JPH1135595A - Antisense oligonucleotide and carcinostatic agent using the same - Google Patents

Abstract

PURPOSE: To obtain an oligonucleotide useful as a carcinostatic agent, etc., capable of manifesting high carcinostatic actions by phosphoramidating a bond between nucleotides of an antisense oligonucleotide against a human protein kinase A gene. CONSTITUTION: This oligonucleotide has a base sequence at least complementary to all or a part of the sequence of a human protein kinase A gene [e.g. a sequence capable of coding for a regulatory part of the human protein kinase A (concretely the one having a base sequence at least complementary to a base sequence of a coding chain of a human protein kinase A-RI α gene represented by the formula) or a part thereof] and is obtained by binding mutual nucleotides with a phosphoramidate.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to an antisense oligonucleotide against human protein kinase A, particularly human protein kinase A-RIα, an anticancer agent comprising the antisense oligonucleotide, and a pharmaceutical composition containing the anticancer agent.

[0002]

2. Description of the Related Art Cancer has long been known as an incurable disease, but it has not changed significantly to date. It is a so-called rebellious molecule, where cancer cells are derived from the organism itself.The basic physiological mechanism is not much different from normal cells, so if you try to kill cancer cells with an anticancer drug etc., normal cells are also damaged. This is because side effects occur. In view of this situation, methods for selectively attacking and treating only cancer have been studied. For example, a method has been devised in which a carrier such as a monoclonal antibody or a liposome for a cancer cell-specific antigen is used and a drug is carried on these carriers.
There was a problem with the binding force between the monoclonal antibody or carrier and the drug, and a problem with release, and it was not possible to exert a sufficient effect.

[0003] Since the early 1980's, various genetic manipulation techniques have been advanced and applied to the field of cancer treatment. Of these, a gene specifically required for the physiology and proliferation of cancer is reacted with an oligonucleotide (antisense oligonucleotide) having a base sequence complementary to a part of the gene, so that the cancer-related gene is covered. An antisense technique has been devised, and various studies have been made on this technique. Since this antisense oligonucleotide inhibits gene expression indiscriminately for both cancer cells and normal cells, it is an important point what kind of gene expression is suppressed.

Among the anti-cancer effects of these antisense oligonucleotides, Yun Soon Chou-Chun et al. Focused on the fact that protein kinase A is required for the division of proliferating cancer cells, and developed the protein kinase A. The technology of antisense oligonucleotides against A-RIα has attracted attention due to the novel mechanism (JP-A-6-21889). However, its anti-cancer effect in vivo cannot be said to be remarkably excellent, and its effectiveness has been problematic.

[0005]

SUMMARY OF THE INVENTION The present invention has been made in view of such circumstances, and it is an object of the present invention to provide an antisense oligonucleotide for a protein kinase A gene having an enhanced anticancer effect.

[0006]

Means for Solving the Problems Based on the above-mentioned circumstances, the present inventors have conducted intensive studies in order to increase the anticancer action of an antisense oligonucleotide against the protein kinase A gene to a practical level, and as a result, The present inventors have found that the use of phosphoramidate as a bond of the compound significantly enhances the anticancer effect, thereby completing the invention.

That is, the present invention provides an oligo-protein having a structure represented by the general formula (I), which has a nucleotide sequence at least partially complementary to all or a part of the sequence of the human protein kinase A gene. Nucleotides.

[0008]

Embedded image

(In the general formula (I), n represents an integer, and R ₁
Represents a hydrogen atom or a hydroxyl group, and B represents a nucleobase. A part of the human protein kinase A gene includes a regulatory portion of human protein kinase A or a sequence encoding a part thereof. Further, the regulatory portion includes RI-α.

[0010] The present invention further provides an anticancer agent comprising the above-mentioned oligonucleotide, and a pharmaceutical composition for treating cancer, comprising at least one selected from the above anticancer agents.

As used herein, the term “antisense oligonucleotide” refers to an oligonucleotide that suppresses expression of a gene or mRNA by hybridizing to the gene or mRNA, and includes the coding strand (+ strand) or the coding strand of gene DNA. Not only oligonucleotides having a base sequence complementary to mRNA but also non-coding strands ((-)
An oligonucleotide having a base sequence complementary to the (strand) is also included.

Hereinafter, the present invention will be described in detail.

(1) Antisense Oligonucleotide of the Present Invention The antisense oligonucleotide of the present invention is an oligonucleotide having a base sequence at least partially complementary to all or part of the sequence of the human protein kinase A gene. Nucleotides. A part of the sequence of the human protein kinase A gene includes a regulatory portion of human protein kinase A or a sequence encoding a part thereof. Furthermore, the regulatory part is RI
-Α. The antisense oligonucleotide of the present invention has the above-described nucleotide sequence, and the bonding between the nucleotides constituting the oligonucleotide is based on the phosphoramidate bond represented by the general formula (I). Things.

[0014] The length of the oligonucleotide chain is not particularly limited as long as the specificity for the protein kinase A gene is maintained. The preferred chain length is 9 to 40 in terms of the number of bases. This is because if it is less than 9, the specificity for the gene may be low and the anticancer effect may not be sufficiently exerted, and if it exceeds 40, it is extremely difficult to synthesize by controlling the base sequence. More preferred chain lengths are those having 15 to 24 bases, which have the best balance between effect and economy.

The type of the antisense oligonucleotide of the present invention is not limited as long as it is a nucleic acid having a sequence complementary to a gene involved in the biosynthesis of protein kinase A-RIα. That is, as long as the bond between nucleotides is a phosphoramidate bond, even if it is a DNA-type oligonucleotide (R ₁ is a hydrogen atom in the general formula (I)), it is an RNA type (general formula (I)) R ₁ may be an oligonucleotide of the hydroxyl group).

The sequence of the antisense oligonucleotide for protein kinase A-RIα is a sequence substantially complementary to a part of the base sequence of the coding or non-coding chain of the protein kinase A-RIα gene, in other words, non-coding. If the sequence is substantially identical to a part of the base sequence of the chain or the coding chain, the protein kinase AR
It is expected that the biosynthesis of Iα can be suppressed. As a part of the nucleotide sequence of the protein kinase A-RIα gene, the above effect can be expected at any site of the gene, but from the viewpoint of completely suppressing the expression of the protein kinase A-RIα activity, It is preferably a part of a sequence consisting of 300 nucleotides from the initiation codon to the 100th codon at the 5 'end of the coding strand of the gene. This protein kinase A-RI
SEQ ID NO: 1 shows the sequence of 300 nucleotides of the coding region of the α gene. In addition, an antisense sequence corresponding to this sequence (the same as the sequence of the non-coding strand) is shown in SEQ ID NO: 6.
Here, the relationship between the sequence shown in SEQ ID NO: 1 and the sequence shown in SEQ ID NO: 6 is complementary, and anticancer activity can be expected with any antisense oligonucleotide for either strand of the gene.

Further, as a part of the nucleotide sequence shown in SEQ ID NO: 1 or 6, it is preferable that the nucleotide sequence is at the 5 'end in SEQ ID NO: 1 and that it is 3' in SEQ ID NO: 6.

Here, "substantially complementary" does not require that all nucleotides in the oligonucleotide are complementary to the protein kinase A gene, and that the oligonucleotide is a gene DNA or It means that it only needs to hybridize to the corresponding site of mRNA and be complementary to the extent that it can inhibit transcription or translation. Therefore, as long as specific hybridization is not inhibited under physiological conditions, there may be substitution, deletion or insertion of some nucleotides in the nucleotide chain.

The nucleotides that can be replaced in an antisense oligonucleotide differ depending on the length and sequence of the oligonucleotide. Generally, the vicinity of both ends of an oligonucleotide is more affected by substitution, deletion and insertion than inside. AT (or AU) base pairs are less affected by substitution than GC base pairs. Methods for calculating the hybridization intensity of nucleic acids are known, and those skilled in the art will modify some of the sequences based on the sequences shown in SEQ ID NOs: 1 and 6 so that hybridization under physiological conditions is not impaired. It is easy. Specifically, those having a homology of 90% or more to the protein kinase A gene can be expected to have a desired effect to some extent, and can be defined as substantially complementary. Furthermore, even if an oligonucleotide having a non-specific sequence is added to the 5 'end or 3' end of such an oligonucleotide, it is not substantially affected.

The type of nucleotides constituting the antisense oligonucleotide of the present invention may be a DNA-comprising nucleotide analog in which the base is thymine, adenine, cytosine or guanine and the sugar is deoxyribose. Adenine, cytosine, and guanine may be used as RNA-constituting nucleotide analogs in which sugar is ribose. Further, it may contain a base capable of nonspecifically hydrogen bonding with another base such as inosine. Most preferred are oligonucleotides of DNA constituent nucleotide analogs complementary to the base sequence of SEQ ID NO: 1.

The sequence of the antisense oligonucleotide for protein kinase A-RIα has a sequence complementary to a part of the base sequence shown in SEQ ID NO: 1, that is, the same sequence as a part of the sequence shown in SEQ ID NO: 6. Specific examples include oligonucleotides having the base sequences shown in SEQ ID NOs: 2, 3, 4, and 5. In addition, as a sequence complementary to a part of the base sequence shown in SEQ ID NO: 6, that is, having the same sequence as a part of the sequence shown in SEQ ID NO: 1, specifically, Nucleotides. The positions of these oligonucleotides on the sequence shown in SEQ ID NO: 1 or 6 are shown below.

SEQ ID NO: 2: Nucleotide numbers 280 to 300 of SEQ ID NO: 6 SEQ ID NO: 3: Nucleotide numbers 46 to 57 of SEQ ID NO: 6 SEQ ID NO: 4: Nucleotide numbers 148 to 165 of SEQ ID NO: 6 SEQ ID NO: 5: SEQ ID NO: 6 Nucleotide numbers 250 to 279 SEQ ID NO: 7: Nucleotide numbers 1 to 21 of SEQ ID NO: 1 SEQ ID NO: 8: Nucleotide numbers 244 to 255 of SEQ ID NO: 1 SEQ ID NO: 9: Nucleotide numbers 136 to 153 of SEQ ID NO: 1 SEQ ID NO: 10: SEQ ID NO: Base number 280-300 of 6

In the antisense oligonucleotide of the present invention, the nucleotides are separated from each other as shown in the general formula (I).
It is characterized by connecting with a phosphorus bond. The antisense oligonucleotide represented by such a general formula has a better cancer-suppressing effect than a conventional antisense oligonucleotide having a binding mode such as phosphorothioate, as described in Examples below.

(2) Method for Producing Antisense Oligonucleotide of the Present Invention The antisense oligonucleotide of the present invention can be synthesized while controlling the nucleotide sequence by sequentially extending nucleotides according to the reaction formula (II). I can do it.

[0025]

Embedded image

(Where Po represents a polymer residue, R represents a hydrogen atom or an acyloxy group, and B represents a nucleobase).

That is, a dimethyltritylated nucleoside fixed to a solid phase of a polymer or the like by an ester bond is detritylated with dichloroacetic acid, and is subjected to (2-cyanoethoxy)-
By reacting (N, N-diisopropylamino) chlorophosphine with N, N-diisopropylethylamine for phosphitylation, a cyanoethoxynucleotide is reacted with tetrazole, and further reacted with 3'-amino acid in the presence of triethylamine. By repeating the operation of substituting tetrazole with the 3'-amino group of -5'-dimethyltrityl deoxyribonucleotide and similarly condensing 3'-amino-5'-dimethyltrityl deoxyribonucleoside with this dimethyltrityl form, ethoxycyanophos An oligonucleotide having an arbitrary base sequence immobilized by an ester bond on the polymer bonded by a foramidate bond is obtained. When this is subjected to dedimethyltritylation and deesterification using ammonia, an oligonucleotide having a structure represented by the general formula (I) can be obtained.

The above series of reactions was carried out using commercially available DNA
By using a synthesizer and the above reaction reagent, it is possible to automatically obtain an oligonucleotide having an arbitrary base sequence. In the above reaction, if a nucleoside in which the sugar chain part is replaced with 2′-acyl-3′-amino-5′-dimethyltritylribose is used, RNA
Similar antisense oligonucleotides are obtained.

(3) Anticancer agent of the present invention The anticancer agent of the present invention comprises at least one selected from the above-described oligonucleotides. When an oligonucleotide is used as a mixture of two or more, a higher anticancer effect may be obtained.

The anticancer agent of the present invention has an excellent anticancer effect on various cancer cells, as shown in the Examples below. The cancer for which the anticancer agent of the present invention is effective is not particularly limited as long as it is a human cancer. For animal cancer, it is expected that the antisense oligonucleotide, which is the anticancer agent of the present invention, may not be effective because it is an antisense oligonucleotide against the human protein kinase A-RIα gene.

Specific examples of cancers for which the anticancer agent of the present invention is effective include leukemia, lung cancer, stomach cancer, liver cancer, kidney cancer, malignant lymphoma, tongue cancer, esophagus cancer, breast cancer, pharyngeal cancer, brain tumor, Malignant fibroids, melanoma, cervical cancer and the like. Although the preferred dose of the anticancer agent of the present invention varies depending on the disease type, medical condition, age, weight, sex, physical condition, etc., it is approximately 10 mg to 200,000 m per adult per day.
It is appropriate to administer g in one or several divided doses. Examples of the administration route include intravenous, intraarterial, intraportal, subcutaneous, intradermal, intramuscular, and intralesional injection, and oral administration.

(4) Pharmaceutical composition for cancer control according to the present invention The pharmaceutical composition according to the present invention comprises the above-mentioned anticancer drug and optional components in the dosage form. The arbitrary components in the dosage form can be used without any particular limitation as long as they are commonly used in pharmaceutical compositions. For example, oral preparations can include bulking agents, binders, flavoring agents, disintegrants, lubricants, coatings, sugar coatings, and the like. Injections include pH regulators, isotonic agents, and stabilizing agents. And the like. It may be formulated together with another drug known to have an anticancer effect. The method of forming these anticancer agents and optional components into a dosage form may be a conventional method.

[0033]

EXAMPLES The present invention will be described in more detail with reference to the following examples, but it goes without saying that the present invention is not limited to these examples.

[0034]

Example 1 Production Example of Antisense Oligonucleotide (1) According to the method described above, using a nucleic acid synthesizer ABI384 synthesizer (manufactured by Applied Biosystems), SEQ ID NOs: 2, 3, 4, 5, 7, DNA-type oligonucleotides having the nucleotide sequences shown in 8 and 9 were synthesized.
That is, the 3 ′ of each sequence immobilized on the polymer with an ester bond
A dimethyltritylated nucleoside having a terminal base was isolated using a 3% solution of dichloroacetic acid in methylene chloride for 1.5 days.
The mixture was treated for 10 minutes to carry out a dimethyltritylation reaction. Further, a phosphitylation reaction is performed for 10 minutes using a 0.2 mol solution of (2-cyanoethoxy)-(N, N-diisopropylamino) chlorophosphine and 0.2 mol of N, N-diisopropylethylamine in methylene chloride, This was a cyanoethoxy nucleotide. This was reacted with a solution of 0.4 mol of tetrazole in 90% acetonitrile aqueous solution for 5 minutes to perform tetrazolylation.
0.2 mole of 3'- having the second base from the 3 'end
The coupling of these nucleosides was carried out for 20 minutes using a 50% solution of amino-5'-dimethyltrityldeoxyribonucleoside and 0.2 mol of triethylamine in tetrachlorocarbon acetonitrile.

In the same manner as described above, nucleosides are sequentially linked in accordance with the respective base sequences, and finally the 5'-terminal nucleotide is dedimethyltritylated, decyanoethoxylated and ester hydrolyzed using a methanol-saturated solution of ammonia. Release of the oligonucleotide from the polymer was performed. The base sequence was previously input to the automatic synthesizer.

[0036]

Example 2 Production Example of Antisense Oligonucleotide (2) The reaction was carried out in the same manner as in Example 1 except that the monomer nucleoside was changed to 2'-acetyl-3'-amino-5'-dimethyltritylribonucleoside. Performed, SEQ ID NO: 10
An RNA-type oligonucleotide having the sequence shown in was prepared.

[0037]

Example 3 Production Example of Antisense Oligonucleotide (3) In the same manner as in Example 1, a DNA having a sequence in which two bases GG at the 5 ′ end of the base sequence shown in SEQ ID NO: 2 were replaced with TT
Type oligonucleotides were synthesized.

[0038]

Example 4 Anticancer action on leukemia cells (in vitro) For the oligonucleotides prepared in Examples 1 to 3,
The growth inhibitory effect was examined using HL-60 leukemia cells.
That is, RPMI supplemented with 10% FBS (fetal calf serum)
After culturing in 1640 medium, the cells washed twice with PBS (phosphate buffered saline) were added to 10% FBS-added RPM.
It was diluted with I1640 medium and adjusted to a concentration of 2 × 10 ⁵ cells / ml. To this were added various concentrations of the physiological saline solutions of the oligonucleotides produced in Examples 1 to 3, which were adjusted so that the final concentration became a predetermined concentration. Thereafter, the cells were cultured for one week at a temperature of 37 ° C. in a 5% carbon dioxide gas mixed gas atmosphere, and the number of cells was counted every day. From the number of cells 7 days after the start of the culture, the minimum concentration that inhibited cell growth by 100% was determined. Incidentally, the positive control is described in Japanese Patent Application Laid-Open No. Hei 6-21188.
No. 9 thiooligonucleotide of SEQ ID NO: 1 (21
), That is, the one in which the binding mode of the oligonucleotide of SEQ ID NO: 2 in Example 1 of the present invention was changed from phosphoramidate to phosphorothioether. Table 1 shows the results.

From these results, it can be seen that the oligonucleotide of the present invention has a carcinostatic action and that the oligonucleotide of the present invention has a better anticancer action than conventional oligonucleotides.

[0040]

[Table 1]

[0041]

Example 5 Anticancer action on colon cancer cells (in vitro) As in Example 4, colon cancer-derived cells LS174T were used to observe the growth inhibitory action. The minimum concentration for complete growth inhibition is shown in Table 2. This indicates that the oligonucleotide of the present invention has the same effect on colon cancer as leukemia.

[0042]

[Table 2]

[0043]

Example 6 Anticancer action on colon cancer cells (in vivo) Using colon cancer-derived cells LS174T, this was transplanted into nude mice (male, 5 mice per group), and the inhibitory effect of the present invention on the proliferation thereof. Was examined. That is, the preculture was performed and the concentration was 2 × 1
0 ⁷ cells / ml dispersion of cancer was adjusted to be injected into 0.1ml right dorsal skin transplanted cancer cells, was fed 7 days, it was used in the experiment. That is, 49.5% of peanut oil, 49.5% of physiological saline and 1% of Tween 80 were used so that the oligonucleotide had a final concentration of 10 mg / ml.
Of the sample mixed with the emulsified vehicle
The tumor was subcutaneously administered to the tumor and the left back skin, and the size of the tumor was measured after the administration. The average volume of the tumor in the oligonucleotide-administered group was subtracted from the average volume of the tumor in the non-administered group, and this value was divided by the average volume of the tumor in the non-administered group.

As the oligonucleotide of the present invention, the oligonucleotide having the sequence shown in SEQ ID NO: 2 was used, and as a control, the phosphorothioate type oligonucleotide shown in Example 1 was used. The growth inhibition rate of the oligonucleotide of the present invention was 71%, whereas that of the control oligonucleotide was 35%. Than this,
It can be seen that the oligonucleotide of the present invention has an excellent anticancer effect even in vivo. Further, no undesired toxicity was observed even after the administration of the oligonucleotide, which indicates that the therapeutic coefficient indicated by the safety and the effective concentration for the toxicity is high.

[0045]

Example 7 Effect of Combination of Plural Antisense Oligonucleotides Equimolarity of the oligonucleotide of the present invention having the sequence shown in SEQ ID NO: 2 and the oligonucleotide of the present invention having the sequence shown in SEQ ID NO: 3 in the same manner as in Example 4. For the mixture,
The anticancer effect on HL-60 was examined. The minimum concentration of cell growth inhibition is 0.4 μM (a mixture of 0.2 μM of the oligonucleotide of the present invention of SEQ ID NO: 2 and 0.2 μM of the oligonucleotide of the present invention of SEQ ID NO: 3), which has an effect more than the additive effect. I understand.

[0046]

The antisense oligonucleotide against the protein kinase A gene of the present invention has a high anticancer effect and is therefore very useful as an anticancer agent and a medical composition for treating cancer.

[0047]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 300 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: genomic DNA Antisense: NO sequence ATGGAGTCTG GCAGTACCGC CGCCAGTGAG GAGGCACGCA GCCTTCGAGA ATGTGAGCTC 60 TACGTCCAGA AGCATAACAT TCAAGCACTG CTCAAAGTGCT 120 GCTCGACCTG AGAGACCCAT GGCATTCCTC AGGGAATACT TTGAGAGGTT GGAGAAGGAG 180 GAGGCAAAAC AGATTCAGAA TCTGCAGAAA GCAGGCACTC GTACAGACTC AAGGGAGGAT 240 GAGATTTCTC CTCCTCCACC CAACCCAGTG GTTAAAGGTA GGAGGCGACG AGGTGCTATC

SEQ ID NO: 2 Sequence length: 21 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic orico-nucleotide Antisense: YES sequence GGCGGTACTG CCAGACTCCA T 21

SEQ ID NO: 3 Sequence length: 12 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic orico-nucleotide antisense: YES sequence AGGAGGAGAA AT 12

SEQ ID NO: 4 Sequence length: 18 Sequence type: Number of nucleic acid chains: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic orico-nucleotide Antisense: YES sequence CCTGAGGAAT GCCATGGG 18

SEQ ID NO: 5 Sequence length: 30 Sequence type: number of nucleic acid chains: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic oriconucleotide antisense: YES sequence TTCTCGAAGG CTGCGTGCC TCCTCACTGGC 30

SEQ ID NO: 6 Sequence length: 300 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Genomic DNA Antisense: YES sequence GATAGCACCT CGTCGCCTCC TACCTTTAAC CACTGGGTTG GGTGGAGGAG GAGAAATCTC 60 ATCCTCCCTT GAGTCTGTAC GAGTGCCTGC TTTCTGCAGA TTCTGAATCT GTTTTGCCTC 120 CTCCTTCTCC AACCTCTCAA AGTATTCCCT GAGGAATGCC ATGGGTCTCT CAGGTCGAGC 180 AGTGCACAAC TGCACAATAG AATCTTTGAG CAGTGCTTGA ATGTTATGCT TCTGGACGTA 240 GAGCTCACAT TCTCGACGGC TGCGGCGCTCGTCGTCGCTCGCTCGCTCGCTCGCTCGCTCGCTCTCTCGATCGCTCTCTCGATCGCTCTCTCGATCTC

SEQ ID NO: 7 Sequence length: 21 Sequence type: nucleic acid Chain length: single stranded Topology: linear Sequence type: other nucleic acid Synthetic oriconucleotide antisense: No sequence ATGGAGTCTG GCAGTACCGC C 21

SEQ ID NO: 8 Sequence length: 12 Sequence type: nucleic acid Chain length: single stranded Topology: linear Sequence type: other nucleic acid Synthetic orico-nucleotide antisense: No sequence ATTTCTCCTC CT 12

SEQ ID NO: 9 Sequence length: 18 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Antisense: No Sequence type: Other nucleic acid Synthetic oriconucleotide sequence CCCATGGCAT TCCTCAGG 18

SEQ ID NO: 10 Sequence length: 21 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic orico-nucleotide Antisense: YES sequence GGCGGUACUG CCAGACUCCA U 21

Claims (12)

[Claims] 1. An oligonucleotide having a base sequence at least partially complementary to all or part of the sequence of the human protein kinase A gene, and having a structure represented by the general formula (I). Embedded image (In the general formula (I), n represents an integer, R ₁ represents a hydrogen atom or a hydroxyl group, and B represents a nucleic acid base.) 2. The oligonucleotide according to claim 1, wherein the part of the human protein kinase A gene is a regulatory part of human protein kinase A or a sequence encoding a part thereof. 3. The oligonucleotide according to claim 1, wherein the regulatory part is RI-α. 4. The oligonucleotide according to claim 3, which has a nucleotide sequence at least partially complementary to the nucleotide sequence of the coding chain of the human protein kinase A-RIα gene shown in SEQ ID NO: 1. 5. The oligonucleotide according to claim 3, which has a nucleotide sequence at least partially complementary to the nucleotide sequence of the non-coding strand of the human protein kinase A-RIα gene shown in SEQ ID NO: 6. 6. The oligonucleotide according to any one of claims 1 to 5, wherein the size is 9 to 40 mer. 7. The oligonucleotide according to claim 4, which has a nucleotide sequence substantially identical to the nucleotide sequence shown in SEQ ID NOs: 2 to 5 or 10. 8. The oligonucleotide according to claim 7, wherein the nucleotide sequence is any of the nucleotide sequences shown in SEQ ID NOs: 2 to 5 or 10. 9. The oligonucleotide according to claim 5, which has a nucleotide sequence substantially identical to the nucleotide sequence shown in SEQ ID NOs: 7 to 9. 10. The oligonucleotide according to claim 9, wherein the nucleotide sequence is any of the nucleotide sequences shown in SEQ ID NOs: 7 to 9. An anticancer agent comprising the oligonucleotide according to any one of claims 1 to 10. 12. A pharmaceutical composition for treating cancer, comprising at least one selected from the anticancer agents according to claim 11.