JPS58189197A - Novel dna and its use - Google Patents

Abstract

PURPOSE:To massproduce human immune interferon (I-IF) having activity to resist cell propagation and high antitumor activity inexpensively, by cultivating a host which is transformed by a novel DNA containing a basic arrangement coding human I-IF polypeptide. CONSTITUTION:A cell to secrete human I-IF such as human peripheral blood lymph cell, etc. is cultivated, mRNA coding human I-IF is separated from the cell, and cDNA is synthesized using mRNA as a template. A double-chain DNA converted from it is integrated into a plasmid, and a plasmid having DNA containing the desired basic arrangement shown by the formula (X is TAA, TGA, or TAG) is obtained from a culture mold of a host which is transformed by the recombined plasmid. If necessary, the desired cloned DNA is cut out from the plasmid, and connected to the downstream of a promoter (preferably trp promoter, or PL promoter) in a vehicle.

Description

DETAILED DESCRIPTION OF THE INVENTION The present invention provides a DNA containing a base sequence encoding a human immune interferon polypeptide, a host transformed with the DNA, a method for producing human immune interferon using the host, and a method for producing human immune interferon using the host. Regarding vine interferon.

Interferon (hereinafter sometimes abbreviated as Ig)
is a protein produced by cells of higher animals when stimulated by viruses, nucleic acids, etc., and has antiviral effects,
It has antitumor effects.

It is currently known that there are three types of human IP', α-type, β-type, and γ-type, with different properties.
The γ-type and β-type are induced by viruses and nucleic acids, and the γ-type is induced by Mit-Chef.

Research on type a rr (hereinafter abbreviated as IF'-a) and β type F (hereinafter abbreviated as F-β) has been relatively completed, and their production mechanisms have also been elucidated. Furthermore, with advances in genetic engineering technology, IF'-a and IF-β1 can now be transformed into IP'-β by culturing Escherichia coli.
1 became able to be obtained in large quantities as biologically active proteins by culturing yeast (G
oeddel.

ny, et al., Nature, 287.411 (198
0), Yel ver-ton, E, et al., Nuclei
c Ac1ds Res, Dan, 731 (1981)
, Goeddel, II V, et al., Nucleic
Ac1daRes, 8.4057 (1980), H
ltzeman, R. et al., Nature%293.
717 (1981)). Furthermore, attempts have been made to mass produce them for clinical application.

R-type IF (hereinafter sometimes abbreviated as IF-r) is produced by immunocompetent cells under conditions where lymphocyte blastogenesis and lymphokine production occur. (Sometimes abbreviated as IF). AE-F is said to have higher anti-cell proliferation activity and anti-tumor activity than IF'-β and F-a, and is highly expected from the standpoint of clinical application. However, due to constraints such as the need for fresh lymphocytes for its production, an efficient production system for RA has not been established to date. Furthermore, in different experimental systems, it has been suggested that different cell types may produce different molecular types of I-IF9, and many points regarding its structure and properties remain unclear.

On the other hand, since IF has high species specificity, human-derived II' must be used for human applications. However, human immune interferon is difficult to produce, so clinical application is currently impossible.
There is a desire for the development of a technology that can easily mass-produce I-IFl (with high purity) at a lower cost.

The present inventors utilized genetic engineering technology to develop human I-I
F gene was cloned and the obtained recombinant D)11
The present invention was completed as a result of research and development of a technology that can obtain the desired I-IF by transferring the molecule into a host and expressing the I-IP'' gene.

That is, the present invention provides a DNA containing a base sequence encoding a human immune interferon polypeptide, the Dll
The present invention provides a method for producing human immune interferon or a polypeptide equivalent thereto by culturing a host transformed with iA and a host transformed with the DNA, and a novel interferon that can be produced by this production method. .

The DNA of the present invention is (5') TGT TACTGCCAG GACCCA
TAT GTAAAA GAA GCA GAA A
ACCTT AAG AAA TATTTT AAT
GCA GGT CAT TCA GAT GTA G
CGGAT AAT GGA ACT CTT TTC
TTA GGCATTTTG AAG AAT T'G
Gmumu A GAG GAG AGT GACAGA
AAA ATA ATG CAG AGCCA
A ATT GTCTCCTTT TACTTC
AAA CTT TTT AAA AACTT
TAAA GAT GACCAG AGCA
TCCAA AAGAGT GTG GAG
ACCATCAAGGAAGACATGAAT
GTCAAG TTT TTCAAT AG
CAACAAAAAG AAA CGA GAT
GACTTCGAA AAG CTGACT
AAT TAT TCG GTA ACT
GACTTG AATGTCCAA CGCAA
A GCA ATA CAT GAA CT
CATCCAA GTG ATG GCT G
AA CTG TCG CCAGCA GCT
AAA ACA GGG AAG CGA
DN containing the base sequence represented by AAA AGG [in the formula, X represents TAA, TGA or TAG]
It is A.

The DNA represented by formula (I) is (N) Cys Tyr Cys Gin Asp P
ro Tyr VanLye Glu Ala Glu
Asn'Leu Lys LySTyrPhe As
n Ala Gly Hls Ser Asp Val
AlaAsp Asn Gly Thr Lau P
he Leu Gly ll5Leu Lya Asn
Trp Lye Glu Glu Ser AspA
rg Lya 11e Met Gin Ser
Gln rle ValSer Phs T
yr Phe Lya Leu Phe L
ya AanPhe Lya Asp M8p
Gln Ser Ile Gln LysSe
r Mal Glu Thr Ile Ly
s Glu Asp MetAan Val
Lys Phe Phe Asn Ser
Aan LyaLys Lys Arg As
p Asp Phe Glu Lya LeuTh
r Aan Tyr Ser Val Thr
Aap Leu AsnMal Gln A
rg Lya Ala 工１e Hls GL
u LeuIce Gln Mal Met
kla Glu Leu Ser Pr.

Ala Ala Lys Thr Gly Ly
s Arg Lya ArgSer Gln M
et Leu Phe Arg Gly Arg
ArgAla Ser Gln (c)
It encodes a polypeptide represented by (II) or a polypeptide that exhibits immunological or biological activity equivalent thereto.

The above DNA (1) has Da ATG AAA TAT ACA AGT TAT at its 5' end.
ATCTTGGCT TTT CAG CTC
TGCATCGTT TTG GGTTCT CT
It may have T GGC3' (N) or ATG (IV).

DNA indicated by (II) at the 5' end of DNA (I)
When having A, in addition to the polypeptide (If), (I
Met Lya Tyr Thr 5 at the N-terminus of I)
erTyr Ile Leu Ala Phe Gln
Leu Cya l1eVal Leu Gly S
er Leu Gly or a polypeptide having an equivalent activity, and the DN
When A(I) has the DNA shown by (IV) at the 5' end, in addition to polypeptide (n), a polypeptide having Met at the N-terminus of (II) or a polypeptide having an activity equivalent to this is added. encodes a peptide.

It is preferable that DNA (I) is linked downstream of a promoter, and these promoters include tryptophan (trp) promoter, bacteriophage-derived humuda (λ) PL promoter, and fuctose (la
c) Promoter, protein chain elongation factor Tu (tuf
B) promoters, etc., and trp promoter and Pr promoter are particularly preferred. P.L.
The promoter is a very effective promoter and λo
It can be efficiently and easily regulated by the I repressor. When a mutation occurs in the gene that controls the repressor, for example crts2 or cIts8
At 57, the repressor becomes temperature sensitive, at 3°C.
However, it becomes inactive at about 37°C to 42°C. Therefore, at 30° C., the λPL promoter is repressed (closed state), and at 421E, the repression is released (open state). This feature is desirable in cases where the product of the gene is harmful to the bacterial cell or when the product is harmful to the growth of the image when produced under strict conditions. By utilizing this regulatory mechanism of the PL promoter, it is possible to culture at approximately 30°C to 37°C without expressing the gene product, and at an appropriate time the temperature can be increased to approximately 37°C.
It is possible to produce the desired gene by changing the temperature to 42°C.

Among the oligo DNAs represented by X in general formula (I), TAA is preferred.

The meanings of the symbols used in the drawings and claims are as shown in Table 1 below.

Table 1 DNA Deoxyliponucleic acid A Adenine T Thymine G Guanine C Cytosine RN Muribonucleic acid dATP Deoxyadenosine tauphosphate dTTP
Deoxythymidine triphosphate dGTP Deoxyguanone-tamaphosphate dcTP Deoxycytidine-tamaphosphate ATP Adenosine triphosphate EDTA Ethylenediaminetetraacetic acid SDS Sodium dodecyl sulfate Gly Glycne Ala Alanine Val Valine Leu Leucine 1e Isoleucine 3ar Serine Thr Threonine Cya Cystine Met Methionine Glu Glutamate M8p Aspartate Lya Lysine Arg Arginine Hls Histidine Phe Phenylalanine Tyr Tyrosine Trp ) Liptophan Pro Proline Asn Asparagine Gln Glutamine DN of the present invention containing the base sequence represented by formula (I)
A can be produced, for example, as shown in (a) to (s) below: (1) Cells secreting human knee IP, such as human peripheral blood lymphocytes, are cultured.

(b) From that cell to h) Messenger RN that encodes I-IF
Separate A.

(c) Synthesize single-stranded complementary DNA using the messenger RNA and reverse transcriptase.

) Convert the complementary DNA into double-stranded DNA.

(e) Incorporate the resulting double @ DNA into a plasmid.

(f) This recombinant plasmid is introduced into a host such as Ozen or dried grass for transformation.

(g) Target D from the bacterial cells obtained by culturing the host.
Monolayer the plasmid containing NA.

Example If desired, the desired cloned DMA is excised from the plasmid.

(b) If desired, the cloned DNA is ligated downstream of the promoter in the vehicle.

The human peripheral blood lymphocytes used here may be either non-sensitized cells or sensitized cells.

The I-(F@) agent used in the present invention may be any agent that induces the production of human lymphocyte I-IF. For example, phytohemagglutinin (PHA), concanavalin A (ConA)
, Staphylococcal enterotochinin A (SEA),
/ iraminidase gafuctose oxidase (NAGO)
, 12-0-tetradecanoy μphorbol-13-acetite (TPA), etc., and these can be used alone or in combination.

Induction of I-IF is achieved by incubating cells with RPM Nee 1640 medium or ME.
This can be carried out by culturing in a medium known per se, such as M medium, but RPMI-1640 containing fetal bovine serum is preferable.
At 38°C, the culture time is 12 to 72 hours, preferably 22 hours.
It will last for ~26 hours. The cells were collected in a manner known per se and treated with R,1Vase inhibitors such as guanidine thionanide, bentonite, heparin, polyvinyl/L
'Sulfuric acid, aurintricarboxylic acid, vanadium complex,
Diethylpyrocarbonate (DPC), sodium dodecyl sulfate (8DS), etc. were added, and then N-turoylsarcosinate sodium, Tween 80, Nonidet P-40, etc. were added to lyse the cells and RN.
Extract A. If necessary, pheno-, pheno-chloroform, etc. are added to this RNA-containing extract, and the extraction procedure is repeated nine times. Afterwards, the RNA is collected by ethanol-μ precipitation.

Most of the mRNA present in the cytoplasm of the true capsule cells is
'Bo' JAgk at the end! Since poly(A) RNA is known to have a sequence, we next collected poly(A) RNA using oligo(a) hexa-rose, poly(U) Sepharose, etc., and separated it by sulfur sugar density gradient centrifugation. %/(Xenopas 1aevi
C Gurdon injected into the oocytes of s) to cause translation.
, aT., B. et al., Naturs, 1st edition, 177 (
(1971)), the antiviral effect of the resulting protein can be assayed, and a portion of I-I'F can be obtained. It can also be purified using ' For the obtained mRNA fp type, a complementary DNA (cDNA) strand is synthesized by a method known per se using, for example, reverse transcriptase, and the cDNA is converted into two strands of dll DNA (Maniatis, T. et al., Ce1l, 8,163
(1976)).

This DNA is conjugated with, for example, dG-dC or dA-dT homopolymer binding method (Nelson%T, 8, Metho
da inEnzymology%68.41 (19
79), Academic Press Inc.
New York: ], for example, pfusmid pBR.
322 into the Pst or 8ph I restriction endonuclease cleavage site. For example, E. coli 1
1776 strain and transform it, chemically synthesize an oligonucleotide having a base sequence thought to correspond to the amino acid sequence of the 1-IF polypeptide, and then fuse it with 32p to form a prologue. Colony hybridization method known per se [Gruns
tein%M-and Hognesa, D@S
,,Proc, Natl, Acad, 8ci+ US
A, 72.3961 (1975)], clones obtained from among the nine tetofcycline-resistant or ampicillin-resistant transformants that have already been obtained are subjected to secondary screening.

The nucleotide sequences of clones that were positive by this colony hybridase VW assay were determined using, for example, Mazam-G
11bert method (MaXamb, M, &G11b
ert.

”W, Proc-Natl, Acad, Sai, U
SA, 74.560 (1977)) or 7AjiM
Method for dinucleotide synthesis chain termination using ll (Mes
sing, J. et al., Nucleic Acids Ee
The presence of the I-IF gene is confirmed by the method of I-IF gene. Next, all or part of the knee gene can be extracted from the obtained clone, ligated downstream of an appropriate promoter and 8D (Shine and Dalgarno) sequence, and introduced into an appropriate host.

Examples of the promoter include the promoters mentioned above, and examples of the host include bacteria such as Escherichia coli and Bacillus subtilis, and B./I.
E. coli (294, W3110, etc.), and 294 are preferred, although other images may be mentioned, such as /#/I.

In addition, E. coli 294 is a known bacterium (Backman, K.
.

et al., Proc. Natl., Mucad-Sci, US
A%ll, 4174 (1976)) and the Institute for Fermentation (Institute for Fermentation).
ntation-0saka) to Ili'0-1
It has also been deposited as No. 4171.

Transformation of a host with the DNAK of the present invention can be carried out, for example, by a known method (Cohen, SN, et al., Proa-Natl.
Acad.

Sci. USA, 69, 2110 (1972)).

The host obtained in this way is cultured in a medium known per se, and the culture is given the general formula (%) [wherein Y is (a) hydrogen, (bj Met or (c
) Met LyaTyr Thr Ser Ty
r Ile Mula Phe Gln Leu
Cye 工 le Val Leu Gly Ser L
The compound (■') can be produced by producing and accumulating a compound represented by eu Gly ] and collecting it.

Examples of medium include M containing glucose and casamino acids.
9 medium (Miller, J. Experiments
inMolecular Genetics, 43
1-43:a (ColdSpring Horbo
r Laboratory, New York, 197
2)]. If necessary, a drug such as 3β-indolyl acrylic acid can be added to make the dibromotor work efficiently.

Cultivation is usually carried out at 15 to 43'C for 3 to 24 hours, and aeration and stirring may be added as necessary.

When using a recombinant that has the λcI repressor and an expression vector containing the PL promoter, culture is performed at a low temperature of about 30°C to 36°C, and inactivation of the λC ellipressor is carried out at a temperature of about 37°C to 36°C. Preferably it is carried out at 42°C.

After culturing, the bacterial cells are collected by a known method, suspended in a buffer solution, and then treated with ultrasonication, lysozyme, freezing/thawing, or a combination thereof [for example, Gu
nsalus, ”Extraction of Enz
yme from Microorganisms”,
Methods in Enzymology, 1,
51 (1955)) and centrifugation to obtain a supernatant.

Isolation of I-F from the supernatant can be carried out in accordance with commonly known protein purification methods.

Knee IF produced according to the present invention or a polypeptide having immunological or biological activities equivalent thereto exhibits immunological and biological activities equivalent to I-IP produced by conventional methods. , can be used for similar purposes and in a similar manner.

l-11i' is anti-viral, anti-inflammatory, and inhibits cell growth.

Has immunosuppressive effects. The compound is sterile water.

Mixing with a sterile, pharmaceutically acceptable carrier known per se, such as human serum apmin () [8A] and physiological saline,
Can be administered orally or applied topically. 1 of this I-IF
The daily dose for adults is about 10 million units (M, U, ) to 100 M, U, preferably about 5
0 M, U, ~60 M, σ. This I-IF preparation may contain pharmaceutically acceptable additives such as salts, excipients, adjuvants, carriers different from those mentioned above, buffers, binders, surfactants, preservatives, etc. . Injectables can be used as ampules of aerobic solutions or suspensions with water or other pharmaceutically acceptable liquids, and black powder preparations (freeze-drying the A.F. solution) can be used. preferable.)
may be filled into ampoules and simultaneously diluted with a pharmaceutically acceptable liquid.

The formulations of the present invention may further contain active substances that can be combined with I-EF, such as interferon derived from lymphocytes or fibroblasts, in an amount in the range of FJl-99% of the amount of knee IF.

The present invention will be explained in more detail with reference to Examples below, but these are not intended to limit the scope of the present invention.

Example 1 (1) Isolation of mRNA encoding Knee IF Lymphocytes prepared from human peripheral blood were isolated from 12-0-tetofudecanoy~phorbo/I/-13-acetate (TPA) (
15ng/ml) and concanavalin A (40ttg,
7'd) was cultured at 37°C in RPM Nee 1640 medium (containing 10% fetal bovine serum) to induce I-IF, and after 24 hours, the induced I x 10'' human lymphocytes were cultured. Thioguanidine denaturation solution (5M guanidine thiocyanate, 596 mercaptoethanol, 50
After disrupting and denaturing with a teteflon homogenizer in mMTris4tc1 (pH 7,6, 10mM solution), N-lauroyl-zap sodium cosinate was added to a concentration of 451, and the homogenized mixture was added to a 5.7M cesium chloride solution (5.7M chloride). Cesium, 0.1 M ethylenediaminetetraacetic acid (EDTA)) was overlaid on SsJ and heated to 2400 O at 15 °C using a Beckman 8127 rotor.
Centrifuge at rpm for 30 hours to obtain RNA precipitate.

This RN* precipitate was dissolved in a sodium lauroyl sarcosinate solution, and then precipitated with ethanol to obtain 8.3 cape RNA. This RNA was added to a high salt solution (0
, 5M NaCl, 10mM Tris HCl pH 7,
6, 1mM EDTA, OJ%SDS) was adsorbed onto oligo(dT) 7 μlose cuff, and Bo! J (A)
The mRNA containing
・pH7.6, 1mMEDTA, 0J96SDS)
), Bo! J (mRN containing Al
700 μg of A was collected.

This mRNA was further precipitated with ethanol and 0.21B
/ solution (10mM Tris-HCl pH 7,6, 2m
MEDTA.

0.3% SDS), treated at 65°C for 2 minutes, and centrifuged at 10 to 36% sucrose density gradient (Peckman 5W2).
21 at 20°C and 25,000 rpm using a rotor of 7.
22 fractions were obtained by fractionation by centrifugation). A portion of the RNA from each fraction was injected into Xenopus oocytes, and the interferon activity in the synthesized protein was determined. Anti-inflammatory activity (Stewar) measured using a cytopathic effect inhibition test.
t, W, E, The In-terferon
System, 11-26, Springer-
Ver -1 μg, lie York (1979)
), and an activity of 195 units/μg RNA was detected in fraction 12 (sedimentation constant S value showed 12-148). The amount of mRNA in fraction 12 thus obtained was approximately 20 μg.

(11) Synthesis of single-stranded DNA Using the nine mRNA obtained above and reverse transcriptase, iooμ
1 reaction f & (5 μg mRNA, 5011 g oligo(dT), 100 units reverse transcriptase, 1 mM each dATP, dCTP, dGTP and dTTP, 8
mM MgClg.

50mM KCl, 10mM dithiothreate-, 60m
42°C, 1:1 in MTris-HCI pH 8,3)
Incubated &K, deproteinized with pheno-N, 0
．． (iii) Synthesis of duplex II DNA The single-stranded complementary DNA synthesized here was added to 50 μl of the reaction solution (containing mRNA and oligo-dT). Synthetic heavy chain DNA was synthesized by reacting at 42° C. for 2 hours in the same reaction solution as above except for the following.

(iV) Addition of dC tail This double-stranded DNA was treated with nuclease $1 in a reaction solution of 50111 (duplex gDNA, 0.1M sodium acetate pH 4,
5, 0,25M NaCl, 1,5mM ZnSO4,6
The DNA was reacted for 30 minutes at room temperature in 0 units of St nuclease), deproteinized with phenol and precipitated with ethanol. Stranded DNA, 0.14M potassium cacodylate 0.3M Tria (base) pH 7,6,2m
M dithiothreate-/L', 1mMco cl,
, o, 15 mM dcTP.

Approximately 20 deoxycytidine chains were extended at both 3' ends of the double-stranded DNA by reacting for 3 minutes at 37°C in a 30-unit terminus to trans7ase. Through these series of reactions, a double chain D with approximately 300 μ deoxycytidine chains was formed.
Got NA.

(V) Cleavage of E. coli pfusmid and addition of dG tail Meanwhile, restriction enzyme PstI was added to E. coli plasmid pBR322 DNA in 50 μm reaction solution [10 μg pBR322 DNA].
a22 DNA, 50mM NaCl, 6mM Tris
・HCl (pH 7, 4), 6 mM Mgc12,6
1) 1 in BRa 22 DNA by reacting for 3 hours at 37°C in mM 2-mercagtoethanol, 100 μg/st bovine serum agmin, 20 units of PatI.
After cutting the existing pstrM tissue and deproteinizing it with phenol, 50μ of terminal protein phase was added.
Reaction solution (I) 10μg NA, 0.14M 4M Cacodylar, 0.3M Tris (base) pH 7.6, 2mM
Dithiothreitol, 1mMco C12,0,16m
The above plasmid p
Approximately 8 deoxyguanosine chains were extended at both 3' ends of the BRa 22 DNA.

(Vi) Association of CDNA and transformation of E. coli 0.1 gg of the thus obtained synthetic double-stranded DNA and 0.1 MN of the above plasmid pBR3220,6fig were combined.
aC1.

50mM Tris・HclpH7,6, 1mMEDT
A was heated at 65°C for 2 minutes and at 45°C for 2 hours in an equal solution consisting of A, and then slowly cooled to cause association, according to the method of Enea et al.
9M01゜Biol, 96, 495 (1975)
E. coli χ1776 was transformed according to :).

(Vii) Isolation of cDI-me-containing pfusmids Approximately 8,500 TEF fucyclin-resistant strains were thus isolated, and the DMA of each of these was immobilized on nitrose μlose protein & (: Grunatein+M, and H
ogneas+ D, S, + Proc, Mat,
Acad.

Sci, USA, 72.3961 (1975)
) On the other hand, the report by D, V., Goeddel et al. (Na
ture +295.503 (1982)) knee IF
Amino acids Na1-5 (Cys
・Tyr-Cys・Gin-Asp) and amino acid 7? -82(Lys-Gln・ABp-Met-A2B
・Base sequence Proc, Nat that can be inferred from Mo1)
l, Acad, 5ci, U8Aa 75 + 57
65 (1978)'). For this oligonucleotide, 50 μl of reaction solution ('oligonucleotide 0
．． 2#g, 50mM Tris・Hcl pH8,
The oligonucleotide was reacted at 1 hour in 0, 10mM MgCl2, 10mM mercaptoethanol, 50μC1γ-''2FATP, 4 polynucleotides in 3 units), and the 5' end was labeled with 32F.This labeled oligonucleotide was Lawn et al.'s method as a probe [
Nucleic Ac1ds Res,, 9.610
3 (1981)), 411 bacterial strains that reacted with the above two types of oligonucleotide deloaf' were isolated by autoradiography by association with the DNA immobilized on the above-mentioned nitrose filter 1. One fusmid DNA from each of these strains was isolated by Birnboi.
m, H, C, & Doly+ J, method (jluc
leicAcids Res, +1.1513 (1
979)). Next, the inserted part of the grasmid DNA was excised using the restriction enzyme PstI Kl, the one containing the longest fragment of the inserted part was selected from the separated grasmids, and this grasmid was incubated with pHIT 370.
9 Named.

A restriction enzyme map of this Grasmid is shown in FIG.

Next, the primary structure (base sequence) of the cDNA sequence inserted into this pHIT 3709 Grasmid was determined by the dinucleotide synthesis chain termination method and the Maxam-Gilbert method. Its secondary structure was as shown in Figure 2.

This -order structure was reported by Gray et al.
Nature, 295.503-508 (1982
) l) The primary structure of ■-11i' cDNA is one place,
CAA that defines amino 1l14x1400Gln
has been changed to CG, but everything else is the same. The protein defined by this base sequence starts from the A'L'G codon at nucleotide positive 30, which is the initiation signal for protein synthesis.
It is estimated to consist of 6 amino acids, the first 20 of which are probably considered to be signal peptides.

The amino acid sequence was also reported by Gray et al.
(Some places are different) Gln of amino acid 140 has been changed to Arg.

From the above-mentioned structure, it can be seen that this grasmid has all the parts encoding the AE F protein. This fact indicates that by inserting the friend DNA sequence into this grasmid and transferring it to another expression grasmid, it is possible to cause a host such as E. coli to produce immune interferon.

Actual Example 2 5J! The inserted part of Grasmid pHIT 3709 obtained in Example 1 was extracted with restriction enzyme Bs tNI from Nucleotide & IQQ.
(See Figure 2.3), and the resulting margin was filled with I) HA Polymefuyeler Difugment (also called DNA Polymefuzee), which was then chemically synthesized by the triester method described above. Oligonucleotide adapter CGATAATGTGTTACTGCCTATTACA containing protein synthesis initiation codon ATG
CAATGACGG T 4 DNA! It was bound with J gauze.

On the other hand, as an expression grasmid, a plasmid pt containing a portion of the promoter for tryptophan synthesis of E. coli (DNA fragment including promoter and operator, 276 base pairs) was used.
rp601 (vector is pBR322) by Benn
Methods of ett, G.N., et al. CJ.

Mo1. Biol-+ 121.113 (197B
) )It was constructed.

This grasmid ptrp 601 was cut with restriction enzyme C1a, and the X-IF gene to which the above adapter was attached was inserted downstream of the tryptophan promoter to generate T4DN.
A! 2. Connect using J gauze to construct ①-E F expressing pfusmid pH engineering T-trp301. (Figure 3) Using this plasmid pHIT-trp 301, Co
A strain containing this plasmid can be obtained by transforming E. coli 294 according to the method of Hen et al. [supra].

Example 3 The strain containing Ni 1F-expressing defusmid obtained in Example 2 was mixed with M9 containing 0.5% glucose and 0.5 casamino acids.
After culturing in the medium at 37°C for 6 hours, the bacterial cells were collected and 0.02
M phosphate buffer pHs, a, 0.15 MNaC1
After suspending in a solution, the bacterial cells are destroyed by sonication, and a supernatant is obtained by centrifugation. The interferon activity of this supernatant can be measured by the method described above.

Example 4 I-EngF expression plasmid pHIT obtained in Example 2
- strain containing trp 301 with 0.5% glucose.

After culturing in M9 medium containing 0.5 casamino acids at 3γ°C for 6 hours with stirring, indole acrylic acid was added to a final concentration of 20 μg/d, and further 3'1.3
After continuing the culture with stirring for an hour, 10IIt was taken out, and this sample was centrifuged to collect the bacterial cells, and 50mM
Trio pH 7,6 10% Sho II solution [Q, 1-
resuspended in. This was quickly frozen on a dry ice/ethanol bath, then thawed at 20°C and then transferred to a water bath! 1ac1.

EDTA, spermidine, and lysozyme were each added to a final concentration of 10 (laM, 10 mM, 20 mM, 200 μg/
S? After 45 minutes, the mixture was incubated at 30°C for 2 minutes. Dissolution was confirmed by an increase in the viscosity of the suspension. Next, this solution was centrifuged to remove bacterial cell residues, and the F-F activity of the resulting Kugami FF solution was measured using the method described above, and the result was 1280 units/- of the whole extraction residue.

The following example shows λPI, promoter and ■- of the present invention.
This is an explanation of the AIF using DNA encoding IF.

Example 5 To isolate a 350 base pair (bp) fragment containing the APL promoter, λC Engineering 8578am 7ONA (Mle
s laboratory) 250 μg was added to BamHI and BglI [
1200 cells digested with restriction endonucleases and subjected to agarose gel electrophoresis containing the APL promoter.
A bp fragment was isolated (see Figure 4).

Next, this 1200 bp fragment was subjected to complete digestion with HpaIK and partial digestion with HlNF, and then a 350 bp fragment was isolated on a 5% polyacrylamide gel. This Hpa I digestion produces two Hlnf I partially digested fragments (approximately 3
50bp) were removed.

The 350 bp fragment contains the PL-promoter and the λc
I One part of the ○L operator that connects the regressor (O
L□"L2"L3) are included.

The Hinf engineering site (see Figure 4), which exists between the SD (Shine and Dalgarno) sequence of the λN gene and the start codon that defines this single gene, allows the expression of a heterologous gene in the large l&IN/1 hybrid ribosome. Build the binding site. This Hlnf I site may be changed to a KcoR site.

pBR3 containing a BgllI site adjacent to the WcoR engineer.
Plasmid pRCI (see Figure 5), which is a derivative of 22, was digested with WcoRI and BglM, and the 35Qbp Bgll [-Hlnf I v# fragment was cloned into it, and the resulting recombinant plasmid was called pRCI.
The name was 14. 's! Figure 15 shows the sequence of the ligated ends, the method for ligating the vector EcoRI end and the Hlnf I fragment end, and the reconstruction of the EcoR site (■ in Figure 5).
indicates that it was filled-in in vivo).

In the same manner, several types of expression vectors other than those described above were constructed using the PL glomotor (Fig. 6, Fig. 7, Fig. 8, and Fig. 9). pRC15 is the above 350bp Bgl
55 base pair fragment Min f (-Mbo engineering) containing the SD sequence of the λ int gene in addition to the ll-H1nf engineering fragment
(See Figures 6 and 7). Expression vector pR
c21 and pRC22 are respectively pRc14 and p
Similar to Rc15. These goufsmids differ in the orientation of the inserted fragment containing the pL'7'9 motor, that is, in the direction of transcription (see Figure 8). pRC23 is a 'consensus''RBS (reference binding site) (5cherer
et al+ Nucleic Ac1ds Research
, 8.3895 (1980)) containing the PL promoter.
It was constructed by ligating to a 50 bp Bgl M-Hae I fragment and then inserting this ligation product into pR02. (See Figure 9).

Next, a PL-expression vector containing the AE F gene obtained from the bufsumid pHIT3T09 of Example 1 above was constructed as shown in the Example below.

Example 6 900 bp BstN engineering fragment (which includes the sequence defining the Vbuna μ portion of AHEF and the predicted 5B
■A plasmid p containing a 430bp O sequence encoding AeF and a 470bp untranslated region on the Go side (there are no codons that specify the first three amino acids of the protein)
In order to insert the missing codon of 31m isolated from H.Eng.
Combined. (See Figure 410).

Using this synthesized fragment, BatNI at both ends was
Convert to RI and mourn. The resulting fragment was digested with EcoRI and cloned into the nine vector pR02'l. The orientation of the insert was determined by restriction analysis using Bgl I, which cuts the 3' untranslated region.

PRC22 vector (pRC22
By determining the sequence of the promoter-gene linkage site of the gene (denoted as /IFI9QG), it was confirmed that all binding occurred as expected (see Figure 10, wA).

Next, we tested the expression of the I-IF gene using the two-strain RRI (pRK 248c-t8+ pRC22/I
900) in M9-glucose medium for 30 min.
After culturing to 4 x 10 cells/sZK, glucose and casamino acids were added to concentrations of 1.0% and 0.5%, respectively, and incubated at 420 °C for 1 hour.
d was collected. This sample was centrifuged to collect bacterial cells and resuspended in 0.1 mK of 50 mM Tri8 (pH 7,4)-10% sig sugar solution. This was quickly frozen in a dry ice/ethanol bath, then thawed at 20°C, then transferred to a water bath and treated with NaCl.

10 each of EDTA, Subemidine, and Lysothief
0mM, 10mM, 20mM, and 200μg/- were added, and after 45 minutes, the mixture was incubated at 37°C for 2 minutes. Next, this suspension was centrifuged to remove bacterial cell residue, and the AE F activity of the resulting supernatant was measured by the method described above, and it was found to be 1280 units/d bacterial cell extract.

To examine the kinetics of triggering, repeat the above steps with the following triggering conditions. Induction conditions were 30 for controls.
℃, and in one experimental system, the temperature was 42℃ for 30 minutes, 60 minutes, 90 minutes, 120 minutes and 180 minutes. As shown in the WN2 table, the results showed no activity at 30°C, and when induced at 42°C, the activity reached a large amount around 90 minutes, and then gradually decreased.

! 2 Table 42°-30' 120 42°-60' +20 42°-90' 320 4 dars 120' 160 42°-180' 40 Dormitory Example 7 pR022/rFI-900 DNA was further digested with EcoRI to l-4F A 900 bp fragment containing the gene was isolated and inserted into PRC23 digested with EcoRI (see Figure 11) to construct pRC23/Engine FI-900. It has a markedly different RBS than that in pBC22/EF (compare Figures 10 and 11). ■-Expression of IFiIl gene was tested;-Strain RIRI (pRK248cIts, pRC23
/IF Ne900) was cultured in M9-glucose medium at 30°C until the bacterial cell concentration reached 3-4 x 10 cells/d, and then glucose and casamino acids were added at a concentration of 1.0.
% and 0.5%, and after induction at 42° C. for 1 hour, 10 s/s were collected. This sample was centrifuged to collect bacterial cells, and 50 mM Tris (pH 7,
4) was resuspended in 10IV Yotou-Solu *0.1-. This was quickly frozen in a dry ice/ethanol bath, then thawed at 20°C, transferred to a water bath, and NaC1,
1 part each of EDTA, spermidine, and lysozyme
00a+M, 10mM.

It was added at 20 mM and 200 μg/sl, and after 45 minutes, it was incubated at 37° C. for 2 minutes. Next, this suspension was centrifuged to remove bacterial cell residue, and the AE F activity of the resulting supernatant was measured by the method described above. E. coli strain R
When RI is transformed, pl'? C23/IF expressed about 4 times as much knee IF activity as pRC22/IF (see Table 3).

tJ! , 3 Table Example 8 pRC23/engine 1i'■ Digested with EcoRI to cleave only one site among all 1i'■ positions, and the resulting molecule was treated with P o 1 engineering "Klenow" to generate EcoR.
After ligating the blunt-ends with T4 DNA ligase, RRI (pRK24
Next, transform 8'c engineering ts). We screened for recombinants lacking the gcoR1 site at the start site of the AE F gene, and two positive results were obtained. One of them was named pRc; Jl/Engineering F Knee 900. This is useful for transforming E. coli strain RRI to express AEF. The zI1 strain RRI (pRK248cIts,
pRC231/IFI-9QQ) was cultured in M9-glucose medium at 30°C until the bacterial cell concentration reached 3-4 x 108 cells/d, and then glucose and casamino acids were added at concentrations of 1.0% and 0.55G, respectively. In addition to 42
After 1 hour of induction at t, 10- was collected. This sample was centrifuged to collect bacterial cells, and 50 mM Tri
resuspended in 0.1 s/o (pH 7.4) of 10% V-sucrose solution. This was quickly frozen in a dry ice/ethanol bath, then thawed in 2 (1), then transferred to an ice bath and treated with NaCl, EDTA.

Spermidine, lysozyme (100mM).

They were added at concentrations of 10mM, 20mM, and 200μg/d, and after 45 minutes, they were incubated at 37t for 2 minutes.

Next, this suspension is centrifuged to remove bacterial cell residue.
The AE F activity of the obtained supernatant was measured by the method described above.
Ta.

The results are shown in Table 3 of the 1st edition.

The above pRc23/F engineering was improved to extend the linker region from 5 bp to 10 bp. In the case of AEF, a distance of 6 bp seems to be more suitable than 10 bp for expression of I-IF.

Example 9 What can be obtained by the present invention? can be purified, for example, by the means described below.

All purification steps are preferably carried out at low temperatures, particularly at temperatures below room temperature and about 4°C.

Nee IF content, such as the supernatant obtained in Example 4, can be sequentially filtered through a 3 micron then 0.22 micron Na1gene filter. The next purification step can be efficiently carried out using a high performance liquid chromatography column using a weak cation exchange resin. For example, CM2O
0 resin + l Om (Separation engineering
ustries) was packed into a 25a11 x 0.46 cm inner diameter column, washed with 2M KCl, and then 24m
peninsula with M phosphate mild Ifl solution pH 7.5 or distilled, deionized water (used throughout performing this procedure) and
．． The sample passed through a 22 micron filter was diluted with an equal volume of water, and this was pumped onto a 0M column to 1.5
Pass at wt/min. The column was then washed with 25 mM potassium phosphate, pH 7.5, and then washed with 25 mM potassium phosphate, pH 7.5, until the protein in the column effluent was reduced to a background concentration determined by automonitoring of the column. -Buffer pH 7.5
Concentration gradient of KCI (0-1M) 0.5 from K
Elutes at d/min.

The active fractions thus obtained from the 0M column were collected and transferred to a previously washed CF25 filter cone (
Concentrate on Amlcon Corp.).

This concentrated solution (Q, !M or less) was injected into 1,000 liters in advance, and then eluted with 0.3 M KCl, 25 mM potassium phosphate pH 7.5 at 24 d/min, and fractions were collected at 1 minute intervals. do. Interferon activity and protein peaks coincide. This process may result in one or more minutes
1 m (depending on the starting materials and the effectiveness of the previous steps) K single A/F is obtained. If necessary, the fraction containing impurities can be unified by repeating concentration and chromatography using a TSK or 0M column.

According to the present invention, human immune interferon or its equivalent can be produced economically, and the interferon is useful as an antiviral agent, an antitumor agent, and the like.

[Brief explanation of drawings]

Figure 1 shows the bufsumid pH obtained in Example 1 (Vii).
Represents IT37090 restriction enzyme map, Z depression Z part Vi
A portion encoding a peptide considered to be a signal peptide is shown, and 5 represents a portion encoding an I-IF polypeptide. Figure 2 shows the primary structure (base sequence) of pH engineering T3709 goufsmid obtained in Example 2 (Vii),
The figures each represent a construction diagram of Example 2. Figure 4 is PL
1 200 bp Bgl I containing promoter
This is a map of f-BamH engineering fragments. Figure 5 is 350b
FIG. 2 is a construction diagram of the expression vector pRC14 containing the Omuda PL promoter located on p. FIG. 6 shows the isolation of an 82 bp fragment containing the SD sequence of the Bacteriophage fumuda int gene used in the construction of the Fi expression vector pRci5, and FIG. 7 is a diagram of the construction of the expression vector pRc15. Figure 8 shows expression vectors pRC21 and pR.
Figure 9 shows the construction of C22, pL promoter and synthetic 'R
The construction of expression vector pRC23 from BS is shown in each case. Figure 10 shows the insertion of the gene encoding immune interferon into the expression vector pRc22 and the PL
The sequence of the promoter-gene connection site is shown, and FIG. 11 shows the insertion of the gene encoding immune interferon into the expression vector pRc23, the sequence of the PL promoter-gene connection site, and its improvement. +1L (Je fl(Li)
・0$5 figure each Roni: TTAA ″”°”“- GAGGA -'L -+QJTTCTCCT - -CTTAAGAGGA -” Rod 6 Illustration c1857 Sam7 DNA [dom-]-49
0oo bpIsolate lso -220bp
YAK・ri711solo↑e 82bp H
inf[-1-1aelI 757ment↓ inf T-TTTTGAAGAGGATCAGAAA
Continuation of page 1 of Hoe II
12N 15100-C1
2R1/19) 6760-4
8 (CI2N 1100
-C12R1/19) 676
0-48 (CI2 P 21102
-C12R1/19)
6760-4B Priority claim @July 12, 1982■United States (US)■397384 0 Inventor: Kyozo Tsukamoto 1-9-1-40 Ueno Higashi, Toyonaka City, No. 2 No. 0 Inventor: Kuroyo Tsutomu Kawanishi City Mizuho 1-chome 1-50

Claims (1)

[Claims] (1) General formula % formula % () [In the formula, X represents TAA, TGA or 1iTAG]
DNA containing the base sequence represented by +2) At the 5' end (5') ATG AAA TAT ACA AGT
TAT ATCTTGGCT TTT CAG CTC
TGCATCGTT TTG GGTTCT CTT
DNA0 according to claim 1, characterized in that it has GGC (3') (3) DNA0 according to claim 1, characterized in that it has ATGf at the 5' end (4) Cys Tyr Cya Gln Asp
Pro Tyr ValLye Glu Ala Gl
u Asn Leu Lya Lya TyrPhe
Asn Ala Gly Hls Ser Asp V
al AlaAsp Asn Gly Thr Leu
Phe Leu Gly l1eLeu Lye A
sn Trp Ly8Qlu Glu Ser Asp
Arg Lya Ile Met Gln Ser G
ln Ile ValSer Phe Tyr Phe
Lya Leu Phe Lya AsnPhe L
ys Asp Asp Gln Ser Ile Gl
n Ly8Ser Val Glu Thr Ile
Lys Glu Asp MetAsn Val
Lya Phe Phe Aan Ser Aan
LyaLy8 Lye Arg Asp As
p Phe Glu Lys LeuThr
Asn Tyr Ser Val Thr
Asp Leu AsnMal Gln Arg
Lys Ala Ile Hls Glu
Leulle Gln Val Met
Ala Glu Leu Ser Pr. Ala Ala Lya Thr Gly Lya
Arg Lys Arg Ser Gln Me
t Lue Phe Arg Gly Arg
DNA0 according to claims 1 to 3, characterized in that it encodes a polypeptide represented by ArgAla Ser Gin. (5) It exhibits immunological or biological activity equivalent to an immune interferon polypeptide. IfF is characterized in that it encodes a polypeptide, claim 1~
DNA0 (61Met Cya Tyr Cya Gin Aa) described in Section 3
p Pro Tyr Val Lys Glu Ala
Glu Aan Leu Lye LysTyr Ph
e Asn Ala Gly Hla Sar Asp
MalAla Asp Asn Gly Thr L
au Phe Leu GlyIIs Leu Lys
Asn Trp Lys Glu Glu 5erAa
p krg Lya 11e Met Gln
Ser Gln l1eVal Ser Pha
Tyr Phe Lya Leu Phe LysA
sn Phe Lys Asp Asp Gln S
er IIs GlnLye Ser Yal Gl
u Thr Ile Lys Glu AspMet
Asn Yal Lya Phe Phe A
sn Ser AsnLys Lys Lys Ar
g Asp Asp Phe Glu LysLeu
Thr Asn Tyr Ser Mal Thr A
sp LeuAsn Val Gln Arg Ly
s Ala 工１e Hls GluLeu I
le Gln l/al Met Ala G
lu Leu 5arPro Ala Ala L
ys Thr Gly Lya Arg LyaArg
Ser Gln Met Leu Phe Arg
Gly ArgArg Ala Ser Gln
D according to claim 1, 3 or 5, characterized in that D encodes a polypeptide represented by
NA0 (7) Met Lya Tyr Thr Ser
Tyr Ile AlaPhe Gln Lau Cy
s, 11e Vhr Leu Gly 5erLeu
Gly Cya Tyr Cys Gln Aap
Pro TyrYal Ly8Glu Ala Glu
Asn Leu LysLysTyr Phe As
n Ala Gly Hls Ser Aap Mal
Ala Asp Asn Gly Thr Leu P
he Leu G4y 工 le Leu Lys A
sn Trp Lys Glu Glu 5erAsp
Arg Lys Engineering Met Gln S
er Gln l1eVal Ser Phe Ty
r Phe Lys Leu Phe LysAsn
Phe Lys Asp Asp Gln Ser
IIs GlnLys Ser Val Glu Th
r IIs Lys Glu AspMet Aan
Val Lys Phe Phe Asn
Ser AanLysLysLyaArg
Aap Asp Phe Glu LyeLeu Th
r Asn Tyr Ser Mal Thr As
p LeuAsn Val Gln Arg L
ye Ala IIs Hls GluLeu
Ile Gln Mal Met Ala
Glu Leu 5erPro Ala Ala
Lys Thr Gly Lys Arg LysA
rg Ser Gln Met Leu Phe Ar
g Gly ArgArg Ala Ser G
DNA0 according to claim 1, claim 2, or claim 5, which is characterized in that it encodes a polypeptide represented by ln (8) Claim characterized in that it is a part of a recombinant DNA molecule DNA0 according to claims 1 to 7 (9) DNA0 according to claims 1 to 8, characterized in that it is linked downstream of a promoter (Iα) General formula % formula % characterized by containing ) ~ (su) % AGT CAG ATG CTG TTT
CGA GGT CGA AGAGCA TCC
CAG -X (3') [wherein, X is TAA, T
A method for producing DNA containing a base sequence represented by GA or TAG. (b) Cultivate cells that secrete human immune interferon. (b) Messenger RNA encoding human immune interferon is isolated from the cells. (c) Synthesize single-stranded complementary DNA using the messenger RNA and reverse transcriptase. ) Convert the complementary DNA to double fiDNA. (e) Incorporate the obtained double-stranded DNA into a plasmid. (f) This recombinant plasmid is introduced into a host and transformed. (g) Isolate a fusmid containing the desired DNA from the cultured bacterial cells of the host. (g) If desired, cut out the desired cloned DNA from the plasmid. (b) If desired, the cloned DNA is linked downstream of the promoter in the vehicle. 11) D N A 1) E Cys Tyr Cys Gln Aap Pro T
yr Val LysGlu Ala Glu Aan
Lsu Lye Ly8Tyr PheAan Al
a Gly Hla Ser Asp Val Ala
AapAsn Gly Thr Leu Phe L
eu Gly IIs LeuLya Asn Trp
LysGlu Glu Ser Asp ArgLy
s Ile Met Gln Ser Gln Ile
Mal 5erPhe Tyr Phe Lye L
eu Phe Lya Asn PheLys Asp
Asp Gln Ser Ile Gln Ly8S
erMal Glu Thr IIs Lye Glu
Asp Met AanMal Ly8Phe Ph
e Asn Ser Asn Ly8LysLys A
rg Aap Aap Phe Glu Lys Le
u Thr Asn Tyr Ser Mal Thr
Asp Leu Aan ValGln Arg Ly
s Ala Ile Hls Glu Leu l1e
Gln Val Met Ala ()lu Leu
Ser Pro AlaAla Ly8Thr Gly
Lys Arg Lya Arg 5erGln M
et Leu Phe Arg Gly Arg Ar
11. The method for producing DNA according to claim 10, which encodes a polypeptide represented by gAlaSerGin. (The method for producing DNA according to claim 10, which encodes a polypeptide that exhibits an immunological or biological activity equivalent to that of the 12D DNA immune and interferon polypeptide. (13j The method for producing DNA according to claims 10 to 12, characterized in that the DNA is a part of a recombinant DNA molecule. , TGA, or TAG] A host transformed with a DNA containing a base sequence represented by the following: (f) A patent claim characterized in that the DNA has the base sequence linked downstream of a promoter. The host according to claim 14. - The host according to claim 14 or 15, which is E. m. or Bacillus subtilis. 17) General formula % Formula % Asn Ala Gly Hls Ser
Aap Mal Ala AspAan Gly
Thr Leu Phe Leu Gly I
Le LeuLye Aan Trp Lya
Glu Glu Ser Asp ArgLy81
1e Met Gln Ser Gln I
le Mal 5erPhe Tyr Phe
Lya Leu Phe Lya Aan Ph
eLy8 Aap Asp Gln Ser Ile
Gln Lya 5erVal Glu T
hr Ile Lye Glu Aap Met
AsnVal Lye Pha Phe
Aan Ser Aan Lys LyaLye
Arg Op Asp Phe Glu L
ye Leu ThrAan Tyr Ser
Mal Thr Aap Leu Asn
MalGln Arg Lys Ala IIs
Hls Glu Leu l1eGln V
al Met Ala Glu Leu S
er Pro AlaAla Lys Thr
Gly Lys Arg Lye Arg 5e
rGln Met Leu Phe Arg Gly
Arg Arg AlaSer Gln [wherein, Y is (a) hydrogen, (b) Met or (c) M
et LyaTyr Thr Ser Tyr
Ile Ala Phe Gln LeuCys
Ile Val Leu Gly Ser Leu
A compound represented by: (e) General formula % formula % () [In the formula, X represents TAA, TGA or TAGQ]
A host transformed with DNA containing the base sequence represented by is incubated and cultured with the general formula % [wherein Y is (a) hydrogen, (b) Met, or (c) M
et LyeTyr Thr Ser Tyr
Ile Ala Phe Gln LeuCys II
s Val Leu Gly Ser Leu Gly
A method for producing a compound, which comprises producing and accumulating a compound represented by the following formula and collecting the compound. - General formula % formula % [wherein Y is (al hydrogen, (blMet or (c)M
et LysTyr Thr Ser Tyr
Ile Ala Phe Gln LeuCys
Ile Mal Leu Gly Ser Leu G
ly] and a pharmaceutically acceptable carrier. (to) The pharmaceutical composition according to claim 19, wherein Y is hydrogen, and the pharmaceutically acceptable carrier is sterile water, physiological saline, or human serum albumin.