this inheritance Child expression is suppressed by using glucose as the carbon source.

Expression of the invertase-avian coccophorum antigen fusion protein was Burnett analysis method (Burnett+Anal).

Biochem, Vol. 112, pp. 195-203 (1981)) It can be detected using a sexual antibody. Location of the fusion protein in the cell ( Cytoplasm or cell wall) can be determined by Western blot analysis of cell fraction extracts. Wear. The presence of the fusion protein in the cytoplasm divides the product into “subunits” It becomes possible to produce, isolate, and determine a vaccine. The fusion protein Its presence on the cell surface allows the bacterial strain to be evaluated as a live vaccine. Becomes Noh.

Although some representative embodiments and details have been presented for the purpose of illustrating the invention, It is technically obvious that various changes and modifications can be made within the scope of the invention.

Figure 1 Glu　Gly　Gly　Ala　Gly　Ala　Gly　GuyGAG　G GCGGCGCA GGT GCT GCA GGAAla Glu Gly GLu Thr Gly Lys Pr.

GCCGAA GGCGAG ACA GGG AAA CC’l’Glu G ly Glu Gly Ala Ser Glu GlyGAG GGA GA A GGG GCG AGT GAA GGALeu Ala Ala Val Gly Gly Gly ValCTG GCA GCA GTG GGT GGT GGCGTTAla Ala Tyr Sar Gly Gly Gl y GlyGCCGCG TACTCCGGT GGT GGT GGApro Glu Ala AIIP Thr Val Ile AspCCT GAG GCT GAT ACT GTG AT’r GAClle Thr Asp Glu Asp Asp Tyr TrpATCACT GACGAA GA CGACTAc TGG Showa year month day

Claims (83)

[Claims] 1. Monoclonal or polyvalent antibodies against antigenic proteins of Avian coccophorum A cloned gene consisting of a DNA sequence encoding an antigenic protein that binds to Or a fragment thereof. 2. The monoclonal or polyvalent antibody is an anti-antibody found in organisms of the genus Eimeria. The cloned gene according to claim 1, which is for a native protein. 3. The antibody is applied to the interior, refractive body, and surface of the reproductive spore life stage of Eimeria. , and specific for internal proteins, surface apical proteins, and apical proteins The cloned gene according to claim 2. 4. The reproductive spore life stages are [sequences available] and [sequences available] species The cloned gene according to claim 3, which is a cloned gene. 5. Cloning according to claim 4, wherein said species is Tenella. gene. 6. Claim 5 consisting of the following deoxyribonucleotide and amino acid sequences: Cloned genes described. [There is an array] [There is a sequence] Here is the base sequence from the 5' end to the 3' end (from 5' to 3' ) and the amino acids corresponding to each triplet code are shown. The abbreviations are as follows. Indicates quasi-meaning. A is deoxyadenyl T is for thymidyl G is deoxyguanyl C is deoxycytosyl X is A, T, C or G Y is T or C When Y is C, Z is A, T, C or G When Y is T, Z is A or G H is A, T or C Q is T or A When Q is T, R is C, S is A, T, C or when GQ is A, R is G, S is T or is C M is A or G L is A or C When L is A, N is A or G When L is C, N is A, T, C or G GLY is glycine ALA is alanine VAL is balin LEU is leucine ILE is isoleucine SER is serine THR is threonine PHE is phenylalanine TYR is tyrosine TRP is tryptophan CYS is cysteine HET is methionine ASP is aspartic acid GLU is glutamic acid LYS is lysine ARG is arginine HIS is histidine PRO is proline GLN is glutamine ASN is asparagine 7. Claim 6 consisting of the following deoxyribonucleotide and amino acid sequences: Cloned gene listed: [Sequence available] [There is an array] Here is the base sequence from the 5' end to the 3' end and the corresponding triplet code. Indicates the amino acid. The abbreviations are the same as those described in claim 6. 8. The clone according to claim 1, wherein said sequence is contained in a cloning vector. turned gene. 9. The cloning vector is a plasmid, bacteriophage, or 9. The cloned gene according to claim 8, which is a hybrid of. 10. The clone according to claim 9, wherein the vector is a bacteriophage λ. turned gene. 11. The DNA sequence is in the correct reading frame. coli lacZ gene The cloned gene according to claim 1. 12. The DNA sequence is in the correct reading frame for host cell outer membrane proteins or secreted proteins. The cloned gene according to claim 1, which is fused to a protein. 13. The cloned gene according to claim 1, wherein the gene is chemically synthesized. Child. 14. expression of said DNA sequence comprising a cloned gene according to claim 1; An expression vector under the control of a control region that can direct 15. An antigenic protein that binds to an antibody against an antigenic protein of the avian cocclocosporidium. The DNA is fused in the correct reading frame and encoded by its DNA sequence. two or more genes under the control of regulatory sequences that can direct the expression of a fusion protein or a fragment thereof. 16. comprising the cloned gene according to claim 6 or 7; An expression vector under the control of a control region that can direct the expression of a sequence. 17. If the vector is a plasmid, bacteriophage, virus, or The plant according to claim 14 or 15 selected from the group consisting of hybrids. Current vector. . 18. If the vector is a plasmid, bacteriophage, virus, or 17. The expression vector of claim 16 selected from the group consisting of hybrids. 19. The DNA sequence of the cloned gene is in the correct reading frame. coli lac Z and under the control of the lac control region Current vector. 20. The DNA sequence of the cloned gene is in the correct reading frame. coli lac Z and under the control of the Iac control region Expression vector. 21. The DNA sequence of the cloned gene is inserted into the outer membrane of the host cell in the correct reading frame. Claim 1 fused to a gene encoding a protein or secreted protein Expression vector according to item 4. 22. The gene is E. Claims that encode E. coli lam B protein The expression vector according to item 20. 23. The DNA sequence of the cloned gene is inserted into the host cell outer membrane in the correct reading frame. Claim No. 1 fused to a gene encoding a protein or secreted protein The expression vector according to item 16. 24. The gene is E. Claims that encode the E. coli lamB protein The expression vector according to item 23. 25. The control region is E. E.coli tryptophan operon promoter, operon The expression vector according to claim 14, comprising a bellator and a translation initiation sequence. -. 26. The vector has control sequences that function within the fowlpox virus and a D homologous to said virus. the cloned gene comprises the homologous sequence under the control of the control sequence. 15. The expression vector according to claim 14, wherein the expression vector is inserted into a vector within a vector. 27. Claim 26, wherein the fowlpox virus is vaccinia virus. Expression vector. 28. The virus is vaccinia virus and the DNA sequence is vaccinia virus. Claim 26, which is homologous to at least a part of the midine kinase gene. Expression vector. 29. Control sequences for which the vector functions within herpesviruses and homology to said viruses. the cloned gene contains the homologous DNA sequence under the control of the control sequence. 27. The expression vector of claim 26, which is inserted into said vector in sequence. 30. The herpesvirus is Marek's disease virus or turkey herpesvirus. The expression vector according to claim 29, which is a virus. 31. A group consisting of gram-positive bacteria, gram-negative bacteria, yeasts, fungi, and mammalian bacteria selected from Transformed host organism. 32. Gram-positive bacteria are B. The lodging according to claim 31, which is P. subtilis. Main creature. 33. Gram-negative bacteria are E. 32. The host organism according to claim 31, which is E. coli. 34. Claims that the yeast is Saccharomyces cerevisiae A host organism according to scope 31. 35. A group consisting of gram-positive bacteria, gram-negative bacteria, yeasts, fungi, and mammalian cells selected from among the following and transformed with the expression vector according to claim 16. host organism. 36. Gram-negative bacteria are E. The host according to claim 35, which is E. coli. Organism. 37. The vector according to claim 26, 27, 28, or 29 and a DNA sequence corresponding to at least a portion of said virus is infected with said virus. virus and the cloned gene is inserted into the genome of the fowlpox virus. The fowlpox virus infected host organism binds to the host organism. 38. An antigen of the avian cocclocosporidium under the control of control sequences that function in the fowlpox virus. Antigenic proteins that bind to monoclonal or multivalent antibodies against proteins from a host organism according to claim 37, comprising a cloned gene encoding Fowlpox recombinant virus isolated. 39. E. coli GX5401 strain, AmericanT ype Culture Collection Rockville, MD ATCC NO. Bacteria entrusted as 53155. 40. E. coli GX5408 strain, AmericanTy pe Culture Collection Rockville MD A TCC NO. Bacteria entrusted as 53154. 41. Monoclonal or polyvalent antibodies against antigenic proteins of Avian coccophorum and expressed by the transformed host organism according to claim 31. protein. 42. Monoclonal or polyvalent antibodies against antigenic proteins of Avian coccophorum and expressed by the transformed host organism according to claim 35. protein. 43. The antigenic protein of claim 41 expressed as a fusion protein. Good quality. 44. The antigenic protein of claim 42 expressed as a fusion protein. Good quality. 45. The fusion protein is a β-galactosidase/avian coccophorum fusion protein. 44. The antigenic protein according to claim 43, which consists of protein. 46. The fusion protein is a β-galactosidase/avian coccophorum fusion protein. 45. The antigenic protein according to claim 44, which consists of protein. 47. Transformation in which the fusion protein is fused with an avian coccophorum antigenic protein. The antigen according to claim 43, which consists of an outer membrane or secreted protein of a host organism. sexual protein. 48. The fusion protein is E. coli lam B/avian coccoid sporidium fusion 48. The antigenic protein according to claim 47, which consists of a protein. 49. Transformation in which the fusion protein is fused to an avian coccophorum antigenic protein. The antigen according to claim 44, which consists of an outer membrane or secreted protein of a host organism. sexual protein. 50. The fusion protein is E. coli lamB/avian cocclobosporidian fusion tongue 50. The antigenic protein according to claim 49, which consists of a protein. 51. Antigenic tags expressed by the recombinant fowlpox virus according to claim 38 Good quality. 52. 42. The antigenic protein according to claim 41, wherein the antigenic protein is purified. Pak quality. 53. 43. The antigenic protein according to claim 42, wherein the antigenic protein is purified. Pak quality. 54. 44. The antigenic protein according to claim 43, wherein the antigenic protein is purified. Pak quality. 55. 45. The antigenic protein according to claim 44, wherein the antigenic protein is purified. Pak quality. 56. Claim 52, wherein the protein is combined with a carrier or an adjuvant. Antigenic proteins as described in Section. 57. Claim 53, wherein the protein is combined with a carrier or an adjuvant. Antigenic proteins as described in Section. 58. Claim 54, wherein the protein is combined with a carrier or an adjuvant. Antigenic proteins as described in Section. 59. Claim 55, wherein the protein is combined with a carrier or an adjuvant. Antigenic proteins as described in Section. 60. The antigenic protein according to claim 41, which can be administered to birds and in an effective amount. A method for immunizing birds against avian coccolidiasis. 61. The antigenic protein according to claim 42, which is administered to birds and in an effective amount. A method for immunizing birds against avian coccolidiasis. 62. The antigenic protein according to claim 43, which is administered to birds and in an effective amount. A method for immunizing birds against avian coccolidiasis. 63. The antigenic protein according to claim 44, which is administered to birds and in an effective amount. A method for immunizing birds against avian coccolidiasis. 64. 61. The method of claim 60, wherein said antigenic protein is purified. 65. 62. The method of claim 61, wherein said antigenic protein is purified. 66. 63. The method of claim 62, wherein said antigenic protein is purified. 67. 64. The method of claim 63, wherein said antigenic protein is purified. 68. A claim in which the purified antigenic protein is mixed with a carrier or an adjuvant. The method according to item 64. 69. A claim in which the purified antigenic protein is mixed with a carrier or an adjuvant. The method according to item 65. 70. A claim in which the purified antigenic protein is mixed with a carrier or an adjuvant. The method according to item 66. 71. A claim in which the purified antigenic protein is mixed with a carrier or an adjuvant. The method according to item 67. 72. Claims in which the antigenic protein is administered by injection or by mixing with feed The method according to paragraph 68. 73. Claims in which the antigenic protein is administered by injection or by mixing with feed The method according to paragraph 69. 74. Claims in which the antigenic protein is administered by injection or by mixing with feed The method according to paragraph 70. 75. Claims in which the antigenic protein is administered by injection or by mixing with feed The method according to paragraph 71. 76. A living microorganism transformed with the expression vector according to claim 21. A method of immunizing birds against avian coccolidiasis, which comprises administering a substance to the bird. 77. A living microorganism transformed with the expression vector according to claim 23. A method of immunizing birds against avian coccolidiasis, which comprises administering a substance to the bird. 78. 77. The method of claim 76, wherein the live microorganism resides in the intestinal tract of a bird. . 79. 78. The method of claim 77, wherein the live microorganism resides in the intestinal tract of a bird. . 80. The microorganism is E. Claim 78, which is a coli or rod fungus. the method of. 81. The microorganism is E. Claim 79, which is a coli or rod fungus. the method of. E. 82.1 amB/E. coccophorum antigen fusion protein. coli strain before 77. The method of claim 76, comprising administering to said bird. E. 83.1 amB/E. coccophorum antigen fusion protein. coli strain before 78. The method of claim 77, comprising administering to said bird.