JPS61132189A - M-rna of protein stored in soybean and its preparation - Google Patents

Abstract

PURPOSE:The title m-RNA is obtained by separating the fraction heavier than 18S b6y sucrose solution density-gradient centrifugation, which contains m-RNA corresponding to the protein stored in soybeans and extracting the m-RNA from the separated fraction. CONSTITUTION:The objective m-RNA corresponds to the protein which is stored in soybeans and is included in the fraction a little heavier than 81S by sucrose solution density-gradient enctrifugation. The starting material for the m-RNA is soybeans at a variety of growth stages such as at ripening stage. The soybeans are combined with a mixture of a surfactant such as NP-40, SDS, Triton X-100 and a phenol solution 2-5 volumes of the soybeans to crush and solubilize the cells by a variety of physical methods, centrifuge, then the supernatant is combined with cool ethanol to cause the precipitation of the RNA.

Description

DETAILED DESCRIPTION OF THE INVENTION The present invention deals with soybean storage protein, which is obtained from soybean seeds and obtained in a fraction slightly heavier than 18S by sucrose density gradient centrifugation.
Abbreviated as RNA. ) and its preparation method.

It is known that the main substances stored in soybean seeds include protein, lipids, and phytates.
Understanding how these storage substances are synthesized and accumulated during the ripening process of seeds is important not only from the viewpoint of seed physiology but also from the viewpoint of food chemistry.

The present inventor has repeatedly researched the physiological role of soybean storage proteins, production methods, etc., and in the process, we discovered that mRNA corresponding to soybean storage proteins was extracted from soybean seeds.
A was successfully extracted, and complementary DNA (hereinafter abbreviated as cDNA) corresponding to this mRNA was successfully prepared. By expressing the DNA thus obtained in microbial cells or plant cells, the desired soybean storage protein can be produced.

The present invention deals with soybean storage proteins, obtained from soybean seeds and fractionated by sucrose density gradient centrifugation.
The purpose of the present invention is to provide mRNA obtained in a fraction slightly heavier than 5 and a method for producing the same.

As mentioned above, the mRNA of the present invention corresponds to soybean storage protein and is obtained as a fraction slightly heavier than 185 by fractionation by sucrose density gradient centrifugation or gel filtration and agarose electrophoresis. mRNA
can be produced by extraction and separation from soybean seeds.

As the material for the mRNA used in the present invention, soybean seeds in various stages, for example, at the full ripening stage, can be used.

mRNA corresponding to soybean storage protein from soybean seeds
A can be extracted by any conventional method regardless of the type of seed. For example, if the tissue is 2 to 5 volumes of N P -40,
A surfactant such as SDS, Triton
After centrifugation, cold ethanol is added to the supernatant to precipitate RNA.

Furthermore, if necessary, a method can be carried out in which polysomes in the process of synthesizing soybean storage protein are precipitated using an antibody corresponding to the soybean storage protein, and then mRNA is extracted using a surfactant or the like.

In addition, for the purification of mRNA of the present invention, oligo dT
- Purification method using an adsorption column such as cellulose or poly-U-Sepharose 2. Purification can be carried out by fractionation using isokinetic sucrose density gradient centrifugation. Through such purification operations, the mRNA of the present invention was purified to 18
It is obtained as a fraction slightly heavier than S.

In order to confirm that the mRNA obtained as described above corresponds to the target soybean storage protein, it is necessary to translate the mRNA into a protein and identify the protein using an antibody or the like. Just follow the method. For example, Reticulocyte-1yz, a system often used to translate mRNA into proteins.
ate (stripe red blood cell lysate), Wheat g
Translation into protein is performed in a cell-free system such as erm (wheat germ).

The greatest use of the soybean storage protein mRNA thus obtained is to convert these mRNAs into cDNAs in vitro.
The purpose of this invention is to synthesize A and incorporate it into an appropriate vector to make it possible to produce soybean storage protein in microorganisms or plants.

Such cDNA synthesis can usually be carried out in vitro by the following method. dATP, dGTP, dC using mRNA as a template and oligo dT as a primer
Single-stranded cDNA complementary to mRNA is synthesized using reverse transcriptase in the presence of TP and dTTP, and template m
After degrading and removing the RNA, oligo dC is added, and then double-stranded cDNA is synthesized using reverse transcriptase or DNA polymerase using oligo dG as a primer and single-stranded cDNA as a template. DN obtained in this way
Both ends of A are treated with exonuclease if necessary, and appropriate NAs are connected to each end, or a plurality of bases in combinations that can be annealed are polymerized. This is then incorporated into a microbial vector. The method of integration involves cleaving the vector with an appropriate restriction enzyme and, if necessary, polymerizing an appropriate linker or a plurality of annealing-enabled combinations of bases. The double-stranded DNA thus processed and vector DNA are mixed and ligated using ligase.

The obtained recombinant DNA is introduced into a vector host microorganism. Suitable host microorganisms include microorganisms of the genus Escherichia such as Escherichia coli, microorganisms of the genus Bacillus such as Bacillus subtilis, and microorganisms of the genus Satucharomyces such as Satucharomyces cerevisiae. Vectors used for these microorganisms are illustrated below. (Refer to Protein Nucleic Acid Enzyme Vol. 26, No. 4 (1981)) p5CIOI of EK-based plasmid vector (stringent type),
pRK353.

p RK646. p RK248. pD F41
etc., EK-based plasmid vector (relaxed type) C
a1El.

pVH51, pAC105, R5F2124. pC
R1゜pMB9. BR313, pBR322, pBR3
24゜p B R325, p B R327, p B
R32B, pKY2289゜pKY2700. p
KN80. pKC7, pKB158゜pMK2004.
pAcYcl, pAcYc184゜λdu1, etc., λgt
λgt・λC2゜λgt・λB of system phage vector
, λWES−λB +, λZ J vir · λB
+.

λALO-λB, λW E S ·Ts622. λ
Dam et al.

Sharon Vector Sharon 4A, Sharon 3A.

Sharon 16A, Sharon 13A, Sharon 14A, Sharon 15A, Sharon 8. Sharon 10. Sharon 1
7. Sharon 20 etc., Tiollais
Group vector L 512. λZEQS, λZ
YV5φ.

λZUV)2. λZUV13. λYEQSφ1
゜λYEQSφ, λYEQSφ3. λBam, λS
st, etc., Bacillus subtilis smid vector p TA 10
15°p L S15. pTA1020. pL
S2B, p L 313°p TA1050.
p T1060. pTA1030. pT
Staphylococcus-derived plasmid vector pT127, such as A1031. p C194, p C221, p
C223,p UB112゜p U BIIO,p S
AO501, p S A2100. p E194
゜pTP4. Yeast vector pJDB such as pTP5
219゜YEp13. YRp7. YTpl, pYC, p
The soybean storage protein can be expressed in a suitable host by integrating it into a TC2° microbial vector, such as Pstl or EcoRl 5ite, such as pBR322, and transforming it into a suitable host.

It is confirmed by the following method that the obtained mRNA contains genetic information corresponding to the soybean storage protein.

Reticulocyte 1yzate or -h
Po5sitive hy using the eat germ system
brid 5election and 1nvitr
.

The gene is introduced into plants using p A L 1050 hectares of soybean storage protein by the translation method.

When inserting recombinant DNA, connect 1n-fran+e to the leader sequence of tmr, and also insert the stop codon region into tmr.
Use what you have.

The method for preparing the mRNA of the present invention from soybean seeds as described above will be explained in detail in the following Examples. Note that the present invention can be carried out in exactly the same manner in the case of mRNA corresponding to the storage protein obtained from the following soybean seeds shown in this example. and is within the scope of the present invention.

Example 1 (1) Glycinin (one of the main soybean storage proteins) was purified from ripe soybeans and acidified (hereinafter abbreviated as A).

) Separate and purify the subunits.

The A subunits have a molecular weight of approximately 35-40 and exhibit strong immunochemical cross-reactivity with each other. Therefore, antiserum specific to each A subunit is prepared. As a method for preparing the antiserum, for example, a method can be applied in which freeze-dried powder of other acidic subunit proteins is added to the antiserum obtained by sufficiently immunizing a rabbit with a specific subunit (hyperimmunization) and the absorption procedure is repeated. . Specificity was tested by Ochterlony's in-gel double diffusion method and Western blot method.

(2) Membrane-bound polysomes are prepared from soybean cotyledons at the mid-ripening stage (38 days after flowering), and mRNA is purified using the 5DS-phenol method and polyU-Sepharose column method. On the other hand, total mRNA is prepared in the same manner from cotyledons at the same stage. A part of this total mRNA preparation was fractionated by sig sugar density gradient centrifugation (sucrose 10% (-8) - 30% (w/w)), and the translation product was isolated in the erythrocyte cell-free protein synthesis system. Chemical analysis identifies glycinin mRNA enriched fractions.

(3) A cDNA library for all the mRNAs in (2) above is prepared according to the method described below.

1) Synthesis of ss-cDNA and alkaline decomposition of template mRNA Siliconized Esobendle tube (1.5 m
l) with 10 pl of X10 cDNA buffer (0.5 M Tris-HCl, 1.4 M potassium chloride, 0.8 M
Magnesium acetate), 3μl of RNasin (Seikagaku 40u/μl, 5μj! of dATP, 5.cr6
of dGTP, 4 μl of dCTP and dTTP.

24 μl of oligo(dT) +2-Ill (P-L
Made by Biochemicals, 0.2 rrq/m
l), 8 ul of actinomycin D (0
, 4 μg/μ7, 1 μl of 0.1 MDTT.

6 μl (α-”P)dATP and 10 μl mRNA
Add A (1 μg/II jl!, treated at 65°C for 10 minutes, then quenched) in this order, mix, add enzyme, mix gently, centrifuge for 1 second, and add this mixture (10
0 μl) at 42°C for 60 minutes.

The reaction mixture contained 20μ of 5M sodium chloride, 16μβ of 2
Stop the reaction by adding 50 mM EDTA, 2 u 1 20% SDS and 62 μ2 distilled water.

Add to this a phenol mixture (10mM Tris-HCl (pH 8)
, 3)-phenol solution saturated with 2mM EDTA) 20
Add 0μ2 and shake vigorously.

Centrifuge to remove the aqueous layer and add to the remaining phenol layer.

Re-extract by adding 122μβ of distilled water and 48μ2 of 5M sodium chloride solution, combine with the previous aqueous layer and treat with ether to remove the mixed phenol, and then add 30μl of potassium acetate (pH 5,0) and 600μL of potassium acetate (pH 5,0). Ethanol precipitation by adding μl of cold ethanol (30 minutes in dry ice-ethanol or 1 hour at -70°C).

Approximately 3 to 5 μg of cDNA is obtained by this operation. This 5s-cDNA is dried under reduced pressure, and 45 μl of distilled water is added to dissolve it.

Add 5μβ of 5N sodium hydroxide solution, mix, centrifuge for 1 second, collect the liquid at the bottom of the tube, and keep at 25°C.
Incubate overnight to degrade the mRNA.

50 pl Hepes-K OH (pH 7,4)
After adding the buffer, add the Ultrogel AcA44 column (
Approximately 0.6+nj2 when placed on gel pent height 28cm)
Fractionate each. Collect the void volume fraction (in this condition, fraction number 6-8, check with a 0M survey meter or use a liquid scintillation counter (measured by the erBnkov method). Add 1/10 volume of 3M potassium acetate, 2 to this fraction. Add twice the amount of cold ethanol, let stand at -70°C for 1 hour, then centrifuge to precipitate. Wash the precipitate twice with 70% ethanol (gently layer the ethanol without peeling off the precipitate and centrifuge for 10 minutes. (rinse) and dry under reduced pressure.

1i) Addition of dC homopolymer to the 3°-OH end of ss-cDNA The dried 5s-cDNA prepared in i) (in a siliconized Esopendorf tube) was dissolved by adding 25μi of distilled water. , centrifuge, collect at the bottom, and incubate at 65℃ for 1
Treat for 0 minutes and quench. Centrifuge again for 1 second, then add 5
μβ X10TdT buffer (1,4 M potassium cacodylate (pH 7,6), 0.6 M I-lith base (
19.3 g of cacodylic acid (free acid) and 7.
50mj of 2g Trizma base (manufactured by Sigma)
Dissolve in double-distilled water (2), adjust the pH to 7.6 by adding potassium hydroxide powder, and sterilize), add 5 μl of cobalt chloride, 5 μl of DTT, and 5 μl of dCTP, mix well, and centrifuge.

Add 5μff of TdT (4u/μj2) to this, mix gently, and keep warm at 15°C for 10 minutes. Add 10 μl of 5M sodium chloride, 4 μl of 250 mM sodium chloride to the reaction mixture.
EDTA, 36 p (t) of distilled water was added and heat treated at 70°C for 5 minutes.

After phenol extraction, ethanol precipitation, washing and drying.

1) Preparation of ds-cDNA Add 26 μl of distilled water to the 5s-cDNA preparation prepared in ii) above with dC homopolymer added to the 3” end (stored dry in a siliconized Esopendorf tube). Thoroughly dissolve at 68°C.

After processing for 5 minutes, rapidly cool.

After centrifugation for 1 second, add 10 pl of X10 cDNA IJl buffer.

1 μJ (7) DTT, 10 μA dATP, dGTP.

dCTP and dTTP, 15μ2 oligo(dG)+
□~18 is added, mixed and centrifuged, then 13μβ reverse transcriptase (5.8u/μm) is added and kept at 42°C for 1 hour.

Add 20 μl of 5M sodium chloride to the reaction solution, 8 μl of 25
0 mM EDTA, 2 p e of 20% SDS and 7
The reaction is stopped by adding 0 μβ of distilled water.

Phenol extraction and ethanol precipitation according to conventional methods.

After washing and drying, add 40 μl of distilled water and dissolve.
After processing at 62°C for 5 minutes, rapidly cool and centrifuge.

This was added with X 10 K 1eno-buffer (0.67MK
- 1 Opl of phosphate buffer (pH 7,4), 67mM magnesium chloride, 10mM DTT),
dATP, dGTP.

Add 10 μβ each of dCTP and dTTP.

After mixing well, add DNA polymerase I (K le
now enzyme, 5 u/μl added in LOpl at 37°C.
Allow time to react.

40μl 5M sodium chloride, 16μβ 250mM
EDTA, 4/11 20% SDS and 1401! After adding distilled water to stop the reaction, phenol extraction and ethanol precipitation are performed according to conventional methods. If necessary, low molecular weight ds-cDNA can also be removed at this stage by gel electrophoresis or neutral sucrose density gradient method.

Add 100 μl of distilled water to ds-cDNA to dissolve it, place it on an Ultrogel AcA44 column (gel ped height 28 cm), and fractionate it into approximately 0.6 m/void.
Collect the yolume fraction (the elution pattern is determined by the Gerenkov method using a liquid scintillation counter).

To this fraction, 1/10 amount of 3M potassium acetate and 2 times the amount of cold ethanol were added, and after standing at -70°C for 1 hour, the resulting d
The s-cDNA precipitate was collected by centrifugal drying, washed,
Dry under reduced pressure.

iv) End processing of ds-cDNA for insertion into plasmid 31p/
Add 5 μl of distilled water to dissolve, add 5 μ2 of X10TdT buffer, 5 μl of dCTD, mix thoroughly, and then add 3 μl of
of TdT and incubate at 37°C for 5 minutes.

After the reaction, 10 μl of 5M sodium chloride, 4 μl of 25
Add 0mM EDTA and 36μl distilled water and incubate at 70°C.
After treatment for 5 minutes, phenol extraction, ethanol precipitation, washing and vacuum drying are performed according to conventional methods.

v) Pst engineered 3° end oligo dG addition pBR322
Annealing ds-cDNA solution (450 μJ) with 50 μe x 10
Annealing buffer (0, IM) Lis-HCl (pH 7,
5), 1M sodium chloride, 10mM EDT
Add A) and mix well, then take 100 μl and put it into an Eppendorf tube (1.5 ml, siliconized). Add to this 1μβ p B R32
2 (oligo(dG) + o-totailed), mixed, and heated to 68°C.

After treating for 5 minutes, it was transferred to a constant temperature water bath at 43°C and kept warm for 2 hours.

The thermostat is switched off and the tubes are stored at 4° C. after cooling to room temperature for at least 2 hours (or may be left overnight).

Vi) Transformation (transformation)D
According to the method of Agert and Ehrlich, a transformation efficiency of 8.2 Xl06 to 1.4 to 10' transformants/μg+) BR322 DNA was obtained using RRI as a host.

(4) ff2p-labeled cDNA for the enriched fraction of glycinin intermediate subunit 7 mRNA of (2) is prepared and used as a probe.

(5) Glycinin subunit clones are selected from the cDNA library of (3) by colony hybridization using the probe prepared in (4) above. 22 out of 1023 clones were positive.

6) From the 22 clones obtained in (5) above, select clones (16) with an insert length of Ikb or more and insert "p"
ositive hybrid 5 selection
and 1nvitr.

Glycinin cDNA by “translation” method
A clone was identified. One of these had an insert of approximately 2 kb. As a result of Northern blot hybridization using this clone as a probe, the length of glycinin mRNA was approximately 2.2 kb, and the prepared CDNA was close to full length.

Glycinin A of the cloned cDNA
3B, the structure of the subunit cDNA was as shown in Table 1.

Example 2 The structure of another glycinin As Aa 83 subunit cDNA obtained in the same manner as in Example 1 was as follows:
It was a table structure.

Table 2 (Soybean glycinin AsAaBi CDNA...
・・・・・・・・・・・・＾、ACTTAATT、AT
TAACACTα￥工G! It's ugly. Bex. A′υ 工〜Tkix品act”6c!Kinjinjin.Samurai.BacIA″cc’：
at! Jf,hAs”6r!’XTr!’qla’dh
r? T! ! c is ^,,,<! ,,1GG9゜υc'd'
rc"dc4i.c"r'cc"￥cQ,zc'd'c
Base c) 'J bow^d7o base sequence). party. what. As story G1IC□-ppc! '＋'r
c"(:'T meter IC4)cAA'A'cc!"c+:J
7',=? xc'￥. late. List. Made by. Hit Tc'7. x♂
HirouT&. Hiyumi ^8C Wabi cA1'A'T flower C~. mine. Made by. A flower AJ'd', a, c'' (, yc?'d
',xc"r'rc5'c',=,,,4'+'rA string A how many AA'"A'. The members of the νυ squad. Hit, huff.

c 4'foTc”err c'X c Samurai., A, n
TJI, u. To the flowers, F.

c廓Tr2゜ATπT g弘c'2T! See♂υ儒9゜Ebe flower. &]A'cc"fTa"dc'Xh;"r!c
T! 'c'r, Pehi G. Death! View back c AI'r;,
B Giran ♂ Ran & Confucian Ran <X. , p;o, GIAIGJ Hiro J.
See Jf GJg see c party G♂vd look Te shameful. Ba. No.

<8AAAr, 3GAL 翫G 弘11p c, V%J o
, Th, r bow Q.

ftJAT to ACAACAAC medium GAAGATGA
(lFIA'A(!'Ap Yumit♂xT♂2..Ply,
a new! r,,G viewing Tl't! c-pMc'r3AAL
¥9c'Xh8'XA♂-＆G♂"Inc a'j:
%FF'CJ sheet music list ASMc4'4Aa'dAAL翫♂'c:, BrTc cleavage, i), g'dxc"fc sheet music & AcP vinyl ♂break. ＾りGJ＾转：1040 10 items a't: Aa'X A 4XA c"c'r J"X
A , = 'Metamen A c scabbard i,,'6 A r'c
h A”.

稗. AL Ranikko ♂ Kake & GAA Kouhiro T ♂ Exploration T ♂υaζ T hit λ♂〜G” (1' T c”d'c , a;%TX”6
Tαc c”36.jTc !Mc c!'vcorrect”g
c (!”I'C♂1Ala Gln Tyr
Vat aQoLeu. Nyr. Ay;;. A2.
, Gl,y, +1. p, ,7y0000AA1'2
1rJT0TTCUran9o13o.

AAs, nc, Sy, :: GI cTy, rTJV,
Product,,TIBg,♂'&xa'ti,ay:'Xha'
d'.

&Ttd"c'Ac"t'c ccTcJ'd"re"
,Scc'￥ffl,5υB,:"d'cc?effect.,5
1, a, I oGv,, l GG12GGg o to l,
n 0%, ~, G4'jl, +, , <1. ,y,,
['1ycG1AATcc"c'Ac"r'cTAs
``CRC silk resistance ￥cA'Kcc'2y, g'r'c appearance υ
Hibiki'crT recognition cAA'A"cc"? r%c'fc, aF
'Jrc', ', a? 6. g'r'c de e6. GIIt
, 3 T Samurai C female. )father. cP'cpT, 33 item invasion &
A
GnzocAccccXiT T A T G A r TGATAATAAAAAGTATGGCCCATGT
TCCC to ACC.

+760 1770
1780i:rTse. cf't, o. 17r
r? 4. Product ♂'&h l list 2"6c, 4赳FT(3,a
,c? ”,/T,=”r,=,c”c:,yc”chc
”gr,=”c'r,g,px'Zc(!”a politics caI
AuA♂moku c"Zhc new t!'X^4"! r1o^ Dede! CFt,',f,,TC'"/'!'Cback C"
I'High A'A. J'c'r,=? X6g'c'r! A
Female cCL\'C♂rc! In the c “A’ A”? ,xc”=”T%rTrSaba. , 52t”
adI,p.

toαTAl'CjAGl''lJT%rTcJ'f&c
, :”zse'a.

A'A fossaGc'\c a"la %Jto!'X c
rTBf,,\clluA梠c,a! 'F, c? 'r
'AQ:, BA'rc, a, cAc, a, ccAc! a
North A A"I'T c"c'c! p-y! :'：
C key T J ¥5 Satsuma.

Claims (2)

[Claims] (1) Corresponding to soybean storage protein, obtained from soybean seeds and fractionated by sucrose density gradient centrifugation, 18S
Messenger RNA obtained in slightly heavier fractions. (2) A method for preparing messenger RNA, which corresponds to soybean storage proteins and is characterized by extracting and fractionating messenger RNA from soybean seeds, which is obtained in a fraction slightly heavier than 18S by sucrose density gradient centrifugation.