JPH11332563A - Antibody and nucleic acid coding therefor - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain an antibody with CDR-1 or the like having a specific amino acid sequence in its H-chain variable region, having affinity for a CD-4 antigen to be highly safe when administered to the human body, capable of massively preparing recombinant antibody, and useful for treatment of, e.g. autoimmune diseases. SOLUTION: This antibody has CDR-1, -2 and -3 with amino acid sequences shown by formulae I, II and III, respectively in its H-chain variable region, and has affinity for a CD4 antigen. It is preferable to prepare a monoclonal antibody for the CD4 antigen produced by the hybridoma H5 (accession no.: FERMOP-16807). It is also preferable to produce the antibody using a nucleic acid having base sequences shown by formulae IV and V, and that to prepare a pharmaceutical composition from the antibody and a pharmaceutically acceptable carrier.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a human CD4 useful for the quantification and detection of antigens, pharmaceuticals and medical devices.
It relates to an antibody having a particularly high affinity and specificity for an antigen.

[0002]

2. Description of the Related Art Human CD4 is a glycoprotein having a molecular weight of 55 kD, exists on a cell membrane as a monomer, and is mainly expressed in T cells. T cells expressing CD4 (about 65% of peripheral T cells) have the properties of helper T cells and recognize antigens presented by class II MHC molecules. CD4 is HIV (human immunodeficiency viru)
s: AIDS virus) and is known to act as a receptor during infection. Helper T in the immune system
Cells are essential for responding properly to antigens,
Essential for most antibody responses of B cells. Helper T cells are activated mainly when they recognize non-self antigens bound to the surface of antigen presenting cells, and secrete interleukin 2 to stimulate the proliferation of T cells, which helps activate B cells. And also promotes the production of antibodies. There are also helper T cells that not only assist lymphocytes but also activate macrophages by secreting gamma interferon.

[0003] In healthy individuals, in order to prevent self-damage, the elimination of lymphocyte clones having an autoreactive antigen receptor (clon
al deletion), their inactivity (clonal anergy),
Various mechanisms such as suppression of its function are provided (immune tolerance). Although the mechanisms involved in the development of autoimmune diseases are not yet fully understood, it is thought that such abnormalities in the immune tolerance mechanism cause autoimmune diseases. Although lymphocyte clones having an autoreactive antigen receptor are not only CD4-expressing helper T cells, the importance of helper T cells in autoimmune diseases is recognized.

[0004] As a method of treating an autoimmune disease, administration of a corticosteroid, removal of a spleen, administration of an immunosuppressant, etc. are applied according to the degree of the symptom. However, there are many cases in which such pharmacotherapy or splenectomy does not effectively recover. At present, no absolute treatment method has been established for such patients, and measures are urgently needed.

[0005] As another method for treating autoimmune diseases, various attempts have been made to adsorb and remove autoantibodies by extracorporeal circulation of blood using immunoadsorption columns. For example, application of a column in which protein A having immunoglobulin-binding properties is immobilized on a carrier has been studied. However, protein A is expensive, is not very good in terms of adsorption specificity, and has also been reported to have side effects, and various problems remain when used in such medical equipment. In recent years, not only removal of humoral factors from blood, but also blood cell separation techniques have been reported. However, depending on the ligand used, there is a problem that sufficient cell removal cannot be expected or cells other than the target are non-specifically adsorbed due to problems such as weak binding to the antigen and low specificity of the reaction with the antigen. There is.

JP-A-3-32680 discloses a separating material in which a peptide or lipid having an affinity for T lymphocytes is immobilized, and JP-A-6-154316, JP-A-6-154317, JP-A-6-218051 and JP-A-6-269663 disclose CD4-positive cell-collecting materials in which a peptide having an affinity for CD4-positive cells is immobilized on a nonwoven fabric, but all of them are used as ligands. There is a problem with the affinity and specificity of the peptide for the antigen, and sufficient cell adsorption ability cannot be expected. In particular, the latter uses a peptide which is a part of the complementarity determining region "CDR" and a part of the framework region "framework" interposed therebetween, which are closely related to the formation of the antigen-binding site of the anti-CD4 antibody. Effective antigen binding cannot be expected. It is known that the CDR has three regions called “CDR-1”, “CDR-2” and “CDR-3” from the N-terminal side for each of the H chain and the L chain. Alternatively, it is essential that the configuration of “CDR-1”, “CDR-2”, and “CDR-3” of the L chain be maintained substantially the same as that of an antibody in order to effectively bind an antigen. The term “substantially the same function” as used in the present invention means that the epitope on the antigen molecule and the binding force to the antigen are substantially the same.

[0007]

[0005] Antibodies are generally known to have strong binding to antigens and high specificity, and are expected to be used for medical treatment. An object of the present invention is to provide an antibody having particularly high affinity and specificity for the human CD4 antigen. In addition, the present invention provides a human mouse chimeric antibody, a single-chain antibody, and other modifications by genetic engineering techniques while retaining the high affinity and specificity of the antibody for the human CD4 antigen. It is an object of the present invention to provide a recombinant antibody capable of lowering the productivity, improving the antibody production amount, and reducing the production cost.

[0008]

Means for Solving the Problems Normally, monoclonal antibodies are prepared by isolating B lymphocytes from an animal immunized with a target antigen and fusing them with myeloma cells to prepare hybridomas. Next, screening using the desired antigen is performed to obtain an antibody-producing hybridoma. At this time, a large number of cells must be screened in order to obtain a hybridoma that produces an antibody that has a high binding property to the antigen and a high specificity, and requires a great deal of labor. As a result of extensive studies by the present inventors, CDR-1, CDR-2 and CDR-3 of the H chain variable region have the amino acid sequences described in SEQ ID NOs: 1, 2 and 3, respectively, in the Sequence Listing,
The 4H5 antibody, in which CDR-1, CDR-2 and CDR-3 of the L chain variable region have the amino acid sequences described in SEQ ID NOs: 4, 5 and 6, respectively, has particularly high affinity for human CD4 antigen. It was found that the antibody had specificity.

As an example, the binding affinity of the OKT4A antibody, known as an anti-human CD4 antibody, to the human CD4 antigen is reported to be KA = 4 × 10 ⁸ M ⁻¹ (Virginia L. et al.
Pulito et al., The Journal of Immunology, 156: 2840-2850.
(1996)) Therefore, the dissociation constant (KD: the lower the value, the higher the binding affinity) is KD = 2.5 × 10 ⁻⁹ M (from 1 / KA = KD). On the other hand, as described in the examples in the present specification, the dissociation constant of the 4H5 antibody with respect to the human CD4 antigen is KD = 1.71 × 10 ⁻⁹ M (Example 4), KD = 8.08 × 10 ⁻¹⁰ M (Example 8). this is
This shows that the 4H5 antibody can bind more strongly to the human CD4 antigen than the OKT4A antibody. A hybridoma producing the 4H5 antibody, Mouse-Mouse hybridoma 4H5,
Deposited with the National Institute of Advanced Industrial Science and Technology, Ministry of International Trade and Industry, Japan under the accession number: FERM P-16807.

[0010] Ordinary antibodies existing in vivo require two antigen-specific variable region base sequences and two constant region genes. Although a small number of classes are known as constant region genes, the variable region base sequences of H and L chains are extremely diverse, and obtaining the target variable region base sequence requires a great deal of labor. However, by making full use of gene amplification (PCR) and binding experiments by antigen immunoassay (EIA) using an antigen, an antibody gene for the target human CD4 antigen is obtained from multiple antibody genes in the hybridoma. The present inventors have made it possible to produce human mouse chimeric antibodies and single-chain antibodies in large quantities by recombination of the gene.

An ordinary antibody is composed of two kinds of polypeptides, large and small, and the larger subunit is called "H chain" and the smaller subunit is called "L chain". Also,
Each peptide is composed of a "variable region" (or "V region") present on the N-terminal side to form an antigen binding site, and a constant "constant region" (or "Fc") for each antibody class. . The variable regions are further divided into complementarity-determining regions "CDRs", which are closely related to the formation of antigen-binding sites, and intervening framework regions "frameworks". It is known that CDR has three regions called “CDR-1”, “CDR-2”, and “CDR-3” from the N-terminal side for each of the H chain and the L chain. FIG. 1 shows a schematic structural diagram of IgG.

The number of amino acids constituting the variable region of an antibody is as follows:
Often varies by antibody. The amino acid sequence of the variable region of the H chain of the 4H5 antibody is shown in SEQ ID NO: 35 of the Sequence Listing. Amino acid positions 1 to 30 of SEQ ID NO: 35 are framework 1, positions 31 to 35 are CDR-1, positions 36 to 49 are framework 2, positions 50 to 66 are CDR-2, position 67. From 98 to framework 3; from 99 to 107 from CDR-3; from 108
Rank 118 indicates Framework 4. The amino acid sequence of the variable region of the L chain of the 4H5 antibody is shown in SEQ ID NO: 36 in Sequence Listing. Amino acid positions 1 to 23 of SEQ ID NO: 36 are framework 1, positions 24 to 38 are CDR-1, positions 39 to 53 are framework 2, positions 54 to 60 are CDR-2, position 61 From92
Ranks are framework 3, 93 to 101 are CDR-3, 102
Rank 111 indicates Framework 4. The boundaries between these frameworks and CDRs are the Sequences of Proteins of I
mmunological Interest, 5th edition, 1991 (USA NIH
The publication was published with a reference to the mouse antibody variable region gene sequence.

SEQ ID No. 7 in the Sequence Listing shows a nucleic acid base sequence corresponding to amino acids 9 to 118 of SEQ ID No. 35 in the Sequence Listing. SEQ ID NO: 8 in the Sequence Listing shows the nucleic acid base sequence corresponding to amino acids 9 to 111 of SEQ ID NO: 36 in the Sequence Listing.

The present invention relates to the following antibodies, nucleic acids encoding the antibodies, methods for producing the antibodies using the nucleic acids, and pharmaceutical compositions comprising the antibodies. (1) An antibody having an affinity for the CD4 antigen, wherein CDR-1, CDR-2, and CDR-3 of the H chain variable region are the amino acid sequences described in SEQ ID NOs: 1, 2, and 3, respectively. (2) An antibody having an affinity for the CD4 antigen, wherein CDR-1, CDR-2, and CDR-3 of the L chain variable region have the amino acid sequences described in SEQ ID NOs: 4, 5, and 6, respectively. (3) Hybridoma 4H5 whose accession number is FERM P-16807
A monoclonal antibody against the CD4 antigen, produced by the company. (4) A nucleic acid encoding the antibody according to any one of (1) to (3). (5) The nucleic acid according to (4), which comprises the nucleotide sequence of SEQ ID NO: 7 or 8 in the sequence listing. (6) A method for producing an antibody using the nucleic acid according to (4) or (5). (7) A recombinant antibody that can be obtained by the method of (6) and has affinity for the CD4 antigen. (8) The recombinant antibody according to (7), wherein the Fc region of the antibody is human. (9) The recombinant antibody according to (7), wherein the antibody is a single-chain antibody. (10) A pharmaceutical composition comprising the antibody according to any one of (1) to (3) and a pharmaceutically acceptable carrier. (11) A pharmaceutical composition comprising the recombinant antibody according to any one of (7) to (9) and a pharmaceutically acceptable carrier.

The term "antibody" as used in the present invention means not only an antibody which normally exists in a living body but also at least one antigen-binding site formed by a variable region of an H chain or an L chain of the antibody or a combination thereof. Including molecules. For example, a peptide comprising only the variable region of an H chain, a Fab consisting of a set of H chain fragments and an L chain fragment, and a peptide consisting of two sets of H chain fragments and an L chain fragment (Fa
b ′) ₂ , including a single-chain antibody “ScFv” in which an H-chain fragment and an L-chain fragment are linked in series on the same peptide.

The "human CD4 antigen" in the present invention is defined as Pa
rnes, reported by JR (Adv. Immunology, 44, 2
65, 1989), and helper T expressed on lymphocytes
Known as a cell antigen marker. The CD4 antigen is also expressed on monocytes, macrophages and the like in humans.

It has been shown by the humanization of mouse antibodies that the antigen specificity and the binding strength of an antibody are determined mainly by the amino acid sequence of CDRs (Gussow, D. and S).
eemann, G., Methods in Enzymology, 203: 99-121 (199
1); Glaser, SM et al., J. Immunology 149: 2607-26
14 (1992)). Various vectors can be used for secretory expression of antibodies by COS7 cells (Whittle, N. and Ada
ir, J. et al. (1987), Protein Eng., 1 (6), 499-50
5 .; Sutter, KD and Feys, V. et al. (1992), Gene
113, 223-30.) And a plasmid pG14H5 capable of expressing a human / mouse chimeric anti-human CD4 antibody was prepared using a human antibody expression plasmid (pG1). This can be transfected into COS7 cells to produce a human anti-CD4 antibody. As used herein, the term “human / mouse chimeric antibody” refers to an antibody produced by a gene whose variable region is a hybridoma-derived mouse gene sequence and whose constant region is composed of a human-derived gene sequence. pG1 is a plasmid improved by removing the transmembrane domain (TM) added to the sequence of human Cγ1 of the pSE plasmid described in International Publication WO95 / 15393 to be secreted in vivo like a normal antibody. It is. The details of the preparation are described as Reference Example 1. That is, the plasmid has a gene sequence encoding a human constant region, and can express a human mouse chimeric antibody by connecting a mouse variable region gene.

COS7 cells are usually supplemented with 10% fetal bovine serum (FBS).
Culture is performed at 37 ° C. in the presence of 5% CO ₂ using Dulbecco's Modified Eagle's Medium (DMEM medium). Methods for gene transfer into COS7 cells and methods for breeding and production of cells after gene transfer are described in Biomanual Series 4 Gene Transfer and Expression / Analysis Methods; Tatsuo Yokota, Ken-ichi Arai, Yodosha (1994), etc. I have. Methods for gene transfer into COS7 cells include electroporation, DEAE dextran method (Bebbington, CR (1991);
METHODS: A Companion to Methods in Enzymology, 2
(2), 136-45.).

In the present invention, since the constant region gene integrated into pG1 is Cγ1, each clone was expressed as IgG1. At the time of antibody production, it is desirable to culture in a serum-free DMEM medium in order to avoid contamination of serum-derived bovine antibodies. Anti-CD thus secreted into the culture supernatant
The four antibodies can be easily purified by, for example, a general IgG antibody purification method using protein A or protein G. CHO cells and myeloma Sp 2/0 cells are well known as hosts for industrial production (Xiang, J. et al.
al. (1990) Mol. Immun., 27, 809; Bebbington, C.
R. et al. (1992) Bio / technology, 10, 169; Larric
k, JW and Wallace, EF et al. (1992) Imunol. Re
v. 130, 69-85 .; Deyev, SM and Lieber, A. et al.
(1994) Appl. Biochem. Biotechnol. 47 (2-3), 143-5
Four.). For example, in CHO cells, a method for selecting a highly productive clone with a drug such as MTX has also been reported (Bebb
tonington, CR (1991) METHODS: A Companion to Metho
ds in Enzymology, 2 (2), 136-45.) If a stable high-producing strain can be obtained, the strain can be used for industrial production of a recombinant anti-human CD4 antibody.

When a human mouse chimeric antibody is used as a drug, the antigenicity in the human body is extremely reduced as compared with a mouse antibody, and the safety is further improved. F (ab ') _{2 obtained} by degrading a normal antibody with a protease such as pepsin
Even when the fragment is used, the fragment using human Fc is higher in safety than the mouse fragment. In addition, when applied to medical devices, antibodies used as ligands may be released in trace amounts due to the degradation of proteases and the like. Is high.

[0021] Single chain antibodies are expected to have the effect of reducing antigenicity by reducing the molecular weight. Antibodies made by treating antibodies with proteases such as papain into Fab
Single chain antibodies, which still contain the mouse constant region, but without them, can be very poorly antigenic. In some cases, a single-chain antibody can be isolated from a hybridoma by using a Recombinant Phage Antibody System kit (Pharmacia) or the like, but the single-chain antibody is toxic to Escherichia coli as a production host. In the case where Escherichia coli is killed or the single-chain antibody is degraded, the kit cannot be used effectively, and much contrivance is required. A single-chain antibody can be prepared by examining an inducible vector such as a pSE380 plasmid (Invitrogen) or a pET24d (+) plasmid (Novagen) and a host strain. In the production, in addition to the above-described methods, eukaryotic cell expression systems, insect cell expression systems, and yeast cell expression systems can also be used effectively. As the linker that binds the H chain and the L chain, (Gly-Gly-Gly-Gly-Ser) × 15 repeat amino acids were used, but the present invention is not limited to this sequence and can be used.

The antibodies produced in the present invention can be used to separate CD4 positive cells. ADVANTAGE OF THE INVENTION By this invention, it becomes possible to isolate | separate CD4 positive cells efficiently from a blood cell suspension in vitro or from blood by extracorporeal circulation. Can be used for treatment. Preparation of CD4 cell-free cell mixture, blood product, or CD
A cell suspension containing 4-positive cells as a main component; a CD4 cell preparation can be easily prepared. Elimination of CD4-positive cells is expected to improve symptoms such as autoimmune diseases such as rheumatoid arthritis, multiple sclerosis, and systemic lupus erythematosus. As the shape of the antibody, it is possible to use the produced antibody molecule as it is, but Fab, F, which are fragments containing an antigen binding site obtained by various protease treatments.
(ab ') ₂ , Fv or Fd can also be applied.
These fragments are described in "Introduction to Antibody Engineering" (Chijinshokan) and the like. In addition, when the present invention is applied to extracorporeal circulation of blood in the human body, side effects other than when the antibody is released into the blood, antigenicity, etc. are considered in order to convert the portion other than the variable region into a humanized antibody. It is also useful to use chimeric antibodies. The method for producing these antibodies is not particularly limited, but a highly purified one must be used. Monoclonal antibody production method
A commonly used method is to grow the hybridoma in the abdominal cavity of a mouse and recover the antibody produced from ascites, or to obtain the antibody from a culture supernatant in a serum-free medium. In the case of a fragment peptide, it can be obtained by enzymatic treatment of an antibody molecule, but it can also be produced by bacteria, yeast, or the like by genetic engineering techniques. By combining the monoclonal antibody, monoclonal antibody-derived antibody fragment, peptide, etc. obtained by these methods, stronger binding properties are produced.

The antibody produced by the gene of the present invention is conjugated with a toxin and administered to patients with rheumatoid arthritis, multiple sclerosis, systemic lupus erythematosus, etc., to obtain CD4 + lymphocytes having an autoreactive antigen receptor. Clones can be reduced. Such modified antibodies can also be used in peripheral blood of patients collected by apheresis, and in peripheral blood leukocyte suspensions. Further, by combining genes of variable regions derived from other antibodies, it becomes possible to produce a bispecific antibody and a multispecific antibody. Multispecific refers to an antibody having at least two or more antigen binding sites that recognize different antigens or epitopes. Among them, bispecific refers to an antibody having two or more types of antigen-binding sites that recognize different antigens or epitopes. For example, a normal antibody in which one antigen-binding site recognizes the CD4 antigen and the other antigen-binding site is bispecific for T lymphocyte antigen CD3, etc., recognizes CD4-positive T lymphocytes more strongly. Is considered possible. Besides CD3,
Pan-lymphocyte markers such as CD2, CD5, CD6, CD7 and the like can be used. If these are combined and expressed as IgM, bispecific and multispecific antibodies can be prepared. In addition to bispecific production during such production, a monoclonal antibody can be produced and purified, and then the antibodies can be combined to produce a bispecific or multispecific antibody.

These include not only different antigens, but also different epitopes within the same molecule, such as different anti-C
It is also possible to combine D4 antibodies. Several anti-CD4 antibodies have been reported. For example, Leu-3a antibody, Le
u-3b antibody (Becton Dickinson), OKT4 antibody, OKT4
A antibody (Ortho), T4 antibody (Coulter), MT310
Antibody (Dako), F101-69 antibody, 16P25 antibody (Biosys), Edu-2 antibody, MEM-115 antibody (Simbas Biotechnology), 7E14 antibody (Exalfia Corporation), BL4 antibody, 13B8.2 Antibody (Immunotech), KT69-7 antibody (Love Vision Corporation), B-F51 antibody (Progen Biotechnic), BL
-TH4 antibody (SanBio BV), 94B1 antibody, L197 antibody, L8
0 antibody, L93 antibody, L201 antibody, L34 antibody, L202 antibody, L2
00 antibody, L252 antibody, 73F11 antibody, 72G4 antibody, NUTH1 antibody, L71 antibody, RFT4 antibody, MT151 antibody, MT321 antibody (D.
G. Healey et al., Eur. J. Immunol., 21, 149, 199.
1 year), OKT4B antibody, OKT4C antibody, OKT4D antibody, OKT4E antibody, OKT4F antibody, Q6D3 antibody, L77 antibody, L104 antibody, L83
Antibody, L190 antibody, L122 antibody, L120 antibody (Matthias Merken
Schlager et al., The J. Immunol. 145: 2839, 19
90 years), and these antibody genes can be isolated and used for production.

The amino acid sequence of the single-chain antibody is shown in SEQ ID NO: 9 and SEQ ID NO: 10 in the Sequence Listing. In addition, examples of the nucleic acid sequence encoding it are shown together with the amino acid sequence. 1 to 22 of the amino acid sequence of SEQ ID NO: 9 contains a signal for secretion from Escherichia coli, 23 to 133 are L chain variable regions, 134 to 148 are linkers, 149 to 266 are H chains The variable region of FLAG-tag (2
70th to 277th), c-myc-tag (281st to 290th), H
Shows a sequence containing is × 6-tag (positions 296 to 301). The amino acid sequence of SEQ ID NO: 10 is a sequence containing a signal for secretion from Escherichia coli, positions 23 to 140 are variable regions of an H chain, positions 141 to 155 are linkers, positions 156 to 266 are L chains. The variable region of FLAG-tag (270
From position 277), c-myc-tag (from position 281 to 290), His
Shows a sequence containing × 6-tag (positions 296 to 301). It is also possible to delete the amino acid sequence from position 1 to position 20 of SEQ ID NO: 9 and SEQ ID NO: 10 to express a single-chain antibody in E. coli cells. In addition, the amino acid sequence described in SEQ ID NO: 9 and SEQ ID NO: 10 from position 267 to position 305 is:
Sequence for detection and purification of a single-chain antibody, which may be deleted or replaced with any sequence. Preparation of a vector containing a secretion signal from E. coli and a sequence for detection and purification is shown in Reference Example 2. The linker at positions 134 to 148 of the amino acid sequence of SEQ ID NO: 9 and at positions 141 to 155 of the amino acid sequence of SEQ ID NO: 10 substantially maintain the three-dimensional structure of the variable region of the L and H chains substantially the same as that of the 4H5 antibody Any sequence can be substituted if possible. Amino acid sequence 305 set forth in SEQ ID NO: 9 and SEQ ID NO: 10
Lys residues work effectively when, for example, immobilizing a single-chain antibody molecule when immobilized on a water-insoluble carrier, but multiple Lys residues may be introduced to further improve the immobilization efficiency. it can. It is also effective to introduce a Cys residue. Such modifications as described above can be easily performed by genetic engineering techniques.

Even in the case of a single-chain antibody, a toxin can be bound. In addition, bispecific and multispecific methods can be used during production, and production can be performed by repeatedly arranging H chains and L chains of a combination of a plurality of antigen recognition sites in one peptide. It can be combined after production and purification. Regardless of the combination of the H chain and the L chain, a peptide consisting only of the H chain or only the L chain can be used. Such an antibody species can be selected depending on the intended use, and can be selected based on the binding strength, antigenicity and the like. The present invention further provides a pharmaceutical composition comprising the above-described monoclonal antibody of the present invention and a pharmaceutically acceptable carrier. The anti-CD4 of the present invention thus obtained
Antibody genes allow for the efficient production of anti-CD4 antibodies and provide various forms of therapeutic formulations. The recombinant antibody thus produced can be used in a pharmaceutical composition together with a substance used to maintain the activity of the antibody upon administration to the human body, such as a carrier or a stabilizer having a pharmaceutically acceptable component composition. May be included. Examples of such carriers and stabilizers include human serum albumin, gelatin and the like. Pharmaceutically acceptable means that there are no undesirable side effects associated with administration, such as nausea, dizziness, nausea, and the like, and no immune response to the preparation at the time of frequent administration. Further, the liquid pharmaceutical composition may be dissolved together with a suitable pharmaceutically acceptable solvent, diluent, or stabilizer. Further, in addition to the above-mentioned pharmaceutical composition, a pharmaceutical composition containing a sustained-release implant such as microsphere or liposome for the purpose of controlling the concentration in a living body may be used. In the case of parenteral injection (injection) in the present invention, it is appropriate that the chimeric antibody and the single-chain antibody are about 10 μg to 1 mg / kg of body weight.
When treating cells outside, 0.1 μg to 1 mg / ml
The degree is appropriate.

[0027]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, embodiments of the present invention will be described. However, these embodiments further illustrate the present invention with specific examples, but do not limit the present invention.

[Reference Example 1] The pG1 plasmid was prepared. Expression vector pSE for membrane-bound human antibody (WO95 / 15393)
The transmembrane region (TM) was removed to prepare a vector capable of secreting and expressing human antibodies. First, the expression vector pSE was digested with the restriction enzyme SalI, and the cut ends were blunted. This reaction is
Using DNA Blunting Kit (Takara Shuzo), operation was performed according to the attached protocol. The digested expression vector pSE is digested with the restriction enzyme ApaI and electrophoresed on a 0.7% agarose gel to extract and purify the pSE vector DNA in which the Cγ1 gene and the gene region including the transmembrane region (TM) have been deleted. did. This reaction was performed using GeneCleanII Kit (Bio101) according to the attached protocol. Extracted p
The end of the SE vector cleaved with the restriction enzyme was treated with bovine alkaline phosphatase (Takara Shuzo) so as not to cause self-cyclization. Next, the plasmid DNA pUCCG1, in which the full length of the human Cγ1 gene was integrated, was converted to the restriction enzyme KpnI (Takara Shuzo).
After digestion with blunt ends, the restriction enzyme ApaI
Digested. This reaction product was electrophoresed on a 0.7% agarose gel, and a DNA fragment containing the full length of the Cγ1 gene was extracted and purified. This DNA fragment was ligated to the previously treated pSE vector using a ligation kit Ver. 2 (Takara Shuzo), and the ligation product was introduced into E. coli DH5 strain. Several colonies were selected from the appeared colonies and cultured, and plasmid DNA was extracted and purified according to a conventional method. The cleavage patterns of these plasmids were examined using the appropriate restriction enzymes present in the pSE vector, and those that matched the expected patterns were selected. The plasmid obtained by the above operation was designated as pG1. FIG. 2 shows a diagram of the pG1 plasmid.

[0028]

[Reference Example 2] A vector producing a single-chain antibody (ScFv antibody) is prepared by preparing a secretion signal from Escherichia coli and a plasmid containing a sequence encoding a tag for purification and detection before introducing the anti-CD4 antibody gene. Created. Secretion signal from E. coli (PelB protein signal sequence)
Was obtained according to the Sequence Listing SEQ ID NO: 21 (5'TCATGAAATACCTGCTGC
CGACCGCTGCTGCTGGTCTGCTGCTCCTCGCGGCCCAG 3 ′) and SEQ ID NO: 22 (5′TGCGGCCGCAGCCATGGTGTTTGCGGCCATCGCCGGCT
GGGCCGCGAGGAGCAGCA 3 ') are mixed in equal amounts at 94 ° C and 5 ° C.
Minutes, heat annealed at 65 ° C for 5 minutes after heat denaturation, 72 ° C, 10 minutes,
GeneAmp PCR Reagent Kit with AmpliTaq DNA Polymera
Using se (Takara Shuzo), an extension reaction was performed with a polymerase. This fragment was cloned using a TA cloning kit (Invitrogen). Thus, cDNA encoding a secretory signal from E. coli was obtained.

The sequence encoding the tag for purification and detection can be obtained by referring to SEQ ID NO: 23 in the Sequence Listing (5'TGCGGCCGCAGACTACAAGGAT
GACGATGACAAAGGCTCGAGCGAGCAGAAGCTGA 3 ′) and SEQ ID NO: 24 (5′GGTGGGTCGACCTCGAGCCCAGATCCTCTTCGCTGATCAG
CTTCTGCTCGCTCGAGC 3 ') is mixed in equal amounts at 94 ° C, 5
Minutes, heat denaturation, annealing at 60 ° C for 5 minutes, 72 ° C, 10 minutes,
GeneAmp PCR Reagent Kit with AmpliTaq DNA Polymera
An elongation reaction was carried out using polymerase (Takara Shuzo) with a polymerase. Using the sample after this reaction as a template,
Perform PCR using the following primers.
The amplified fragment was cloned using a TA cloning kit (Invitrogen). As a result, cDNA encoding the tag for purification and detection was obtained. The primer used was SEQ ID NO: 25 in the Sequence Listing (5′TGCGGCCGCAGACTACAAGG
ATG 3 ') and SEQ ID NO: 26 (5' TAAGCTTATCATTTGGTCGACC
CGTGGTGATGATGATGGTGGGTCGACCTCGAGCC 3 ') was used.
PCR conditions are GeneAmp PCR Reagent Kit with AmpliTaq DN
Using A Polymerase (Takara Shuzo), 94 ° C for 1 minute, 62 ° C 1
And 18 ° C. for 1 minute at 72 ° C.
As a PCR device, a DNA Thermal Cycler 480 (Perkin Elmer) was used. The cDNA encoding the secreted signal from Escherichia coli is a restriction enzyme
BspHI (New England Biolabs) and NotI (Takara Shuzo)
The cDNA encoding the tag for purification and detection was digested with the restriction enzymes HindIII (Takara Shuzo) and NotI (Takara Shuzo), and then electrophoresed on a 3.5% agarose gel to obtain each D
The NA fragment was cut out and extracted. DNA from agarose gel
Extraction of fragments was performed using PCR prep (Promega).

The pET24d (+) plasmid (Novagen) was previously removed from the restriction enzyme NotI site in the multiple cloning site to the restriction enzyme Bpu1102I site. The pET24d (+) plasmid was digested with restriction enzymes NotI (Takara Shuzo) and restriction enzyme Bpu1102I (Takara Shuzo), and Klenow f
The ends were blunt-ended using ragment (New England Biolabs) and dNTP mixture (Takara Shuzo) according to the attached protocol. This plasmid DNA fragment was electrophoresed on a 1% agarose gel, cut out and extracted. This was self-cyclized to remove restriction enzyme sites.
The (+) plasmid was obtained. For self-cyclization, a ligation Ver. 2 kit (Takara Shuzo) was used. For extraction of DNA fragments from agarose gel, use GeneCleanII Kit (B
io 101).

PSE380 plasmid (Invitrogen)
Or pET24d (+) after removal of the above restriction enzyme sites
The plasmid was digested with restriction enzymes NcoI (Takara Shuzo) and HindIII (Takara Shuzo), electrophoresed on a 0.8% agarose gel, and the vector DNA fragment was extracted and purified. The cDNA encoding the secretion signal from Escherichia coli digested with the restriction enzyme and the cDNA encoding the tag for purification and detection were ligated to this vector fragment. For each ligation, a ligation Ver. 2 kit (Takara Shuzo) was used. For extraction of DNA fragments from agarose gel, GeneCleanII Ki
t (Bio 101). Plasmid vector for ScFv antibody production produced by the above operation pSE380ScFv and
pET24ScFv was used. FIGS. 3 and 4 show schematic diagrams of the respective components.

[0032]

Example 1 Production and purification of the 4H5 antibody were performed. Anti-human C
D4 antibody producing hybridoma 4H5 (Accession No. FERM P-1680)
7) is DMEM supplemented with 10% fetal bovine serum (FBS) (ICN)
The cells were cultured in a medium (GIBCO). The clones of the hybridomas were separated in advance by the limiting dilution method, and clones having high binding to human soluble CD4 were selected by ELISA using the culture supernatant and immobilized human soluble CD4 (Lipligen). This 4H5 hybridoma clone is
After transplantation into the abdominal cavity of b / c mice, the cells were proliferated and the ascites obtained was purified by affinity chromatography using Protein A Sepharose (Pharmacia) to obtain a purified 4H5 antibody sample.

[0033]

Example 2 Human soluble CD4 was produced and purified in order to evaluate the binding affinity between various antibodies and human CD4. 15 ml of peripheral blood is collected from a healthy person, made up to 30 ml with Hanks balanced saline (Gibco), and gently layered in 13 ml each on two centrifuge tubes into which 10 ml of Ficoll pack (Pharmacia) has been dispensed, 800 rotations The cells were separated under the conditions of / min and 20 min, and the cells in the mononuclear cell layer were collected. The collected cells were washed with Hanks' solution. MRNA from 1 × 10 ⁷ cells
It was isolated using QuickPrep mRNA Purification Kit (Pharmacia) according to the attached instructions. Obtained mRNA
Using this as a template, 1st strand cDNA was synthesized. this is,
This was performed using a cDNA Synthesis Kit (Pharmacia) according to the attached instructions. Then, by PCR, amplify from the start codon of the target gene to just before the transmembrane region (TM), add a HindIII site to the 5 'end, and add a FL
An AG-tag sequence, a stop codon and a NotI site were added. The primer used was SEQ ID NO: 11 in the Sequence Listing (5'AAGC
TTATGAACCGGGGAGTCCCTTTTA 3 ′) and SEQ ID NO: 12 (5 ′
GCGGCCGCTCACTTGTCATCGTCGTCCTTGTAGTCTGGCTGCACCGGGGT
GGACCA 3 '). PCR conditions are GeneAmp PCR Reagent Ki
t with AmpliTaq DNAPolymerase (Takara Shuzo)
One cycle of 4 ° C for 1 minute, 57 ° C for 1 minute, 72 ° C for 2 minutes, 30
Cycled. The PCR device is a DNA Thermal Cycler
480 (Perkin Elmer) was used. The amplified gene fragment was cloned using a TA cloning kit (Invitrogen). For nucleotide sequence determination, use DNA Sequencer Ver. 1.2.0, Model373A (Applied Biosy
stems) according to the manufacturer's protocol. The labeling reaction is performed using Universal M13 Reverse primer (Invitrogen) or Universal M13 Forward prim
er (Invitrogen) as a primer
Ready Reaction Dye Deoxy Terminator Cycle Sequenci
Using ng Kit (Applied Biosystems), the method followed the attached protocol.

For staining, a labeling kit manufactured by ABI was used. After confirming the obtained gene sequence, the pcDNA3 plasmid (Invitrogen), which is an eukaryotic cell expression vector, and the plasmid containing the cloned human soluble CD4 cDNA were ligated with restriction enzymes HindIII (Takara Shuzo) and NotI restriction enzyme.
(Takara Shuzo Co., Ltd.), followed by agarose gel electrophoresis by a conventional method, followed by extraction and purification of a vector and human soluble CD4 cDNA. This reaction is performed using GeneCleanII Kit (Bio 101)
And according to the attached protocol. Ligation kit Ver. 2 (Takara Shuzo)
And the ligation reaction product was introduced into E. coli DH5 strain. Several colonies were selected from the appeared colonies and cultured, and plasmid DNA was extracted and purified according to a conventional method. Using appropriate restriction enzymes present in pcDNA3, the cleavage patterns of these plasmids were examined, and those that matched the expected patterns were selected.

Next, the obtained human soluble CD4 expression plasmid was subjected to the DEAE dextran method (Beb-bington, CR (1992)).
1); METHODS: A Compa-nion to Methods in Enzymolo
gy, 2 (2), 136-45.). Dulbecco's M with 10% fetal bovine serum (FBS)
Approximately 6.1 × 10 ⁵ per 100 mm diameter dish 4 days before gene integration in odified Eagle's Medium (DMEM)
Cells were replated so as to become Cells / 10 ml and cultured. After 4 days, first remove the supernatant, gently wash the cells with PBS (-),
Of DMEM supplemented with 10% FBS, and then a mixture of DEAE dextran / human soluble CD4 expression plasmid was evenly spread on the cells and incubated at 37 ° C. for 4 hours. This mixture was prepared by adding a 20 mg / ml aqueous solution of DEAE dextran (Pharmacia) and a human soluble CD4 expression plasmid to TBS (-) (20
0.17μg / μm with mM Tris ・ HCl (pH7.4), 0.15M NaCl)
The mixture was mixed at 2: 1 (v / v), and 180 μl was added per dish. After the incubation, discard the supernatant, and add 10% dimethyl sulfoxide (DMSO).
5 ml of PBS (-) was added and left for 1 minute. Next, the supernatant was discarded, and after washing with PBS (-), 7 ml of 2% FBS-containing DMEM containing 100 µM chloroquine (Sigma) was added, and the mixture was incubated at 37 ° C for 3 hours. Thereafter, the supernatant was discarded, washed with PBS (-), 10 ml of DMEM supplemented with 10% FBS was added, and the cells were cultured. Next day, PB
After removing FMEM with FBS well by S (-) and DMEM, 10 ml of serum-free DMEM was added to start production.

Three days after the start of the production, the culture supernatant was collected, and the production was continued for about two weeks thereafter. Collect the obtained culture supernatant, and
The product was purified by FLAG-M2 gel (Eastman Chemical Co.) column chromatography and used as a purified sample of human soluble CD4.

[0037]

Example 3 Human soluble CD prepared in Example 2
The PBS (−) solution (5.2 μg / ml) of No. 4 was dispensed in 50 μl portions into a polystyrene 96-well plate (NUNC) and allowed to stand at 4 ° C. overnight to immobilize the antigen. 0.05 after removing the supernatant
The cells were washed with 250 µl of PBS (-) (hereinafter, PBS-T) supplemented with% Tween20.
Blocking was performed by dispensing 100 μl of Block Ace (Dainippon Pharmaceutical) into each well, and allowing it to stand at room temperature for 1 hour. After removing the supernatant of each well, PBS-T
Washed twice with 250 μl. After removing the supernatant, 4H5 antibody adjusted to various concentrations (prepared in Example 1, isotype is I
gG1-κ) or MT310 antibody (Dako, isotype is Ig)
G1-κ) in PBS (-), 50 μl each, dispensed at room temperature
The reaction was allowed to stand for hours. After removing the supernatant, 250 μl of PBS-T
And washed three times. After removing the supernatant, a biotin-labeled anti-mouse IgG (H + L) antibody (VECTOR) diluted 200-fold with PBS-T
Was dispensed into individual wells and allowed to stand at room temperature for 1 hour. After removing the supernatant, the cells were washed three times with 250 μl of PBS-T. After removing the supernatant, vectastai diluted 100-fold with PBS-T
n 50 μl of an equal mixture of solution A and solution B of Elite standard kit (VECTOR) was dispensed into each well and allowed to stand at room temperature for 1 hour. After removing the supernatant, the cells were washed six times with 250 μl of PBS-T. After removing the supernatant, orthophenylenediamine (SIG
MA Co., Ltd.) A color-developing solution obtained by adding 0.01% H ₂ O ₂ to a PBS (-) aqueous solution
After adding 3 μl and reacting at room temperature for 3 minutes, 50 μl of 2N sulfuric acid solution was added to stop the enzyme reaction. The absorbance of the plate at 490 nm was measured.

The antibody concentration (4H5 antibody or MT3 antibody) used in FIG.
10 antibody) and the absorbance. MT31 for 4H5 antibody
The CD4 molecule can be detected at a concentration lower than the 0 antibody, and it has been revealed that the antibody has higher affinity for the human CD4 molecule.

[0039]

Example 4 Antibody 4H5 (prepared in Example 1, isotype is IgG1-κ) and antibody 13B8.2 (Immunotech, isotype is IgG1-κ) were subjected to Superdex200 gel filtration column (Pharmacia) and SMARTsystem (Pharmacia). ), The buffer was replaced with 10 mM acetate buffer pH = 5.0. This antibody solution (100 μg / ml, 70 μl) was immobilized by the amine coupling method by sending the solution to each of different lanes of the sensor chip CM5 (Pharmacia) at 5 μl / min.
An anti-human CD4 antibody-immobilized sensor chip was obtained. Next, the human soluble CD4 prepared in Example 2 was replaced with Superdex2
HBSbuffer (Pharmacia) using a gel filtration column (Pharmacia) and SMARTsystem (Pharmacia)
Was replaced with a buffer. Using BIA-core2000 (Pharmacia), this human soluble CD4 solution (15.2 μg / ml, 20 μl) was used as an analyte on the previously prepared antibody-immobilized sensor chip at 5 μl / min in each lane of the sensor chip. The liquid was sent to obtain a sensorgram at the time of bonding. Thereafter, only HBSbuffer was supplied at 5 μl / min to each lane of the sensor chip to obtain a sensorgram at the time of dissociation. From the analysis of this sensorgram, the dissociation constant between human soluble CD4 and anti-human CD4 antibody (KD: the lower this value, the higher the binding affinity) was obtained.

As a result, the 4H5 antibody had a KD of 1.71 × 10 ⁻⁹ M (K
on = 1.35 × 10 ⁵ M ⁻¹ · S ⁻¹ , Koff = 2.31 × 10 ⁻⁴ S ⁻¹ ), and KD = 7.58 × 10 ⁻⁹ M (Kon = 1.82 × 10 ⁴ M) for the 13B8.2 antibody
⁻¹ · S ⁻¹ , Koff = 1.38 × 10 ⁻⁴ S ⁻¹ ). However, a comparison of the dissociation constants revealed that the 4H5 antibody had a binding affinity for human soluble CD4 that was about 4.4 times higher than the 13B8.2 antibody.

[0041]

[Example 5] Anti-human CD4 antibody producing hybridoma 4H5
(Accession No. FERM P-16807) was cultured in a DMEM medium (GIBCO) supplemented with 10% FBS (ICN). Hybridomas are separated in advance by the limiting dilution method,
A clone having high binding to human soluble CD4 was selected from the culture supernatant by ELISA using human soluble CD4 (Lipligen) immobilized. MRNA from 1 × 10 ⁷ cells
To QuickPrep mRNA Purification Kit (Pharmacia)
And was isolated according to the attached instructions. Obtained mR
1st strand cDNA was synthesized using NA as a template. This was performed using a cDNA Synthesis Kit (Pharmacia) according to the attached instructions. Thereafter, the target gene was amplified by PCR using the cDNA obtained above as a template.

For obtaining the H chain, the primers are Mouse Ig
-Using Prime Kit (Novagen), SEQ ID NO: 13 (5'GGGAATTCATGRAATGSASCTGGGTYWTYCTCTT 3 ') and SEQ ID NO: 14 (5'CCCAAGCTTCCAGGGRCCARKGGATARACNGR)
The gene was amplified from the primer having the sequence of TGG 3 '). PCR conditions are GeneAmp PCR Reagent Kit with Ampli
Use Taq DNA Polymerase (Takara Shuzo) at 94 ° C for 1 minute, 50 ° C
One cycle was performed at 72 ° C. for 2 minutes, and 30 cycles were performed. As a PCR device, a DNA Thermal Cycler 480 (Perkin Elmer) was used. The amplified gene fragment
Cloning was performed using a TA cloning kit (Invitrogen).

Regarding the acquisition of the L chain, the N chain
The terminal amino acid sequence is converted to a protein sequencer (Applied
15 residues from the N-terminus were determined by Biosystems 492 Protein Sequencer according to the attached protocol.
For the sense primer, a plurality of base sequences that can be encoded were synthesized based on the N-terminal amino acid sequence. Antisense primers, Sequences of Proteins of Immunological Interest,
Multiple genes were synthesized with reference to the mouse antibody variable region gene sequence described in 5th edition, 1991 (USA NIH). A PCR method combining these sense primers and antisense primers was performed. Sequence Listing SEQ ID NO: 15
(5′TGTGCCCTCGAGCTNACNCARAGYCCNGC 3 ′) and the primer having the sequence of SEQ ID NO: 16 (5′ATGGATACTAGTGGTGCAGCATCAGCCC 3 ′) amplified the L chain variable region gene (partial length). PCR conditions are GeneAmp PCR Reagent Kit with A
94 ° C using mpliTaqDNA Polymerase (Takara Shuzo)
Each cycle was performed for 30 minutes at 55 ° C. for 1 minute and at 72 ° C. for 2 minutes. The PCR instrument is a DNA Thermal Cycler 480
(PerkinElmer) was used. The amplified gene fragment was cloned using a TA cloning kit (Invitrogen).

The variable region (partial length) base sequences of the H chain and L chain of the obtained genes were determined. The nucleotide sequence was determined using DNA Sequencer Ver. 1.2.0, Model 373A (Appl.
iedBiosystems) according to the manufacturer's protocol. The labeling reaction was performed using the Universal M13 Reverse pr
imer (Invitrogen) or Universal M13For
Using ward primer (Invitrogen) as a primer, PRISM Ready Reaction Dye Deoxy Terminator Cycle
Using the Sequencing Kit (Applied Biosystems), the method followed the attached protocol. For staining, a labeling kit of ABI was used.

Further, regarding the acquisition of the L chain, the target gene was amplified again by the PCR method in order to acquire the unacquired region at the N-terminal. Primers are Mouse Ig-Prime Kit
(Novagen) and the nucleotide sequence complementary to the obtained cDNA of the "CDR-3" cDNA, and using the sequence listing SEQ ID NO: 17 (5'GGGAAT
TCATGGAGACAGACACACTCCTGCTAT 3 ') and SEQ ID NO: 18
The gene was amplified from the primer having the sequence of (5'CGTCGGAGGATCCTCACTACT 3 '). PCR conditions are GeneAmp PCR Re
agent Kit with AmpliTaq DNA Polymerase (Takara Shuzo)
And 30 cycles of 94 ° C. for 1 minute, 50 ° C. for 1 minute, and 72 ° C. for 2 minutes. The PCR device is a DNA Therma
l Cycler 480 (PerkinElmer) was used. The amplified gene fragment was cloned using a TA cloning kit, and the nucleotide sequence of the variable region (N-terminal) of the L chain was similarly determined. Variable region (partial length) of L chain cloned on pCR2.1 plasmid (attached to TAcloning kit)
Using the restriction enzymes PflMI site and HindIII site inside,
The genes for the L chain variable region (N-terminal) and the L chain variable region (partial length) were recombined to construct a gene fragment for the L chain variable region (full length). Restriction enzyme PflMI is New England Bio
Labs Co., Ltd., HindIII restriction enzyme used from Takara Shuzo. GeneCl was used for extraction and purification after agarose gel electrophoresis.
Using eanII Kit (Bio 101), the operation was performed according to the attached protocol. Ligation kit Ver. 2 (Takara Shuzo) was used for ligation of these two DNAs.

The gene sequence of the variable region (full length) of the H chain of the 4H5 antibody determined by the above procedure is shown in SEQ ID NO: 37 together with the amino acid sequence. This is shown in SEQ ID NO: 38.

[0047]

Example 6 The anti-human CD4 antibody obtained in Example 5 (4H5
A gene fragment containing the variable region nucleotide sequence of the H chain (amino acids 4 to 118) and the L chain (amino acids 4 to 111) of the antibody) is incorporated into a pG1 plasmid, and a plasmid capable of expressing an anti-CD4 human mouse chimeric antibody Produced. Using the plasmid DNA of the clone containing the gene fragment of the H chain variable region as a template, SEQ ID NO: 19 (5 ′ CAGGATCCGCTG
CAGCAGTCTGGACCT 3 ') and SEQ ID NO: 20 (5'TGGGCCCGT
Using a primer having the sequence of CGTTTTGGCTGCAGAGAC 3 '), a heavy chain variable region fragment newly introduced with ApaI and BamHI restriction enzyme sites was prepared by PCR. PCR conditions
GeneAmpPCR Reagent Kit with AmpliTaqDNA Polymerase
Using (Takara Shuzo Co., Ltd.), 30 cycles were performed with 94 ° C for 1 minute, 55 ° C for 1 minute, and 72 ° C for 2 minutes as one cycle. As a PCR device, a DNA Thermal Cycler 480 (Perkin Elmer) was used. The amplified fragment was cloned using a TA cloning kit (Invitrogen). The DNA fragment containing the variable region nucleotide sequence of the H chain (amino acids 4 to 118) is digested with restriction enzymes ApaI (Takara Shuzo) and BamHI (Takara Shuzo), developed on a 2% agarose electrophoresis gel, cut out and extracted. did. To extract DNA fragments from agarose electrophoresis gel, use GeneCleanII Kit (Bio101).
The operation was performed according to the attached protocol.

Next, the vector pG1 was replaced with the restriction enzymes ApaI and Ba
After digestion with mHI, the fragment was excised and extracted similarly from a 0.7% agarose electrophoresis gel and ligated. The ligation reaction was introduced into E. coli strain JM109. For this ligation reaction, a ligation kit ver. 2 (Takara Shuzo) was used. The transformed Escherichia coli was plated on an LB plate containing ampicillin and cultured overnight. Several colonies were selected from the colonies that appeared, and plasmid DNA was extracted and purified according to a conventional method. These were digested with the restriction enzymes ApaI and BamHI used for integration, and those into which a fragment containing the base sequence of the H chain variable region was inserted were selected.
Next, a clone in which a gene was amplified from a primer having a sequence of SEQ ID NO: 13 (5'TGTGCCCTCGAGCTNACNCARAGYCCNGC 3 ') and SEQ ID NO: 14 (5'ATGGATACTAGTGGTGCAGCATCAGCCC 3') obtained in Example 5 for the L chain. Digested with the restriction enzymes XhoI (Takara Shuzo) and SpeI (Takara Shuzo) and developed on a 1% agarose electrophoresis gel And the D chain containing the L chain variable region base sequence
The NA fragment was cut out and extracted. DNA from agarose gel
The extraction of the fragments was performed using GeneCleanII Kit (Bio101) according to the attached protocol. next,
The vector pG1 into which the DNA fragment containing the H chain variable region nucleotide sequence was inserted was digested with the restriction enzymes XhoI and SpeI, ligated with 0.7% agarose gel and similarly extracted and extracted,
The ligation reaction was introduced into E. coli strain JM109. For this ligation reaction, a ligation kit ver. 2 (Takara Shuzo) was used. The transformed Escherichia coli was plated on an LB plate containing ampicillin and cultured overnight. Several colonies were selected from the colonies that appeared, and plasmid DNA was extracted and purified according to a conventional method. These were digested with the restriction enzymes XhoI and ApaI used for integration, and those into which fragments containing the H chain and L chain variable region base sequences were inserted were selected. The secretory antibody expression plasmid obtained by the above method was designated as pG14H5.

[0049]

Example 7 The secretory antibody expression plasmid pG14H5 obtained in Example 6 was used in a DEAE dextran method (Beb-bington,
CR (1991); METHODS: A Compa-nion to Methods in
Enzymology, 2 (2), 136-45.). Dulb containing COS7 cells in 10% fetal bovine serum (FBS)
Using ecco's Modified Eagle's Medium (DMEM), about 6.1 per 100 mm diameter dish 4 days before gene integration
The cells were replated so as to be × 10 ⁵ cells / 10 ml and cultured. Four days later, first remove the supernatant, gently wash the cells with PBS (-), add 4 ml of DMEM supplemented with 10% FBS, and then sprinkle the DEAE dextran / secretory antibody expression plasmid mixture evenly on the cells. And incubated at 37 ° C for 4 hours. This mixture is 20mg / ml DEAE Dextran (Pharmacia)
The aqueous solution and the secretory antibody plasmid were converted to TBS (-) (20 mM Tris
HCl (pH7.4), 0.15M NaCl) to make 0.17μg / μl solution mixed at 2: 1 (v / v).
Add 180 μl. After the incubation, discard the supernatant, and add PBS (-) 5% with 10% dimethyl sulfoxide (DMSO).
ml was added and left for 1 minute. Next, the supernatant was discarded, washed with PBS (-), and then washed with 2% FBS containing 100 μM chloroquine (Sigma).
Added 7 ml of DMEM and incubated at 37 ° C. for 3 hours. After that, discard the supernatant, wash with PBS (-), and add 10% FBS.
10 ml of DMEM was added and cultured. The next day, DMEM with FBS was removed well with PBS (-) and DMEM, and then 10 ml of serum-free DMEM was added to start production.

Three days after the start of the production, the culture supernatant was collected, and the production was continued for about two weeks thereafter. The obtained culture supernatant was collected and purified by protein G sepharose column chromatography to obtain a purified human mouse chimeric anti-CD4 antibody (hereinafter referred to as chimeric 4H5 antibody).

[0051]

Example 8 Human soluble CD prepared in Example 2
4 with Superdex200 gel filtration column (Pharmacia)
The buffer was replaced with 10 mM acetate buffer pH = 5.0 using SMARTsystem (Pharmacia). This human soluble CD4 solution
(250 μg / ml, 20 μl) was sent to different lanes of the sensor chip CM5 (Pharmacia) at 5 μl / min to immobilize it by the amine coupling method to obtain a human soluble CD4-immobilized sensor chip. 4H5 antibody (prepared in Example 1) or chimeric 4H5 antibody (prepared in Example 7)
Superdex200 gel filtration column (Pharmacia) and SM
The buffer was replaced with HBSbuffer (Pharmacia) using ARTsystem (Pharmacia). Using BIA-core2000 (Pharmacia), this 4H5 antibody solution or chimera was placed on the previously prepared human soluble CD4-immobilized sensor chip.
Using the 4H5 antibody solution (50 μg / ml, 20 μl) as the analyte,
The solution was sent to each lane at μl / min to obtain a sensorgram at the time of binding. Thereafter, only HBSbuffer was supplied at 5 μl / min to each lane of the sensor chip to obtain a sensorgram at the time of dissociation. From the analysis of this sensorgram, the dissociation constant between human soluble CD4 and anti-human CD4 antibody (KD: the lower this value, the higher the binding affinity) was obtained. As a result, KD = 8.08x for 4H5 antibody
10 ^-10 M (Kon = 6.60 x 10 ³ M ^-1 · S ^-1 , Koff = 5.33 x 10 ^-6 S
^-1 ) and KD = 1.24 × 10 ⁻⁹ M (Kon
= 2.36 × 10 ⁴ M ⁻¹ · S ⁻¹ , Koff = 2.92 × 10 ⁻⁵ S ⁻¹ ), indicating that it can strongly bind to the human CD4 antigen.

[0052]

Example 9 A stable high-producing strain which can be used for industrial production of chimeric 4H5 antibody was obtained. CHO cells and myeloma Sp 2/0 cells are well known as hosts for industrial production (Xiang, J. et al. (1990) Mol. Immun., 27, 809; B
ebbington, CR et al. (1992) Bio / technology, 10,
169; Larrick, JW and Wallace, EF et al. (199
2) Imunol. Rev. 130, 69-85 .; Deyev, SM and Liebe
r, A. et al. (1994) Appl. Biochem. Biotechnol. 47
(2-3), 143-54.). For example, in CHO cells, a method for selecting a highly productive clone using a drug such as MTX has also been reported (Bebbington, CR (1991) METHODS: A Companion).
Ion to Methods in Enzymology, 2 (2), 136-45), and by referring to this method, a high-producing strain of a stable chimeric 4H5 antibody was obtained. That is, the CHOdhfr- strain (ATCC CRL-9096) was converted into a buffer for electroporation (272 mM sucrose, 7 mM phosphate buffer, 1 mM
(M MgCl ₂ , pH = 7.4) to a concentration of 1.0 × 10 ⁷ cells / ml, 500 μl was dispensed into a cuvette for electroporation (Bio-rad), and cooled with ice. Here, pG prepared in Example 6 was used.
10 μg of 14H5 plasmid and pSV2dhfr plasmid (ATCC No.
37146) 1 μg was mixed and cooled on ice for 5 minutes. 3μF, 0.55
An electric pulse of kV was applied, and the mixture was ice-cooled for 1 minute. Again 3μ
F. An electric pulse of 0.55 kV was applied, and the mixture was ice-cooled for 5 minutes. The electric pulse was applied using a bio-rad Gene Pulser. The cells were transferred to 10 ml of a medium containing 10% FBS in F12 medium (GIBCO), and a 100 mm tissue culture dish (FALCON
At 37 ° C. under 5% CO ₂ overnight. The cells were detached from the dish using a trypsin-EDTA solution (GIBCO), transferred to a 120 ml medium containing 10% dialyzed FBS (GIBCO) in DMEM medium (GIBCO), and seeded on four 150 mm tissue culture dishes. did. The medium was replaced with the same medium every two to three days. In about two weeks, colonies of cells are formed so that they can be observed with the naked eye.

Dozens of colonies were isolated, and MTX (A
methopterin; SIGMA) DMEM medium + 10 with 20 nM
The cells were cultured in% dialysis FBS (GIBCO). The medium was replaced with the same medium every two to three days, and the cells were cultured for one month. Clones having acquired MTX drug resistance (clones capable of growing in the same medium) were cultured in a DMEM medium supplemented with 100 nM of MTX + 10% dialyzed FBS medium. The medium was replaced with the same medium every two to three days, and the cells were cultured for one month. The concentration of chimeric 4H5 antibody in the culture supernatant of clones that finally acquired 100 nM MTX drug resistance (clone that can grow in the same medium) was determined using human immunoglobulin G (Ig
G) Using a subclass EIA kit (The Binding site) for IgG1, measurement was performed, and a high-producing strain of a stable chimeric 4H5 antibody was selected. With these techniques, chimeric 4H5 antibody was
A stable expression strain was produced at a rate of 10 ⁶ cells / day.

[0054]

Example 10 In order to incorporate an antibody gene into a vector for producing a ScFv antibody, the genes shown in SEQ ID NO: 37 and SEQ ID NO: 38 in the Sequence Listing obtained in Example 5 were replaced with primers containing a restriction enzyme sequence and a linker sequence. Used and amplified by PCR. The primer for the L chain is as shown in SEQ ID NO: 27 (5′AGCC
GGCCATGGCCGACATTGTGCTGACCCAATCTCCA 3 ') and SEQ ID NO: 28 (5'CTCCGGAGCCACCTCCGCCTGAACCGCCTCCACCTTTGAT
TTCCAGCTTGGTGCCTCC 3 ′), the primer for the H chain is SEQ ID NO: 29 (5 ′ CTCCGGAGGTGGCGGATCGCAGGTTCAGCTGCAG
CAGTCT 3 '), and SEQ ID NO: 30 (5'TGCGGCCGCTGCAGAGAC
AGTGACCAGAGTC 3 ') was used. PCR conditions are GeneAmp PCR
Using Reagent Kit with AmpliTaq DNA Polymerase (Takara Shuzo Co., Ltd.), 18 cycles were performed at 94 ° C. for 45 seconds, 58 ° C. for 45 seconds, and 72 ° C. for 1 minute. The PCR device is a DNA Th
ermal Cycler 480 (Perkin Elmer) was used.
Each of the amplified fragments was cloned using a TA cloning kit (Invitrogen). The L chain of this gene is restricted to the restriction enzymes NaeI (Takara Shuzo) and MroI (Toyobo)
The heavy chain is digested with restriction enzymes MroI (Toyobo) and NotI
After digestion with Takara Shuzo Co., each DNA fragment was cut out and extracted by electrophoresis on a 2% agarose gel. To extract DNA fragments from agarose gel, use GeneCleanII Kit (B
io 101).

The pSE380ScFv or pET24ScFv vector prepared in Reference Example 2 was ligated with the restriction enzymes NaeI (Takara Shuzo) and
After digestion with NotI (Takara Shuzo), each DNA fragment was cut out and extracted by electrophoresis on a 1% agarose gel. This was ligated to the L chain and H chain DNA fragments digested with the restriction enzyme as described above. For the ligation, a ligation Ver. 2 kit (Takara Shuzo) was used. D from agarose gel
Extraction of the NA fragment was performed using GeneCleanII Kit (Bio 101). The plasmids obtained by the above operations were each introduced into Escherichia coli DH5 strain. Transformed E. coli
Those derived from the pSE380ScFv vector were plated on ampicillin-containing LB plates, or those derived from the pET24ScFv vector were plated on kanamycin-containing LB plates and cultured overnight.
NA was extracted and purified. The cleavage patterns of these plasmids were examined using appropriate restriction enzymes, and those that matched the expected patterns were selected. 4H5ScFv having an anti-CD4 antibody sequence (N-terminal VL-lin
Plasmids expressing the ker-VH C-terminal (hereinafter referred to as LH) antibody were designated as pSE380ScFv4H5LH or pET24ScFv4H5LH, respectively. In the sequence listing, SEQ ID NO: 9, a single-chain antibody (ScFv4H5L
H) is the amino acid sequence of
Shown with examples.

[0056]

Example 11 In order to incorporate an antibody gene into a vector for producing a ScFv antibody, the gene shown in SEQ ID NO: 37 and SEQ ID NO: 38 obtained in Example 5 was replaced with a primer containing a restriction enzyme sequence and a linker sequence. Used and amplified by PCR. The primer for the H chain can be obtained from SEQ ID NO: 31 (5'AGCC
GGCCATGGCCCAGGTTCAGCTGCAGCAGTCT 3 ') and SEQ ID NO:
32 (5'CTCCGGAGCCACCTCCGCCTGAACCGCCTCCACCTGCAGAGACA
GTGACCAGAGTC 3 ′), the primer for the light chain is SEQ ID NO: 33 (5′CTCCGGAGGTGGCGGATCGGACATTGTGCTGACCCAATCT
CCA 3 '), and SEQ ID NO: 34 (5'TGCGGCCGCTTTGATTTCCA
GCTTGGTGCCTCC 3 ') was used. PCR conditions are GeneAmp PC
Using R Reagent Kit with AmpliTaq DNA Polymerase (Takara Shuzo Co., Ltd.), 18 cycles were carried out at 94 ° C. for 45 seconds, 58 ° C. for 45 seconds, and 72 ° C. for 1 minute. PCR equipment is model name DN
A Thermal Cycler 480 (Perkin Elmer) was used. Each of the amplified fragments was cloned using a TA cloning kit (Invitrogen). The H chain is digested with restriction enzymes NaeI (Takara Shuzo) and MroI (Toyobo), and the L chain is digested with restriction enzymes MroI (Toyobo) and
After digestion with NotI (Takara Shuzo), each DNA fragment was cut out and extracted by electrophoresis on a 2% agarose gel. Extraction of DNA fragments from agarose gel requires GeneCleanII Ki
t (Bio 101).

The pSE380ScFv or pET24ScFv vector prepared in Reference Example 2 was ligated with the restriction enzymes NaeI (Takara Shuzo) and
After digestion with NotI (Takara Shuzo), each DNA fragment was cut out and extracted by electrophoresis on a 1% agarose gel. This was ligated to the H chain and L chain DNA fragments digested with the restriction enzymes described above. For the ligation, a ligation Ver. 2 kit (Takara Shuzo) was used. D from agarose gel
Extraction of the NA fragment was performed using GeneCleanII Kit (Bio 101). The plasmids obtained by the above operations were each introduced into Escherichia coli DH5 strain. Transformed E. coli
Those derived from the pSE380ScFv vector were plated on ampicillin-containing LB plates, or those derived from the pET24ScFv vector were plated on kanamycin-containing LB plates and cultured overnight.
NA was extracted and purified. The cleavage patterns of these plasmids were examined using appropriate restriction enzymes, and those that matched the expected patterns were selected. 4H5ScFv having an anti-CD4 antibody sequence (N-terminal VH-lin
The plasmids expressing the ker-VL C-terminal (hereinafter referred to as HL type) antibodies were designated as pSE380ScFv4H5HL or pET24ScFv4H5HL, respectively. In addition, the single-chain antibody (ScFv4H5H
L) The amino acid sequence of
Shown with examples.

[0058]

Example 12 Escherichia coli DH5 strain transformed with the pSE380ScFv4H5LH plasmid of Example 10 was added to 2 × YT medium (1.6%) supplemented with 100 μg / ml ampicillin and 1% glycerol.
(Bactotryptone, 1% Bacto yeast extract, 0.5% NaCl). The next day, a portion of this was added to a 10-fold amount of the above medium, and after culturing for 1 hour, the supernatant was removed and 1 mM
Was replaced with an equivalent volume of 2 × YT medium supplemented with IPTG, 100 μg / ml ampicillin and 1% glycerol, and after culturing for further 3 hours, the cells from which the culture supernatant had been removed were ice-cooled to 1/10 of the culture volume. TES solution (200mM Tris-HCl (pH = 8.0), 0.5mM EDT
A, 0.5M sucrose). After standing at the ice temperature for 10 minutes, the mixture was centrifuged at 14,000 rpm for 20 minutes at 4 ° C. The supernatant was removed and 1/10 volume of the ice-cooled TE solution (10 mM Tris-HC
l (pH = 8.0), 0.5 mM EDTA). After leaving the mixture at the ice temperature for 30 minutes, the antibody in the periplasm was recovered by centrifugation at 14,000 rpm at 4 ° C. for 20 minutes. The obtained antibody crude fraction is subjected to anti-FLAG-M2 gel (Eastman Chemical)
Purified by column chromatography and then TALON
Purified by metal affinity gel (Clontech). Column chromatography was performed according to the protocol attached to each gel. This is called anti-human CD41
It was used as a purified sample of the main chain antibody (ScFv4H5LH).

Human soluble CD prepared in Example 2
A PBS (-) solution (5.2 µg / ml) of No. 4 was dispensed in 50 µl portions into a polystyrene 96-well plate, and left standing at 4 ° C overnight to immobilize the antigen. After removing the supernatant, 0.05% Tween20
The plate was washed with 250 µl of PBS (-) (hereinafter, PBS-T). Blocking was performed by dispensing 100 μl of Block Ace (Dainippon Pharmaceutical) into each well, and allowing it to stand at room temperature for 1 hour. After removing the supernatant of each well, PBS-T 250μ
Washed twice with l. After removing the supernatant, the above-prepared anti-human CD4 single-chain antibody (ScFv4H5LH) in PBS (-) solution, 10 μg /
ml and 50 μl were dispensed and allowed to stand still at room temperature for 2 hours. After removing the supernatant, the cells were washed three times with 250 μl of PBS-T. After removing the supernatant, a horseradish peroxidase-labeled anti-myc antibody (Invitrogen) 50-fold diluted 1000-fold with PBS-T
μl was dispensed into individual wells and left at room temperature for 2 hours.
After removing the supernatant, the cells were washed three times with 250 μl of PBS-T. After removing the supernatant, the PB of orthophenylenediamine (SIGMA)
50 μl of a coloring solution containing 0.01% H ₂ O ₂ added to the S (−) solution,
After reacting at room temperature for 7 minutes, 50 μl of 2N sulfuric acid solution was added to stop the enzyme reaction. The absorbance of this plate at 490 nm was measured. The absorbance at that time was 0.574. When a similar experiment was performed without performing only the operation of immobilizing human soluble CD4, the absorbance was 0.109. These results indicate that the anti-human CD4 single-chain antibody (ScFv4H5LH) recognizes human CD4 and has affinity.

[0060]

Example 13 A stable anti-CD4 antibody-containing preparation was produced. The 4H5 antibody obtained in Example 1 was aseptically replaced with 20 mM phosphate buffer containing 100 mM sodium chloride, pH = 7.4 (PBS) by gel filtration, and 1 mg of the 4H5 antibody and 200 mg of human serum albumin were mixed with PBS. The volume was adjusted to 2 ml and aseptically injected into a glass vial and sealed.

[0061]

Example 14 A stable preparation containing a human mouse chimeric anti-CD4 antibody was prepared. The chimeric 4H5 antibody obtained in Example 7 was aseptically replaced with 20 mM phosphate buffer containing 100 mM sodium chloride, pH = 7.4 (PBS) by gel filtration.
1 mg of antibody and 200 mg of human serum albumin were mixed with PBS and mixed with 2 m
and aseptically injected into a glass vial and sealed.

[0062]

Example 15 A stable single-chain anti-CD4 antibody-containing preparation was produced. The anti-human CD41 single-chain antibody (ScFv
4H5LH) containing 100 mM sodium chloride by gel filtration 20
Aseptic replacement with mM phosphate buffer, pH = 7.4 (PBS), 500 micrograms of the single-chain antibody and human serum albumin
200 mg was mixed with PBS to make 2 ml and aseptically injected into a glass vial and sealed.

[0063]

Example 16 4H5 hybridoma was obtained as follows. The blood was layered on a Ficoll Hypaque, and after centrifugation, a mononuclear leukocyte layer was collected, and CD8-positive cells were immunoprecipitated and removed with an anti-CD8 antibody to obtain a fraction enriched in CD4 lymphocytes. Furthermore, by stimulating this cell fraction with PHA lectin (Eye Laboratory),
Immunization cells were prepared. After washing the cells with a DMEM medium (Gibco), the cells were mixed with an adjuvant, TiterMax (CytRx), and about 2 × 10
7 cells were intraperitoneally administered to Balb / c mouse (Charles River Japan) to be immune. Booster immunizations were performed every two weeks after the initial immunization. Thereafter, three months after the initial immunization, cells prepared in the same manner were boosted intravenously. The NS1 cell line (ATCC TIB-18), a myeloma cell line derived from BALB / c mice,
Passage was performed in a DMEM medium (Gibco) supplemented with 20% FCS.

The spleen obtained from the mouse of the above-mentioned immunized animal was loosened and filtered through a mesh while washing with a DMEM medium.
The spleen cells were separated by centrifugation. After mixing the spleen cells and the NS1 cell line grown above, centrifugation was performed. The mixed cells were suspended so that the final concentration of polyethylene glycol (Boehringer Mannheim) was 30%. The cells were separated by centrifugation, and gradually dispersed in a DMEM tissue culture medium (Gibco) containing 20% fetal calf serum using mouse spleen cells as a feeder. And
Cells were seeded at 106 cells / 100 μl / well in a flat-bottomed 96-well microtiter plate (manufactured by Nunc) and cultured at 37 ° C. in 5% carbon dioxide. One day after cell fusion, 100 μl of HAT medium (13.61 μg / ml hypoxanthine, 3.88 μg / ml
Thymidine and 0.18 μM aminopterin, each supplemented). For the next three days,
About half of the HAT medium was replaced with fresh HAT medium, and thereafter, the same replacement was performed every 2-3 days. Hybridoma (fused cell) clones were cultured and maintained in HT medium (HAT medium containing no aminopterin).

A plurality of the above hybridomas were subcloned by the limiting dilution method. The cell number of these hybridomas was counted by trypan blue dye exclusion and a hemocytometer. And these hybridomas, 100
The cells were suspended at a rate of 0.5 viable cells per μl of HT medium.
Aliquots of 0 μl were dispensed. The medium was exchanged every two to three days to grow hybridomas.

The obtained culture supernatant of the hybridoma was reacted with human leukocytes, and an antibody recognizing CD4 positive cells of human leukocytes was detected by FACScan (Becton Dickinson). By this operation, 4H5 cells excellent in specificity and binding ability were successfully obtained from the obtained antibody group.

[0067]

According to the present invention, an antibody having particularly high affinity and specificity for the human CD4 antigen can be provided. In addition, it is possible to prepare a large amount of a recombinant antibody that recognizes the human CD4 antigen, which is highly safe for human administration,
A ligand for separating CD4 positive cells and an antibody preparation for treating an autoimmune disease can be provided.

[Sequence list]

SEQ ID NO: 1 Sequence length: 5 Sequence type: Amino acid Origin Organism name: Mouse Strain name: 4H5

SEQ ID NO: 2 Sequence length: 17 Sequence type: amino acid Origin Organism name: Mouse Strain name: 4H5 Sequence Glu Ile Tyr Pro Gly Ser Gly Ser Ala Tyr Tyr Asn Glu Met Phe Lys 1 5 10 15 Gly

SEQ ID NO: 3 Sequence length: 9 Sequence type: amino acid Origin Organism name: Mouse Strain name: 4H5

SEQ ID NO: 4 Sequence length: 15 Sequence type: amino acid Origin Organism name: Mouse Strain name: 4H5 Sequence Lys Ala Ser Gln Ser Val Asp Tyr Asp Gly Asp Ser Tyr Met Asn 1 5 10 15

SEQ ID NO: 5 Sequence length: 7 Sequence type: amino acid Origin Organism name: Mouse Strain name: 4H5

SEQ ID NO: 6 Sequence length: 9 Sequence type: amino acid Origin Organism name: Mouse Strain name: 4H5

SEQ ID NO: 7 Sequence length: 330 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA Origin Organism name: Mouse Strain name: 4H5 Sequence CCT GAG CTG GTG AAG CCT GGG GCT TCA GTG AAG ATG TCC TGC AAG GCT 48 Pro Glu Leu Val Lys Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala 1 5 10 15 TCT GGA TAC ACA TTC ACT GAC TAT GTT ATA AAC TGG TTG AAC CAG AGA 96 Ser Gly Tyr Thr Phe Thr Asp Tyr Val Ile Asn Trp Leu Asn Gln Arg 20 25 30 ACT GGA CAG GGC CTT GAG TGG ATT GGA GAG ATT TAT CCT GGA AGT GGT 144 Thr Gly Gln Gly Leu Glu Trp Ile Gly Glu Ile Tyr Pro Gly Ser Gly 35 40 45 AGT GCT TAC TAC AAT GAG ATG TTC AAG GGC AAG GCC ACA CTG ACT GCA 192 Ser Ala Tyr Tyr Asn Glu Met Phe Lys Gly Lys Ala Thr Leu Thr Ala 50 55 60 GAC AAA TCC TCC AAC ACA GCC TAC ATG CAG CTC AGC AGC CTG ACA TCT 240 Asp Lys Ser Ser Asn Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser 65 70 75 80 GAG GAC TCT GCG GTC TAT TTC TGT GCA AGA CGC GGA ACT GGG ACG GGG 288 Glu Asp Ser Ala Val Tyr Phe Cys Ala Arg Arg Gly Thr Gly Thr Gly 85 90 95 TTT GCT TAC TGG GGC CGA GGG ACT CTG GTC ACT GTC TCT GCA 330 Phe Ala Tyr Trp Gly Arg Gly Thr Leu Val Thr Val Ser Ala 100 105 110

SEQ ID NO: 8 Sequence length: 309 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA Origin Organism name: Mouse Strain name: 4H5 Sequence GCT TCT TTG GCT GTG TCT CTA GGG CAG AGG GCC ACC ATC TCC TGC AAG 48 Ala Ser Leu Ala Val Ser Leu Gly Gln Arg Ala Thr Ile Ser Cys Lys 1 5 10 15 GCC AGC CAA AGT GTT GAT TAT GAT GGT GAT AGT TAT ATG AAC TGG TAC 96 Ala Ser Gln Ser Val Asp Tyr Asp Gly Asp Ser Tyr Met Asn Trp Tyr 20 25 30 CAA CAG AAA CCA GGA CAG CCA CCC AAA CTC CTC ATC TAT GCT GCA TCC 144 Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Ala Ala Ser 35 40 45 AAT CTA GAA TCT GGG ATC CCA GCC AGG TTT AGT GGC AGT GGG TCT GGG 192 Asn Leu Glu Ser Gly Ile Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly 50 55 60 ACA GAC TTC ACC CTC AAC ATC CAT CCT GTG GAG GAG GAG GAT GCT GCA 240 Thr Asp Phe Thr Leu Asn Ile His Pro Val Glu Glu Glu Asp Ala Ala 65 70 75 80 ACC TAT TAC TGT CAG CAA AGT AGT GAG GAT CCT CCG ACG TTC GGT GGA 288 Thr Tyr Tyr Cys Gln Gln Ser Ser Glu Asp Pro Pro Thr Phe Gly Gly 85 90 95 GGC ACC AAG CTG GAA ATC AAA 309 Gly Thr Lys Leu Glu Ile Lys 100

SEQ ID NO: 9 Sequence length: 925 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA Origin Organism: Mouse Strain: 4H5 Sequence ATG AAA TAC CTG CTG CCG ACC GCT GCT GCT GGT CTG CTG CTC CTC GCG 48 Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala 1 5 10 15 GCC CAG CCG GCC ATG GCC GAC ATT GTG CTG ACC CAA TCT CCA GCT TCT 96 Ala Gln Pro Ala Met Ala Asp Ile Val Leu Thr Gln Ser Pro Ala Ser 20 25 30 TTG GCT GTG TCT CTA GGG CAG AGG GCC ACC ATC TCC TGC AAG GCC AGC 144 Leu Ala Val Ser Leu Gly Gln Arg Ala Thr Ile Ser Cys Lys Ala Ser 35 40 45 CAA AGT GTT GAT TAT GAT GGT GAT AGT TAT ATG AAC TGG TAC CAA CAG 192 Gln Ser Val Asp Tyr Asp Gly Asp Ser Tyr Met Asn Trp Tyr Gln Gln 50 55 60 AAA CCA GGA CAG CCA CCC AAA CTC CTC ATC TAT GCT GCA TCC AAT CTA 240 Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Ala Ala Ser Asn Leu 65 70 75 80 GAA TCT GGG ATC CCA GCC AGG TTT AGT GGC AGT GGG TCT GGG ACA GAC 288 Glu Ser Gly Ile Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 85 90 95 TTC ACC CTC AAC ATC CAT CCT GTG GAG GAG GAG GAT GCT GCA ACC TAT 336 Phe Thr Leu Asn Ile His Pro Val Glu Glu Glu Asp Ala Ala Thr Tyr 100 105 110 TAC TGT CAG CAA AGT AGT GAG GAT CCT CCG ACG TTC GGT GGA GGC ACC 384 Tyr Cys Gln Gln Ser Ser Glu Asp Pro Pro Thr Phe Gly Gly Gly Thr 115 120 125 AAG CTG GAA ATC AAA GGT GGA GGC GGT TCA GGC GGA GGT GGC TCC GGA 432 Lys Leu Glu Ile Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 130 135 140 GGT GGC GGA TCG CAG GTT CAG CTG CAG CAG TCT GGA CCT GAG CTG GTG 480 Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val 145 150 155 160 AAG CCT GGG GCT TCA GTG AAG ATG TCC TGC AAG GCT TCT GGA TAC ACA 528 Lys Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr 165 170 175 TTC ACT GAC TAT GTT ATA AAC TGG TTG AAC CAG AGA ACT GGA CAG GGC 576 Phe Thr Asp Tyr Val Ile Asn Trp Leu Asn Gln Arg Thr Gly Gln Gly 180 185 190 CTT GAG TGG ATT GGA GAG ATT TAT CCT GGA AGT GGT AGT GCT TAC TAC 62 4 Leu Glu Trp Ile Gly Glu Ile Tyr Pro Gly Ser Gly Ser Ala Tyr Tyr 195 200 205 AAT GAG ATG TTC AAG GGC AAG GCC ACA CTG ACT GCA GAC AAA TCC TCC 672 Asn Glu Met Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser 210 215 220 AAC ACA GCC TAC ATG CAG CTC AGC AGC CTG ACA TCT GAG GAC TCT GCG 720 Asn Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala 225 230 235 240 GTC TAT TTC TGT GCA AGA CGC GGA ACT GGG ACG GGG TTT GCT TAC TGG 768 Val Tyr Phe Cys Ala Arg Arg Gly Thr Gly Thr Gly Phe Ala Tyr Trp 245 250 255 GGC CGA GGG ACT CTG GTC ACT GTC TCT GCA GCG GCC GCA GAC TAC AAG 816 Gly Arg Gly Thr Leu Val Thr Val Ser Ala Ala Ala Ala Asp Tyr Lys 260 265 270 GAT GAC GAT GAC AAA GGC TCG AGC GAG CAG AAG CTG ATC AGC GAA GAG 864 Asp Asp Asp Asp Asp Lys Gly Ser Ser Glu Gln Lys Leu Ile Ser Glu Glu 275 280 285 GAT CTG GGC TCG AGG TCG ACC CAC CAT CAT CAT CAC CAC GGG TCG ACC 912 Asp Leu Gly Ser Arg Ser Thr His His His His His His Gly Ser Thr 290 295 300 AAA TGA TAA GCT T 925 Lys 305

SEQ ID NO: 10 Sequence length: 925 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA Origin Organism: Mouse Strain: 4H5 Sequence ATG AAA TAC CTG CTG CCG ACC GCT GCT GCT GGT CTG CTG CTC CTC GCG 48 Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala 1 5 10 15 GCC CAG CCG GCC ATG GCC CAG GTT CAG CTG CAG CAG TCT GGA CCT GAG 96 Ala Gln Pro Ala Met Ala Gln Val Gln Leu Gln Gln Ser Gly Pro Glu 20 25 30 CTG GTG AAG CCT GGG GCT TCA GTG AAG ATG TCC TGC AAG GCT TCT GGA 144 Leu Val Lys Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly 35 40 45 TAC ACA TTC ACT GAC TAT GTT ATA AAC TGG TTG AAC CAG AGA ACT GGA 192 Tyr Thr Phe Thr Asp Tyr Val Ile Asn Trp Leu Asn Gln Arg Thr Gly 50 55 60 CAG GGC CTT GAG TGG ATT GGA GAG ATT TAT CCT GGA AGT GGT AGT GCT 240 Gln Gly Leu Glu Trp Ile Gly Glu Ile Tyr Pro Gly Ser Gly Ser Ala 65 70 75 80 TAC TAC AAT GAG ATG TTC AAG GGC AAG GCC ACA CTG ACT GCA GAC AAA 288 Tyr Tyr Asn Glu Met Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys 85 90 95 TCC TCC AAC ACA GCC TAC ATG CAG CTC AGC AGC CTG ACA TCT GAG GAC 336 Ser Ser Asn Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp 100 105 110 TCT GCG GTC TAT TTC TGT GCA AGA CGC GGA ACT GGG ACG GGG TTT GCT 384 Ser Ala Val Tyr Phe Cys Ala Arg Arg Gly Thr Gly Thr Gly Phe Ala 115 120 125 TAC TGG GGC CGA GGG ACT CTG GTC ACT GTC TCT GCA GGT GGA GGC GGT 432 Tyr Trp Gly Arg Gly Thr Leu Val Thr Val Ser Ala Gly Gly Gly Gly 130 135 140 TCA GGC GGA GGT GGC TCC GGA GGT GGC GGA TCG GAC ATT GTG CTG ACC 480 Ser Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val Leu Thr 145 150 155 160 CAA TCT CCA GCT TCT TTG GCT GTG TCT CTA GGG CAG AGG GCC ACC ATC 528 Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly Gln Arg Ala Thr Ile 165 170 175 TCC TGC AAG GCC AGC CAA AGT GTT GAT TAT GAT GGT GAT AGT TAT ATG 576 Ser Cys Lys Ala Ser Gln Ser Val Asp Tyr Asp Gly Asp Ser Tyr Met 180 185 190 AAC TGG TAC CAA CAG AAA CCA GGA CAG CCA CCC AAA CTC CTC ATC TAT 624 Asn Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr 195 200 205 GCT GCA TCC AAT CTA GAA TCT GGG ATC CCA GCC AGG TTT AGT GGC AGT 672 Ala Ala Ser Asn Leu Glu Ser Gly Ile Pro Ala Arg Phe Ser Gly Ser 210 215 220 GGG TCT GGG ACA GAC TTC ACC CTC AAC ATC CAT CCT GTG GAG GAG GAG 720 Gly Ser Gly Thr Asp Phe Thr Leu Asn Ile His Pro Val Glu Glu Glu 225 230 235 240 GAT GCT GCA ACC TAT TAC TGT CAG CAA AGT AGT GAG GAT CCT CCG ACG 768 Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Ser Ser Glu Asp Pro Pro Thr 245 250 255 TTC GGT GGA GGC ACC AAG CTG GAA ATC AAA GCG GCC GCA GAC TAC AAG 816 Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Ala Ala Ala Asp Tyr Lys 260 265 270 GAT GAC GAT GAC AAA GGC TCG AGC GAG CAG AAG CTG ATC AGC GAA GAG 864 Asp Asp Asp Asp Lys Gly Ser Ser Glu Gln Lys Leu Ile Ser Glu Glu 275 280 285 GAT CTG GGC TCG AGG TCG ACC CAC CAT CAT CAT CAC CAC GGG TCG ACC 912 Asp Leu Gly Ser Arg Ser Thr His His His His His His Gly Ser Thr 290 295 300 AAA TGA TAA GCT T 925 Lys 305

SEQ ID NO: 11 Sequence Length: 28 Sequence Type: Nucleic Acid Sequence Type: Other Nucleic Acid (Synthetic DNA) Sequence AAGCTTATGA ACCGGGGAGT CCCTTTTA 28

SEQ ID NO: 12 Sequence length: 56 Sequence type: nucleic acid Sequence type: Other nucleic acid (synthetic DNA) Sequence GCGGCCGCTC ACTTGTCATC GTCGTCCTTG TAGTCTGGCT GCACCGGGGT GGACCA 56

SEQ ID NO: 13 Sequence length: 34 Sequence type: Nucleic acid Sequence type: Other nucleic acid (synthetic DNA) Sequence GGGAATTCAT GRAATGSASC TGGGTYWTYC TCTT 34

SEQ ID NO: 14 Sequence length: 35 Sequence type: Nucleic acid Sequence type: Other nucleic acids (synthetic DNA) Sequence CCCAAGCTTC CAGGGRCCAR KGGATARACN GRTGG 35

SEQ ID NO: 15 Sequence length: 29 Sequence type: nucleic acid Sequence type: Other nucleic acid (synthetic DNA) Sequence TGTGCCCTCG AGCTNACNCA RAGYCCNGC 29

SEQ ID NO: 16 Sequence length: 28 Sequence type: nucleic acid Sequence type: Other nucleic acid (synthetic DNA) Sequence ATGGATACTA GTGGTGCAGC ATCAGCCC 28

SEQ ID NO: 17 Sequence length: 33 Sequence type: Nucleic acid Sequence type: Other nucleic acid (synthetic DNA) Sequence GGGAATTCAT GGAGACAGAC ACACTCCTGC TAT 33

SEQ ID NO: 18 Sequence Length: 21 Sequence Type: Nucleic Acid Sequence Type: Other Nucleic Acid (Synthetic DNA) Sequence CGTCGGAGGA TCCTCACTAC T 21

SEQ ID NO: 19 Sequence Length: 27 Sequence Type: Nucleic Acid Sequence Type: Other Nucleic Acid (Synthetic DNA) Sequence CAGGATCCGC TGCAGCAGTC TGGACCT 27

SEQ ID NO: 20 Sequence Length: 27 Sequence Type: Nucleic Acid Sequence Type: Other Nucleic Acid (Synthetic DNA) Sequence TGGGCCCGTC GTTTTGGCTG CAGAGAC 27

SEQ ID NO: 21 Sequence length: 56 Sequence type: Nucleic acid Sequence type: Other nucleic acid (synthetic DNA) Sequence TCATGAAATA CCTGCTGCCG ACCGCTGCTG CTGGTCTGCT GCTCCTCGCG GCCCAG 56

SEQ ID NO: 22 Sequence length: 56 Sequence type: Nucleic acid Sequence type: Other nucleic acid (synthetic DNA) Sequence TGCGGCCGCA GCCATGGTGT TTGCGGCCAT CGCCGGCTGG GCCGCGAGGA GCAGCA 56

SEQ ID NO: 23 Sequence length: 56 Sequence type: Nucleic acid Sequence type: Other nucleic acid (synthetic DNA) Sequence TGCGGCCGCA GACTACAAGG ATGACGATGA CAAAGGCTCG AGCGAGCAGA AGCTGA 56

SEQ ID NO: 24 Sequence length: 57 Sequence type: Nucleic acid Sequence type: Other nucleic acid (synthetic DNA) Sequence GGTGGGTCGA CCTCGAGCCC AGATCCTCTT CGCTGATCAG CTTCTGCTCG CTCGAGC 57

SEQ ID NO: 25 Sequence Length: 23 Sequence Type: Nucleic Acid Sequence Type: Other Nucleic Acid (Synthetic DNA) Sequence TGCGGCCGCA GACTACAAGG ATG 23

SEQ ID NO: 26 Sequence length: 56 Sequence type: Nucleic acid Sequence type: Other nucleic acid (synthetic DNA) Sequence TAAGCTTATC ATTTGGTCGA CCCGTGGTGA TGATGATGGT GGGTCGACCT CGAGCC 56

SEQ ID NO: 27 Sequence length: 38 Sequence type: Nucleic acid Sequence type: Other nucleic acid (synthetic DNA) Sequence AGCCGGCCAT GGCCGACATT GTGCTGACCC AATCTCCA 38

SEQ ID NO: 28 Sequence Length: 58 Sequence Type: Nucleic Acid Sequence Type: Other Nucleic Acid (Synthetic DNA) Sequence CTCCGGAGCC ACCTCCGCCT GAACCGCCTC CACCTTTGAT TTCCAGCTTG GTGCCTCC 58

SEQ ID NO: 29 Sequence length: 40 Sequence type: Nucleic acid Sequence type: Other nucleic acid (synthetic DNA) Sequence CTCCGGAGGT GGCGGATCGC AGGTTCAGCT GCAGCAGTCT 40

SEQ ID NO: 30 Sequence length: 31 Sequence type: Nucleic acid Sequence type: Other nucleic acid (synthetic DNA) Sequence TGCGGCCGCT GCAGAGACAG TGACCAGAGT C 31

SEQ ID NO: 31 Sequence length: 35 Sequence type: nucleic acid Sequence type: Other nucleic acid (synthetic DNA) Sequence AGCCGGCCAT GGCCCAGGTT CAGCTGCAGC AGTCT 35

SEQ ID NO: 32 Sequence length: 56 Sequence type: nucleic acid Sequence type: Other nucleic acid (synthetic DNA) Sequence CTCCGGAGCC ACCTCCGCCT GAACCGCCTC CACCTGCAGA GACAGTGACC AGAGTC 56

SEQ ID NO: 33 Sequence length: 43 Sequence type: Nucleic acid Sequence type: Other nucleic acid (synthetic DNA) Sequence CTCCGGAGGT GGCGGATCGG ACATTGTGCT GACCCAATCT CCA 43

SEQ ID NO: 34 Sequence length: 33 Sequence type: Nucleic acid Sequence type: Other nucleic acid (synthetic DNA) Sequence TGCGGCCGCT TTGATTTCCA GCTTGGTGCC TCC 33

SEQ ID NO: 35 Sequence length: 118 Sequence type: amino acid Origin Organism strain: Mouse Strain name: 4H5 Sequence Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Val Ile Asn Trp Leu Asn Gln Arg Thr Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Tyr Pro Gly Ser Gly Ser Ala Tyr Tyr Asn Glu Met Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Asn Thr Ala Tyr 65 70 75 80 Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys 85 90 95 Ala Arg Arg Gly Thr Gly Thr Gly Phe Ala Tyr Trp Gly Arg Gly Thr 100 105 110 Leu Val Thr Val Ser Ala 115

SEQ ID NO: 36 Sequence length: 111 Sequence type: amino acid Origin Organism name: Mouse Strain name: 4H5 Sequence Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Gln Arg Ala Thr Ile Ser Cys Lys Ala Ser Gln Ser Val Asp Tyr Asp 20 25 30 Gly Asp Ser Tyr Met Asn Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40 45 Lys Leu Leu Ile Tyr Ala Ala Ser Asn Leu Glu Ser Gly Ile Pro Ala 50 55 60 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Asn Ile His 65 70 75 80 Pro Val Glu Glu Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Ser Ser 85 90 95 Glu Asp Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 110

SEQ ID NO: 37 Sequence length: 354 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA Origin Organism name: Mouse Strain name: 4H5 Sequence CAG GTT CAG CTG CAG CAG TCT GGA CCT GAG CTG GTG AAG CCT GGG GCT 48 Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 TCA GTG AAG ATG TCC TGC AAG GCT TCT GGA TAC ACA TTC ACT GAC TAT 96 Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 GTT ATA AAC TGG TTG AAC CAG AGA ACT GGA CAG GGC CTT GAG TGG ATT 144 Val Ile Asn Trp Leu Asn Gln Arg Thr Gly Gln Gly Leu Glu Trp Ile 35 40 45 GGA GAG ATT TAT CCT GGA AGT GGT AGT GCT TAC TAC AAT GAG ATG TTC 192 Gly Glu Ile Tyr Pro Gly Ser Gly Ser Ala Tyr Tyr Asn Glu Met Phe 50 55 60 AAG GGC AAG GCC ACA CTG ACT GCA GAC AAA TCC TCC AAC ACA GCC TAC 240 Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Asn Thr Ala Tyr 65 70 75 80 ATG CAG CTC AGC AGC CTG ACA TCT GAG GAC TCT GCG GTC TAT TTC TGT 288 Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys 85 90 95 GCA AGA CGC GGA ACT GGG ACG GGG TTT GCT TAC TGG GGC CGA GGG ACT 336 Ala Arg Arg Gly Thr Gly Thr Gly Phe Ala Tyr Trp Gly Arg Gly Thr 100 105 110 CTG GTC ACT GTC TCT GCA Leu Val Thr Val Ser Ala 354 115

SEQ ID NO: 38 Sequence length: 333 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA Origin Organism name: Mouse Strain name: 4H5 Sequence GAC ATT GTG CTG ACC CAA TCT CCA GCT TCT TTG GCT GTG TCT CTA GGG 48 Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly 1 5 10 15 CAG AGG GCC ACC ATC TCC TGC AAG GCC AGC CAA AGT GTT GAT TAT GAT 96 Gln Arg Ala Thr Ile Ser Cys Lys Ala Ser Gln Ser Val Asp Tyr Asp 20 25 30 GGT GAT AGT TAT ATG AAC TGG TAC CAA CAG AAA CCA GGA CAG CCA CCC 144 Gly Asp Ser Tyr Met Asn Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40 45 AAA CTC CTC ATC TAT GCT GCA TCC AAT CTA GAA TCT GGG ATC CCA GCC 192 Lys Leu Leu Ile Tyr Ala Ala Ser Asn Leu Glu Ser Gly Ile Pro Ala 50 55 60 AGG TTT AGT GGC AGT GGG TCT GGG ACA GAC TTC ACC CTC AAC ATC CAT 240 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Asn Ile His 65 70 75 80 CCT GTG GAG GAG GAG GAT GCT GCA ACC TAT TAC TGT CAG CAA AGT AGT 288 Pro Val Glu Glu Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Ser Ser 85 90 95 GAG GAT CCT CCG ACG TTC GGT GGA GGC ACC AAG CTG GAA ATC AAA 333 Glu Asp Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 110

[Brief description of the drawings]

FIG. 1 schematically shows the structure of IgG.

FIG. 2 is a schematic diagram of a pGl plasmid.

FIG. 3 is a schematic diagram of a pSE380 ScFv plasmid.

FIG. 4 is a schematic diagram of the pET24 ScFv plasmid.

FIG. 5 is a graph showing the antigen-binding affinities of the 4H5 antibody and the MT310 antibody. The antibody concentration used and the quantitative value by ELISA (AB
S).

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁶ Identification code FI C12P 21/08 C12N 15/00 A

Claims (11)

[Claims] 1. CDR-1, CDR-2 and CDR of H chain variable region
-3 is an amino acid sequence described in SEQ ID NOs: 1, 2, and 3 in the Sequence Listing, respectively, and has an affinity for the CD4 antigen. 2. CDR-1, CDR-2, and CDR of L chain variable region
-3 is an amino acid sequence described in SEQ ID NO: 4, 5, or 6 in the Sequence Listing, and has an affinity for CD4 antigen. 3. A monoclonal antibody against the CD4 antigen, produced by hybridoma 4H5 having the accession number FERM P-16807. A nucleic acid encoding the antibody according to any one of claims 1 to 3. 5. Sequence Listing SEQ ID NO: 7 and SEQ ID NO: 8
The nucleic acid according to claim 4, which comprises the nucleotide sequence according to (1). 6. A method for producing an antibody using the nucleic acid according to claim 4 or 5. 7. A recombinant antibody obtainable by the method of claim 6 and having an affinity for the CD4 antigen. 8. The recombinant antibody according to claim 7, wherein the Fc region of the antibody is human. 9. The recombinant antibody according to claim 7, wherein the antibody is a single-chain antibody. 10. A pharmaceutical composition comprising the antibody according to claim 1 and a pharmaceutically acceptable carrier. 11. A pharmaceutical composition comprising the recombinant antibody according to claim 7 and a pharmaceutically acceptable carrier.