JPS61257185A - Novel promoter - Google Patents

Abstract

PURPOSE:A DNA fragment having extremely strong promoter activity and functioning in various hosts has been found in the chromosome DNA of Nicotiana tabacum. CONSTITUTION:A DNA fragment having promoter activity and containing at least a part of the base sequence of the formula. The fragment is present in the 195bp DNA fragment obtained by digesting Nicotiana tabacum with a restriction enzyme BamHI. The 195bp fragment contains a bidirectional promoter containing a promoter sequence in both chains in an overlapped manner. The promoter range from the 5' to the 3' direction in the plus chain (the upper chain) is supposed to be present between the HinfI site and the MspI site or between the MspI site and the HbaI site.

Description

[Detailed description of the invention] Industrial application fields> The present invention relates to novel eukaryotic promoters.

The promoters of the present invention are inserted into suitable vectors and used for the expression of genes foreign to these hosts in prokaryotic or eukaryotic hosts.

<Prior art> Recent progress in recombinant DNA technology has been remarkable, and interferon, L -2, HBV antigenic peptide, F'MD
These polypeptides are commercially available by expressing heterologous genes encoding useful polypeptides with physiological activities such as V antigenic peptides, human growth hormone, bovine growth hormone, insulin, tpA (human tissue plasminogen activator), and rennin. A method of producing it is being tried.

<Problems to be solved by the invention> In order to efficiently express the above-mentioned polypeptides in biological hosts and enable commercial production, it is necessary to insert a strong The presence of an active transcription initiation control region (promoter) is required for tJ and ta.
c bromotor, trp promoter, tac promoter,
H8VTK promoter, sv9tθ initial promoter, S
A number of promoters are known that function in prokaryotes or eukaryotes, such as the Vda0 late promoter, PL promoter, PR promoter, P/bromotor, and SPO/promoter, but there are even more powerful promoters that can function in many hosts. There is a need for such promoters.

<Means for Solving the Problems> The present inventors have discovered that a DNA fragment having promoter activity exists in the chromosomal DNA of Nicotiana tabacum and have arrived at the present invention.

To explain the present invention in detail, the Bromol/? It is present in the r'bp DNA fragment.

/tatbp fragment contains a bidirectional promoter (bidir
ectional promoter). / 9 bp The BamH fragment has the nucleotide sequence shown in FIG. Plus strand (upper strand)! ' to 3'
The promoter region in the direction is thought to exist between the μLnf[ site and the Msp[ site or the Map 1 site and the Raw 1 site in the same figure. The function of the transcription initiation upstream region is not completely clear, but the underlined T on the plus strand
AATATTT or OAAT%TATATT and ATAAAA are considered promoter sequences.

Mano, from 3' of the plus chain! The promoter region in the ' direction is thought to exist between the Bam I site and just before the Msp 1 site on the 3' terminal strand. ! As with the promoter region in the ' to 3' direction, the function of the transcription initiation upstream region is not completely clear, but the minus strand (lower strand)
CAAAT%TA underlined, read from the 3' direction.
TAAT and either of the two ATGs are considered promoter sequences.

The DNA fragment having promoter activity of the present invention is inserted into a plasmid vector or a phage vector having an origin of replication in prokaryotes such as E. coli, yeast, plant cells, animal cells, etc., and expresses a heterologous gene. used as a vector to

The DNA fragment shown in FIG. 1 has blunt ends, so if it is not used as is, Alu f 5 Hael, Pvu i
It can be inserted into the t, Sma 1 site, etc. Alternatively, the above /rij bp fragment can be digested with BanH and then inserted into the BanH site of the vector, or the above fragment can be used as it is or treated with restriction enzyme (BamH) using an appropriate synthetic linker. Engineering, Hlnf r%Ms
It goes without saying that it can be inserted into the desired restriction site in the vector after p f ) or even after DNA polymerase or Ba13/treatment. When inserting the same DNA fragment, the vector was made flocculent with a restriction enzyme and treated with alkaline phosphatase to prevent vector double-stranding, and then the same DNA fragment was ligated to the vector using 'l'4t DNA ligase. to close the ring.

At this time, it is necessary to adjust the translation frames of the promoter and the heterologous gene to match, but translation can be achieved by conventional methods such as the homopolymer tailing method or by adding an appropriate number of base pairs between the promoter and the heterologous gene. You can match the frames. Furthermore, the above / 9 j
By utilizing restriction sites contained in the bp fragment, using exonucleases, synthetic linker sequences,
The optimal spacing between the promoter and the heterologous gene can be determined to increase the expression level of the heterologous gene.

As is clear from the above explanation, in order for the promoter of the present invention to function, all of the above-mentioned /jbp fragments are not necessarily necessary, and those in which the above-mentioned DNA fragments are partially deleted or some bases are used. Substitutions, insertions, and deletions are included within the scope of the present invention as long as they have promoter activity.

The promoter of the present invention is suitably used in yeast host-vector systems and plant cell host-vector systems. These vectors are required to have an origin of replication that allows replication in the host and a selection marker that allows selection of transformed strains. Furthermore, in order to perform cloning and expression of a heterologous gene in different hosts, it is preferable to insert the 10 motors of the present invention into a so-called shuttle vector. Vectors in yeast include known pJDBjt, pJDB,
2/ri, pJDBoi, pDB2g♂, YRp7, pY
e(C!KN3)m/, p8G! Mko 37, Yko p! ,
Examples include Y-pJ, 2, etc. Are these E. coli plasmid pMB? Alternatively, it has a pBRj-1 fragment, and the selection marker is LEUλ gene, TRP/gene or TT.
It has the RA j gene and has a replication origin of 2μmD.
It has an NA replication origin, ars (autonomous replicating sequence).

Most of these vectors have only one rib! Since it has an H site, after digesting the above-mentioned /jbp DNA fragment with Ban H site, the resulting digested fragment is used as a Bam site in the vector.
Can be inserted into the H-section site.

As a vector in plant cells, the T1-plasmid derivative pNo/(Nature 303, 20
(page 273), pNcAT/(Nature
Volume 303 209-2/! page), pJFneo (Na
Vol. turli 1304 // Cedar p. 17). In addition, the insertion site of the DNA fragment of the present invention in the above vector includes the BamH site for pNo/, the 5au3A site, p, and TF site for pNcAT/.
For "neo", the Set 1 site can be mentioned. Also, examples of the host include f3.cereviiae, tobacco, which has YNNλ2 and URA gene deletion traits
Plant cells such as tomatoes, carrots, and rice, Escherichia coli FIB
10/, ctoo, etc. can be used.

Vectors containing the promoter of the present invention can be used to generate genes for degrading toxins produced by plant fungi (such as genes encoding tenuazonic acid degrading enzymes), herbicide degrading genes, and polypeptides with physiological activity, such as the engineered L-J gene. It is suitable for expressing a gene encoding a peptide to obtain the same polypeptide.

To specifically explain the present invention, the DN of the base sequence shown in FIG.
A is, for example, a type of tobacco leaf (N1cotian).
a tabacum) to conventional methods (biochemical experimental methods/≦
, Introduction to Plant Cell Breeding, ? It was isolated by Ri~Tako Page (/ri! 2), published by Gakkai Publishing Center). DNA fragments having all or 7 parts of the base sequence shown in Figure 1 of Figure 1, or deletions, substitutions, or insertions of 7 parts of the bases of these DNA fragments can also be synthesized by conventional methods such as solid-phase methods.

For example, constructed as shown in FIG.
Shuttle plasmid vector pU for promoter search
A method for measuring the total promoter activity of DNA of the present invention using Gm//Δ will be explained in detail. In addition,
In FIG. 1 (the same applies to FIGS. 3 and 4 below).

pTTG 4t/ /Δ is E. coli E. coIJ (E
, CO'li) and the yeast S. cerevisiae (S. cerevisiae).
Ampicillin resistance gene (Ap') derived from BR322
and origin of replication (ori), yeast plasmid coμm
It contains the DNA-derived replication initiation 71 and the yeast URA J gene. However, it was created by deleting the promoter region of the URA 3 gene.

Details of the construction of pUG@//Δ will be described in Examples below, but as shown in the construction route shown in Figure 1, first, the plasmid child p! The EcoR knee Pst I fragment of plasmid pJDBJA and the KcoR knee 11 fragment of plasmid pJDBJA;
The plasmid pUG'ptO/ was created by ligating with NA ligase (hereinafter referred to as T ligase), and then this pUG'ptO/
The at 1 site was converted to the Bam H site by a conventional method to create a plasmid pt7G 4t//, and further,
From this, the rib H-age slow 1 fragment was deleted, and Ban
Plasmid pUG by joining the Hnilinker
Create 9t//Δ.

In addition, plasmid child p! For example, Pro.

Natl, Acacl, +3ci, USA, 7 volumes, 4t! ! The plasmid pJDB3 is a well-known plasmid described in Nature, Vol. 276, 70g, p. 09 (/97/).

Next, as shown in FIG. 3, the obtained tobacco DNA
and ptTG +t//Δ are each cut using H technology, mixed, and ligated using T4tDNA IJ gauze. Using the obtained ligated plasmid, yeast YNN 27 URAj-
! 2 (Pro, Natl, Acad, 8ci.

USA, Volume 77! ! A colony expressing the URA j gene (containing the plasmid into which the promoter region has been inserted) is collected on a selective medium plate. Next, the plasmid was isolated and used to transform Escherichia coli HB10/. After propagation, ampicillin-resistant colonies were collected, and a ligated plasmid (referred to as pTNBz) containing the promoter region was isolated from the bacterial cells.

When plasmid pTNBj is cut with Ban H engineer, p
It was separated into UGda//Δ and a DNA fragment of about 200 base pairs. This approximately -00 base DNA fragment was confirmed by Southern hybridization to be derived from tobacco DNA, and was also determined by the Maxam-Gilbert method as shown in Figure 1. It was found that it has a base pair sequence.

<Effect of the invention> The promoter activity of the above DNA fragment in yeast is as follows:
As shown in the Examples below, compared to the case where this promoter was replaced with another promoter, a significantly higher transformation frequency and a shorter generation time were exhibited.

From this fact, the above DNA fragment of the present invention exhibits strong promoter activity, regardless of its orientation, especially in yeast cells.

<Examples> The present invention will be described in more detail with reference to Examples below, but the present invention is not limited to the following Examples unless the gist of the invention is exceeded.

In addition, the operations in the following examples were carried out by the following method unless otherwise specified.

■ [Cleavage and recovery of DNA with restriction enzymes] Use the following three types of buffers for cutting with restriction enzymes, (1) ~ (
The proper use of 3) is AdvancedBacteria
l Genetics (/ta//)(0
01stpringHarbor, New York
) was followed. The cleavage is carried out using a restriction enzyme of 2 units/μf DNA at 37° C. for 10 hours.

Then, TK buffer (10mM Tris-HCl pH♂, O
After extracting once with phenol saturated with and/mM EDTA), removing the phenol with ether, adding -2 volumes of ethanol and leaving at 110°C for 30 minutes,
Collect DNA by centrifugation.

tl) Low salt buffer consisting of 70mM Tris-HCl (pH 78g), 10mM magnesium sulfate and /mM dithiothreitol.

(2) Raw salt concentration buffer! θmM NaC31,/OmM Tris-HCl (pH
7,4t), 10mM magnesium sulfate and /mM
dithiothreitol.

(3) High salt concentration buffer consisting of /00mM Mace, 10mM Tris-HCl (pH 7, @) and /OmM magnesium sulfate.

■ [Preparation of plasmid DNA from E. coli HB10] (1) Mini preparation method (m1ni prep method) Nu
cleic Ac1dsRee, Volume 7, /! /j ~/
j-23 page, (/97ri)] Escherichia coli HB10/ was used as a host, and o, r- L-broth (101 peptone, 11 yeast extract, /f glucose, jt NaC!
It consists of 1/l. cultured overnight using pH 7, J),
The bacterial cells collected by centrifugation were added to / 00 aL of solution A.
(70mM glucose, 10mM KDTA.

It consists of 2 j mM Tris-HCl (pHtr, o ) and lysozyme 2/1. ) K suspension and let stand at room temperature for 30 minutes.

Then, add 100 μt of solution B (/% 5DEI) in ice water.
(0.2N NaOH containing sodium dodecyl sulfate)
was added and shaken to lyse the bacteria and denature the DNA, /! Oμ
Add 3M sodium acetate solution of t, cool with water, centrifuge, add cold ethanol to the supernatant, cool to -20°C, centrifuge, and collect the precipitate.

The precipitate was dissolved in solution 0 (70 mM Tris-HCl and θ,/M
After removing insoluble matter, cold ethanol is added, and after cooling to -20°C, centrifugation is performed. The precipitated DllfA is dried under reduced pressure and then dissolved in TK buffer.

(2) Large-scale preparation method: Inoculate 100 d of L-pros (containing drug in case of drug-resistant plasmid) K Escherichia coli HB10/ and culture overnight.
After collecting bacteria, /! d sTms buffer (2! to TK8 buffer)
Suspended in sucrose (added with saccharose),! ! ! D
T.A.

Lysozyme and ribonuclease A (manufactured by Sigma) at 30mM% t00μt/m and! Add 0μt/wl of pronase E in ice water. Next, add Sn2 to /H, shake at 32°C, return to ice water, add 7M Mail, centrifuge, add λ times the volume of cold ethanol to the supernatant, and -2θ
The DNA is kept at 0.degree. C. and centrifuged to collect the DNA as a precipitate, dried under reduced pressure, and stored at -SO.degree.

1 (Ligation using T4t-DNA ligase) The two DNA fragments to be ligated are prepared in a ligation buffer (t A mM Tris-HCl (pH 7,
j), j, consisting of 4mM magnesium chloride, 10mM dithiothreitol] and 1. (70 at 7℃
After treatment for 1 minute, 4 dμM MuTP (adenosine triphosphate) was added at z°C, and additional KT4t-ligase was added at θ for sticky ends, /units/μfDNA1 or for blunt ends, /units/μf. Add it to become DNA at g℃/? After reacting for an hour, the mixture was treated at tr°C for 70 minutes.

■ [Transformation of E. coli (Advanced Bact
erialGenetics (/rir/) (Co
1d Spring Harbor.

New YOrk) ) g-L-broth was inoculated with Escherichia coli HB10/, cultured to logarithmic growth phase and collected, suspended in J yxl's OmM calcium chloride solution, collected after cooling with water, and cultured again. 0.3
- Suspend in the same solution and cool on ice. This bacterial solution θ, /1ttl
and 0. D in 0.7M Tris-HCl (pH 7,2)
The dissolved NA is mixed, cooled with water, heat-treated at 32°C for 1 minute, added with /xi L-broth, and incubated at 37°C for 7 hours. Transfer this solution to an agar plate of L-broth (
(containing antibiotic for selection) and cultured overnight at 37°C to obtain colonies.

V (Removal of DNA sticky ends (/main-stranded portion) by s7 nuclease) DNA with sticky ends was removed in a high salt concentration buffer [30mM sodium acetate (pH 41, 21), 0.3M
NaC! 20 units/μ2 S/nuclease was added to the DNA, treated at 22°C for 0 min, extracted with phenol saturated with TE buffer, and extracted with phenol saturated with TE buffer. Phenol is removed, cold ethanol is added, the mixture is cooled to -2σ°C, and the precipitated DNA is recovered by centrifugation.

■(Phosphorylation of BamH Nilinker) BamH Nilinker (manufactured by B, R, L) j-CCGG
ATOcGG-3 GGOCTAGGOC! Since it does not have a phosphate group at its end, it was phosphorylated with T dakinase.

J n mol of Ban H Nilinker, g/μ
20mM Tris-HCl (pH 7,t) and /2
After treatment for 70 min at 60 °C, dissolved in mM magnesium chloride/OmM Komelkabutoethanol, at 32 °C.
-0mM (DATP) was added, and Tm kinase/θ units were added and treated at 37°C for 3θ minutes, then at 0°C for 70 minutes, then Tm kinase/θ units were added again and treated at 37°C for 30 minutes. , store at -20°C.

■ (Ligation of BamH Nilinker to blunt end) Blunt-end DNA fragment (/, 2 p mol end) and Bam H Nilinker phosphorylated in the above (■)
end) with ligation buffer [6 dmM Tris-HCl (pH 7)
j), l, /, mM magnesium chloride, 70 m
M dithiothreitol], dissolved in 0.6 r
Add nM ATP and /unit T% ligase and incubate at /
After reacting for a while, treat with Ban H process to remove excess Bam.
After removing the H-nilinker, extract the DNA with phenol saturated with TK buffer, remove the phenol with ether, and recover the DNA by ethanol precipitation.

Example (1) Preparation of tobacco DNA Tobacco [Nicotia f-1' Baka A
natabaccum, 8 sustenance bright yellow o -, 2
(BrightYellow 2) ) (Grown with seeds provided by the monopoly public corporation) leaves θ2 shredded/! θ gastric buffer (j OmM Tris-HCl, jm
M of magnesium chloride, jmM of Komelkabutoethanol and 0.6 M of sucrose) and ground in a Waring blender.

The homogenate was filtered, the filtrate was centrifuged, the precipitated cells were collected and washed with the above buffer, and o, -t% Triton X-/θ
The suspension was suspended in the above buffer containing θ (surfactant) and centrifuged.

Precipitate! tθmM Tris-HCl and/OmM E
Suspended in DTA (ethylenediaminetetraacetic acid), 0. jl
Add SDS (sodium dodecyl sulfate) and
At 7°C, ribonuclease was added and treated for 2 hours, pronase was added for 2 hours, centrifuged, the supernatant was treated with chloroform-phenol to remove protein, and ethanol was added to collect the precipitated DNA.

(2) Preparation of plasmid pUG4t//Δ As shown in the construction route shown in FIG.
DBj& was cut with Kco RI and Pst 1, respectively, and the obtained Y-p! 3. /kb Kco RI-P
day tl fragment (ΔURAj, Ap'.

containing the replication origin of pBRJJ-) and 3. of p, TDB jt. & kb Eco R knee Pst I fragment (,2μ
IR of mDNA (reverse base sequence (1nrerted)
repeat)) Fragment with origin of replication in 1) at Tm
Plasmid pUG daθ/(7,4t) was ligated with ligase.
kl:+) was produced. These operations were performed using E. coli HB/
A transformation method using θ/ was used.

pUG Iltθ/ was then partially digested with Pθtl to prepare a linear molecule and digested with S7 nuclease (,2θ units/
μfDNA) to remove the sticky end at the Pat 1 site, and Ba
After binding the mHni linker and cutting with Ban HI,
It was ligated with T g IJ gauze.

Then, FIB10/ was transformed to obtain an ampicillin-resistant transformant. Plasmid DNA was prepared from this transformant by the mini preparation method, and the URJkJ portion of Pet
A search was made for one in which one site was changed to a Ban HI site, and pt104t// (7, da kb) was obtained.

pUGllt// was cut with BamHI and HpaI, and a BamH linker was added with T ligase.

After cutting with Ban HI, ligation with T%-ligase, H
pUG 4t/ by transforming B10/
/'s Bam H-section to Hpa-section (37 pieces b)
pUG′l//Δ in which p) was deleted was obtained.

Transform HB10/ with pUGda//Δ and create ampicillin-resistant colonies of HB10/, ampicillin 2! μf/
OD, 1 at 37°C in θOml of L-pros containing d.
゜=/, after fF− grown to θ/jθμy/xi
of chloramphenicol was added and cultured for 70 hours to collect bacteria. The bacterial cells were treated with /j% sucrose, j OmM Tris-HCl and 30mM! ! ! After stirring the solution consisting of DTA, it was subjected to lysozyme treatment and surfactant treatment, and then jM of potassium acetate was added so that the final concentration was θ, tM,
After being maintained at 0°C for 7 hours, it was centrifuged, and the supernatant was subjected to phenol extraction and ethanol precipitation. 10 μt/ml of precipitate
Containing ribonuclease / OmM Tris-HCl and /mM EDTA, treated at 32°C for 30 minutes, ethanol precipitated, ultracentrifuged #), 2oo
The μt plasmid pTTGda//Δ was obtained.

(3) Linkage of tobacco DNA and pUGda//Δ700
DNA obtained by treating μt tobacco DNA with 30Q units of 7 □ Bam HI at 37°C for 72 hours
A fragment! pUG4t//Δ of θμf! Ba in θ
The DNA fragments obtained by treatment with nHI at 37°C for 3 hours were mixed, T4t ligase was added, and the mixture was treated at 37°C for 1/2 hour to obtain a solution of the ligated plasmid.

(4) Transformation of yeast using ligated plasmid (3) above
Using the ligated plasmid obtained in
urnal Of BaCteri010g7゜113
Volume, 763~/Ir page (/9♂3)) Yoshi, Yeast YN
N27 TrRA3-, tco was transformed. That is, after planting 7% of YNN cores grown to a steady state in /θgo's YPD medium (7% yeast extract, flathead peptone, 2% dextrose, pH 3), they were cultured for r hours in IO"c). did.

After collecting bacteria, wash with TEi @ buffer solution and add O8 Yogo TE and 0.1
-〇〇, x M Lithium acetic acid mixture suspended at 30℃
After treatment for 7 hours with /tttl of 70 polyethylene glycol yooOt and treatment at 30°C for 3θ minutes, the ligated plasmid solution λθμ obtained in (3) above was added.
f was added and further heated at 30°C for 7 hours. after that,
At yo℃! Heat treatment for 3 minutes, collect bacteria, wash with water,
The colonies grown on the plates were selected as those expressing the URA 3 gene. It was identified as having a plasmid with a promoter region inserted just before the gene.

As a selective medium, Jθμf/8D medium (2% dextrose, 0.7% yeast nitrogen base) was used.
-9 using 2% agarose plates containing tryptophan.

(5) Transfer of the ligated plasmid to E. coli The colonies obtained in (4) above were suspended in tryptophan-supplemented SD medium of /θgo, continued to be cultured at 30°C until the logarithmic growth phase, collected, and washed. After that, the bacterial cells were mixed with 2■/-containing Norizozyme/! Thisucrose, /1mM) IJS hydrochloric acid and! θmME
It was suspended in a solution of DTA and treated at room temperature for 3θ minutes. To this, alkali, surfactant solution, and 3M sodium acetate were sequentially added, and after treatment at ℃ for 7 hours, centrifugation was performed, ethanol was added to the supernatant, and the precipitated plasmid was dried.
It was dissolved in μt TK buffer and transformed into HB10/.

That is, 0D61°=0. By step B, after growing coli HB10/, collect the bacteria.
j After washing with 3 d of OmM calcium chloride solution, suspend in the same solution 0.3- and add O
The above plasmid solution of .mu.t was added and treated at 3.7.degree. C. for 2 minutes to perform transformation. Then add /l to this solution
After adding nl of L-pros and incubating at 37°C for 7 hours, An ampicillin-resistant colony was obtained by applying the mixture to an ampicillin-containing L-pros agarose plate of μt/d and growing.

(6) Preparation of plasmid pTNB3 and determination of base sequence of insertion site The E. coli colony obtained in (5) above was cultured in exactly the same manner as described in (2) above, and after propagation, the bacteria were collected, and the bacterial cells were collected. A plasmid was obtained and named pTNB3.

When plasmid pTNBJ is cut with BamH, pU
The DNA fragment was separated into a DNA fragment having a length of 04t//Δ and about -200 base pairs, and this DNA fragment was confirmed by Southern hybridization to be derived from tobacco DNA. Furthermore, as a result of determining the base sequence using the Maxam-Gilbert method, this DNA fragment was surrounded by the BamH engineering site.
Shown in Figure 1/? ! It was found that it has a base pair sequence.

(7) pTNB,? Assay of promoter activity of pT
In order to compare the promoter activity of NB3 and the promoter activity of the yeast URAl gene itself, URA J
A plasmid (YpJDB
) was prepared (see Figure 4).

On the other hand, the /ri obtained from (6) above! A DNA fragment of base size,
The previously mentioned epUGllt//Δ was mixed with Bam H-digested, ligated with 7g ligase, and H-digested in the same manner as above.
B10/ was transformed, ampicillin-resistant colonies were picked, and after culture and multiplication, plasmids pTNBj-/ and p
TNBj-1 (/ri! The base pair DNA fragment is pTNBj
-/ inserted in the opposite direction) was isolated.

YpJDB and pTNBJ-/, pTNB J-2
Finally, yeast YNN27 was transformed and URA+ colonies were obtained. Isolate each URA+ transformant, grow it in 8D medium supplemented with tryptophan, and determine the bacterial growth curve and generation time.9. The transformation frequency and generation time for each plasmid were as shown in Table 1.

table /

[Brief explanation of the drawing]

FIG. 1 shows the base sequence of the DAA fragment containing the promoter of the present invention, and FIGS.
G%//Δ, pTNB! FIG. 2 is a schematic diagram showing the construction of Yp and TDB. BamHI Hinf I
Mspl ACAATTTCCA CCCGCTCGAA A
TGACCACATTGTTAAAGGT GGGC
GAGCTT TACTGGTGTATATATTTT
TTT GGCATTTTTACAGCCATAAA
ATATAAAAAAA CCGTAAATG T
CGGTATTTT昂 1 巳Hhal HinfT TGTGCTATGCCCGTGCCTTA CCG
CCTTGGGACACGATACGGGCACG
GAAT GGCGGAACCC 2nd Nagibe Old A3 ↓ MushiυNAj Figure 3 RA3

Claims (17)

[Claims] (1) A DNA fragment having all or part of the base sequence shown in FIG. 1 or a base sequence equivalent thereto, and having promoter activity. (2) The DNA fragment according to claim 1, wherein the DNA fragment is a 195 bp BamHI fragment derived from chromosomal DNA of Nicotiana tabacum. (3) A vector into which a DNA fragment having promoter activity and having all or part of the base sequence shown in FIG. 1 or a base sequence equivalent thereto is inserted. (4) The vector according to claim 3, wherein the DNA fragment is a 195 bp BamHI fragment derived from chromosomal DNA of Nicotiana tabacum. (5) The vector according to claim 3 or 4, wherein the heterologous gene is under the transcriptional control of a promoter. (6) The vector according to claim 5, wherein the heterologous gene is a gene encoding a physiologically active polypeptide. (7) The vector according to any one of claims 3 to 4, which has an origin of replication in a host. (8) The vector according to any one of claims 3 to 7, which is capable of replicating in yeast. (9) The vector according to claim 8, which has a 2 μm DNA replication origin. (10) The vector according to any one of claims 3 to 9, which contains a gene that can be selected in a host. (11) The vector according to any one of claims 3 to 10, which contains a gene selectable in yeast. (12) The vector according to claim 11, wherein the selectable gene is the \URA\3 gene. (13) The vector according to any one of claims 3 to 12, wherein the vector is a plasmid vector. (14) pTNB3, pTNB3-1 or pTNB3-
14. The vector according to claim 13, wherein the vector is (15) Nicotiana tabacum (￥Nicotiana￥
D derived from the chromosomal DNA of \taba-cum\) and having a 195 bp\Bam\HI fragment or a part thereof, or a base sequence equivalent thereto, having promoter activity.
A host transformed with a plasmid vector into which an NA fragment has been inserted. (16) The host according to claim 15, wherein the host is yeast. (17) The host according to claim 15, wherein the host is a plant cell.