JPH11332578A - Device and method for separating cell - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a device for separating CD34-positive cells or the like useful in collecting hematopoietic undifferentiated cells, lymphocyte removal from cells for bone marrow transplantation, and detecting leukemic cells, etc., by using a chimeral antibody, single-stranded antibody, or a combination thereof. SOLUTION: This device for separating CD34-positive cells is such one as to use a chimeral antibody produced from the gene of an anti-CD34 antibody, wherein CDR-1, CDR-2 and CDR-3 in the H-strand variable region are amino acid sequences of formula I, formula II and formula III, respectively, CDR-1, CDR-2 and CDR-3 in the L-strand variable region are amino acid sequences of formula IV, formula V and formula VI, respectively, and the Fc region is of human type, a single-stranded antibody, or a combination thereof. This device is effectively usable in the medical, field such as the collection of hematopoietic undifferentiated cells, lymphocyte removal from cells for bone marrow transplantation, and the detection of leukemic cells.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a method for detecting cells, a method for separating cells, and a device using a recombinant antibody, more specifically, a recombinant antibody against human CD (Cluster differentiation) 34 antigen.

[0002]

2. Description of the Related Art Conventionally, human CD34 has been reported as a cell surface antigen of hematopoietic undifferentiated cells, and an anti-MY10 antibody-producing hybridoma has been known as a cell producing an antibody recognizing the human CD34 molecule (USP-4965204, and J.Immunolo
gy, 133, 157, 1984). Then, anti-human CD
Many antibodies have been reported, and their application to the isolation of hematopoietic undifferentiated cells in the medical field such as bone marrow transplantation has been attempted. In order to effectively utilize such medical applications, it has been necessary to efficiently produce anti-human CD34 antibodies and develop medical devices using the antibodies.

[0003] Ordinary antibodies are composed of two kinds of polypeptides, large and small, and the larger subunit is called "H chain", and the smaller subunit is called "L chain". Also,
Each peptide is composed of a "variable region" (or "V region") present on the N-terminal side to form an antigen binding site, and a certain "constant region" (or "Fc") for each antibody class. . The variable regions are further divided into complementarity-determining regions “CDRs”, which are particularly closely related to the formation of antigen-binding sites, and framework regions “frameworks” interposed therebetween. The CDR contains N chain for each of the heavy and light chains.
"CDR-1""CDR-2""CDR-
It is known that there are three regions called "3". FIG. 1 shows a schematic structural diagram of IgG.

[0004] The CD34 molecule is known as an antigen marker for undifferentiated cells expressed on undifferentiated cells of blood, and its application to the isolation of undifferentiated cells has been reported (S. Saeland).
Et al., Blood, 72, 1580, 1988). further,
Medical devices are being developed to separate undifferentiated cells from differentiated cells and cancer cells by using a combination of anti-CD34 antibody and biotin, avidin, or magnetic beads (Dreger et al., ExpHematol. , 23 volumes, 147
P. 1995).

[0005]

[0005] Antibodies are generally known to have strong binding to antigens and high specificity, and are expected to be used for medical treatment. However, the cost of producing antibodies has become a problem when creating medical devices. It is necessary to produce antibodies efficiently and apply them to medical devices. Therefore, as a method for efficiently producing antibodies, it is expected to establish a technique for producing a recombinant antibody and apply it to medical devices. An object of the present invention is to provide an apparatus for separating cells, particularly human CD34-positive cells, using a recombinant antibody, specifically, a novel antibody against the human CD34 antigen, and a method for separating or detecting the cells using the apparatus. Is to provide.

[0006]

Means for Solving the Problems Ordinary antibodies existing in a living body need two antigen-specific variable region base sequences and constant region genes. Although a small number of classes are known as constant region genes, the variable region base sequences of H and L chains are extremely diverse, and obtaining the target variable region base sequence requires a great deal of labor. However, the present inventors have obtained a gene for the objective human CD34 antigen from a plurality of antibody genes in a hybridoma by making full use of gene amplification (PCR) and a binding experiment using a flow cytometer. The sequence and function were determined as follows. Furthermore, it has made it possible to produce human mouse chimeric antibodies and single-chain antibodies in large quantities by recombining the gene.

That is, the gene sequence of the variable region of the H chain of the anti-MY10 antibody and the amino acid sequence encoded thereby are shown in SEQ ID NO: 1 in the Sequence Listing. Amino acid 1 of SEQ ID NO: 1 in Sequence Listing
# 30 to # 1 for Framework 1, # 31 to # 35 for CDR
-1, 36th to 49th positions are Framework 2, 50th to 65th positions are CDR-2, 66th to 97th positions are Framework 3, 98th to 106th positions are CDR-3, 107th to 117th positions are Frame. Work 4 is shown.

[0008] The gene sequence of the variable region of the L chain of the MY10 antibody and the amino acid sequence encoded thereby are shown in SEQ ID NO: 2 in the Sequence Listing. Amino acids 1 to 23 of Sequence Listing SEQ ID NO: 2 are framework 1 and positions 24 to 39 are CDR-
1, 40th to 54th are Framework 2, 55th to 61st are CDR-2, 62nd to 93rd are Framework 3, 94th to 102nd are CDR-3, 103th to 113th are Framework 4 is shown.

[0009] The gene sequence of the single-chain antibody and the amino acid sequence encoded thereby are shown in SEQ ID NO: 3 in the Sequence Listing. The amino acid sequence from position 1 to position 39 of SEQ ID NO: 3 contains a signal for secretion from Escherichia coli, positions 40 to 156 are variable regions of the H chain, positions 157 to 171 are linkers, and positions 172 to 284.
The position indicates the variable region of the L chain, and positions 285 to 302 indicate a sequence containing an E-tag.

The pCANTAB5E plasmid (Pharmacia)
Is a sequence containing a part of the H chain L chain as a linker, that is, 14
Positions 0 to 169 are prepared, and the sequence was used in the present invention. The linker that binds to the H chain and the L chain is included in the plasmid of the present invention, but can be used without being limited to such a sequence. Methods for isolating single-chain antibodies from hybridomas are described in Recombinant Phage An
In some cases, a tibody System kit (Pharmacia) or the like can be used. However, when there is no human CD34 antigen required for screening as in the present invention, the kit cannot be used effectively, and many contrivances are required.

The present invention relates to the following cell separation device and a method for separating or detecting cells using the same. (1) A cell separation device using a chimeric antibody, a single-chain antibody, or an antibody obtained by combining them. (2) The CDR-1 of the H chain variable region is Ser-His-Gly-Val-Hi
s (SEQ ID NO: 5), CDR-2 is Val-Ile-Trp-Gl
y-Ala-Gly-Arg-Thr-Asp-Tyr-Asn-Ala-Ala-Phe-Ile-Ser
(SEQ ID NO: 6), wherein CDR-3 is Asn-Arg-Tyr-Glu-Ser-
This is an amino acid sequence represented by Tyr-Phe-Asp-Tyr (SEQ ID NO: 7), wherein CDR-1 of the L chain variable region is Arg-Ser-Ser-Gl.
n-Asn-Leu-Val-His-Ser-Asn-Gly-Asn-Thr-Tyr-Leu-His
(SEQ ID NO: 8), wherein CDR-2 is Lys-Val-Ser-Asn-Arg-P
he-Ser-Gly-Val-Pro-Asp-Arg-Phe (SEQ ID NO: 9), C
DR-3 is an amino acid sequence represented by Ser-Gln-Ser-Thr-His-Val-Pro-Leu-Thr (SEQ ID NO: 10), and a cell separation device using an antibody having a human Fc region. (3) CDR-1 of the H chain variable region is Ser-His-Gly-Val-Hi
s (SEQ ID NO: 5), CDR-2 is Val-Ile-Trp-Gl
y-Ala-Gly-Arg-Thr-Asp-Tyr-Asn-Ala-Ala-Phe-Ile-Ser
(SEQ ID NO: 6), wherein CDR-3 is Asn-Arg-Tyr-Glu-Ser-
This is an amino acid sequence represented by Tyr-Phe-Asp-Tyr (SEQ ID NO: 7), wherein CDR-1 of the L chain variable region is Arg-Ser-Ser-Gl.
n-Asn-Leu-Val-His-Ser-Asn-Gly-Asn-Thr-Tyr-Leu-His
(SEQ ID NO: 8), wherein CDR-2 is Lys-Val-Ser-Asn-Arg-P
he-Ser-Gly-Val-Pro-Asp-Arg-Phe (SEQ ID NO: 9), C
A cell separation device using a single-chain antibody in which DR-3 is an amino acid sequence represented by Ser-Gln-Ser-Thr-His-Val-Pro-Leu-Thr (SEQ ID NO: 10). (4) The cell separation according to any one of (1) to (3) above, wherein the antibody is obtained by adding an amino acid sequence containing a basic amino acid or an acidic amino acid to the C-terminus, the N-terminus or both of the amino acid sequence of the antibody. apparatus.

(5) A method for separating human CD34-positive cells using a chimeric antibody, a single-chain antibody, or an antibody obtained by combining them, or a method for detecting such cells. (6) CDR-1 of the H chain variable region is Ser-His-Gly-Val-Hi
s (SEQ ID NO: 5), CDR-2 is Val-Ile-Trp-Gl
y-Ala-Gly-Arg-Thr-Asp-Tyr-Asn-Ala-Ala-Phe-Ile-Ser
(SEQ ID NO: 6), wherein CDR-3 is Asn-Arg-Tyr-Glu-Ser-
This is an amino acid sequence represented by Tyr-Phe-Asp-Tyr (SEQ ID NO: 7), wherein CDR-1 of the L chain variable region is Arg-Ser-Ser-Gl.
n-Asn-Leu-Val-His-Ser-Asn-Gly-Asn-Thr-Tyr-Leu-His
(SEQ ID NO: 8), wherein CDR-2 is Lys-Val-Ser-Asn-Arg-P
he-Ser-Gly-Val-Pro-Asp-Arg-Phe (SEQ ID NO: 9), C
DR-3 is an amino acid sequence represented by Ser-Gln-Ser-Thr-His-Val-Pro-Leu-Thr (SEQ ID NO: 10), and is human CD34 positive using an antibody having a human Fc region. A method for separating cells or a method for detecting the cells. (7) CDR-1 of the H chain variable region is Ser-His-Gly-Val-Hi
s (SEQ ID NO: 5), CDR-2 is Val-Ile-Trp-Gl
y-Ala-Gly-Arg-Thr-Asp-Tyr-Asn-Ala-Ala-Phe-Ile-Ser
(SEQ ID NO: 6), wherein CDR-3 is Asn-Arg-Tyr-Glu-Ser-T
It is an amino acid sequence represented by yr-Phe-Asp-Tyr (SEQ ID NO: 7), wherein CDR-1 of the L chain variable region is Arg-Ser-Ser-Gl.
n-Asn-Leu-Val-His-Ser-Asn-Gly-Asn-Thr-Tyr-Leu-His
(SEQ ID NO: 8), wherein CDR-2 is Lys-Val-Ser-Asn-Arg-P
he-Ser-Gly-Val-Pro-Asp-Arg-Phe (SEQ ID NO: 9), C
Method for separating human CD34-positive cells using a single-chain antibody in which DR-3 contains an amino acid sequence represented by Ser-Gln-Ser-Thr-His-Val-Pro-Leu-Thr (SEQ ID NO: 10) Or a method for detecting the cell. (8) The human CD34-positive according to any of (5) to (7) above, wherein an amino acid sequence containing a basic amino acid or an acidic amino acid is added to the C-terminus, the N-terminus or both of the amino acid sequence of the antibody. A method for separating cells or a method for detecting the cells.

The term "antibody" as used in the present invention means not only an antibody which is usually present in a living body but also at least one antigen-binding site formed by a variable region of an H or L chain of the antibody or a combination thereof. Including molecules. For example, a peptide containing only the variable region of the H chain, an F chain consisting of a pair of H and L chains
ab, two sets of H chain fragments and L chains (Fab ′) 2, a single chain antibody “ScFv” in which H chain fragments and L chains are linked in series on the same peptide, and the like.

The term "chimeric antibody" used in the present invention refers to an antibody obtained by artificially combining amino acid sequences of antibodies of different animal species. For example, CDRs derived from mouse hybridomas
And an antibody comprising a human antibody-derived amino acid sequence in the constant region. In addition, the framework can include amino acid sequences of human origin. In the present invention, "human CD"
34 antigen '' was reported by Civin et al. (USP-4965204,
And J. Immunology, 133, 157, 1984)
It is known as an antigen marker for hematopoietic undifferentiated cells expressed on undifferentiated cells of blood.

"Substantially the same function" as used in the present invention means:
It means that the epitope on the antigen molecule and the binding force to the antigen are substantially the same. It is known that amino acid substitutions in the framework and constant regions of the variable region often produce antibodies of essentially the same performance.
The antigen specificity of an antibody and the strength of its binding
Is determined by the humanization of a mouse antibody (Gussow, D. and Seemann, G., Meth.
ods in Enzymology, 203: 99-121 (1991); Glaser, SM et.
al., J. Immunology 149: 2607-2614 (1992)).

As a method for producing a recombinant antibody, for example, COS7
Various vectors can be used for antibody expression by cells (Whittle, N. and Adair, J. et al. (1987), Protein
Eng., 1 (6), 499-505 .; Sutter, KDand Feys, V. et al.
(1992), Gene 113, 223-30.) For example, using a human antibody expression plasmid (pG1), a human mouse chimeric anti-human C
A plasmid pG1My10 capable of expressing the D34 antibody can be prepared. This can be transfected into COS7 cells to produce a human anti-CD34 antibody. The term "human mouse chimeric antibody" as used herein refers to an antibody produced by a gene whose variable region is a hybridoma-derived mouse gene sequence and whose constant region is composed of a human-derived gene sequence. The expression plasmid pG-1 was prepared using pS described in International Publication WO95 / 15393.
This plasmid is modified so that the transmembrane domain (TM) added to the sequence of human Cγ1 of the E plasmid is removed and secreted into the body like a normal antibody. The details of the creation are described as reference examples. That is, the plasmid has a gene sequence encoding a human constant region, and can express a human mouse chimeric antibody by connecting a mouse variable region gene.

COS7 cells are usually 10% fetal calf serum (FCS)
Dulbecco's Modified Eagle's Medium (DMEM
Medium) at 37 ° C. in the presence of 5% CO ₂ . COS7
Methods for gene transfer into cells and breeding and production of cells after gene transfer are described in Biomanual Series 4 Gene Transfer and Expression / Analysis Methods; described in experimental books such as Yokota, T., Arai, and Yodosha (1994). I have. The method of gene transfer into COS7 cells
Electroporation, DEAE dextran method (Bebbington, CR
(1991); METHODS: A Companion to Methods in Enzymolo
gy, 2 (2), 136-45.)

According to the practice of the present invention, the expression plasmid pG
Since the constant region gene integrated in 1 is Cγ1,
Each clone expresses as IgG1. When producing antibodies,
To avoid contamination of serum-derived bovine antibodies, serum-free D
It is desirable to culture in a MEM medium. The anti-CD34 antibody secreted into the culture supernatant in this manner can be easily purified by a general IgG antibody purification method using, for example, protein A or protein G. CHO cells and myeloma Sp2 / 0 cells are well known as hosts for industrial production (Xiang, J. et al. (1990) Mol.
n., 27,809; Bebbington, CR et al. (1992) Bio / techn.
ology, 10, 169; Larrick, JWand Wallace, EF et al. (1
992) Imunol. Rev. 130, 69-85 .; Deyev, SMandLieber, A.
et al. (1994) Appl. Biochem. Biotechnol. 47 (2-3), 143-
54.). For example, in CHO cells, a method for selecting a highly productive clone with a drug such as MTX has been reported.
(Bebbington, CR (1991) METHODS: A Companion to Met
hods in Enzymology, 2 (2), 136-45.), if a stable high-producing strain can be obtained, the strain can be used for industrial production of a recombinant anti-human CD34 antibody.

As the shape of the antibody, it is possible to use the produced antibody molecule as it is, but it is possible to use Fab, F which is a fragment containing an antigen binding site obtained by various protease treatments.
(ab ') 2, Fv or Fd can also be applied.
About these fragments, "Introduction to Antibody Engineering" (by Kanemitsu,
p20-22, Citizens' Library). In addition, when the present invention is applied to extracorporeal circulation of blood in a human body, it is necessary to consider the side effects when antibodies are released into the blood, to consider the antigenicity, etc., and to make the portion other than the variable region a humanized antibody. It is also useful to use chimeric antibodies. The method for producing these antibodies is not particularly limited, but a highly purified one must be used. The method for producing a monoclonal antibody may be a method in which a hybridoma is usually grown in the abdominal cavity of a mouse to recover the antibody produced from ascites, or a method obtained from a culture supernatant cultured in a serum-free medium. In the case of a fragmented peptide, it can be obtained by enzymatic treatment of an antibody molecule, but it can also be produced by bacteria, yeast, and the like by genetic engineering techniques.
By combining the monoclonal antibody, monoclonal antibody-derived antibody fragment, peptide, etc. obtained by these methods, stronger binding properties are produced.

The CD34 molecule was reported by Civin et al.
SP-4965204, and J. Immunology, 133, 157,
1984), and is known as an antigen marker for undifferentiated cells specifically expressed on blood undifferentiated cells. Attempts to isolate undifferentiated cells using this antigen marker have been reported (S. Saeland et al., Blood, 72, 1580).
P., 1988). Furthermore, medical devices that combine anti-CD34 antibodies with biotin, avidin, or magnetic beads to separate undifferentiated cells from differentiated cells and cancer cells are being developed (Dreger et al., ExpHematol.
Magazine, 23, 147, 1995).

Hematopoietic undifferentiated cells (CD) isolated in the present invention
34 positive cells) are cells that can proliferate under a specific stimulus, and indicate cells that can differentiate mature cell groups such as erythrocytes, monocytes, granulocytes, lymphocytes, and macrophages into one or more types. In particular, when cultured in a semi-solid medium in the presence of an appropriate growth factor, it includes undifferentiated blood cells that form colonies and hematopoietic stem cells that have the ability to differentiate into all lineages and have the ability to self-proliferate. The cells are abundant in bone marrow and cord blood. The cells are also contained in peripheral blood, but can be induced in peripheral blood by administering a cytokine such as granulocyte colony forming factor (G-CSF). In addition, a technique for culturing these cells to proliferate undifferentiated hematopoietic cells in vitro has been reported. The cell suspension containing these hematopoietic undifferentiated cells can be a material for separating hematopoietic undifferentiated cells according to the present invention.
Hematopoietic undifferentiated cells can be separated using the cell separation device of the present invention as a medical device. Hematopoietic undifferentiated cells can be efficiently separated from the blood cell suspension outside the body or from the blood by extracorporeal circulation, and the separated cells can be used for treatment of various diseases.

The required hematopoietic undifferentiated cells are isolated or concentrated from a solution containing various cell types such as blood,
Alternatively, removing unnecessary cells is an effective means for enhancing medical effects. Bone marrow transplantation is a method of transplanting normal hematopoietic undifferentiated cells into cancer patients such as leukemia patients with myeloablation and innate immune diseases such as aplastic anemia. It is taking root. Recently, a method is used in which hematopoietic undifferentiated cells are obtained not only from bone marrow but also from peripheral blood and cord blood. Allogeneic bone marrow transplantation is a leukocyte-type HLA
This method involves injecting bone marrow fluid collected from healthy individuals of almost the same type into patients whose bone marrow has been destroyed by anticancer drugs or radiation. The problem with this is that it causes GVHD (graft host disease), a rejection reaction That is. Therefore, isolation of hematopoietic undifferentiated cells to prevent autologous bone marrow transplantation in recent years in the treatment of hematopoietic malignancies and cancer, or graft-versus-host disease (GVHD) caused by allogeneic bone marrow transplantation Demand is growing.

At present, as a method for separating cells, a method for specifically separating only target cells using an antibody is being developed. For example, a fluorescent antibody-labeled cell separation method, a method in which a ligand having an affinity for a target cell is immobilized on a water-insoluble carrier, and the target cell is directly or indirectly bound to the ligand,
There are a separation method using an immunoadsorption column and a separation method using immunomagnetic beads. In the fluorescent antibody-labeled cell separation method, first, a cell mixture is incubated with a fluorescent-labeled monoclonal antibody that recognizes a membrane antigen expressed on a target cell, and then the treated cells are irradiated with a laser beam using a cell sorter or the like. This is a method of separating cells to which a fluorescent antibody is bound by applying the fact that only cells to which an antibody is bound emit fluorescence.

A method in which a monoclonal antibody against an antigen present on the membrane surface of a target cell is directly immobilized on the surface of a separation device, and a method in which a cell mixture is first incubated with a monoclonal antibody that binds to a membrane antigen on the target cell; International Patent Publication WO 87-04628 describes a method of treating a ligand such as an anti-immunoglobulin antibody that binds to an antibody on a cell surface with a cell separation device having immobilized thereon. Cell separation is a cell separation method performed by directly or indirectly binding the antigen-positive cells to a monoclonal antibody immobilized on a carrier or a device. In these methods, the antibody is separated on a plastic petri dish on which the antibody is immobilized, and the cell mixture is first poured onto the plastic petri dish on which the antibody is immobilized, and the antibody is bound to the membrane antigen on the target cell. To be incubated for. After the incubation, the plastic dish is washed to remove unbound cells and separated. In the immunoadsorption column method, a ligand such as an antibody against a membrane antigen on a target cell is immobilized on the surface of a bead, and this is packed in a column to perform cell separation.

A biotin-labeled antibody against a membrane antigen on a target cell is added to a cell mixture, and the mixture is incubated to form a cell-antibody-biotin bond. Then, avidin is immobilized on a porous acrylamide gel. International Patent Publication WO 91-16116 describes a method for separating target cells by passing through a column filled with the beads and utilizing the strong binding of biotin-avidin to bind the target cells to the column. In the immunomagnetic bead method, target cells are labeled with magnetic beads by first incubating a cell mixture with magnetic beads to which antibodies are bound. After labeling, the labeled cells are separated from the unlabeled cells using a magnetic device.

For example, biotin or magnetic beads are bound to an antibody to be immobilized on cells in advance, and then reacted with a substance which easily binds to the biotin or magnetic beads, for example, avidin or a water-insoluble carrier containing or containing magnetism. This makes it possible to easily recover the water-insoluble carrier to which the cells are bound. In addition, the desired hematopoietic undifferentiated cells
By allowing the D34 antibody to react and reacting with the water-insoluble carrier to which the anti-immunoglobulin antibody is bound, and washing or collecting the water-insoluble carrier, only the target cells can be selectively separated. If an antibody immobilized on magnetic beads, which is a water-insoluble carrier, is used, the efficiency of separation can be increased by a magnet or the like. Examples of the shape of the container used in the present invention include a column filled with a water-insoluble carrier, a flask, or a flask-shaped case filled with a water-insoluble carrier. A separator for hematopoietic undifferentiated cells can be prepared by combining these container shapes with an insoluble carrier to which these antibodies are directly or indirectly immobilized. In addition, these separators can be made highly utilizable as a cell separation system by combining with a pump for flowing a cell suspension, physiological saline, or the like.

When the antibody is immobilized on the water-insoluble carrier, it is also useful to bond the antibody and the water-insoluble carrier via a spacer. Furthermore, if necessary, the water-insoluble carrier and the compound may be bound via a molecule (spacer) of any length (for details of the spacer, for example,
Affinity chromatography (see Kazui Kaichi et al., Tokyo Kagaku Dojin Press, 1991, pp. 105-108). Examples of the spacer include a polymethylene chain and a polyethylene glycol chain. The length of the spacer is preferably not more than 500 °, more preferably not more than 200 °. As a method of binding a compound to a water-insoluble carrier via a spacer, for example, when agarose is used as a water-insoluble carrier, a hydroxyl group of agarose is reacted with an isocyanate group on one side of hexamethylene diisocyanate used as a spacer. A method of reacting and bonding the remaining isocyanate group with the amino group, hydroxyl group or carboxyl group of the antibody.

The term "water-insoluble carrier" as used in the present invention means a carrier which is in a solid form in an aqueous solution at normal temperature, and may have any shape. Spherical, cubic, planar,
Examples thereof include chips, fibers, flat membranes, sponges, and hollow fibers. Of these, spherical and granular, from the viewpoint of ease of close packing, relatively easy retention of antibodies on the surface, relatively large effective area, and distribution of cell suspension Is desirable.

The material of the water-insoluble carrier may be any of inorganic and organic compounds as long as it can retain the antibody on the surface. Organic polymer compounds are preferred because of their ease. Examples of such polymers include polymers and copolymers of vinyl compounds such as polypropylene, polystyrene, polymethacrylate esters, polyacrylate esters, polyacrylic acid, and polyvinyl alcohol; polyamide compounds such as nylon 6 or 66; and polyethylene terephthalate. And a plant-derived polysaccharide-based compound such as cellulose. Further, by combining these with a magnet, it is possible to easily recover these water-insoluble carriers.

On the surface of the water-insoluble carrier, the antibody is covalently bonded to the surface of the water-insoluble carrier by a chemical or grafting method using radiation or an electron beam, or a functional group on the surface of the water-insoluble carrier is produced by a chemical method. Via a covalent bond. Among them, a copolymerization bonding method via a functional group is preferable because there is no danger of elution of the antibody during use.
When the water-insoluble carrier has a coating layer, it can be insolubilized on the surface of the coating layer. Examples of a method for obtaining a functional group on the surface of the water-insoluble carrier or its coating layer include a cyanogen halide method, an epichlorohydrin method, a bisepoxide method, a bromoacetyl bromide method, and a halogenated acetamide method. Specific examples include an amino group, a carboxyl group, a hydroxyl group, a thiol group, an acid anhydride, a succinylimide group, a substitutable halogen group, an aldehyde group, an epoxy group, and a tresyl group. The Bromcian method and the N-hydrosuccinimide group method are particularly desirable for ease of immobilization of the antibody. Examples of the container shape used in the present invention include a column filled with a water-insoluble carrier, a flask, or a flask-shaped case filled with a water-insoluble carrier.

A carrier on which two or more kinds of antibodies recognizing different antigen molecules on the same cell are directly immobilized may be used. CD34 molecule and other molecules expressed in undifferentiated cells, for example, c-kit which is a receptor for SCF (Yarden et al., EMBO J., 6, p. 3341, 19)
1987), Receptor FLK-2 (Mathews et al., Cell magazine, 65 volumes,
1143, 1991), interleukin-3 receptor α
Combinations with chains (Kitamura et al., Cell magazine, 66, 1165, 1991) and the like are also possible. These molecules also have very low expression frequency and poor separation efficiency. However, by combining an antibody together with the CD34 molecule, these expressing cells can be isolated.

By combining genes of variable regions derived from other antibodies, it becomes possible to produce bispecific antibodies and multispecific antibodies. Multispecific refers to an antibody having at least two or more antigen binding sites that recognize different antigens or epitopes. Among them, bispecific refers to an antibody having two types of antigen-binding sites that recognize different antigens or epitopes. For example, one antigen-binding site of a normal antibody recognizes the CD34 antigen, and the other antigen-binding site is bispecific for the lymphocyte antigen CD3, etc., and makes CD34-positive leukemia cells more strongly recognize lymphocytes. Can induce an anti-leukemia effect. In addition to CD3, pan-lymphocyte markers such as CD2, CD4, CD5, CD
6, CD7, etc. can be used. By combining these, I
When expressed as gM, bispecific and multispecific antibodies can be prepared. In addition to bispecific production during such production, a monoclonal antibody can be produced and purified, and then the antibodies can be combined to produce a bispecific or multispecific antibody.

In the case of a single-chain antibody, it is possible to make it bispecific or multispecific at the time of production, and by repeatedly arranging H chains and L chains of a combination of a plurality of antigen recognition sites in one peptide. Can be produced. It can be combined after production and purification. Regardless of the combination of the H chain and the L chain, a peptide consisting only of the H chain or only the L chain can be used. Such an antibody species can be selected depending on the intended use, and can be selected based on the binding strength, antigenicity and the like.

These include not only different antigens, but also different epitopes within the same molecule, such as different anti-C
It is also possible to combine D34 antibodies. Anti-CD3
Several antibodies have been reported. For example, anti-HPCA-2 antibody (Becton Dickinson), anti-HPCA-1 antibody (Becton Dickinson), 4A1 (Nichirei), B1.3C5
(Katz et al., Leuk. Res. 9: 191, 1985), 12.
8, 115.2 (Andrews et al., Blood, 67, 842, 1986
), ICH3 (Watt et al., Leukaemia, Vol. 1, p. 417, 19
1987), Tuk3 (Unchanska-Ziegler et al., Tissue Antigen
s, 33, 230, 1989), QBEND10 (Fina et al., Blood
75, 2417, 1990), CD34 (Ab-1) (Oncogene Sci.
ences), Immu-133 (Barrande et al., Hybridoma, 12
Vol. 203, 1993), and these antibody genes can be isolated and used for production.

One feature of the present invention is that a recombinant antibody is used. By using the recombinant antibody, the antibody can be modified into an antibody which can be easily immobilized on an insoluble carrier. By adding an amino acid sequence to the C-terminus or N-terminus of the peptide constituting the antibody, it can be efficiently immobilized on a substrate such as an insoluble carrier. In the case of a human mouse chimeric antibody, a sequence containing a basic or acidic amino acid is added as a sequence that the original antibody did not have at the C-terminus or N-terminus of the H chain or L chain, or a combination thereof. . Even when the sequence is genetically modified to a basic or acidic amino acid in the middle of the Fc portion, the C-terminal side including the modified portion can be regarded as an added amino acid sequence. Not only human mouse chimeric antibody, Fc
Facilitating binding of the moiety to the insoluble carrier is suitable for making separators and the like.

In a single-chain antibody, it is desirable to add a sequence for immobilization to a substrate at the C-terminus or N-terminus of the peptide. The amino acid contained in the sequence to be added is preferably a sequence containing a basic amino acid or an acidic amino acid, but any amino acid for immobilization to a substrate is included in the present invention.

The basic amino acids include lysine, hydroxylysine, arginine, histidine and the like. Examples of the acidic amino acid include aspartic acid and glutamic acid. In particular, utilizing lysine, glutamic acid, and aspartic acid is more efficient. The length of the sequence is not particularly limited, but it is also effective to add one amino acid such as lysine, aspartic acid or glutamic acid. However, it is more effective to add a sequence containing a plurality of these amino acids. 1
When added to a small molecular weight antibody such as a main chain antibody,
By adding a longer sequence to some extent, steric hindrance when the antibody binds to the antigen after immobilization to the substrate is reduced, and the effect as a separator is expected more. Antibodies added to this sequence, in order to facilitate the binding of a dye or the like for detection,
By detecting the antibody bound to the antigen, the antigen can be detected and measured.

[0038]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, embodiments of the present invention will be described. However, these embodiments further illustrate the present invention with specific examples, but do not limit the present invention.

[0039]

[Reference Example] A pG1 plasmid was prepared. Expression vector pSE for membrane-bound human antibody (WO95 / 153)
93) to remove the transmembrane region (TM) to prepare a vector capable of secretory expression of a human antibody. First, the expression vector pS
After digestion of E with the restriction enzyme SalI, the cut ends were blunted. This reaction was performed using DNA Blunting Kit (Takara Shuzo) according to the attached protocol. After digesting the expression vector pSE treated as described above with the restriction enzyme ApaI, 0.7%
Electrophoresis was performed on an agarose gel, and the pSE vector DNA from which the gene region including the Cγ1 gene and the transmembrane region (TM) had been deleted was extracted and purified. GeneCleanII for this reaction
Using Kit (Funakoshi), the operation was performed according to the attached protocol. The restriction enzyme-cleaved end of the extracted pSE vector was treated with bovine alkaline phosphatase (Takara Shuzo) so as not to cause self-cyclization. Next, human Cγ
Plasmid DNA pUCC incorporating the full length of one gene
G1 was digested with the restriction enzyme KpnI (Takara Shuzo), the cut ends were blunt-ended, and then digested with the restriction enzyme ApaI. The reaction product was electrophoresed on a 0.7% agarose gel, and a DNA fragment containing the full length of the Cγ1 gene was extracted and purified. This DNA fragment and the pSE vector that had been subjected to the above treatment were ligated using a ligation kit Ver.2 (Takara Shuzo), and the ligation reaction product was introduced into Escherichia coli DH5 strain. Several colonies were selected from the appearing colonies and cultured, and plasmid DNA was extracted and purified according to a conventional method. Using appropriate restriction enzymes present in the expression vector pSE, examine the cleavage patterns of these plasmids,
Those that matched the expected pattern were selected. The plasmid obtained by the above operation was designated as pG1. FIG.
The figure of the pG1 plasmid is shown in FIG.

[0040]

Example 1 Hybridoma for Isolating Antibody Gene
Anti-My-10 (ATCC HB-8483) is a 10% fetal bovine serum (Flow
Was added to RPMI-1640 medium (Gibco). For the hybridoma, clones were separated in advance by the ultradilution method, and the culture supernatant was measured to select a clone having high binding to human acute myeloid leukemia cell KG-1a. Total RNA was obtained from 6 × 10 ⁷ cells by the AGPC method (Chomczynsk
i, P. and Sacchi, N. (1987) Single-step method of RNA i
solation by acid guanidinium thiocyanate-PhOH-chlo
roform extraction. Anal. Biochem. 162, 156-159.). Furthermore, the isolated RNA Kara mRNAm QuickPrep mRNA
It was isolated using Purification Kit (Pharmacia). Using the obtained mRNA as a template, 1st strand cDNA was synthesized. This was performed using a cDNA Synthesis Kit (Pharmacia) according to the attached instructions.

Thereafter, the target gene was amplified by the PCR method. Primers are mouse antibody gene cDN
Sequences of Proteins of A
Immunological Interest, 5th edition, 1991 (USA NIH
A plurality of primers were synthesized with reference to the gene sequence of the mouse antibody variable region described in “Issue”, and a PCR method combining these primers was performed. The nucleic acid sequence (5'GTC
CCAGGATCCTCTGAAGCAGTCAGGCCC3 ') and (5'ACAGTGGGCCCGT
CGTTTTGGCTGAGGAGA3 ') and (5'TGTGCC
CTCGAGGTGACTCAAACTCCACTCTC3 ') and (5'ATGGATACTAGT
The gene was amplified from the primer having the sequence of GGTGCAGCATCAGCCC3 '). The amplified gene fragment is TAcloning
Cloning was performed using a kit (Invitrogen). The variable region base sequences of the H chain and L chain of these obtained genes were determined. DNA sequencer Ver.1.2.0, Model373A (Applied Biosystems)
And according to the manufacturer's protocol. In the labeling reaction, the H chain is a nucleic acid sequence (5'CTCTTGGAGGAGGGTGCCAG3 ')
The κ chain uses the nucleic acid sequence (5'CCAGATTTCAACTGCTCATCAGA3 ') as a primer and PRISM Ready Reaction DyeDeoxy Te
rminator Cycle Sequencing Kit (Applied Biosystems
And the method followed the attached protocol. For staining, a labeling kit from ABI was used. As a result, the gene fragment obtained from the H chain primer was shown in SEQ ID NO: 1, and the gene fragment obtained from the L chain primer was shown in SEQ ID NO: 2.

[0042]

Example 2 A gene fragment containing the H chain L chain variable region nucleotide sequence of the anti-CD34 antibody obtained in Example 1 was incorporated into a pG1 plasmid to prepare a plasmid capable of expressing the anti-CD34 antibody. After digesting the L chain of the cloned plasmid DNA with restriction enzymes XhoI (Takara Shuzo) and SpeI (Takara Shuzo),
The product was developed on a 0.7% agarose electrophoresis gel, and a DNA fragment containing the base sequence of the L chain variable region was cut out and extracted. To extract DNA fragments from agarose gel, use GeneCleanII
The operation was performed using Kit (Funakoshi) according to the attached protocol. Next, the vector pG1 was replaced with the restriction enzymes XhoI and
After digestion with SpeI, the fragment was similarly excised and extracted on a 0.7% agarose gel and ligated. Next, a DNA fragment containing the H chain variable region base sequence of the cloned plasmid DNA was cut out and extracted with restriction enzymes ApaI (Takara Shuzo) and BamHI (Takara Shuzo). The extraction of the DNA fragment from the agarose electrophoresis gel was performed using GeneCleanII Kit (Funakoshi) according to the attached protocol. Next, H
After digesting the vector pG1 into which the DNA fragment containing the base sequence of the chain variable region was inserted with the restriction enzymes ApaI and BamHI, 0.7%
The ligation product was ligated to a fragment similarly extracted and extracted from an agarose electrophoresis gel, and the ligation product was introduced into Escherichia coli JM109 strain. Ligation kit ver.2 (Takara Shuzo) was used for this ligation reaction. The transformed Escherichia coli was plated on an LB plate containing ampicillin, cultured overnight, and several colonies were selected from the colonies that appeared.
Was extracted and purified. Restriction enzyme X using these for integration
After digestion with hoI and ApaI, those into which fragments containing the base sequences of the H chain and L chain variable regions were inserted were selected. The secretory antibody expression plasmid obtained by the above method was replaced with pG1My10
And

[0043]

EXAMPLE 3 The secretory antibody expression plasmid pG1My10 obtained in Example 2 was ligated to the DEAE dextran method (Beb-bington,
CR (1991); METHODS: ACompa-nion to Methods in Enz
ymology, 2 (2), 136-45.). COS7 cells were added to Dulbecco's 10% fetal calf serum (FCS).
s About 6.1x10 ⁵ per 100 mm diameter dish 4 days before gene integration in Modified Eagle's Medium (DMEM)
Cells were re-seeded to 10 ml and cultured. Four days later, the supernatant was first removed, and the cells were gently washed with phosphate-buffered saline (containing no calcium or magnesium) (PBS (-)), and 4 ml of Dulbecco's Modified Eagle's with 10% FCS was added.
Medium (DMEM) and then DEAE dextran /
The mixture of the secretory antibody expression plasmid was evenly spread on the cells and incubated at 37 ° C. for 4 hours. This mixture
20mg / ml DEAE Dextran (Pharmacia Cod
e No. 1703 50-01, Lot.PF97323) Aqueous solution and secreted antibody plasmid were added to TBS (-) (20 mM TrisHCl (pH 7.4), 0.15
(M NaCl) to make 0.17 μg / μl 2: 1 (v / v)
Add 180 μl per dish. After the incubation, the supernatant was discarded, and 5 ml of 10% dimethyl sulfoxide (DMSO) -added PBS (-) was added to add 1 ml.
Let stand for a minute. Next, discard the supernatant and wash with PBS (-).
2% FC with 100 μM chloroquine (Sigma No.C6628)
7 ml of S-added DMEM was added and incubated at 37 ° C. for 3 hours. Then, discard the supernatant, wash with PBS (-),
10 ml of DMEM supplemented with% FCS was added and cultured. The next day, PB
After removing FCS-added DMEM with S (-) and DMEM, 10 ml of serum-free DMEM was added to start production. Three days after the start of the production, the culture supernatant was collected, and the production was continued for about two weeks thereafter. The obtained culture supernatant was collected and purified by protein G sepharose column chromatography, and this was used as a purified preparation of human and mouse chimeric anti-CD34 antibodies.

The binding of the purified sample to the CD34 antigen was confirmed by the following method. Cultured cells KG1a in 1.5 ml tube
1 × 10 ⁶ were prepared, and the cell suspension (PBS with 2% FCS) was prepared.
(-)). Apply 50 μl of cell suspension to the washed cells
l was added and suspended. 1 μg of the purified sample was added thereto, and the mixture was allowed to stand on ice for 30 minutes. Thereafter, the cells are further washed three times with the cell suspension, and 50 μl of the cell suspension is added and suspended. This was followed by a FITC-labeled goat anti-human IgG (Fc) antibody (1/20 dilution
ec) was added and the mixture was allowed to stand in ice for 30 minutes. Then, after further washing three times with the cell suspension, the cell suspension is
Add μl and suspend. The cells treated as described above were irradiated with laser light using a flow cytometer (Becton Dickinson) to measure the amount of antibody bound on the cells by fluorescence. As a control, 1 μg of myeloma-derived human IgG antibody was added instead of the purified sample, and the cells were treated in the same manner. FIG. 3 shows the binding of the purified sample to the CD34 antigen. It was confirmed that the purified preparation derived from the anti-CD34 antibody pG1MY10 retained the binding activity to the CD34 antigen, and it was demonstrated that the human mouse chimeric antibody having the characteristics described in Example 1 had the binding activity to the CD34 antigen. Was done. In addition, it was confirmed that CD34-positive cells could be detected by the purified sample.

[0045]

Example 4 In order to incorporate an antibody gene into a ScFv antibody production vector, the gene obtained in Example 2 was amplified by PCR using a primer containing a restriction enzyme sequence. The nucleic acid sequence of the H chain primer is (5′GCGGCCCAGCCGGCCATGGCCCA
GGTGCAGCTGAAGCAGTCAG 3 ') and (5'AGACGGTGACCGTGGTGC
CTTGGCCCC3 '), the nucleic acid sequence of the L chain primer is (5'TCG
AGCTCACTCAGTCTCCACTCTCCCTGCCT3 '), and (5'CACCTGC
GGCCGCCCGTTTCAGCTC3 ') was used. PCR conditions are Gen
eAmp PCR Reagent Kit with AmpliTaq DNA Polymerase
(Takara Shuzo), 94 ° C for 1 minute, 55 ° C for 1 minute, 72 ° C for 2 minutes
As one cycle, 30 cycles were performed. The PCR device
Model name DNA Thermal Cycler 480 (Perkin Elmer) was used. The H chain is a restriction enzyme
After digestion with SfiI (Toyobo) and BstP (Takara Shuzo), the L chain was digested with restriction enzymes SacI (Takara Shuzo) and NotI (Takara Shuzo), followed by electrophoresis on a 1.5% agarose gel to separate each DNA fragment. Cut out and extracted. To extract DNA fragments from agarose gel, use GeneCleanII Kit (Funakoshi)
This was performed using

The vector producing the ScFv antibody is an anti-CD3
Prior to the introduction of the four antibody genes, a plasmid for producing an arbitrary antibody gene was prepared in advance. Recombinant
Using a Phage Antibody System kit (Pharmacia), an arbitrary antibody-producing hybridoma gene was incorporated. The vector was prepared according to the instructions attached to this kit.

The plasmid containing this arbitrary antibody gene was digested with restriction enzymes SacI (Takara Shuzo) and NotI (Takara Shuzo), followed by electrophoresis on a 0.8% agarose gel to obtain a vector DNA fragment lacking the L chain region. It was extracted and purified. This D
The NA fragment and the L chain gene of the previously prepared anti-CD34 antibody were ligated to incorporate the L chain gene. Next, the plasmid in which the L chain was replaced was replaced with restriction enzymes SfiI (Toyobo) and
After digestion with BstPI (Takara Shuzo), it was electrophoresed on a 0.8% agarose gel to extract and purify a vector DNA fragment from which the H chain region had been deleted. This DNA fragment and the previously prepared anti-CD3
The H chain genes of the four antibodies were ligated to incorporate the H chain genes. For each ligation, a ligation Ver.2 kit (Takara Shuzo) was used. Extraction of DNA fragments from agarose gel was performed using GeneCleanII Kit (Funakoshi). The plasmid obtained by the above operation was introduced into E. coli HB2151 (Pharmacia). The transformed Escherichia coli was transformed into 2% Glucose containing 2% ampicillin.
The cells were seeded on a YT plate and cultured overnight. Several colonies were selected from the colonies that appeared, and plasmid DNA was extracted and purified according to a conventional method. The cleavage patterns of these plasmids were examined using appropriate restriction enzymes, and those that matched the expected patterns were selected. Anti-CD obtained by the above operation
The plasmid expressing the ScFv antibody having the sequence of the 34 antibody was designated as pCANMY10.

E. coli transformed with the above plasmid was added with 2% Glucose and added with 100 μg / ml ampicillin.
The cells were cultured in a B medium (3.5% bactotryptone, 2% bactoeast extract, 0.5% NaCl). The next day, a portion of this was added to a 10-fold amount of the above-described medium, and the cells were cultured for 1 hour, followed by centrifugation. The supernatant was removed, and the medium was replaced with an equal amount of 1 mM IPTG and 100 μg / ml ampicillin-added SB medium. After culturing, the cells were treated according to the protocol of RPAS Purification Module (Pharmacia) to collect the antibody in the periplasm. The obtained antibody crude fraction was purified with an Etag antibody column (Pharmacia). Purification using this column was performed according to the attached protocol using the attached reagent. By the above operation, a purified ScFv antibody sample was obtained.

[0049]

Example 5 Using the purified anti-CD34 ScFv antibody obtained in Example 4, the human CD34 antigen was detected. 1x10
^Seven KG-1a cells were treated with 1 ml of PBS (-) containing 0.05% Triton × 100 (Nacalai Tesque) on ice for 10 minutes,
Protein extraction from cell membrane was performed. KG-1a used
Cells were cultured in RPMI-1640 medium containing 10% fetal calf serum. 10 μl of the extract was added in the presence of mercaptoethanol to 3
Boiled for minutes. This solution was developed using SDS polyacrylamide electrophoresis gel (ACI). This electrophoresis was performed under the conditions described in the instructions attached to the gel. After the electrophoresis, the proteins in the gel were transferred to a PVDF membrane (BioRad). Transfer was performed using 25 mM Tris 192 mM glycine buffer and Electrophoresis power Supply-
Using an EPS 600 apparatus (Pharmacia), transfer was performed at 100 V for 1 hour. The filter was blocked at room temperature with PBS (-) containing 10% skim milk for 1 hour.
This filter was washed with PBS (-) containing 0.05% Tween-20, and then reacted with 15 μg / ml of a single-chain antibody for 1 hour.

Next, after washing the filter, an anti-E-tag antibody (Pharmacia) was added as a secondary antibody at 5 μg / ml at 1 μg / ml.
Allowed to react for hours. After washing, a peroxidase-labeled anti-mouse Fc antibody was reacted as a tertiary antibody at 5 μg / ml for 1 hour. After washing this filter, the band of the electrophoresis to which the primary antibody was bound was confirmed by the ECL solution (Amersham).
And light was detected with a high-sensitivity film (Hyperfilm-ECL: Amersham). As a result, a CD34 molecule band was detected at a position of about 120 K daltons as in the positive control. As a positive control, a filter using an anti-HPCA-1 antibody (Becton Dickinson) as a primary antibody and a peroxidase-labeled anti-mouse Fc antibody as a secondary antibody was similarly colored. In addition, the same treatment was performed except for a single-chain antibody as a primary antibody as a negative control. The 120K dalton band could not be detected. Therefore, it was confirmed that the anti-CD34 single-chain antibody can detect the CD34 molecule.

[0051]

Example 6 Cord blood (29 ml) was adjusted to 48 ml with Hanks balanced saline (Gibco), and 12 ml each was dispensed into four conical tubes into which Ficoll Pack (Pharmacia) was dispensed at 3 rpm, and 800 rpm. For 20 minutes, the cells were separated, and the cells in the mononuclear cell layer were collected. The collected cells were washed with Hanks' solution. To 2.0 × 10 ^{7 of} the cells, 5 μg of the human mouse chimeric antibody produced in Example 3 was added, and 1 μl / ml was added.
The reaction was performed on ice for 30 minutes. After washing it with Hanks solution,
Dynabeads (Dynal) anti-human Ig beads 9 × 10 ⁶
The mixture was added and reacted on ice for 1 hour. The separation operation of the dynabeads was performed according to the attached manual. The obtained cells were cultured in Dulbecco's MEM medium for 14 hours with 10% fetal bovine serum.
The cells were cultured at 37 ° C. in a 5% carbon dioxide atmosphere. After the culture, the cells and beads were completely separated by pipetting, and the beads were removed with a magnet according to the manual attached to Dynabeads. A part of the collected cells was used to measure the number of cells to determine the number of recovered cells. The remaining cells were reacted with anti-HPCA-2 antibody (Becton) for 30 minutes on ice, washed with cold saline containing 2% fetal calf serum, and collected by centrifugation. Transfer the cells to CD using Coulter flow cytometer.
The 34 positive rate was measured. The CD34 positive rate was defined as the purity of CD34 cells, and the number of cells obtained by multiplying the CD34 positive rate by the number of recovered cells was defined as the number of recovered CD34 positive cells. The recovery rate of CD34-positive cells was calculated from the number of positive cells before separation and the number of collected positive cells. As a result, CD34-positive cells were
The recovery rate was 80.4% and the recovery rate was 45.3%. This indicated that the antibody produced in Example 3 separated CD34-positive cells.

[0052]

Example 7 An antibody column to which the human mouse chimeric antibody produced in Example 3 was bound was prepared using CNBr-activated Sepharose 4B (Pharmacia). Antibody Sepharose4B
The method of binding to beads was in accordance with the attached instruction manual. A 4.0 ml gel was reacted with a human mouse chimeric antibody solution to prepare an affinity gel with a coupling efficiency of 99.5%. A glass column (2 cm ² × 3 cm) in which a small amount of glass wool was fixed in the lower part of the column was siliconized, and a gel column for cell separation was prepared by packing this column with 1 ml of the previously prepared gel. To 32 ml of umbilical cord blood, 3 ml of a silica solution (Immunological Institute, Inc.) was added, and the mixture was incubated at 37 ° C. for 1 hour. This cell suspension was made up to 48 ml with Hanks balanced saline (Gibco), and 12 ml of this suspension was dispensed into four concentric tubes into which 3 ml of Ficoll Pack (Pharmacia) was dispensed. The cells were separated under the conditions of rotation / minute and 20 minutes, and the cells in the mononuclear cell layer were collected. The collected cells were washed with Hanks' solution. 1 containing the cells 2.1 × 10 ⁷ cells
The ml cell suspension was placed in the above antibody column and reacted at 4 ° C. for 1 hour with gentle stirring. The column was washed by flowing Hanks balanced saline containing 10% fetal calf serum, 100 units / ml penicillin, and 100 μg / ml streptomycin. The column was added with 2 ml of MEM medium (Gibco) containing 10% fetal calf serum, 100 units / ml penicillin, and 100 μg / ml streptomycin, and cultured at 37 ° C. for 13 hours in a carbon dioxide incubator. By raising and lowering this column, the gel was agitated somewhat strongly, and the medium was recovered from the column. Further, Hanks balanced saline containing 5 ml of 10% fetal bovine serum, 100 units / ml of penicillin, and 100 μg / ml of streptomycin was passed through the column, and the liquid was also collected. The cells in these collected liquids were collected by centrifugation. The number of these cells was counted. The remaining cells were reacted with anti-HPCA-2 antibody (Becton) for 30 minutes on ice, washed with cold saline containing 2% fetal calf,
Collected in a centrifuge. The CD34 positive rate of the cells was measured with a Coulter flow cytometer. CD34
The positive rate is defined as the purity of the CD34 cells, and the CD34 positive rate and
The number of cells multiplied by the number of collected cells was defined as the number of collected CD34-positive cells. As a result, a result with a purity of 45.2% and a recovery of 62.6% was obtained. From this, it was confirmed that an apparatus for separating and separating hematopoietic undifferentiated cells comprising a column apparatus packed with gel was effective.

[0053]

Example 8 29 ml of cord blood was adjusted to 48 ml with Hank's balanced saline (Gibco), and 12 ml each was dispensed into four conical tubes into which 3 ml of Ficoll Pack (Pharmacia) was dispensed at 800 rpm. For 20 minutes, the cells were separated, and the cells in the mononuclear cell layer were collected. The collected cells were washed with Hanks' solution. To 2.0 × 10 ^{7 of} the cells, 25 μg of the single-chain antibody produced in Example 4 was added, and the mixture was added on ice at 5 μl / ml.
Allowed to react for hours. After washing it with Hanks solution, anti-Eta
g (Pharmacia) antibody for 30 minutes. After washing
Dynabeads (Dynal) anti-mouse IgG beads 9x
10 ⁶ were added and reacted on ice for 1 hour. According to the attached Dynabeads manual, the beads were separated together with the cells adsorbed on the beads. The obtained cells were cultured in Dulbecco's MEM medium supplemented with 10% fetal calf serum at 37 ° C. for 12 hours in a 5% carbon dioxide gas atmosphere. After the culture, the cells and the beads were completely separated by pipetting, and the beads were removed with a magnet according to the manual attached to Dynabeads. A part of the collected cells was used to measure the number of cells to determine the number of recovered cells. The remaining cells were reacted with anti-HPCA-2 antibody (Becton) for 30 minutes on ice, washed with cold saline containing 2% fetal calf serum, and collected by centrifugation. The CD34 positive rate of the cells was measured with a Coulter flow cytometer. The CD34 positive rate was defined as the purity of the CD34 cells, and the number of cells obtained by multiplying the CD34 positive rate and the number of recovered cells was defined as the number of recovered CD34 positive cells. As a result, purity 36.1
% And a recovery rate of 35.3%. This indicated that the antibody produced in Example 4 separated CD34-positive cells.

[0054]

Example 9 An antibody column to which the single-chain antibody produced in Example 4 was bound was prepared using CNBr-activated Sepharose 4B (Pharmacia). The method of binding the antibody to Sepharose4B beads was in accordance with the attached instruction manual. 4.0ml
Reaction of single-chain antibody solution on the gel
Affinity gels were made with 9.0% efficiency. A glass column with a small amount of glass wool fixed at the bottom of the column (2
cm ² × 4 cm), and a gel column cell separation device was prepared in which this column was packed with 1 ml of the previously prepared gel. To 28 ml of umbilical cord blood, 3 ml of a silica solution (Immunological Institute, Inc.) was added, and the mixture was incubated at 37 ° C. for 1 hour. The cell suspension was made up to 48 ml with Hanks balanced saline (Gibco) and Ficoll Pak (Pharmacia)
The suspension was dispensed in 12 ml portions into four concentric tubes into which 3 ml portions were dispensed, and the cells were separated under the condition of 800 rpm for 20 minutes to collect the cells in the mononuclear cell layer. The collected cells were washed with Hanks' solution. 1 ml of the cell suspension containing 1.8 × 10 ⁷ cells was placed in the antibody column and reacted for 1 hour at 4 ° C. with gentle stirring. Column contains 10% fetal calf serum, 100 units
Washing was carried out by flowing Hank's balanced physiological saline containing / ml of penicillin and 100 µg / ml of streptomycin.
The column was washed with ME containing 10% fetal calf serum, 100 units / ml penicillin, and 100 μg / ml streptomycin.
2 ml of M medium (Gibco) was added at 37 ° C in a carbon dioxide incubator.
For 13 hours. By raising and lowering this column, the gel was agitated somewhat strongly, and the medium was recovered from the column. Further, Hanks balanced saline containing 5 ml of 10% fetal calf serum, 100 units / ml penicillin, and 100 μg / ml streptomycin was passed through the column, and the liquid was also collected. The cells in these collected liquids were collected by centrifugation. The number of these cells was counted. The remaining cells are
The mixture was reacted with anti-HPCA-2 antibody (Becton) on ice for 30 minutes, washed with cold saline containing 2% fetal calf, and collected by centrifugation. The CD34 positive rate of the cells was measured with a Coulter flow cytometer. CD34 positive rate to CD
The number of cells obtained by multiplying the CD34 positive rate by the number of recovered cells was defined as the number of recovered CD34 positive cells. As a result, a result having a purity of 52.8% and a recovery of 41.0% was obtained. From this, it was confirmed that an apparatus for separating and separating hematopoietic undifferentiated cells comprising a column apparatus packed with gel was effective.

[0055]

Example 10 An antibody capable of improving the binding to a water-insoluble carrier was prepared by improving the pCANMY10 vector prepared in Example 4. E-tag at the carboxyl terminus of single chain antibody
Following the sequence, three amino acid lysine residues were introduced. pCAN
Using a restriction enzyme site of the MY10 vector, a sequence containing a lysine residue was introduced by PCR. The sequence is shown in Sequence Listing 4. This vector was introduced into E. coli HB2151 cells, and a single-chain antibody was prepared in the same manner as in Example 4. The obtained antibody was prepared using a CNBr-activated Sepharose 4B (manufactured by Pharmacia) on an antibody column to which a single-chain antibody was bound. The method of binding the antibody to Sepharose4B beads was in accordance with the attached instruction manual. The single-chain antibody solution was reacted with 4.0 ml of the gel to prepare an affinity gel. A glass column with a small amount of glass wool fixed at the bottom of the column (2c
m ² × 3 cm), and a gel column cell separation device was prepared in which this column was packed with 1 ml of the previously prepared gel. Silica solution in umbilical cord blood 32ml
Was added and incubated for 1 hour at 37 ° C. The cell suspension was made up to 48 ml with Hanks balanced saline (manufactured by Gibco), and 12 ml of the suspension was added to four concentric tubes into which 3 ml of Ficoll pack (manufactured by Pharmacia) was dispensed.
The cells were separated at 800 rpm for 20 minutes, and the cells in the mononuclear cell layer were collected. The collected cells were washed with Hanks' solution. 1 ml of the cell suspension containing 2.1 × 10 ⁷ cells was placed in the above antibody column and reacted for 1 hour at 4 ° C. with gentle stirring. The column was washed by flowing Hanks balanced saline containing 10% fetal calf serum, 100 units / ml L of penicillin, and 100 micrograms / ml of streptomycin. This column was filled with 2% MEM medium (manufactured by Gibco) containing 10% fetal calf serum, 100 units / ml penicillin, and 100 microgram / ml streptomycin.
The mixture was added for 14 hours in a 37 ° C. carbon dioxide incubator. By raising and lowering this column, the gel was agitated somewhat strongly, and the medium was recovered from the column. Add 5 ml to the column
10% fetal calf serum, 100 units / ml penicillin, 10
A Hanks balanced saline solution containing 0 microgram / ml streptomycin was run and the fluid was also collected.
The cells in these collected liquids were collected by centrifugation. The number of these cells was counted. The remaining cells are anti-HPCA-2 antibodies
(Becton) for 30 minutes on ice, washed with cold saline containing 2% fetal calf, and collected with a centrifuge. The cells were transferred to CD34 using a Coulter flow cytometer.
Positive rate was measured. The CD34 positive rate was defined as the purity of CD34 cells, and the number of cells obtained by multiplying the CD34 positive rate by the number of recovered cells was defined as the number of recovered CD34 positive cells. As a result, purity 71.0
% And a recovery rate of 52.0%. From this, it was confirmed that the separation device for hematopoietic undifferentiated cells consisting of a column device packed with gel was effective, and the recombinant antibody with a lysine residue introduced at the carboxyl terminus was able to separate cells more efficiently. It was shown to be possible.

[0056]

According to the present invention, it has become possible to specifically and efficiently separate hematopoietic undifferentiated cells. INDUSTRIAL APPLICABILITY The present invention is effective in fields such as collecting hematopoietic undifferentiated cells for the purpose of medical treatment such as leukemia, and removing lymphocytes from cells for bone marrow transplantation.

[0057]

[Sequence list] SEQ ID NO: 1 Sequence length: 351 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA, Origin Organism name: Mouse Strain name: anti-My-10 Sequence CAG GTG CAG CTG AAG CAG TCA GGA CCT GGC CTA GTG CAG CCC TCA CAG 48 Gln Val Gln Leu Lys Gln Ser Gly Pro Gly Leu Val Gln Pro Ser Gln 5 10 15 AGC CTG TCC TTC ATC TGC ACA GTC TCT GGT TTC TCA TTA ACT AGT CAT 96 Ser Leu Ser Phe Ile Cys Thr Val Ser Gly Phe Ser Leu Thr Ser His 20 25 30 GGT GTA CAC TGG GTT CGC CAG TCT CCA GGA AAG GGT CTG GAG TGG CTG 144 Gly Val His Trp Val Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp Leu 35 40 45 GGA GTG ATA TGG GGT GCT GGA AGG ACA GAC TAT AAT GCA GCT TTC ATA 192 Gly Val Ile Trp Gly Ala Gly Arg Thr Asp Tyr Asn Ala Ala Phe Ile 50 55 60 TCC AGA CTG AGC ATC AGC AGG GAC ATT TCC AAG AGC CAA GTT TTC TTT 240 Ser Arg Leu Ser Ile Ser Arg Asp Ile Ser Lys Ser Gln Val Phe Phe 65 70 75 80 AAG ATG AAC AGT CTG CAA GTT GAT GAC ACA GCC ATA TAT TAC TGT GCC 288 Lys Met Asn Ser Leu Gln Val Asp Asp Thr Ala Ile Tyr Tyr Cys Ala 85 90 95 AGA AAT AGG TAC GAG AGC TAC TTT GAC TAC TGG GGC CAA GGC ACC ACT 336 Arg Asn Arg Tyr Glu Ser Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Thr 100 105 110 TCC CTC ACA GTC TCC 351 Leu Thr Val Ser Ser 115

SEQ ID NO: 2 Sequence length: 339 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Origin Organism name: mouse Strain name: anti-My-10 Sequence GAT GTT GTG ATG ACC CAA ACT CCA CTC TCC CTG CCT GTC AGT CTT GGA 48 Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly 5 10 15 GAT CAG GCC TCC ATC TCT TGC AGA TCT AGT CAG AAC CTT GTA CAC AGT 96 Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Asn Leu Val His Ser 20 25 30 AAT GGA AAT ACC TAT TTA CAT TGG TAC CTG CAG AAG CCA GGC CAG TCT 144 Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45 CCA AAT CTC CTG ATC TAC AAA GTT TCC AAC CGA TTT TCT GGG GTC CCA 192 Pro Asn Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro 50 55 60 GAC AGG TTC AGT GGC AGT GGA TCA GGG ACA GAA TTC ACA CTC AAG ATC 240 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Lys Ile 65 70 75 80 AGC AGA GTG GAG GCT GAG GAT CTG GGA GTT TAT TTC TG C TCT CAA AGT 288 Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe Cys Ser Gln Ser 85 90 95 ACA CAT GTT CCG CTC ACG TTC GGT GCT GGG ACC AAG GTG GAG CTG AAA 336 Thr His Val Pro Leu Thr Phe Gly Ala Gly Thr Lys Val Glu Leu Lys 100 105 110 CGG 339 Arg

SEQ ID NO: 3 Sequence length: 879 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Origin Organism name: Mouse Strain name: anti-My-10 Sequence ATG ACC ATG ATT ACG CCA AGC TTT GGA GCC TTT TTT TTG GAG ATT TTC 48 Met Thr Met Ile Thr Pro Ser Phe Gly Ala Phe Phe Leu Glu Ile Phe 5 10 15 AAC GTG AAA AAA TTA TTA TTC GCA ATT CCT TTA GTT GTT CCT TTC TAT 96 Asn Val Lys Lys Leu Leu Phe Ala Ile Pro Leu Val Val Pro Phe Tyr 20 25 30 GCG GCC CAG CCG GCC ATG GCC CAG GTG AAG CTG CAG CAG TCT GGA CCT 144 Ala Ala Gln Pro Ala Met Ala Gln Val Lys Leu Gln Gln Ser Gly Pro 35 40 45 GGC CTA GTG CAG CCC TCA CAG AGC CTG TCC TTC ATC TGC ACA GTC TCT 192 Gly Leu Val Gln Pro Ser Gln Ser Leu Ser Phe Ile Cys Thr Val Ser 50 55 60 GGT TTC TCA TTA ACT AGT CAT GGT GTA CAC TGG GTT CGC CAG TCT CCA 240 Gly Phe Ser Leu Thr Ser His Gly Val His Trp Val Arg Gln Ser Pro 65 70 75 80 GGA AAG GGT CTG GAG TGG CTG GGA GTG ATA TGG GGT G CT GGA AGG ACA 288 Gly Lys Gly Leu Glu Trp Leu Gly Val Ile Trp Gly Ala Gly Arg Thr 85 90 95 GAC TAT AAT GCA GCT TTC ATA TCC AGA CTG AGC ATC AGC AGG GAC ATT 336 Asp Tyr Asn Ala Ala Phe Ile Ser Arg Leu Ser Ile Ser Arg Asp Ile 100 105 110 TCC AAG AGC CAA GTT TTC TTT AAG ATG AAC AGT CTG CAA GTT GAT GAC 384 Ser Lys Ser Gln Val Phe Phe Lys Met Asn Ser Leu Gln Val Asp Asp 115 120 125 ACA GCC ATA TAT TAC TGT GCC AGA AAT AGG TAC GAG AGC TAC TTT GAC 432 Thr Ala Ile Tyr Tyr Cys Ala Arg Asn Arg Tyr Glu Ser Tyr Phe Asp 130 135 140 TAC TGG GGC CAA GGG ACC ACG GTC ACC GTC TCC TCA GGT GGA GGC GGT 480 Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Val Ser Ser Gly Gly Gly Gly 145 150 155 160 TCA GGC GGA GGT GGC TCT GGC GGT GGC GGA TCG GAC ATC GAG CTC ACT 528 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Glu Leu Thr 165 170 175 CAG TCT CCA CTC TCC CTG CCT GTC AGT CTT GGA GAT CAG GCC TCC ATC 576 Gln Ser Pro Leu Ser Leu Pro Val Ser Leu Gly Asp Gln Ala Ser Ile 180 185 190 TCT TGC AGA TCT AGT CAG AAC CTT GTA CAC AGT AAT GGA AAT ACC TAT 624 Ser Cys Arg Ser Ser Gln Asn Leu Val His Ser Asn Gly Asn Thr Tyr 195 200 205 TTA CAT TGG TAC CTG CAG AAG CCA GGC CAG TCT CCA AAT CTC CTG ATC 672 Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Asn Leu Leu Ile 210 215 220 TAC AAA GTT TCC AAC CGA TTT TCT GGG GTC CCA GAC AGG TTC AGT GGC 720 Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly 225 230 235 240 AGT GGA TCA GGG ACA GAA TTC ACA CTC AAG ATC AGC AGA GTG GAG GCT 768 Ser Gly Ser Gly Thr Glu Phe Thr Leu Lys Ile Ser Arg Val Glu Ala 245 250 255 GAG GAT CTG GGA GTT TAT TTC TGC TCT CAA AGT ACA CAT GTT CCG CTC 816 Glu Asp Leu Gly Val Tyr Phe Cys Ser Gln Ser Thr His Val Pro Leu 260 265 270 ACG TTC GGT GCT GGG ACC AAG GTG GAG CTG AAA CGG GCG GCC GCA GGT 864 Thr Phe Gly Ala Gly Thr Lys Val Glu Leu Lys Arg Ala Ala Ala Gly 275 280 285 GCG CCG GTG CCG TAT CCG GAT CCG CTG GAA CCG CGT GCC GCA TAG 909 Ala Pro Val Pro Tyr Pro Asp Pro Leu Glu Pro Arg Ala Ala * 290 295 300

SEQ ID NO: 4 Sequence length: 918 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Origin Organism name: Mouse Strain name: anti-My-10 Sequence ATG ACC ATG ATT ACG CCA AGC TTT GGA GCC TTT TTT TTG GAG ATT TTC 48 Met Thr Met Ile Thr Pro Ser Phe Gly Ala Phe Phe Leu Glu Ile Phe 5 10 15 AAC GTG AAA AAA TTA TTA TTC GCA ATT CCT TTA GTT GTT CCT TTC TAT 96 Asn Val Lys Lys Leu Leu Phe Ala Ile Pro Leu Val Val Pro Phe Tyr 20 25 30 GCG GCC CAG CCG GCC ATG GCC CAG GTG AAG CTG CAG CAG TCT GGA CCT 144 Ala Ala Gln Pro Ala Met Ala Gln Val Lys Leu Gln Gln Ser Gly Pro 35 40 45 GGC CTA GTG CAG CCC TCA CAG AGC CTG TCC TTC ATC TGC ACA GTC TCT 192 Gly Leu Val Gln Pro Ser Gln Ser Leu Ser Phe Ile Cys Thr Val Ser 50 55 60 GGT TTC TCA TTA ACT AGT CAT GGT GTA CAC TGG GTT CGC CAG TCT CCA 240 Gly Phe Ser Leu Thr Ser His Gly Val His Trp Val Arg Gln Ser Pro 65 70 75 80 GGA AAG GGT CTG GAG TGG CTG GGA GTG ATA TGG GGT GC T GGA AGG ACA 288 Gly Lys Gly Leu Glu Trp Leu Gly Val Ile Trp Gly Ala Gly Arg Thr 85 90 95 GAC TAT AAT GCA GCT TTC ATA TCC AGA CTG AGC ATC AGC AGG GAC ATT 336 Asp Tyr Asn Ala Ala Phe Ile Ser Arg Leu Ser Ile Ser Arg Asp Ile 100 105 110 TCC AAG AGC CAA GTT TTC TTT AAG ATG AAC AGT CTG CAA GTT GAT GAC 384 Ser Lys Ser Gln Val Phe Phe Lys Met Asn Ser Leu Gln Val Asp Asp 115 120 125 ACA GCC ATA TAT TAC TGT GCC AGA AAT AGG TAC GAG AGC TAC TTT GAC 432 Thr Ala Ile Tyr Tyr Cys Ala Arg Asn Arg Tyr Glu Ser Tyr Phe Asp 130 135 140 TAC TGG GGC CAA GGG ACC ACG GTC ACC GTC TCC TCA GGT GGA GGC GGT 480 Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Val Ser Ser Gly Gly Gly Gly 145 150 155 160 TCA GGC GGA GGT GGC TCT GGC GGT GGC GGA TCG GAC ATC GAG CTC ACT 528 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Glu Leu Thr 165 170 175 CAG TCT CCA CTC TCC CTG CCT GTC AGT CTT GGA GAT CAG GCC TCC ATC 576 Gln Ser Pro Leu Ser Leu Pro Val Ser Leu Gly Asp Gln Ala Ser Ile 180 185 190 TCT TGC AGA TCT AGT CAG AAC CTT GTA CAC A GT AAT GGA AAT ACC TAT 624 Ser Cys Arg Ser Ser Gln Asn Leu Val His Ser Asn Gly Asn Thr Tyr 195 200 205 TTA CAT TGG TAC CTG CAG AAG CCA GGC CAG TCT CCA AAT CTC CTG ATC 672 Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Asn Leu Leu Ile 210 215 220 TAC AAA GTT TCC AAC CGA TTT TCT GGG GTC CCA GAC AGG TTC AGT GGC 720 Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly 225 230 235 240 AGT GGA TCA GGG ACA GAA TTC ACA CTC AAG ATC AGC AGA GTG GAG GCT 768 Ser Gly Ser Gly Thr Glu Phe Thr Leu Lys Ile Ser Arg Val Glu Ala 245 250 255 GAG GAT CTG GGA GTT TAT TTC TGC TCT CAA AGT ACA CAT GTT CCG CTC 816 Glu Asp Leu Gly Val Tyr Phe Cys Ser Gln Ser Thr His Val Pro Leu 260 265 270 ACG TTC GGT GCT GGG ACC AAG GTG GAG CTG AAA CGG GCG GCC GCA GGT 864 Thr Phe Gly Ala Gly Thr Lys Val Glu Leu Lys Arg Ala Ala Ala Gly 275 280 285 GCG CCG GTG CCG TAT CCG GAT CCG CTG GAA CCG CGT GCC GCA AAG 909 Ala Pro Val Pro Tyr Pro Asp Pro Leu Glu Pro Arg Ala Ala Lys 290 295 300 AAG AAG TAG 918 Lys Lys *** 305

SEQ ID NO: 5 Sequence length: 5 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Ser His Gly Val His

SEQ ID NO: 6 Sequence Length: 16 Sequence Type: Amino Acid Topology: Linear Sequence Type: Peptide Sequence Val Ile Trp Gly Ala Gly Arg Thr Asp Tyr Asn Ala Ala Phe Ile Ser

SEQ ID NO: 7 Sequence length: 9 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Asn Arg Tyr Glu Ser Tyr Phe Asp Tyr

SEQ ID NO: 8 Sequence length: 16 Sequence type: amino acid Topology: Linear Sequence type: Peptide sequence Arg Ser Ser Gln Asn Leu Val His Ser Asn Gly Asn Thr Tyr Leu His

SEQ ID NO: 9 Sequence Length: 13 Sequence Type: Amino Acid Topology: Linear Sequence Type: Peptide Sequence Lys Val Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe

SEQ ID NO: 10 Sequence length: 9 Sequence type: amino acid Topology: linear Sequence type: peptide Sequence Ser Gln Ser Thr His Val Pro Leu Thr

[Brief description of the drawings]

FIG. 1 schematically shows the structure of IgG.

FIG. 2 shows a schematic diagram of the pGl plasmid.

FIG. 3 shows the binding of the chimeric antibody to KG-1a cells.
(1) Positive control reacted with mouse CD34 antibody. (2) shows that the recombinant antibody can stain KG-1a cells, which are CD34 positive cells. The black peak indicates staining against the white peak, a negative control.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁶ Identification code FI C12R 1:91)

Claims (8)

[Claims] 1. A cell separation device using a chimeric antibody, a single-chain antibody, or an antibody obtained by combining them. 2. CDR of the H chain variable region is an amino acid sequence represented by SEQ ID NO: 5, SEQ ID NO: 6 is CDR-2, and CDR-3 is an amino acid sequence represented by SEQ ID NO: 7; CDR-1 of the region is SEQ ID NO: 8, CDR-2 is the amino acid sequence represented by SEQ ID NO: 9, CDR-3 is the amino acid sequence represented by SEQ ID NO: 10, and human CD34 using an antibody in which the Fc region is human. Cell separator for positive cells. 3. The CDR of the H chain variable region is an amino acid sequence represented by SEQ ID NO: 5, SEQ ID NO: 6, CDR-2 is an amino acid sequence represented by SEQ ID NO: 7, and CDR-3 is a light chain variable region. Cell separation device for human CD34-positive cells using a single-chain antibody in which the CDR-1 region is SEQ ID NO: 8, CDR-2 is the amino acid sequence represented by SEQ ID NO: 9, and CDR-3 is the amino acid sequence represented by SEQ ID NO: 10. . 4. An amino acid sequence of an antibody comprising C-terminal, N-terminal,
4. The cell separation device according to claim 1, wherein an amino acid sequence containing a basic amino acid or an acidic amino acid is added to both of them and used. 5. A method for separating or detecting cells using a chimeric antibody, a single-chain antibody, or an antibody obtained by combining them. 6. The CDR of the H chain variable region is an amino acid sequence represented by SEQ ID NO: 5, SEQ ID NO: 6, CDR-2 is an amino acid sequence represented by SEQ ID NO: 7, and CDR-3 is a light chain variable region. CDR-1 of the region is SEQ ID NO: 8, CDR-2 is the amino acid sequence represented by SEQ ID NO: 9, CDR-3 is the amino acid sequence represented by SEQ ID NO: 10, and human CD34 using an antibody in which the Fc region is human. Cell separation or detection method for positive cells. 7. The heavy chain variable region CDR-1 is an amino acid sequence represented by SEQ ID NO: 5, SEQ ID NO: 6, CDR-2 is an amino acid sequence represented by SEQ ID NO: 7, and CDR-3 is a light chain variable region. Cell separation from human CD34-positive cells using a single-chain antibody containing the amino acid sequence represented by SEQ ID NO: 8 for CDR-1 and SEQ ID NO: 9 for CDR-2 in the region. Or the detection method. 8. The antibody according to claim 5, wherein an amino acid sequence containing a basic amino acid or an acidic amino acid is added to the C-terminus or the N-terminus of the amino acid sequence of the antibody or to both of them.
The method for separating or detecting cells according to any one of the above.