JPS60120991A - Enhancer base sequence - Google Patents

Abstract

PURPOSE:To provide the enhancer base sequence which is composed of specific three sequence units and has effect to increase the transcription efficiency from the promotor at the upper part of the V gene which has been allowed to come near by gene recombination. CONSTITUTION:The base sequence that contains the base pairs consisting of base units of formulas I , II, III and their complementary bases in their orders and has the total base pairs of less than 150, preferably less than 50. The base sequence increases the transcription efficiency from the promotor at the upper part of the V gene, when gene recombination is caused in the V, D, J genes which are human antibody genes located at the upper part. The resultant base sequence can be used by recombining into the gene which develops human H- chain protein or insulin or interferon genes.

Description

DETAILED DESCRIPTION OF THE INVENTION a. Field of Industrial Application The present invention relates to a base sequence having an enhancer function. More specifically, it relates to a base sequence having an enhancer function derived from a human antibody gene.

b. Prior Art Recently, research on antibody genes has been progressing, and the H chain in human antibodies is being elucidated. The first chain is the variable region (
It mainly consists of an antigen-binding site (called V) and a constant region (called C) that has physiological activities such as complement binding and interaction with specific cells. It is well known that it is formed.

In addition, the nucleotide sequence of antibody) W Butsu and the elucidation of its function are
A3 has made quite good progress regarding mouse genes.
In the vicinity of the variable region (V), ■ gene, D3
W gene and Jmm hanger are present, and there is a nucleotide sequence with B[1 motor function upstream of the V gene to transcribe these antibody genes, and the Jm hanger and constant region (
It was speculated that there is an enhancer, a base sequence that has the function of significantly increasing transcription efficiency, between C).
Published by Baifukan, Gendai Kagaku November 1983 issue 62-68
(see page).

This enhancer exists downstream of the J gene, and in the undifferentiated type, the promoter is far away, so it reduces transcription efficiency.
However, it is said that it has the function of causing recombination when the V-J gene and V-D-J gene recombine and increasing the efficiency of transcription from the promoter upstream of Vmm Jinshi. .

Regarding the enhancer in the mouse 1-1 chain gene, its nucleotide sequence has recently been determined by Schaffner (Walte).
3chaffncr) et al. (Cell, Vol. 33. 729-7110 J
(see Uly 1983).

Similarly, Yoshin Tone et al. also revealed the existence and nucleotide sequence of the mouse 11-chain genetic enhancer (Ce11. Vol, 33.717-728゜Jul
y 1983).

As described above, regarding the mouse 1-1 chain gene, both the variable region (V) and the constant region (C) contain various gene units, promoters, enhancers, etc. The units that determine the function have been investigated in detail,
The base sequences of some of them have also been determined.

On the other hand, regarding the 1-1 chain of human antibody genes, the constituent genes and their functions have been gradually clarified, and the existence of ``Nhan 1 No'' is presumed, but its entire nucleotide sequence and the nucleotides that express its function. The array unit is still unknown.

Therefore, the present inventors conducted research on the genes in the 11th chain of the human antibody gene, and found Vilff Futsuko.

The presence of a J-enhancer between the DI chain and Jmm chain and the constant region was confirmed, and the 7J11 base in front of the chain was identified, and its core nucleotide sequence was clarified.

Structure of the C9 Invention The present invention was arrived at based on these findings, and consists of the following base units 1. This is an enhancer base sequence containing at least base pairs consisting of [and (1) and complementary bases, respectively, in this order.

Unit L knee AAΔACAC 1 unit ■: -TCIGTTGTGAA 1 unit 111:
-GTGGTTTTG- [However, in each of the above units, A represents adenine, C represents cytosine, G represents guanine, and T represents thymine. ] The units constituting the antibody-derived enhancer base sequence are contained in the above order, and the direction of the sequence is such that the left side is the 5' end base, and the right side is the 3' end base. The base is shown. The units I, IT and ■
form a pair with each complementary base, and since these are included in the base sequence in this order,
The V iM chain D gene and JAm located upstream thereof
When Butsuko0 recombination occurs, the function to increase the efficiency of transcription from the promoter upstream of the gene, that is, the function as an enhancer, is overexpressed.

The enhancer base sequence of the present invention has the above-mentioned unit (2).

(1) and (2), the total SA certain logarithm can be about 150 or less, especially about 50 or less. In this way, even a relatively small number of base pairs shows its function.

As mentioned above, the research conducted by the present inventors revealed that the V gene, f) m-stripe and J
A nucleotide sequence with an empan 1 no function in 1t(4) between the ll Mitsuko sequence and the constant region (C) was excised, and the nucleotide sequence was
nd G! J was determined to be the standard method for (l berτ). Its base sequence is shown in FIG.

In FIG. 1, the base sequences (1) to (6) correspond considerably to the mouse enhancer base sequence, especially the intermediate 1. The nucleotide sequences II and ■ (indicated by underlining) contain the same units as/υ in the mouse empan 1 no nucleotide sequence.

Even if there is a slight base substitution, deletion, or insertion in the base sequence (1) to (6) in FIG. It belongs to the category of base sequences.

In addition, in FIG. 1, the jn group arrays from (2) to (5), especially the 1! from (3) to (4)! The iB sequence is also an enhancer-bearing sequence of the present invention. This 50 base sequence from (3) to (4) contains the units I, II and (2), and has the function of an enhancer.

The enhancer base sequence of the present invention is V3 as described above.
It has the effect of increasing the transcription efficiency from the promoter located upstream of 1ff Butsuko, and this effect is disused not only for genes in human antibodies but also for genes in antibodies of other animals.

According to the research of the present inventors, the enhancer of the present invention (
Well, it can be effectively used to express antibody protein in the sling. We proposed human antibody gene fragments that can be used with such antibody proteins to C.

The W Buddha fragment (proposed earlier) is based on the IN position of the salt kl (hereinafter abbreviated as 5') at the 5' end of the cleavage site by the restriction endomeclease FCORI of human chromosomal DNA containing the antibody gene. [Note (about 1.6 Kb from 115', about 0.33 Kb from the cleavable part by restriction endomeclease ΔatH to 5',
Approximately 0.
V gene, D gene and J i in the range +1 to 04
Units included in this order (Unit A) (2) 5' to approximately 7.9Kl] Limitation)
approximately 0 towards 5' from the part cleavable by 7-ze PstI.
, 69 K b , about 1.02 K toward 3' (7)
b (7) CT+M gene of flc[ul as a hanger unit (unit B) (3) A base sequence having a promoter function on the 5' side of the unit △, and (4) Between the unit A and the unit B It is a human antibody gene fragment consisting of a base sequence unit and a base sequence that has an enhancer function.

The V gene, the D gene, the JilN Butsuko, the Cr+Kandenshiromotor, and the 2nd enhancer in the Teibutsuko fragment are the genes or base sequences described below, respectively.

■Gene: Approximately 10 from the NH2 terminus of the immunoglobulin molecule
A gene encoding a variable region portion of 0 residues.

O gene: A gene located between the J31 gene and the V gene that encodes the most diverse part of the immunoglobulin molecule [e.g., J, Schillina, B,
Clevinger.

J, M, [)avi and l, Hoo
d.

Nature, 283.35' (1980)]J
A gene that encodes the connecting portion between the variable region and constant region of the 3m-stripe immunoglobulin molecule.

[For example, J, G, Seidman, E, E.

Max and P, l-eder, Nat
ure.

-υ4-, 370 (1979)] Crtiu gene: Approximately 33 minutes from the COOH terminus of the immunoretentive bulin Ll chain molecule.
0'II! One of the genes that encodes the constant region portion of the i group. T1 indicates the 1 (IG subclass 1 I) chain.

Promoter: A base sequence that has a signal function to initiate transcription from DNA to RNA.

Enhancer: A base sequence that increases the efficiency of transcription from the upstream promoter of the V gene during DNA recombination.

[See, for example, Toshio Nikaido, Tsuyoshi Honjo, Gendai Kagaku, -υKo-, 62 (1983)] In order to aid understanding of the human antibody gene fragment described above, the following will describe the human antibody gene fragment in detail using the accompanying drawings.

Figure 2 shows the antibody gene-containing human 1-chromosomal body f).
! Each unit existing between 5' and 3' and each IAJ, 41
1+: A column is schematically shown.

In Figure 2, 5' and 3' are the restriction endonucleases of chromosome D'NA to human 1, respectively.
The terminal base of the cleavage site of the cut-out fragment containing the antibody gene by Ri is shown, and the distance between 5' and 3' is approximately 21 in 1) (
211 (b±IKb). The position indicated by an arrow as △at■ on the excised fragment is the position that can be cleaved by the restriction endonuclease Aatn in the excised fragment, and is about 1.6 Kb from 5'.
It is located at (1,6Kb±0.IKb).

The unit Δ in the present invention is approximately 0.33 Kb (0,
'33. About 0.04 Kb (0,Q41(b±0.005 Kb) towards 3' from the point Kb±0,02 Kb
) (7) Approximately 0.37 Kb (0,37K
b ± 0.025) (b ). Inside this unit is the v gene.

It contains the D3u gene and the Jl gene, and is arranged in this order when viewed from 5'.

In addition, the location indicated by an arrow as PstI in FIG.
Restriction endonuclease ps in the excised fragment
This is the position where it can be cut by t■, from 5' to about 7.
It is located at 9Kb (7,9Kb±0.5Kb').

The unit B is cleaved by pstI, and from the cleavable site to the 5' direction, approximately 0.69 Kb (0.69 Kb±0
．． Approximately 1.02 K from the point 02 K11 ) towards 3'
b (approximately 1.71 Kb (1,71 Kb ± 0.05 Kb) to the point of 1,02 Kb ± 0.031 (h)
It has a length of This unit B is the so-called constant region (c
(instant region) Cr, contains a part called /v, CH1 region, h region when viewed from 5'.

It contains a CH2 region and a CH3 region in this order. Furthermore, the 3' side end of this single block B includes a stop godon.

Furthermore, in Fig. 2, P indicates a nucleotide sequence with a promoter function located on the 5' side of the unit △.
exists in unit A and unit 13.4. The figure shows a nucleotide sequence that has an enhancer function.

The human antibody gene fragment described above is composed of a base sequence (P) having a protein motor function, a unit A, a base sequence (E) having an enhancer function, and a unit 8 in this order.

The enhancer base sequence of the present invention is a base sequence having an enhancement function (E
)” can be used.

The antibody gene fragment having the enhanced base sequence of the present invention has the function of converting human diary protein, and can be incorporated into another vector to form a hybrid DNA.

Such vectors include, for example, Charon 4A
.

Charon 28. Phage vectors for E. coli such as λgtWES/λB; rlBR322, 1IBR32
Plasmid vector for E. coli such as 5゜pMB9; II
LJBIIO, '1) Blasumi for Bacillus subtilis like HWI 1
: Vector: Y E p13. pJ D B 21
9. Y Rp7゜Y R1116, Y j D5.
Yeast plasmid vectors such as Y I 932; 1
lsV2-(llt, plasmid vectors for animal cells such as DKSV-10; plasmid vectors for human cells such as pTiB6-806) (These vectors are shown merely as examples, and other vectors may be used. Needless to say, any vector can be used.

Thus, the enhanced nucleotide sequence of the present invention (as described in M, it can also be used by incorporating it into the gene expressing the human 1-H chain protein, and can also be used in place of the human antibody gene by other useful genes). By inserting , it can also be used for the expression of other useful genes. Examples of other useful genes include insulin gene, interferon gene, etc.

Examples are given below, using single strands of human chromosomal DNA.

Creation of human gene library, screening of human antibody genes, restriction of human antibody genes: Creation of 1-donuclease cleavage map, cloning of human antibody genes, and intracellular application of antibody genes to human antibodies are explained in detail. Riri.

Example 1. (1ill of human chromosomal DNA) Human cultured cells ΔR day 77 3 x 108 cells were crushed with a glass rod, treated with Protea-1K (manufactured by Sigma) in the presence of 2%81'S, and then 1011M T l'is 1-IC
Phenol saturated with I (8,0)-1 mM EDTA aqueous solution was added. The aqueous phase and phenol phase were separated by centrifugation, and the aqueous phase was diluted with 20mM T'ris l-lC.
R(1187,5) -100mMNa (J-5mM
Dialysis was performed against EDT△ aqueous solution. After treatment with ribonuclease A (manufactured by Sigma) and phenol extraction, 10n+M Tris f-lcf (p
8.0> - Dialyzed against 1mM EDT△ aqueous solution,
About 1.2111ff of chromosomal DNA was obtained from and 1 [N
, B11n and D, W.

3tafford, Nucleic Ac1ds Re
s., 3.2303 (1976)].

Example 2 (Human Gene Library) 150 μ9 of human chromosomal DNA obtained in Example 1 was partially digested with restriction endonuclease EcoRI (manufactured by Takara Shuzo) according to the method shown in Example 4 described below, and then digested with a sucrose density gradient. Centrifugation [sucrose 10-40% (wt/vol)
, 28000r, p, m, x15 hours, 20'C]
A DNA fragment of 4.3 microns corresponding to 15 Kb to 23 Kb was obtained. Next, this DNA fragment 0.8μ7 and C
har.

n4A vector [F, R, E31attner, B
, G.

Williams, A.E., Blechl, K.D.T.
h.

mpson, I-1, E, Faber, l-, A,
Furlong, D.

J., Grunward, D., O., Kiefrr, D.
, O.

Moore, J, W, 3chumm, F, l-
,5heldonand O,Sm1tl)ies,5
science, 196. 161 (1977) Reference 1 Which ligation is performed and R1Qh of the Charon 4A vector
Hybrid ON8 in which Nicht-derived DNA was inserted between t-al'n+ and 1-ert-arm is 4E4 t=
.

T4-DNA Rigger U (manufactured by Beresda Lileach Laboratories) was used for the ligation, and the ligation reaction was performed using 66 m
M Tris-HC9 (7.6) -6.6mM
MgCf 2-10111. M dithiothreitol-1
The test was carried out in an aqueous solution of mM AT'P at 11°C for 72 hours. Depressed hybrid DNA, in
Vitro Packaging [A, Becker an
dM, Gold, Proc.

Natl, Acad, Sci, U, S,, 72.
581 (1975)] was carried out, and a human gene library (1,8 x 10 PFU/μg, 9
(including 9% nozzle top) and 1 piece.

Example 3. (Screening for human antibody genes) Charo containing the human-derived DNA 1q in Example 2
A collection of n4A phages (gene library) was infected with Escherichia coli LE392 strain to form plaques. The line containing the human antibody gene is Benton et al.
avis plaque hybridization method [W,
D. Benton and R.W. Davis
, 5science, 196. 180 (1977)
C1l''2pl-labeled human antibody H chain J using reference 1
I selected If< with 31 genes. Ch containing human antibody genes
Preparation of DNA from T. aron 4A phages
homas [)avis I no law [M, Thom
as and R, W., Davis, J.;

Mo1. Rial, 91. 315 (1974)
This is done by referring to [Reference].

Example 4. (Creation of restriction endonuclease breakpoint map) Charon containing the human antibody gene obtained in Example 3
4A DNA 1 μ9 restriction endonuclea 1! Digestive buffer [Fco R1, Mlul, 5p
hf, 50 niM Tris-1c1 (pI
-1γ, 4) -100mM Na (1-10mM M
o So4 aqueous solution, AatlT, AvaT, Bam
Hl, 3st Elf, Hind IIl, Pstl
, 10mM TriS-HC9 (
pl-17,5>-60mM NaCj-7mM
MgCP2 aqueous solution was mixed with 10mM T for BqlIr digestion.
ris-1-ICf (17,4) -10mM
IVN) 804-IJyl aqueous solution and 10mM Tris- for HpaI digestion.
1-1cN (pl-18,0) -20mMKCR7
An aqueous solution of 27 mM MgCR and 2-mercaptotanol was used in each case. ] 2 oll wheat, restriction endonuclease (△at[ is manufactured by Toyobo, Ava■
is manufactured by Bethenda Lileach Laboratories, Inc., Bs
t Elf, 5IlhIL; t New In' 1 manufactured by Land Bio-Labs, and others manufactured by Takara Shuzo. ) 2 units were added and digestion was carried out at 37°C for over 1 hour. In addition, when performing digestion with two types of restriction endonucleases, first treat with a restriction endonuclease that acts at a low salt concentration, then increase the salt concentration to a predetermined concentration, and then use a restriction endonuclease that acts at a higher temperature of 12.6 degrees Celsius. treated with restriction endonuclease.

After digestion with restriction endonucleases, 0.2μ of 4μ
5% Bu[]mof: [Norblue/50% glycerol aqueous solution was added, and 0.8% to 2.5% Aga 11-sgel electrophoresis was performed. The agarose used was Sigma's type ■ for electrophoresis. As an electrophoresis breader, 40
mMT ris-CI-13COOH (pi-18,
0) Ita for AZkffill&'& under -1mM ED.

6.~9 V/c in the vertical gel of jI no Sa 2 Asahi Z
Electrophoresis was carried out at a voltage of m for 15 to 3 hours. During this electrophoresis, I) As a molecular weight marker for the N△ fragment, λfi-shi DNA was used in l-1indllll (manufactured by Herlinker Mannheim). After the electrophoresis was completed, , 2μ of DNA in Aka11-Sgel
'j/mQI busium bromide aqueous solution was stained,
This gel was illuminated with S.1C long wavelength ultraviolet light to observe the digestion pattern. By analyzing the digestion patterns of various restriction endonucleases alone and digestion of two types of restriction endonucleases V together, we determined the relative positional relationship of the cleavage points of each restriction endonuclease, as described below. It was determined.

Example: [Human 1 ~ antibody gene glue cloning (promoter region, V-/D-Jl region).

3.4 Kb-[tricoRl
/ It ind III fragment and plasmid for E. coli
rlBP322 Which hybrid DNA) 1 Hi 1 ~ Charon 4 containing antibody gene
A3 μl was digested with restriction ■ indomeclease l-1ina [[ and EC0RI] according to the method of Example 4, and A3 μ
]-Sgel electrophoresis (glue concentration 0.8%) was performed.

A band corresponding to a 3.1 IKb portion of DNA including the promoter region, V-D-J region, and enhanced region was cut out, and the agarose gel fragment was separated by 3x ffl (v
ol, /wt, ) in 8M NaCfO4 aqueous solution. Chen and Ding 1) Omas glass filter removal [C, W, Chen and C, △,
l-bomasJr, △nal, F3 iochem
, 404.399 (+980) ], -3,
The DNA fragment of 41(b) was recovered from agarose gel.

On the other hand, plasmid for E. coli 1) BR3221μ9 was added to Example 4 using QLjiC restriction endonuclease l-1ind.
0.5 units of alkaline small sphatase (F, colic75) (manufactured by Takara Shuzo) was added to the digested product with H and coRT, and the mixture was reacted at 45°C for 1 hour. After the reaction is complete, the alkali 11 and 1\ in the reaction solution
Fuco to inactivate and remove sphatase. The nol extraction was repeated three times. pf3R3 obtained in this way
22 1-find III/FcoRI/Alkaline Bosphatase Treatment II! The liquid was collected from the gel in 3 and 4
1) Mix with the fragment aqueous solution, precipitate with ethanol, and dissolve in 50 μp of ligation reaction buffer (see Example 2). Two units of T4-DNA ligase were added and the mixture was reacted at 11°C for 12 hours to obtain hybrid I')NA.

Transformation of E. coli strain C600 is carried out using the usual CaCf2 method [
M., V., Norgard, K., Keen an.
d J, J.

Monaham, Gene, 3. 297 (1978
)] was carried out using an improved method. That is, 5d L-broth (1%! Lipton, 0.5% yeast extract, 0.5%
Nacj.

11117.2) with an 18-hour culture medium of E. coli strain C600 and grown to an optical density of 0.3 at 600 μm. Magnesium buffer i 0.IM Na CR-5mM MOCjz -
5mM Tris-N(J (pl-17,6,0℃
)] and washed twice in 2 mQ of cold calcium buffer [100n+MCa CN2-250mM K
Cl-5mM MQ (Jz-5mM]1・is-
It (J (all 7, 6.0℃)) and incubate for 25 hours at 0℃.Next, the bacterial cells were diluted to 1/10 of this amount in calcium buffer. Mix the hybrid DNA aqueous solution 2:1 (vol, : vol,). After keeping this mixture for 60 minutes at 0°C'C'', add 1mf!
of l-1”3 G-broth (1% 1~rib 1~n, 04
i% yeast extract, 1% NaCf, 0.08% glycose.

pH 7.2) and culture at 37°C for 1 hour. The culture solution was mixed with selective medium (ampicillin 30 (1':l/
1--broth spray 1~) containing mQ 100μ/
Inoculate in play 1. The plates are incubated overnight at 37°C to grow the transformants. From the obtained colonies,
l') NA was prepared using a known method and subjected to agarose gel electrophoresis to confirm the desired hybrid DNA.

The thus obtained approximately 3.4 Kb [coRT/It
The restriction of the hybrid DNA obtained by introducing the 1ndI fragment into E. coli pB R322 is shown in FIG.

Example 6. (Determination of DNA base sequence) Human antibody gene I' chain region and ] = 1 chain enhancement r
N II (7) Yi base sequence is Max -
Gibert method [A. Maxam and W
．． Gilbert, Methods FnzymO
1. , Gen, 499 (1980).

For the second example, approximately 50 Ilg of the TITJ3 DNA prepared in Example 5 was digested with BStEII according to the method of Example 4. Obtained DNA
The fragment was dephosphorylated with alkaline phosphatase and
It was labeled with [γ-32p1ΔTP] using polynucleotide kinase (manufactured by P-1-by-A Chemicals) 5 conits. Polynucleotide Kina-1 reaction was carried out at 50mM 1-
ris -HCj (pl-1 9.5>-10m
The test was carried out in an aqueous solution of MMU Ci2-5mM dithiothreitol, and 100 pCi of [γ-321)]ATP manufactured by Amersham was used. The 32p-labeled DNA fragment was
After digestion with lpaI, the desired DNA fragment was separated by polyacrylamide gel electrophoresis (gel concentration 5%).
Extraction from the gel was performed. ObtainedttZ. =32p-labeled to BstEI[/HpaI fragments were subjected to each base-specific h partial decomposition reaction and separated by polyacrylamide gel electrophoresis (gel compatibility 8% to 23%) containing 7M urea. 2. After A-radiography was performed at -80°C for 7 days, the degradation pattern was analyzed and used as evidence for determining the base sequence of the enhanced region.

On the other hand, when pTJ3 was digested with Aatll, the 3′
Using an end labeling kit (Amersham?lJ),
α-3211 ] ddATP labeling was performed.

After digesting this 32p-labeled 1') NA fragment with Bam+-IIr, the desired DNA fragment was separated and recovered by polyacrylamide gel electrophoresis (gel depth 5%).
C. The resulting 32llI-labeled-ΔatII/B
The aml-II fragment was also analyzed according to the above procedure and was used as a reference material for determining the FA group sequence of the D region.

In this way, a base sequence containing at least the one enhanced base sequence of the present invention shown in FIG. 1 was determined.

[Brief explanation of the drawing]

Figure 1 shows the base sequence in the vicinity of the 11th chain of the human antibody gene containing the J-31 chain, and Figure 8112 shows the sequence of the restriction 1 chain of the human chromosomal DNA containing the antibody gene. This figure shows the cleavage site by nuclease EcoRI, the units existing between them, and the base sequence.
1 shows a restriction endonuclease cleavage map of one small DNA fragment obtained from NA. 1 plane k? Figure 1↓ 5-TTGGCGAGCTGGAAGCAGATGAT
GAATTAGAGTCAAAGATGGCTGCATG
GGGGTCT'CCGG'CACCCACAGCAG
GTGGCAGGAAGCAGGTCACCGCGAG
AGTCTAT DingTTAGGAAGCAAA'AAAA
CACAATTGGTAAATTTATCACTTCDINGGGTTGTGAAGAGGTGGTTTTG'CCA
GGCCCAGATCTGAAAGTGCTCTACT
GAGCAAAACAACACTTGGACAATTT
GCGTTTCTAAAA'TAAGGCGAG (5) G'CTGACCGAAATCGAAAGGCTTT
TTTAACTA King CTGCAATTTC'ATTTC
CAATCTTΔGCTT4e. Wow. ■. . Air A. Eh. . (3. Figure 3 Procedural Amendments July 1980//day 1 Temple Yoshigo Agency Director's White House 1, Indication of Case Patent Application No. 58-229037 No. 2, Title of Invention Enhance → No Base Sequence 3 , Person making the amendment (300) Representative of Teijin Ltd. Sa Okamoto Part 4 (1) Revise the scope of the claims as shown in the attached sheet 1. (2) Change the title of the invention on page 1 of the specification to 1-] (3) Corrected the lines 9 and 11 on page 2 of the same page to read ``Nucleic acid base sequence.'' (4) Page 5 of the same page. r I) N A for the “base unit” in line 5
base (hereinafter sometimes simply abbreviated as ``base'')''. (5) Change “base pair” on page 5, line 6 to “1) N△base pair 1
I am corrected. (6) "Enhancer-1j Jl array 1" on page 5, line 7
is corrected as [enhancer-nucleobase sequence]. (7) On page 5, lines 11-12, “[However, △
is atenine, C is cy1-syn, G is guanine; -NJ thymine to] J is 1 [However, in each of the above 11417, A is deoxyadenosine-5'-phosphorus M! i, C is de J2 l =
Cycytidine-5'-phosphorus M, G is deoxyguanosine-
5'-phosphoric acid, ]-indicates] theogycythymidine 5'-phosphorus. 11 Do old 11-Rir. (8) Page 6, lines 4, 11, 12, 14, 1
"Nucleic base sequence" in lines 6 and 19 are corrected to "Nuclear IS! base sequence." (91rffil, page 6, lines 5 and 7, “Number of base pairs 4
are corrected as "rDNA base pair number, respectively." 00) “Base sequence” on page 7, lines 4, 8, and 11
Correct each to ``nucleic acid base sequence.'' on page 7, line 16, ``enhancer'' on line 17 [
Enhancer - nucleobase sequence]. 02) 2nd line of the 9th page and 2 lines from the bottom of ``rcr+Denshi'' respectively [Cγ13! Correct it to Denden-1. 113] 1ii1, page 10, line 1, rcr l M gene-1 is subjected to rc7+ gene gene pressure. 04) Correct "single base sequence" on page 10, line 8 to "nucleic acid base sequence." 05) Change rCr I J on page 12, line 4 to rc7+ J
I am corrected. 06) Lines 10, 12, 14, 15, and 17 on page 12. Correct "base sequence" in lines 19 and 20 to "nucleic acid base sequence" respectively. 0 force, page 13, line 17, ``delta base sequence 1 is referred to as ``nucleoacid base sequence''. 0 (() Attachment A) Figure 1 of the drawings has been corrected to Figure 1 of the attached sheet. 2. Claim 1: The following DNA base (hereinafter abbreviated as "base") units I, TI and ■, and each of them DNA consisting of complementary bases
An enhanced nucleic acid J radical sequence containing at least base pairs in this order. Unit T: -AAAACAC- ili position 1r: -TGGTTGI-GAA-2, the enhanced nucleic acid i according to item 1, having a total [)NA base pair number of 150 or less! i-based array. 3. The enhanced nucleic acid base sequence according to item 1, wherein the total DNA number is 50 or less. 4. Cutting site (1) to cutting site (6) in Figure 1
The bases up to and the more complementary bases J: S<K DN
Enhancer 2 core 1111 composed of A Shiofusu 1
Base sequence. 5. Figure 1 shows the diagram from J'+Rir cleavage site (2) to cleavage site (
5) bases up to and more complementary 1! W, J,
Rinaru l) Ding Hanley nucleate star array composed of N△J Fu Kiwen J. 6. From the cutting site (/I) in Figure 1, the 12iiiiii of the cleavage site (/I) and the more complementary base J: S<krul) N△''λ8 base pair J ,su(1
4-generated 1L Nhanley nucleobase sequence. Figure 1 5'-TTGGCGAGCTGGAAGCAG'ATG
ATGAATTAGAGTCAAAGATGGCTGCA
TGGGGGTCTCCGG'CACCG:ACAGC
AGGTGGCAGGAAGCAGGTCAC↓ CGCGAGAGTCTATTTTAGGAAGCAA
AAAA△GAAAGTGCTCTACTGAGCAA
AACAACACTDingGGACAATTTGCGTT
CTAAAATAAGGCGAG(5')

Claims (1)

[Scope of Claims] 1. A Hanley base sequence containing at least IW1 base pairs consisting of the following base units I, If and ■ and their respective complementary bases in this order. Unit I Knee AAAACAC One Unit Ir: -TGGTTGTGAA One Unit I[[:
-GTGGTTTTG- [However, in each of the above units, A represents adenine, C represents cytosine, G represents guanine, and T represents thymine. ] 2. The enhancer base sequence according to item 1, which has a total number of base pairs of 150 or less. 3. The enhancer base sequence according to item 1, which has a total number of base pairs of 50 or less. 4. From the cutting site (1) to the cutting site (6) in Figure 1 ().
) and a more complementary base pair. 5. Cutting site (2) to cutting site (5) in Figure 1
An enhancer base sequence is composed of base pairs consisting of the bases up to and the bases complementary to the bases. 6. From the cutting site (3) in Figure 1 to the cutting site (/I
) and the complementary base J: Enhanter base sequence composed of base pairs.