JPH11318463A - Gene which relates to gravitropic excitation-response of plant root - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new gene which codes for a protein which has a specific amino acid sequence, and comprises a protein which relates to gravitropic excitation-response of the plant root, and allows, for example, enhancement of fixation ratio of the plant root into soil, and simplification of harvesting operation. SOLUTION: This gene codes for a protein having an amino acid sequence shown by the formula, or a protein having an amino acid sequence in which one or more amino acid(s) is/are substituted, deleted from, or inserted into the protein, and has a function comparable to a protein having the amino acid sequence shown by the formula and other proteins, and relates to gravitropic excitation-response of the plant root and controls the growth direction of the plant root, so that introduction of the gene allows, for example, enhancement of fixation ratio of the plant root into soil, and simplification of harvesting operation. This gene is obtained by preparing a cDNA library from mRNA isolated from a plant by a conventional method, followed by screening the library using a probe having its partial sequence. The protein is obtained by linking the obtained gene to a vector, followed by expressing the gene in a cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a gene involved in the gravitropic stimulus response of plant roots.

[0002]

2. Description of the Related Art Plant roots extend in the direction in which gravity acts, and this process is called a gravitropic stimulus response. This mechanism goes through processes such as sensation of stimulation, transmission of information, and bending due to uneven cell elongation in the elongation region of the root. It is thought that the sense of gravity is that the amyloplast sediments in the direction of gravity in cormella cells present in the root cap and senses the direction of gravity by compressing the endoplasmic reticulum in that direction (Kiss, JZ, Hertel , R., and Sack, F.
D. (1989) Amyloplasts are necessary for full gravi
tropic sensitivity in roots of Arabidopsis thalian
a.Planta 177, 198-206.). This known information is transmitted to the elongation zone of the root, where a concentration gradient of auxin occurs in the vertical direction, and the lower side elongates more slowly than the upper side, so that it bends in the direction of gravity. However, little is known about the mechanism of their action at the molecular level.

[0003] Various mutant individuals have been found in Arabidopsis thaliana, and among them, axr1-4 (Lincol), which has been isolated as a mutant showing resistance to auxin.
n, C., Britton, JH, and Estelle, M. (1990) Growt
h and development of the axr1 mutants of Arabidops
is. Plant Cell 2, 1071-1080 .; Timpte, CS, Wils
on, AK, and Estelle, M. (1992) Effects of the ax
r2 mutation of Arabidopsis on cell shape in hypoco
tyl and inflorescence. Planta 188, 271-278.
rence, H. and Estelle, M. (1995) The axr4 auxin-re
sistant mutants of Arabidopsis thaliana define ag
ene important for root gravitropismand lateral roo
t initiation. Plant J.7, 211-220.), aux1 (Picket
t, FB, Wilson, AK, and Estelle, M. (1990) The a
ux1 mutation of Arabidopsis confers both auxin and
ethylene resistance.Plant Physiol. 94, 1462-146
6.) is known to show abnormalities in gravity stimulus response,
Of these, axr1 (Leyser, HMO, Lincoln, C., Timp
le, C., Lammer, D., Turner, J., and Estelle, M. (19
93) Arabidopsis auxin resistance gene AXR1 encodes
a protein relatedto ubiquitine-activating Enzyme
E1. Nature 364, 161-164.) And aux1 (Bennett, MJ, M
archant, A., Green, HG, May, ST, Ward, SP, M
illner, PA, Walker, AR, shulz, B., and Feldma
n, KA (1996) Arabidopsis AUX1 Gene: A Permease-Li
ke Regulator of Root Gravitropism.Science 273, 94
8-950.) Has been isolated. On the other hand, as a gravitropic mutation that does not show resistance to auxin, agr
Mutants (agr-1, agr-2, agr-3) were isolated (Bell an
dMaher (1990) Mol Gen Genet 220: 289-293.). As allelic variants to these, wav6-5
2 (Okada and Shimura (1990) Science 250: 274-27
6.) has been isolated. In addition, eir1-1 as a similar mutation
(Roman et al. (1995) Genetics 139: 1393-1409.)
Has been isolated.

[0004] However, the gene causing the agr mutation (AGR gene) has not yet been isolated.

[0005]

An object of the present invention is to provide the AGR gene involved in the gravitropism of plant roots, its analogous genes, and the proteins encoded by these genes. Another object of the present invention is to improve the gravitropic stimulus response of plant roots using these genes.

[0006]

Means for Solving the Problems The present inventors have conducted intensive studies to solve the above-mentioned problems, and by using a positional cloning technique, the agr mutation which inhibits the gravitational stimulus response of the root of a plant has been developed. A single causative gene was successfully identified and isolated in a large chromosomal region. In addition, the present inventors have determined that the isolated AGR gene is involved in the gravitational stimulus response of plant roots. It has been found that it is possible to improve the stimulus response.

[0007] That is, the present invention provides an AGR gene involved in the gravitropism of plant roots, a similar gene thereof, a protein encoded by these genes, and an improvement of the plant's root gravitropic stimulation response using these genes. More specifically, (1) a protein consisting of the amino acid sequence of SEQ ID NO: 1, or 1
Or a protein having an amino acid sequence in which a plurality of amino acids have been substituted, deleted, or added, and having a function equivalent to that of the protein consisting of the amino acid sequence described in SEQ ID NO: 1, (2) the base described in SEQ ID NO: 2 DN consisting of an array
(3) a protein encoded by a DNA hybridizing with A and having a function equivalent to that of the protein having the amino acid sequence of SEQ ID NO: 1;
DN encoding the protein according to (1) or (2)
A, (4) a vector containing the DNA of (3), (5)
(6) a method for producing the protein according to (1) or (2), which comprises the step of culturing the cell according to (5), 7) an antisense DNA against the DNA according to (3) or a part thereof, (8) a vector containing the antisense DNA according to (7), (9) a DNA according to (3)
Or (7) a transformed plant cell capable of expressing the antisense DNA according to (7), (10) a plant containing the transformed plant cell according to (9), (11) a change in root gravity stimulation response. The plant according to (10), (1)
2) A propagation medium for the plant according to (11), (13)
An antibody that binds to the protein according to (1) or (2), (14) a DN that specifically hybridizes with the DNA according to (3) and has a chain length of at least 15 nucleotides;
A, concerning.

[0008]

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to "AGR" proteins involved in the gravitropism of plant roots. The nucleotide sequence of the cDNA of the “AGR” gene isolated by the present inventors is shown in SEQ ID NO: 2.
The nucleotide sequence of genomic DNA is shown in SEQ ID NO: 3, and the amino acid sequence of the “AGR” protein encoded by these genes is shown in SEQ ID NO: 1. AGR mutations known to show abnormalities in Arabidopsis root gravity stimulation response include agr1 and agr
2, five of agr3, eir1-1 and wav6-52 are known. Of these mutations, agr1 is a substitution of methionine at position 539 with isoleucine, agr2 is a substitution of a stop codon of tryptophan at position 30, agr3 is a substitution of methionine at position 1 with isoleucine, and eir1-1 is the first exon. Counting from the first base of
The G to A substitution at position 2989 (without amino acid substitution), wav6-52, results in the substitution of glycine at position 541 for glutamic acid (Example 6). Due to these mutations, agr1
And wav6-52 show a loss of the gravity stimulus response or a marked decrease in the response, and agr2, agr3, and eir1-1 show a weak response. These facts demonstrate that the "AGR" protein plays an important role in the gravity-stimulated response of Arabidopsis roots. "AGR" protein and "A
The "GR" gene can be used to modify, or as a target for, modifying the gravity stimulus response of Arabidopsis roots.

[0009] The present invention also relates to a protein functionally equivalent to the "AGR" protein. As a method for isolating a functionally equivalent protein, a method for introducing a mutation into an amino acid in a protein is well known to those skilled in the art.
That is, a person skilled in the art can modify the amino acid in a natural “AGR” protein (for example, the protein described in SEQ ID NO: 1) appropriately by a known method and have an equivalent function. It is possible to prepare proteins. Amino acid mutations may also occur in nature. The protein of the present invention has an amino acid sequence in which one or more amino acids are substituted, deleted or added in the amino acid sequence of the natural `` AGR '' protein, and has a function equivalent to that of the natural protein. Also includes proteins. Amino acid modifications in proteins are usually within 50 amino acids of all amino acids,
Preferably within 30 amino acids, more preferably 10
It is within amino acids, more preferably within 3 amino acids. Amino acid modification, for example, if the mutation or substitution, "Transformer Site-directed Mutagenesis Kit" or "ExSite PCR-Based Site-directed Mutagenesis Kit"
(Manufactured by Clontech), and if the deletion is "Quantum leap Nested Deletion Ki
t "(manufactured by Clontech) or the like. An "isolated protein" is "functionally equivalent" to a native protein when the protein functions in the gravitropic stimulus response of plant roots. Whether a protein functions in the gravitational stimulus response of plant roots can be determined, for example, by performing a functional complementation test by expressing the protein in a mutant strain or by inhibiting the expression of the protein using antisense technology. By detecting changes in the stimulus response,
It is possible to decide.

[0010] Another method well known to those skilled in the art for isolating a protein equivalent in function is a hybridization technique (Southern 1975 J. Mol. Bio.
l. 98: 503, Maniatis et al. Molecular Cloning Cold
Spring harbor Laboratry Press) and PCR technology (Isao Shimamoto, Takuji Sasaki, supervised, “Plant PCR Experiment Protocol” (Cell Engineering Separate Volume, Plant Cell Engineering Series 2) Shujunsha
Issued on April 10, 1995). That is, for those skilled in the art, the nucleotide sequence of the “AGR” gene (SEQ ID NO:
2) or a part thereof as a probe, an oligonucleotide hybridizing to a part of the nucleotide sequence of the “AGR” gene (SEQ ID NO: 2) as a primer, and isolating DNA having high homology with the oligonucleotide; Obtaining a protein having a function equivalent to that of the “AGR” protein from DNA can be usually performed. Thus, proteins having functions equivalent to those of the “AGR” protein isolated by the hybridization technique or the PCR technique are also included in the protein of the present invention. Here, "having the same function" means that the protein functions in the gravitational stimulus response of the root of a plant, as described above. Proteins obtained by hybridization technology or PCR technology are referred to as `` AG
Preferably, the amino acid sequence has at least 45% homology with the "R" protein, more preferably at least 60% homology, even more preferably at least 75% homology, and preferably at least 90% homology. More preferably, it is more preferable that it has 95% or more homology. Examples of a plant for isolating such a protein include, but are not limited to, root vegetables, konjac, carrot, burdock, lotus root, and the like.

The protein of the present invention can be prepared by a method known to those skilled in the art as a natural protein or as a recombinant protein prepared by using a gene recombination technique. For example, a natural protein can be obtained by immunizing a small animal such as a rabbit with a recombinant protein prepared by the following method, using an appropriate adsorbent (CNBr).
It can be prepared by binding to activated agarose or tosyl activated agarose to form a column, and purifying a plant protein extract using the obtained column. On the other hand, the recombinant protein is a conventional method, for example, inserting a DNA encoding the protein of the present invention into an appropriate expression vector, introducing the vector into appropriate cells,
It can be prepared by purifying from the transformed cells. Cells used for producing a recombinant protein include, for example, plant cells, Escherichia coli, yeast, animal cells, insect cells, and the like. Further, as a vector for expressing a recombinant protein in cells, for example, for plants and yeast cells, the plasmid `` pB
Plasmid "pET Expression system" (Stratagene) and "GST gene fusionVectors" (Pharmacia) for E. coli and plasmid "pMAM" (Clontech) for mammalian cells
For insect cells, the plasmid “pBacPAK8.9” (Cl
ontech). Insertion of DNA into a vector can be performed by a conventional method, for example, using Molecular Cloning (Maniatis et al.).
al. Cold Spring harbor Laboratry Press). The introduction of the vector into the host cell can be carried out by a conventional method according to the host cell, such as an electroporation method, a microinjection method, or a particle gun method. Purification of the recombinant protein of the present invention from the obtained transformed cells may be carried out by salting out, precipitation with an organic solvent, ion exchange chromatography, affinity chromatography, column chromatography with immunoadsorbent, gel chromatography, depending on the properties of the protein. Filtration, SDS electrophoresis, isoelectric focusing and the like can be performed in an appropriate combination. When the recombinant protein of the present invention is expressed as a fusion protein with a label such as glutathione S-transferase, it can be purified by affinity chromatography or the like for the label.

[0013] The present invention also relates to a DNA encoding the protein of the present invention. The DNA of the present invention is not particularly limited as long as it can encode the protein of the present invention,
Genomic DNA, cDNA, chemically synthesized DNA and the like are included. genome
DNA is described, for example, in the literature (Rogers and Bendich, Plant Mo
l. Biol. 5:69 (1985)) and using a genomic DNA prepared as a template as a template, a primer prepared based on the nucleotide sequence of the DNA of the present invention (eg, the nucleotide sequence of SEQ ID NO: 2). PCR (Saiki et al. Science 239: 487 (1
988)). In the case of cDNA, a conventional method (Maniatis et al. Molecular
Cloning Cold Spring Laboratory Press) to prepare mRNA from the plant, perform a reverse transcription reaction, and perform PCR using the same primers as described above. For genomic DNA or cDNA, a genomic DNA library or cDNA library is prepared by a conventional method, and the library is subjected to, for example, the DNA of the present invention.
(For example, the nucleotide sequence of SEQ ID NO: 2)
Can also be prepared by screening using a probe synthesized based on The nucleotide sequence of the obtained DNA is, for example, “Sequencer Model 37
3 "(manufactured by ABI) can be easily determined.

[0013] The present invention also relates to an antisense DNA against the DNA encoding the protein of the present invention or a part thereof. The antisense DNA of the present invention can be used for producing a plant in which the expression of the protein of the present invention is suppressed. It is not necessary that the antisense DNA of the present invention be 100% complementary to the DNA of the present invention in order to exhibit an antisense effect. The complementarity need not be high as long as the expression of the protein of the present invention can be suppressed.
The antisense DNA has preferably 90%, more preferably 95% complementarity with the DNA of the present invention. Further, in order to exhibit an antisense effect, the antisense DN of the present invention is required.
A has a chain length of at least 15 bp, preferably 100 bp or more, more preferably 500 bp or more.

[0014] The present invention also relates to a vector into which the DNA or the antisense DNA of the present invention has been inserted. The vectors of the present invention include, in addition to the above-mentioned vectors used for production of recombinant proteins, vectors for expressing the proteins or antisense genes of the present invention in plant cells for producing transformed plants. Such a vector is not particularly limited as long as it contains a promoter sequence transcribable in plant cells and a terminator sequence containing a polyadenylation site necessary for stabilization of the transcript, for example, plasmids `` pBI121 '', `` pBI2
21 "and" pBI101 "(all manufactured by Clontech). The vector of the present invention may contain a promoter for constitutively or inducibly expressing the protein of the present invention. Examples of promoters for constitutive expression include a cauliflower mosaic virus 35S promoter (Odell et al. 1985 Nature 313: 810) and a rice actin promoter (Zhang et al. 1991 Plant).
Cell 3: 1155), corn ubiquitin promoter (Cornejo et al. 1993 Plant Mol. Biol. 23: 567)
And the like. It is also known that a promoter for inducible expression is expressed by an external factor such as infection or invasion of a filamentous fungus, a bacterium, or a virus, low temperature, high temperature, drying, irradiation of ultraviolet rays, or spraying of a specific compound. Promoters and the like. Examples of such a promoter include a promoter of a rice chitinase gene expressed by infection or invasion of a filamentous fungus, bacterium, or virus (Xu et al. 1996 Plant Mol. Biol. 30:38).
7) and tobacco PR protein gene promoter (Ohs
hima et al. 1990 Plant Cell 2:95), promoter of rice “lip19” gene induced by low temperature (Aguan
et al. 1993 Mol. GenGenet. 240: 1), promoters of rice “hsp80” and “hsp72” genes induced by high temperature (Van Breusegem et al. 1994 Planta 19
3:57), Arabidopsis thaliana induced by drying
b16 "gene promoter (Nundy et al. 1990 Proc.
Natl. Acad. Sci. USA 87: 1406), the promoter of the parsley chalcone synthase gene induced by ultraviolet irradiation (Schulze-Lefert et al. 1989 EMBO J. 8:65).
1) The promoter of the maize alcohol dehydrogenase gene induced under anaerobic conditions (Walker et al.
Natl. Acad. Sci. USA 84: 6624). In addition, the promoter of the rice chitinase gene and the promoter of the PR protein gene of tobacco are induced by specific compounds such as salicylic acid, and “rab16” is also induced by spraying the plant hormone abscisic acid.

[0015] The present invention also relates to a transformed cell into which the vector of the present invention has been introduced. Cells into which the vector of the present invention is introduced include, in addition to the above-described cells used for production of a recombinant protein, plant cells for producing a transformed plant. Plant cells are not particularly limited, and include, for example, cells of Arabidopsis, rice, corn, potato, tobacco, and the like. The plant cells of the present invention include cells in plants as well as cultured cells. It also includes protoplasts, shoot primordia, multiple shoots, and hairy roots. Vectors can be introduced into plant cells by, for example, a method using Agrobacterium (Hood et al. 1993 T).
ransgenic Res. 2: 218, Hiei et al. 1994 Plant J. 6:
271), electroporation method (Tada et al. 1990)
Genel 80: 475), polyethylene glycol method (Lazzeri et al. 1991 Theor. Appl. Genet 81:43).
7), Particle gun method (Sanford et al. 1987 J. Pa.)
rt. Sci. tech. 5:27) can be used.

The transformed plant cells can regenerate plants by redifferentiation. The method of regeneration differs depending on the type of plant cell. For example, in the case of rice, Fujimura et al. (Plant Tissue Culture Lett.
2:74 (1995)), and for corn, Shillito et al. (Bio / Technology 7: 581 (1989)) and Gorden-Kamm et al. (Plant Cell 2: 603 (1990)). For potatoes, Visser et al. (Theor. Appl. Genet
78: 594 (1989)).
gata and Takebe (Planta 99:12 (1971)). In the case of Arabidopsis, the hypocotyl callus transformation method (KazuhitoAkama, Hideaki Shi
raishi, Shozo Ohta, Kenzo Nakamura, KiyotakaOkada
and Yoshiro Shimura; Efficient transformation of A
rabidopsis thaliana: comparison of the efficiencie
s with various organs, plant ecotypesand Agrobacte
rium strains "," Plant Cell Reports (1992) 12: 7-11)
Is mentioned.

The plant thus produced or the plant bred from its propagation medium (eg, seeds) can be compared with an individual whose root gravity stimulus response is normal by increasing or decreasing the expression level of the protein of the present invention. Can change. Thus, this can control the direction of plant root growth, increase the root settling rate of the plant to the soil, and limit root buckling for purposes such as facilitating harvesting operations. It is.

The present invention also relates to an antibody that binds to the protein of the present invention. The antibodies of the present invention include polyclonal and monoclonal antibodies. The antibody of the present invention can be prepared by a method known to those skilled in the art (for example,
lar cloning (Maniatis et al.cold Spring harbor Labo
ratry Press)).
When preparing the antibody of the present invention, in addition to the method of immunizing the whole protein of the present invention, it is also possible to prepare by immunizing a partial peptide. The antibody of the present invention can be used for purification and detection of the protein of the present invention.

The present invention also relates to a DNA which specifically hybridizes with a DNA encoding the protein of the present invention, and
It relates to DNA having a chain length of 5 nucleotides. Examples of the DNA encoding the protein of the present invention include a DNA having the nucleotide sequence of SEQ ID NO: 2 or 3. Here, “specifically hybridizes” refers to substantially hybridizing to a DNA encoding the protein of the present invention, and not substantially hybridizing to a DNA encoding another protein. Such DNA is
For example, detecting a DNA encoding the protein of the present invention,
It can be used as a probe for isolation and as a primer for amplification.

[0020]

The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to these examples. Methods necessary for general gene recombination such as DNA cutting, ligation, transformation of Escherichia coli, base sequence determination of genes, hybridization, etc. are attached to commercially available reagents, machinery and the like used for each operation. Instructions and experiments (for example, “Molecular cloning (Maniatis T. et al. Co.
ld Spring Harbor Laboratory Press) "). In addition, Arabidopsis thaliana grown on an agar medium or soil, mated, and prepared for genomic DNA are described in the experimental manual (for example, "Isao Shimamoto and Kiyotaka Okada," Experimental protocol for model plants ").
(Cell Engineering Separate Volume, Plant Cell Engineering Series 4) Shujunsha 19
Published April 1, 1996 ").

[Example 1] Isolation of agr mutant Agr-1, ag-1, agr mutant as a gravitropic mutation
r-2, agr-3 (Bell and Maher (1990) Mol Gen Genet 22
0: 289-293.), Wav6-52 (Okada and Shimura (1990) Sc
ience 250: 274-276.), but eir1-1 (Rom
an et al. (1995) Genetics 139: 1393-1409.)
Allele test was performed by crossing with 52, and it was found that both had an allele relationship.

Example 2 Mapping of AGR Loci Since the agr mutant strain was obtained from a population of Randsburgh species treated with the chemical mutagen EMS, it was crossed with a Colombian species and the same mutation in the F2 generation was obtained. The approximate location of the AGR locus was determined by comparing the separation of the AGR loci with molecular markers. As a result, the locus is a molecular marker mi
It was found to be between 69 and mi70. In particular,
It went as follows.

F2 seeds are immersed in 0.8% (w / v) sodium hypochlorite, 0.2% Triton X-100 for 10 minutes, thoroughly washed and sterilized, and containing 0.5 × Arabidopsis nutrient solution (described below). 26 plates were inoculated on one plate on a% agar medium (about 40 ml, Eiken No. 2 square petri dish (length 10 cm, width 14 cm, height 1.5 cm)). About 10 plates were placed vertically in a constant temperature room at 23 ° C and 16hr light / 8hr dark, and after 4 days, they were rotated 90 ° to transplant an individual whose roots did not respond to gravity (agr mutant) to the soil. .

The Arabidopsis nutrient solution is 1 M KNO_Three(Five
ml), 1M MgSO_Four(2ml), 1M Ca (NO_Three )_Two (2ml), 20mM F
e ・ EDTA (2.5ml), trace element solution (70mM H_ThreeBO_Three, 14mM MnC
l_Two, 0.5mM CuSO_Four, 1mM ZnSO_Four, 0.2mM NaMoO_Four, 10mM NaC
l, 0.01mM CoCl_Two) (1ml), 1M K-PO_FourBuffer solution (pH 5.5) (2
0ml 1M K_TwoPO_FourAnd 480ml 1M KH_TwoPO_FourMix) (2.5ml)
After mixing, 985 ml of ion-exchanged water was added to produce.

For preparation of genomic DNA from F2 plants, CTAB
Method was used. First, several leaves developed from the agr plant were placed in an Eppendorf tube, frozen with liquid nitrogen, and then sufficiently ground. 500 μl of CTAB buffer (0.1 M Tris-HCl (PH8.0), 20 mM EDTA, 1.4 M NaCl, 2%
Cetyltrymethylammonium bromide (cetyltrymet
hylammonium bromide) and 0.2% 2-mercaptoethanol) were added, and the mixture was kept at 60 ° C for 30 minutes. 500 μl of a chloroform: isoamyl alcohol solution (24: 1) was added, shaken for 15 minutes at room temperature, and then centrifuged at 3000 rpm for 10 minutes. The aqueous layer was transferred to a new Eppendorf tube, 2/3 volume of isopropanol was added, and centrifuged at 3000 rpm for 10 minutes. The supernatant was discarded, 500 ml of 70% ethanol was added, and the mixture was centrifuged at 15,000 rpm for several minutes. The supernatant was discarded again, and the pellet was dried under reduced pressure.
After drying, it was dissolved in 0.5 ml of TE (containing 10 mg / ml RNaseA). Phenol, chloroform, and isoamyl alcohol were mixed at a ratio of 25: 24: 1 (500 μl), and the mixture was centrifuged at 15,000 rpm at 4 ° C. for 10 minutes. The aqueous layer was transferred to a new Eppendorf tube, and phenol / chloroform extraction was performed again. To the aqueous layer, 1/10 volume of sodium acetate and 2.5 volumes of ethanol were added, and ethanol precipitation was performed. After adding 200 μl of 70% ethanol to wash the pellet, the pellet was dried under reduced pressure. After dissolving in 100 μl of TE and measuring the concentration by agarose gel electrophoresis, it was used for the subsequent experiments.

A CAPS marker, a kind of molecular marker (Konieczny, A., and Ausubel, FM (1993) A produce
for mapping Arabidopsismutations using co-dominan
t ecotype-specific PCR-based markers.Plant J. 4,
403-410.), The genomic DNA of the above-mentioned F2 plant was analyzed by PCR using DFR and LYF3a, and it was found that the agr mutation was located between these two markers. further,
Analysis of F2 individuals with different CAPS markers TSB1 and 10A10 revealed that in 436 chromosomes, recombination was still found on TSB1 at 7, and 10A10 at chromosome 19, and that the AGR gene was sandwiched between these two markers. Was. As a PCR reaction solution, “1 × amplification buffer (Takara), 125 μM
dNTPs, 500ng primers (F and R), 1U EX Taq (Takar
a), 50 ng genomic DNA / 100 μl of reaction solution ”.

To further narrow the locus, RFLP
The markers mi69, mi70, and mi418 were converted to CAPS. That is, both ends of these RFLP markers are sequenced,
Based on the sequence, PCR primers were prepared. PCR was performed using genomic DNA from Randsburg and Columbia as templates, treated with restriction enzymes, and electrophoresed on a 5% acrylamide gel. As a result, Afa I, Mbo I, Nla III respectively
RFLP was detected between Randsburg and Colombia. Using these markers, F2 individuals showing chromosomal recombination with TSBI, 10A10 were examined. 1 individual with mi69 (individual number 30), m
1 individual with i70 (individual number 124), 2 individuals with mi418 (individual number 1)
24, 238) still showed chromosomal recombination between the AGR and the marker. From the above results, the AGR gene was finally sandwiched between two markers, mi69 and mi70, whose distance on the RI map was 1.1 cM.

Example 3 Genomic DNA Containing AGR Locus
Preparation of Contig Since the AGR gene was found to exist between the molecular markers mi69 and mi70, genomic DNA fragments physically connecting the markers were isolated from the YAC library and the P1 library. Specifically, a CIC YAC library was screened using both markers as probes, and two clones hybridizing with both mi69 and mi70 (CIC9-2
E, CIC9-3F) and one clone (CIC9-9C) hybridizing only to mi70. Yeast chromosomes containing clones hybridized in both cases were subjected to pulse-field gel electrophoresis and hybridized with mi69 and mi70 to estimate the YAC size. As a result, both 9-2E and 9-3F clones were YAC
Was found to be about 600 kb in size. Therefore, the region where the AGR gene may exist could be replaced with a physical distance of 600 kb or less.

Further, a P1 library (Yao-Guang Liu, N.
orihiro Mitsukawa, Alejandro Vazquez-Tello and Rob
ertF.Whittier (1995) Generation of a high-quality
P1 library of Arabidopsis suitable for chromosome
walking. Plant J. 7, 351-358.), and 8 clones hybridized with mi69 (# Ω13K,
# I19K, # V21D, # P10I) and 8 clones hybridized with mi70 (# Q1D, # R1I, # U2A, # J2I, # N2J,
# S5P, # S8P, # F24I). From the comparison of the obtained restriction enzyme fragments between the P1 clones, a P1 clone contig near the marker was prepared. At this time, the P1 clones obtained from mi69 and mi70 did not overlap, and # Ω13
Four clones, K, # P10I, # R1I, and # U2A, were determined to be the ends of each contig.

To determine the direction of the contig, CIC9-2
From the cosmid library constructed from E, a clone containing a boundary region between both arms of YAC was screened.
Next, the P1 clone was hybridized with the plant-derived sequence as a probe. As a result, the genomic fragment adjacent to the left arm hybridized to # Ω13K and # P10I
And did not hybridize. Therefore, regarding the mi69 side, the # Ω13K side was found to be outward. However, the light arm hybridized to an unknown P1 clone and mi70
The orientation of the P1 contig could not be determined because none of the eight P1 clones hybridized did not hybridize. Therefore, it was decided to walk from the # P10I on the mi69 side and from both # R1I and # U2A on the mi70 side. # P10I with 4 pieces (# T2F, # N7M, #
H17M, # H19M), 2 for # I1R (# R10O, # T20I), # U2
Three new clones of A (# S19F, # Ω19M, # J24B) were obtained which hybridized with the respective contig ends. Since there is a possibility that chromosome walking may be performed erroneously due to a repetitive sequence in the probe, a newly obtained P1 clone was hybridized to YAC9-2E digested with BamHI. Its hybridization pattern and Pam clone Bam H
Compare the I restriction enzyme cleavage band pattern to the P1 DNA
It was confirmed that the region was definitely present in the YAC9-2E DNA.

Clone # T20 hybridized with # R1I
Since I hybridized with the RFLP marker mi418 of YAC CIC 9-2E, it was judged to be outside the CIC 9-2E clone. Therefore, the P1 contig # U2A on the mi70 side was considered inside. Therefore, clone # J24 that hybridized with # U2A
Four clones (# U3L, # V4C, # R4K, # F19K) that further clone the B terminus and hybridize with this terminus
Obtained. On the mi69 side, among the clones hybridized to the end of # P10I, the clone # H1 at the extreme end of the contig
When further screened with 7M end probe,
# U3L, a clone that had been walked from the mi70 side, was obtained. From this, it was determined that the P1 clone contig between mi69 and mi70 was connected.

In order to confirm the connection on the plant genome, the PCR primer “3LU13” was used at the inner ends of # T2F and # U3L.
-I "(SEQ ID NO: 4 / GTAATCCATGAGAAAAACTTCG)," 2F
TI "(SEQ ID NO: 5 / TCGAATGTGACAATGTTGTGG) was prepared, PCR was performed using the YAC CIC 9-2E clone and the plant genome as a template, and a 2.5 kb fragment was obtained using either template.

Subsequently, a new CAPS marker was prepared on the P1 clone contig to further narrow down the region where the AGR gene might exist. Using these CAPS markers, individuals showing chromosomal recombination at mi69 and mi70 were analyzed. The AGR gene was found to be within about 165 kb between marker 2FT-32 and 24BJ-9.

The total yeast chromosomal DNA containing the 580 kb YAC clone CIC 9-2E was subcloned into pOCA28, a binary cosmid that can be directly transformed into plants. The reason for using YAC clones is that the genome size is about 1/6 of the Arabidopsis genome, 15 Mb, and that large amounts of DNA can be easily extracted. Generally, YAC is separated in a pulse field, cut out, and a library is prepared from YAC DNA. However, even in a method using total yeast chromosomes, one out of every 30 cosmid clones is a YAC-derived cosmid clone, which does not hinder the experiment. By this method, a cosmid library of about 100,000 clones was prepared. Also, # U3L of P1 clone
And cosmid libraries having sizes of 20,000 and 10,000 from # J24B and # J24B, respectively. The # U3L cosmid library was screened with a probe selected based on the # U3L restriction map. The clones obtained by screening were compared with each other by comparing the cleavage patterns of restriction enzymes to confirm the overlap, and a cosmid contig of # U3L clone was obtained at an interval of about 10 kb.

The cosmid library was prepared according to the following procedure. That is, P1 clones (# U3L, # J24
B) and 400 ng each of YAC clone 9-2E were transferred to Sau3AI (1 / 128u
nit), and the reaction was performed at 37 ° C. with 120 μl of the reaction solution. Time is 5 minutes,
It took 10 minutes and 15 minutes. After confirmation by electrophoresis, it was partially decomposed to a size (15-20 kb) suitable for preparing a cosmid library. Here, dATP and dGTP were added as substrates to prevent ligation between the inserts, and the mixture was reacted with Klenow fragment at 37 ° C. for 20 minutes to partially blunt-end. Next, pOCA28 (400 ng) was treated with SalI at 37 ° C for 2 hours, and dCTP,
dTTP was added to the substrate to perform partial blunting. As a reaction solution for partial blunting, `` Insert (P1 clone #
U3L, # J24B and YAC clone CIC 9-2E) Partial digest or vector (pOCA 28) Sal I digest 100 ng, 10 × L buffer 20
μl, 10 mM dATP, dGTP (for insert) 5 μl, dCTP, dTT
P (in the case of a vector) 5 μl, Klenow fragment 2 μl / reaction solution 200 μl "was used. This insert and vector are 10
A ligation reaction was performed using 0 ng. Reaction is Ligation
Using Kit Ver 1 (Takara), an equal volume of solution B was added, and a double volume of solution A was added, followed by 10 minutes at 26 ° C. further,
In vitro packaging was performed using Gigapack II XL Packaging Extract (STRATAGENE). Reaction 4
Add μl DNA to packaging extract, then add 10 μl son
The ic extract was added to the packaging extract, the liquids were mixed without foaming, and the mixture was centrifuged gently and collected at the bottom of the tube, followed by 2 hours at 22 ° C. After the reaction, 500 μl of SM buffer
And 20 μl chloroform was further added. This solution was gently centrifuged, and the supernatant was transferred to a new tube and stored at 4 ° C., and used as a packaging solution in subsequent experiments. VCS257 was used as E. coli for cosmid infection. Two
× YT + 10 mM MgSO ₄ + VCS257 was cultured in 0.2% maltose medium, the culture was centrifuged, and the precipitate was washed with 10 mM MgSO ₄ at an OD600 of 0.5%.
And suspended. To 100 μl of this suspension, a packaging solution diluted with an SM buffer was added so that a titer from which a single colony could be isolated was added, and the mixture was allowed to stand at 37 ° C. for 15 minutes. One ml of 2 × YT was added, and cultured at 37 ° C. for 30 minutes with shaking at 250 rpm. This was spread on a plate containing 2 × YT + 1.5% agar + spectinomycin at a final concentration of 30 μg / ml.

Example 4 Fine Mapping of AGR Locus It was found that the AGR locus was present in a region of about 165 kb, but it is expected that many genes exist in this long region. Therefore, the area was further narrowed by performing fine mapping. Specifically, an allele of agr (wav6-52) was crossed with a wild strain of Colombia, and the resulting seeds were bred and selfed to obtain seeds of the F2 generation. this
From the F2 seeds, 247 individuals showing the agr mutant trait were selected.
When the thus selected individuals were finely mapped using the molecular markers on chromosome 5, the AGR gene was located in the region sandwiched between the two molecular markers (about 80 kb).
(Fig. 1).

Example 5 Isolation of AGR Gene Of the region where the AGR locus is located, about 60 kb was covered with four transformable cosmid clones. When these four cosmid clones were transformed into the agr mutant strain (eir1-1), when one of the clones (clone No. 5) was introduced, the transformed plant was restored to the wild-type trait. Therefore, within this clone (about 20 kb), AGR
The gene was thought to be present. DNA was prepared from the fifth cosmid clone, cut with an appropriate restriction enzyme, subcloned into a plasmid vector, and the nucleotide sequence was determined. As a result, three relatively long open reading frames were expected in this approximately 20 kb region. When one of these sequences was compared with the corresponding region of eir1-1, a mutation was found at the splicing site of exon 6. Thus, the nucleotide sequence of this region was determined in a wild strain, and the genomic nucleotide sequences of the other four alleles were compared. As a result, a mutation in the nucleotide sequence was observed in each case, indicating that the open reading frame was a coding region of the AGR gene.

Example 6 Structural Analysis of AGR Gene The ARG gene was a novel gene composed of nine exons. In the AGR gene, the protein encoded by the ARG gene was composed of 647 amino acid residues, and regions that could penetrate the membrane were found at the amino and carboxy terminals. Mutations in five alleles were four amino acid substitutions except eir-1. In agr-3, the starting methionine was mutated to isoleucine. Since this allele is weakly sensitive to gravity, it is considered that the protein is not deficient, and methionine located downstream is read as the initiation codon, and thus it is thought that the allele is related to gravity, albeit weakly. agr-2 is slightly sensitive to gravity, in this case 3
The 0th tryptophan was mutated to a stop codon.
In this case as well, it is considered that methionine located downstream was read as the start codon. Glycine at position 539 was mutated to aspartic acid in agr-1, and glycine at position 541 was mutated to glutamic acid in wav6-52, and the roots of these alleles hardly responded to gravity.

To date, seven genes having amino acid sequences homologous to the predicted transmembrane regions at the amino and carboxy termini have been identified in Arabidopsis (T26J12 (BAC), F22K2
0 (BAC), T17P20 (BAC), MQK4 (P1), 121L8T7 (EST), 3
5D8T7 (EST), 158K17T7 (EST)), three for rice (RICR2985
A (EST), C26920 (EST), C27713 (EST)), but no gene having a homologous amino acid sequence over its entire length has been reported.

Example 7 Isolation of AGR cDNA cDNA was isolated from Arabidopsis thaliana mRNA by RT-PCR, and its nucleotide sequence was determined (SEQ ID NO: 2). Specifically, mRNA extracted from Arabidopsis thaliana and RT-PCR
Using a kit (such as TaKaRa One Step RNA PCR Kit of TaKaRa), the following primers located at the first and sixth exons predicted from the genomic nucleotide sequence, “SEQ ID NO: 6 / 5-AAATGATCACCGGCAAAGAC-3”, “ SEQ ID NO: 7
/ 5-AAACATAGCCATTCCAAGACC-3 ", cDNA was amplified, subcloned into plasmids, and the nucleotide sequences of a plurality of plasmids were determined.

The 5 'and 3' sides are Maratho from Clonetech.
n Amplification was performed using the PCR method using the PCR Kit. Specifically, mRNA extracted from Arabidopsis thaliana was used as a template, and two primers derived from the first exon “SEQ ID NO: 8 / 5-TGGTCCGGTGTGAATATCCC-
3 "and" SEQ ID NO: 9 / 5-TCATAGCAACGTATAGCGGC-3 ", and for the 3 'side, a primer derived from the third exon" SEQ ID NO: 10 / 5-GTTCAATCGTCACGAGAGCG-3 "and a primer derived from the fifth exon "SEQ ID NO: 11-5-T
The cDNA was amplified using "CCTAGGAAACAGCAGATGCC-3" and subcloned into plasmids, and then the nucleotide sequences of a plurality of plasmids were determined.

[0042]

Industrial Applicability According to the present invention, there are provided novel proteins and genes involved in the gravitational stimulus response of plant roots, and plants in which the root gravitational stimulus response is modified by regulating the expression of the gene. offered. By modifying the gravitropic stimulus response of plant roots, it is possible to control the growth direction of plant roots, for example, to improve the rate of plant roots settling in soil, and to increase the yield of crops to facilitate harvesting operations. It is possible to control the refraction of the root.

[0043]

[Sequence List] (1) Name or name of applicant: Mitsui Interdisciplinary Plant Biotechnology Research Institute, Inc. Kazusa DeNA Institute (2) Title of invention: Involved in the response of plant roots to gravitropic stimulation (3) Reference number: M2-003 (4) Application number: (5) Filing date: (6) Number of sequences: 11 SEQ ID NO: 1 Sequence length: 647 Sequence type: Number of amino acid chains: Single-chain topology: Linear Sequence type: Protein sequence Met Ile Thr Gly Lys Asp Met Tyr Asp Val Leu Ala Ala Met Val Pro 1 5 10 15 Leu Tyr Val Ala Met Ile Leu Ala Tyr Gly Ser Val Arg Trp Trp Gly 20 25 30 Ile Phe Thr Pro Asp Gln Cys Ser Gly Ile Asn Arg Phe Val Ala Val 35 40 45 Phe Ala Val Pro Leu Leu Ser Phe His Phe Ile Ser Ser Asn Asp Pro 50 55 60 Tyr Ala Met Asn Tyr His Phe Leu Ala Ala Asp Ser Leu Gln Lys Val 65 70 75 80 Val Ile Leu Ala Ala Leu Phe Leu Trp Gln Ala Phe Ser Arg Arg Gly 85 90 95 Ser Leu Glu Trp Met Ile Thr Leu Phe Ser Leu Ser Thr Leu Pro Asn 100 105 110 Thr Leu Val Met Gly Ile Pro Leu Leu Arg Ala Met Tyr Gly Asp Phe 115 120 125 Ser Gly Asn Leu Met Val Gln Ile Val Val Leu Gln Ser Ile Ile Trp 130 135 140 Tyr Thr Leu Met Leu Phe Leu Phe Glu Phe Arg Gly Ala Lys Leu Leu 145 150 155 160 Ile Ser Glu Gln Phe Pro Glu Thr Ala Gly Ser Ile Thr Ser Phe Arg 165 170 175 Val Asp Ser Asp Val Ile Ser Leu Asn Gly Arg Glu Pro Leu Gln Thr 180 185 190 Asp Ala Glu Ile Gly Asp Asp Gly Lys Leu His Val Val Val Arg Arg 195 200 205 Ser Ser Ala Ala Ser Ser Met Ile Ser Ser Phe Asn Lys Ser His Gly 210 215 220 Gly Gly Leu Asn Ser Ser Met Ile Thr Pro Arg Ala Ser Asn Leu Thr 225 230 235 240 Gly Val Glu Ile Tyr Ser Val Gln Ser Ser Arg Glu Pro Thr Pro Arg 245 250 255 Ala Ser Ser Phe Asn Gln Thr Asp Phe Tyr Ala Met Phe Asn Ala Ser 260 265 270 Lys Ala Pro Ser Pro Arg His Gly Tyr Thr Asn Ser Tyr Gly Gly Ala 275 280 285 Gly Ala Gly Pro Gly Gly Asp Val Tyr Ser Leu Gln Ser Ser Lys Gly 290 295 300 Val Thr Pro Arg Thr Ser AsnPhe Asp Glu Glu Val Met Lys Thr Ala 305 310 315 320 Lys Lys Ala Gly Arg Gly Gly Arg Ser Met Ser Gly Glu Leu Tyr Asn 325 330 335 Asn Asn Ser Val Pro Ser Tyr Pro Pro Pro Asn Pro Met Phe Thr Gly 340 345 350 Ser Thr Ser Gly Ala Ser Gly Val Lys Lys Lys Glu Ser Gly Gly Gly 355 360 365 Gly Ser Gly Gly Gly Val Gly Val Gly Gly Gln Asn Lys Glu Met Asn 370 375 380 Met Phe Val Trp Ser Ser Ser Ala Ser Pro Val Ser Glu Ala Asn Ala 385 390 395 400 Lys Asn Ala Met Thr Arg Gly Ser Ser Thr Asp Val Ser Thr Asp Pro 405 410 415 Lys Val Ser Ile Pro Pro His Asp Asn Leu Ala Thr Lys Ala Met Gln 420 425 430 Asn Leu Ile Glu Asn Met Ser Pro Gly Arg Lys Gly His Val Glu Met 435 440 445 Asp Gln Asp Gly Asn Asn Gly Gly Lys Ser Pro Tyr Met Gly Lys Lys 450 455 460 Gly Ser Asp Val Glu Asp Gly Gly Pro Gly Pro Arg Lys Gln Gln Met 465 470 475 480 480 Pro Pro Ala Ser Val Met Thr Arg Leu Ile Leu Ile Met Val Trp Arg 485 490 495 Lys Leu Ile Arg Asn Pro Asn Thr Tyr Ser Ser Leu Phe Gly Leu Ala 500 505 510 Trp Ser Leu Val Ser Phe Lys Trp Asn Ile Lys Met Pro Thr Ile Met 515 520 525 Ser Gly Ser Ile Ser Ile Leu Ser Asp Ala Gly Leu Gly Met Ala Met 530 535 540 Phe Ser Leu Gly Leu Phe Met Ala Leu Gln Pro Lys Ile Ile Ala Cys 545 550 555 560 Gly Lys Ser Val Ala Gly Phe Ala Met Ala Val Arg Phe Leu Thr Gly 565 570 575 575 Pro Ala Val Ile Ala Ala Thr Ser Ile Ala Ile Gly Ile Arg Gly Asp 580 585 585 590 Leu Leu His Ile Ala Ile Val Gln Ala Ala Leu Pro Gln Gly Ile Val 595 600 605 Pro Phe Val Phe Ala Lys Glu Tyr Asn Val His Pro Asp Ile Leu Ser 610 615 620 Thr Ala Val Ile Phe Gly Met Leu Val Ala Leu Pro Val Thr Val Leu 625 630 630 635 640 Tyr Tyr Val Leu Leu Gly Leu 645 SEQ ID NO: 2 Sequence length: 2232 Sequence type: Number of nucleic acid strands: Double strand Topology: Linear Sequence type: cDNA to mRNA sequence characteristics Characteristic symbol: CDS location : 24 .. 1984 Method for determining characteristics: E sequence CTCGCCGGAA AAAGTAAATC AAA ATG ATC ACC GGC AAA GAC ATG TAC GAT GTT 53 Met Ile Thr Gly Lys Asp Met Tyr Asp Val 1 5 10 TTA GCG GC T ATG GTG CCG CTA TAC GTT GCT ATG ATA TTA GCC TAT GGT 101 Leu Ala Ala Met Val Pro Leu Tyr Val Ala Met Ile Leu Ala Tyr Gly 15 20 25 TCG GTA CGG TGG TGG GGG ATA TTC ACA CCG GAC CAA TGT TCC GGT ATA 149 Ser Val Arg Trp Trp Gly Ile Phe Thr Pro Asp Gln Cys Ser Gly Ile 30 35 40 AAC CGG TTC GTT GCG GTT TTC GCG GTT CCT CTT CTC TCT TTC CAT TTC 197 Asn Arg Phe Val Ala Val Phe Ala Val Pro Leu Leu Ser Phe His Phe 45 50 55 ATC TCC TCC AAT GAT CCT TAT GCA ATG AAT TAC CAC TTC CTC GCT GCT 245 Ile Ser Ser Asn Asp Pro Tyr Ala Met Asn Tyr His Phe Leu Ala Ala 60 65 70 GAT TCT CTT CAG AAA GTC GTT ATC CTC GCC GCA CTC TTT CTT TGG CAG 293 Asp Ser Leu Gln Lys Val Val Ile Leu Ala Ala Leu Phe Leu Trp Gln 75 80 85 90 GCG TTT AGC CGC AGA GGA AGC CTA GAA TGG ATG ATA ACG CTC TTT TCA 341 Ala Phe Ser Arg Arg Gly Ser Leu Glu Trp Met Ile Thr Leu Phe Ser 95 100 105 CTA TCA ACA CTG CCT AAC ACG TTG GTA ATG GGA ATC CCA TTG CTT AGG 389 Leu Ser Thr Leu Pro Asn Thr Leu Val Met Gly Ile Pro Leu Leu Arg 110 115 120 GCG ATG TAC GG A GAC TTC TCC GGT AAC CTA ATG GTG CAG ATC GTG GTG 437 Ala Met Tyr Gly Asp Phe Ser Gly Asn Leu Met Val Gln Ile Val Val 125 130 135 CTT CAG AGC ATC ATA TGG TAT ACA TTA ATG CTC TTC TTG TTT GAG TTC 485 Leu Gln Ser Ile Ile Trp Tyr Thr Leu Met Leu Phe Leu Phe Glu Phe 140 145 150 CGT GGG GCT AAG CTT CTC ATC TCC GAG CAG TTC CCG GAG ACG GCT GGT 533 Arg Gly Ala Lys Leu Leu Ile Ser Glu Gln Phe Pro Glu Thr Ala Gly 155 160 165 170 TCA ATT ACT TCC TTC AGA GTT GAC TCT GAT GTT ATC TCT CTT AAT GGC 581 Ser Ile Thr Ser Phe Arg Val Asp Ser Asp Val Ile Ser Leu Asn Gly 175 180 185 CGT GAA CCC CTC CAG ACC GAT GCG GAG ATA GGA GAC GAC GGA AAG CTA 629 Arg Glu Pro Leu Gln Thr Asp Ala Glu Ile Gly Asp Asp Gly Lys Leu 190 195 200 CAC GTG GTG GTT CGA AGA TCA AGT GCC GCC TCA TCA ATG ATC TCT TCA 677 His Val Val Valg Arg Arg Ser Ser Ala Ala Ser Ser Met Ile Ser Ser 205 210 215 TTC AAC AAA TCT CAC GGC GGA GGA CTT AAC TCC TCC ATG ATA ACG CCG 725 Phe Asn Lys Ser His Gly Gly Gly Leu Asn Ser Ser Met Ile Thr Pro 220 225 230 CG A GCT TCA AAT CTC ACC GGC GTA GAG ATT TAC TCC GTT CAA TCG TCA 773 Arg Ala Ser Asn Leu Thr Gly Val Glu Ile Tyr Ser Val Gln Ser Ser 235 240 245 250 CGA GAG CCG ACG CCG AGA GCT TCT AGC TTT AAT CAG ACA GAT TTC TAC 821 Arg Glu Pro Thr Pro Arg Ala Ser Ser Phe Asn Gln Thr Asp Phe Tyr 255 260 265 GCA ATG TTT AAC GCA AGC AAA GCT CCA AGC CCT CGT CAC GGT TAC ACT 869 Ala Met Phe Asn Ala Ser Lys Ala Pro Ser Pro Arg His Gly Tyr Thr 270 275 280 AAT AGC TAC GGC GGC GCT GGA GCT GGT CCA GGT GGA GAT GTT TAC TCA 917 Asn Ser Tyr Gly Gly Ala Gly Ala Gly Pro Gly Gly Asp Val Tyr Ser 285 290 295 295 CTT CAG TCT TCT AAA GGC GTG ACG CCG AGA ACG TCA AAT TTT GAT GAG 965 Leu Gln Ser Ser Lys Gly Val Thr Pro Arg Thr Ser Asn Phe Asp Glu 300 305 310 GAA GTT ATG AAG ACG GCG AAG AAA GCA GGA AGA GGA GGC AGA AGT ATG 1013 Glu Val Met Lys Thr Ala Lys Lys Ala Gly Arg Gly Gly Arg Ser Met 315 320 325 330 AGT GGG GAA TTA TAC AAC AAT AAT AGT GTT CCG TCG TAC CCA CCG CCG CCG 1061 Ser Gly Glu Leu Tyr Asn Asn Asn Ser Val Pro Ser Tyr Pro ProPro 335 340 345 AAC CCA ATG TTC ACG GGG TCA ACG AGT GGA GCA AGT GGA GTC AAG AAA 1109 Asn Pro Met Phe Thr Gly Ser Thr Ser Gly Ala Ser Gly Val Lys Lys 350 355 360 AAG GAA AGT GGT GGC GGA GGA AGC GGT GGC GGA GTA GGA GTA GGA GGA 1157 Lys Glu Ser Gly Gly Gly Gly Ser Gly Gly Gly Val Gly Val Gly Gly 365 370 375 CAA AAC AAG GAG ATG AAC ATG TTC GTG TGG AGT TCG AGT GCT TCT CCG 1205 Gln Asn Lys Glu Met Asn Met Phe Val Trp Ser Ser Ser Ala Ser Pro 380 385 390 GTG TCG GAA GCC AAC GCG AAG AAT GCT ATG ACC AGA GGT TCT TCC ACC 1253 Val Ser Glu Ala Asn Ala Lys Asn Ala Met Thr Arg Gly Ser Ser Thr 395 400 405 410 GAT GTA TCC ACC GAC CCT AAA GTT TCT ATT CCT CCT CAC GAC AAC CTC 1301 Asp Val Ser Thr Asp Pro Lys Val Ser Ile Pro Pro His Asp Asn Leu 415 420 425 GCT ACT AAA GCG ATG CAG AAT CTG ATA GAG AAC ATG TCA CCG GGA AGA 1349 Ala Thr Lys Ala Met Gln Asn Leu Ile Glu Asn Met Ser Pro Gly Arg 430 435 440 AAA GGG CAT GTG GAA ATG GAC CAA GAC GGT AAT AAC GGG GGA AAG TCA 1397 Lys Gly His Val Glu Met Asp Gln Asp Gly Asn Asn Gly Gly Lys Ser 445 450 455 CCT TAC ATG GGC AAA AAA GGT AGC GAC GTG GAA GAC GGC GGT CCC GGT 1445 Pro Tyr Met Gly Lys Lys Gly Ser Asp Val Glu Asp Gly Gly Pro Gly 460 465 470 CCT AGG AAA CAG CAG ATG CCG CCG GCG AGT GTG ATG ACG AGA CTA ATT 1493 Pro Arg Lys Gln Gln Met Pro Pro Ala Ser Val Met Thr Arg Leu Ile 475 480 485 490 CTG ATA ATG GTT TGG AGA AAA CTC ATT CGA AAC CCT AAC ACT TAC TCT 1541 Leu Ile Met Val Trp Arg Lys Leu Ile Arg Asn Pro Asn Thr Tyr Ser 495 500 505 AGT CTC TTT GGC CTT GCT TGG TCC CTT GTC TCT TTC AAG TGG AAT ATA 1589 Ser Leu Phe Gly Leu Ala Trp Ser Leu Val Ser Phe Lys Trp Asn Ile 510 515 520 AAG ATG CCA ACG ATA ATG AGT GGA TCG ATT TCG ATA TTA TCT GAT GCT 1637 Lys Met Pro Thr Ile Met Ser Gly Ser Ile Ser Ile Leu Ser Asp Ala 525 530 535 535 GGT CTT GGA ATG GCT ATG TTT AGT CTT GGT CTA TTT ATG GCA TTG CAA 1685 Gly Leu Gly Met Ala Met Phe Ser Leu Gly Leu Phe Met Ala Leu Gln 540 545 550 CCA AAG ATT ATT GCG TGC GGA AAA TCA GTA GCA GGG TTT GCG ATG GCC 1733 Pro Lys Ile Ile Ala C ys Gly Lys Ser Val Ala Gly Phe Ala Met Ala 555 560 565 570 GTA AGG TTC TTG ACT GGA CCA GCC GTG ATC GCA GCC ACC TCA ATA GCA 1781 Val Arg Phe Leu Thr Gly Pro Ala Val Ile Ala Ala Thr Ser Ile Ala 575 580 585 ATT GGT ATT CGA GGT GAT CTC CTC CAT ATC GCC ATC GTT CAG GCT GCT 1829 Ile Gly Ile Arg Gly Asp Leu Leu His Ile Ala Ile Val Gln Ala Ala 590 595 600 CTT CCT CAA GGA ATC GTT CCT TTT GTT TTC GCC AAA GAA TAT AAC GTC 1877 Leu Pro Gln Gly Ile Val Pro Phe Val Phe Ala Lys Glu Tyr Asn Val 605 610 615 CAT CCT GAT ATT CTC AGC ACT GCG GTT ATA TTC GGA ATG CTG GTT GCT 1925 His Pro Asp Ile Leu Ser Thr Ala Val Ile Phe Gly Met Leu Val Ala 620 625 630 TTG CCT GTA ACA GTA CTC TAC TAC GTT CTT TTG GGG CTT TAAGTTATTA 1974 Leu Pro Val Thr Val Leu Tyr Tyr Val Leu Leu Gly Leu 635 640 645 645 TCAAAACGTA TTTGCAAATA AAAGGCGATA TGTTCATCAGAAGA AATTCCAGGT CAGGCTTAGG TGTATGGGAC 2094 CATGCAATGT CGCATTAATT AAATTATAGC ATATGATAGT CGAAAATTTA GATAACTTTG 2154 TATAATTAAT TATAT GCACA TGCATGTACG TGACTTTGTA GTTTTTGTTA CATTTATTAA 2214 ATTTTTGGGA TGTGCAAG 2232 SEQ ID NO: 3 Sequence length: 3980 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Genomic DNA Sequence characteristics Characteristic symbols: exon location: 24 .. 293 Method that determined the feature: E Symbol representing feature: exon Location: 542 .. 844 Method that determined feature: E Symbol representing feature: exon Location: 1225 .. 1669 Feature Determined method: E Symbol indicating feature: exon Location: 2067 .. 2336 Method determining feature: E Symbol indicating feature: Active-site Location: 2635 .. 2902 Method determined feature: E Indicates feature Symbol: exon Location: 2990 .. 3075 Method for determining the feature: E Symbol for representing the feature: exon Location: 3151 .. 3308 Method for determining the feature: E Symbol for the feature: exon Location: 3432 .. 3508 Method used to determine feature: E Symbol representing feature: exon Location: 3649 .. 3980 Method of Characterization: E Sequence CTCGCCGGAA AAAGTAAATC AAA ATG ATC ACC GGC AAA GAC ATG TAC GAT GTT 53 Met Ile Thr Gly Lys Asp Met Tyr Asp Val 1 5 10 TTA GCG GCT ATG GTG CCG CTA TAC GTT GCT ATG ATA TTA GCC TAT GGT 101 Leu Ala Ala Met Val Pro Leu Tyr Val Ala Met Ile Leu Ala Tyr Gly 15 20 25 TCG GTA CGG TGG TGG GGG ATA TTC ACA CCG GAC CAA TGT TCC GGT ATA 149 Ser Val Arg Trp Trp Gly Ile Phe Thr Pro Asp Gln Cys Ser Gly Ile 30 35 40 AAC CGG TTC GTT GCG GTT TTC GCG GTT CCT CTT CTC TCT TTC CAT TTC 197 Asn Arg Phe Val Ala Val Phe Ala Val Pro Leu Leu Ser Phe His Phe 45 50 55 ATC TCC TCC AAT GAT CCT TAT GCA ATG AAT TAC CAC TTC CTC GCT GCT 245 Ile Ser Ser Asn Asp Pro Tyr Ala Met Asn Tyr His Phe Leu Ala Ala 60 65 70 GAT TCT CTT CAG AAA GTC GTT ATC CTC GCC GCA CTC TTT CTT TGG CAG 293 Asp Ser Leu Gln Lys Val Val Ile Leu Ala Ala Leu Phe Leu Trp Gln 75 80 85 90 GCCCGTCTCT TTCAATAATC TCTCTATGCA CATAATCTAT CTTCATTAAG TGATGGTAGT 353 CTACTAGTAA TTGCTATGAT GGTCAATTTT TACTCGAAAA CATATTGGTT AT CGAAAGCT 413 TATAGTATAG TAACTATGTC ATTTAACACG GGTAAATATT TTAGTTAACA TTTTAGCTCT 473 TTTGTAATAT GTGTCTCTCTAA ACACACACAT TCTCATGTTT GTGTATATAT TGTGATATTA 533 TTTTTTAG GCG TTT AGC CGC AGA GGA AGC CTA GAA GTC AGA TTC AGA TCG ATG C CTA TCA ACA CTG CCT AAC ACG TTG GTA ATG GGA ATC CCA TTG 631 Phe Ser Leu Ser Thr Leu Pro Asn Thr Leu Val Met Gly Ile Pro Leu 105 110 115 120 CTT AGG GCG ATG TAC GGA GAC TTC TCC GGT AAC CTA ATG GTG CAG ATC 679 Leu Arg Ala Met Tyr Gly Asp Phe Ser Gly Asn Leu Met Val Gln Ile 125 130 135 GTG GTG CTT CAG AGC ATC ATA TGG TAT ACA TTA ATG CTC TTC TTG TTT 727 Val Val Leu Gln Ser Ile Ile Trp Tyr Thr Leu Met Leu Phe Leu Phe 140 145 150 GAG TTC CGT GGG GCT AAG CTT CTC ATC TCC GAG CAG TTC CCG GAG ACG 775 Glu Phe Arg Gly Ala Lys Leu Leu Ile Ser Glu Gln Phe Pro Glu Thr 155 160 165 GCT GGT TCA ATT ACT TCC TTC AGA GTT GAC TCT GAT GTT ATC TCT CTT 823 Ala Gly Ser Ile Thr Ser Phe Arg Val Asp Ser Asp Val Ile Ser Leu 170 175 180 AAT GGC CGT GAA CCC CTC CAG GTATGAATTT TTCACTGATG ACCTTTTTCA 874 Asn Gly Arg Glu Pro Leu Gln 185 190 TATGTTTGTT CAAATTAACG GACCGGTTAA CTCAAGTAAA CTAGAAAATG GGTAGTTACT 934 AGTTACGACA TGACTACATG TCATTTTGGG ATTCCTTTTT GCCTATGTAA ATCTATAACA 994 AATTTTGAGT TTTGTCTGAG TTCCTTTTTC AGAAGTCAAA AATAATCTTC AAAGTGACGT 1054 GTTACATTAT TCACGCAGAA TTTAATAATT AGTACAATAT AAGAAATATC AAGTTATTAA 1114 CTATAGTCTA GTTGAATTTT CATTCTTTTT GTACCGATTC GGTTATATCC GGTTTAAATC 1174 ACATCGACTC GAAATTCATC ACCTAAAAAT ATGGATTTAT CTTTCATTAG ACC GAT 1230 Thr Asp GCG GAG ATA GGA GAC GAC GGA AAG CTA CAC GTG GTG LepGal AsgA Gal Glu Asp 195 200 205 AGT GCC GCC TCA TCA ATG ATC TCT TCA TTC AAC AAA TCT CAC GGC GGA 1326 Ser Ala Ala Ser Ser Met Ile Ser Ser Phe Asn Lys Ser His Gly Gly 210 215 220 225 GGA CTT AAC TCC TCC ATG ATA ACG CCG CGA GCT TCA AAT CTC ACC GGC 1374 Gly Leu Asn Ser Ser Met Ile Thr Pro Arg Ala Ser Asn Leu Thr Gly 230 235 240 GTA GAG ATT TAC TCC G TT CAA TCG TCA CGA GAG CCG ACG CCG AGA GCT 1422 Val Glu Ile Tyr Ser Val Gln Ser Ser Arg Glu Pro Thr Pro Arg Ala 245 250 255 TCT AGC TTT AAT CAG ACA GAT TTC TAC GCA ATG TTT AAC GCA AGC AAA 1470 Ser Ser Phe Asn Gln Thr Asp Phe Tyr Ala Met Phe Asn Ala Ser Lys 260 265 270 GCT CCA AGC CCT CGT CAC GGT TAC ACT AAT AGC TAC TAC GGC GGC GCT GGA 1518 Ala Pro Ser Pro Arg His Gly Tyr Thr Asn Ser Tyr Gly Gly Ala Gly 275 280 285 GCT GGT CCA GGT GGA GAT GTT TAC TCA CTT CAG TCT TCT AAA GGC GTG 1566 Ala Gly Pro Gly Gly Asp Val Tyr Ser Leu Gln Ser Ser Lys Gly Val 290 295 300 305 ACG CCG AGA ACG TCA AAT TTT GAT GAG GAA GTT ATG AAG ACG GCG AAG 1614 Thr Pro Arg Thr Ser Asn Phe Asp Glu Glu Val Met Lys Thr Ala Lys 310 315 320 AAA GCA GGA AGA GGA GGC AGA AGT ATG AGT GGG GAA TTA TAC AAC AAT 1662 Lys Ala Gly Arg Gly Gly Arg Ser Met Ser Gly Glu Leu Tyr Asn Asn 325 330 335 AAT AGT G GTATGAATTT TTTAATATAT ATATATATAT ATATTTATTTTT 1711 Asn Ser V 340 TATTTATTTT TTTAAAAAAA TATATTTTGC TTCTTTATATA ATTTAAATAG ATATAAGAAT 1771 C GATTCAGAT ATTATTATTA TTTTCCATCA GTCACCGGTG ATTATAAGTG GGATATTATT 1831 AGGTTTAAAA AGGTTTAAAA GTTAAGTAAA GAGTTCATCA AATAATTTTG CGTAATTATT 1891 TTTTTCTTTT AACAAAATAA TAATAATTTA GTATATCACT TCCAAAACTC TTAGGTTTTT 1951 AAACTGATTA TAGTTTTGGA AAACAAAATA TTAATTTTGT ATTTTGAAAT TTAAATGTGA 2011 TTTTTTCATT ATAATGTAAT GTTTTAAAAT AAAATTTTCT ATAATTTATG GTCAG TT 2068 al CCG TCG TAC CCA CCG CCG AAC CCA ATG TTC ACG GGG TCA ACG AGT GGA 2116 Pro Ser Tyr Pro Pro Pro Asn Pro Met Phe Thr Gly Ser Thr Ser Gly 345 350 355 GCA AGT GGA GTC AAG AAA AAG GAA AGT GGT GGC GGA GGA AGC GGT GGC 2164 Ala Ser Gly Val Lys Lys Lys Glu Ser Gly Gly Gly Gly Ser Gly Gly 360 365 370 GGA GTA GGA GTA GGA GGA CAA AAC AAG GAG ATG AAC ATG TTC GTG TGG 2212 Gly Val Gly Val Gly Gly Gln Asn Lys Glu Met Asn Met Phe Val Trp 375 380 385 AGT TCG AGT GCT TCT CCG GTG TCG GAA GCC AAC GCG AAG AAT GCT ATG 2260 Ser Ser Ser Ala Ser Pro Val Ser Glu Ala Asn Ala Lys Asn Ala Met 390 395 400 ACC AGA GGT TCT TCC ACC GAT GTA TCC ACC GAC CCT AAA GTT TCT ATT 2 308 Thr Arg Gly Ser Ser Thr Asp Val Ser Thr Asp Pro Lys Val Ser Ile 405 410 415 420 CCT CCT CAC GAC AAC CTC GCT ACT AAA G GTTTATTAAT CTCCAACTTA TT 2358 Pro Pro His Asp Asn Leu Ala Thr Lys A 425 430 TCATATTTTT TTTTATCATT ACTTGCCACG CTTCTATTTT TTTTTTAACT TTTAGGAAAA 2418 ATGTATAAAG CTCAATATCG GTTCTAAGTT TTTTTTATAG TTTTTTCAAA GTTTCAAAAC 2478 TTATGAAAAC TTTTAAACTA ATTAAAGTAG ATTTTTATTT GGTTCCGTAC GGCTTTCTAT 2538 AAGTTAGTTT TTTGGTCGAA GAAAGGTCAT AATAAATTTA GTTTAGTATT TTCTGTGATA 2598 TTTAATTATA ATTATATTCA TACTTGGTGA TGACAG CG ATG CAG AAT CTG ATA 2651 la Met Gln Asn Leu Ile 435 GAG AAC ATG TCA CCG GGA AGA AAA GGG CAT GTG GAA ATG GAC CAA GAC 2699 Glu Asn Met Ser Pro Gly Arg Lys Gly His Val Glu Met Asp Gln Asp 440 445 450 GGT AAT AAC GGG GGA AAG TCA CCT TAC ATG GGC AAA AAA GGT AGC GAC 2747 Gly Asn Asn Gly Gly Lys Ser Pro Tyr Met Gly Lys Lys Gly Ser Asp 455 460 465 GTG GAA GAC GGC GGT CCC GGT CCT AGG AAA CAG CAG ATG CCG CCG GCG 2795 Val Glu Asp Gly Gly Gly Pro Gly Pro Arg Lys Gln Gln Met Pro Pro Ala 470 475 480 AGT GTG ATG ACG AGA CTA ATT CTG ATA ATG GTT TGG AGA AAA CTC ATT 2843 Ser Val Met Thr Arg Leu Ile Leu Ile Met Val Trp Arg Lys Leu Ile 485 490 495 CGA AAC CCT AAC ACT TAC TCT AGT CTC TTT GGC CTT GCT TGG TCC CTT 2891 Arg Asn Pro Asn Thr Tyr Ser Ser Leu Phe Gly Leu Ala Trp Ser Leu 500 505 510 515 GTC TCT TTC AA GTAAGTACTA ATAATAATGT CACAATCATA TAACATAACA A 2943 Val Ser Phe Ly TATATTTGGG CAATTGTG TAG TGT TGA TGA TTG TGA TGA TGA TGA TGA TGA S Trp Asn Ile 520 AAG ATG CCA ACG ATA ATG AGT GGA TCG ATT TCG ATA TTA TCT GAT GCT 3047 Lys Met Pro Thr Ile Met Ser Gly Ser Ile Ser Ile Leu Ser Asp Ala 525 530 535 535 GGT CTT GGA ATG GCT ATG TTT AGT CTT G GTATAGTTCC CTTCATATAT AT 3097 Gly Leu Gly Met Ala Met Phe Ser Leu G 540 545 ATTTAGTTAT AGTCTTTGGT GCTTTTTTTT TTGCTAATTA TTGATACATA TAG GT CTA 3155 ly Leu TTT ATG GCA TTG CAA CCA AAG ATT ATT GCG TGC AGA TGA GGA AGA Pro Lys Ile Ile Ala Cys Gly Lys Ser Val Ala 550 555 560 565 GGG TTT GCG ATG GCC GTA AGG TTC TTG AC T GGA CCA GCC GTG ATC GCA 3251 Gly Phe Ala Met Ala Val Arg Phe Leu Thr Gly Pro Ala Val Ile Ala 570 575 580 GCC ACC TCA ATA GCA ATT GGT ATT CGA GGT GAT CTC CTC CAT ATC GCC 3299 Ala Thr Ser Ile Ala Ile Gly Ile Arg Gly Asp Leu Leu His Ile Ala 585 590 595 ATC GTT CAG GTGATTACTC TTTAGTCTTA TATATATTTC AATCTAACTT 3348 Ile Val Gln 600 ACAGTTTGAT GTTTTAGCTA GTGATGTTGG GTTTCTTTGA AAAATATAAT TGATACTGATT AGTATTGATAT GATT AGT 3AT Gln Gly Ile Val Pro Phe 605 610 GTT TTC GCC AAA GAA TAT AAC GTC CAT CCT GAT ATT CTC AGC ACT GC G 3509 Val Phe Ala Lys Glu Tyr Asn Val His Pro Asp Ile Leu Ser Thr Al 615 620 625 TAAGTTATTT AAGTTATAAA ATATTTAATTTTCATTCT A TAATACTATA 3569 TATAAGATAT TAATTTGGTA TTCAAACTAT ACAAAGTTAC AGAGATCTCC TAAGCTAAAA 3629 ACTTGATATT ATTTTTCAG G GTT ATA TTC GGA ATG CTG GTT GCT TTG CCT 3679 a Val Ile Phe Gly Met Leu Val Ala Leu Pro 630 635 CTC ATC ATC ATC Val Thr Val Leu Tyr Tyr Val Leu Leu Gly Leu 640 645 TTTGCAAATA AAAGGCGATA CGACCCAAAG GTGATTTTTT TTCAAACGAA AAAGAATAAT 3792 TACAAGAACG AAAAAAGACT AATTCCAGGT CAGGCTTAGG TGTATGGGAC CATGCAATGT 3852 CGCATTAATT AAATTATAGC ATATGATAGT CGAAAATTTA GATAACTTTG TATAATTAAT 3912 TATATGCACA TGCATGTACG TGACTTTGTA GTTTTTGTTA CATTTATTAA ATTTTTGGGA 3972 TGTGCAAG 3980 SEQ ID NO: 4 Length of sequence : 22 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA GTAATCCATG AGAAAAACTT CG 22 SEQ ID NO: 5 Sequence length: 21 Sequence type: Number of nucleic acid strand : Single-stranded topology: Linear Sequence type: Other nucleic acid Synthetic DNA TCGAATGTGA CAATGTTGTG G 21 SEQ ID NO: 6 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single-stranded topology: Linear sequence Type: Other nucleic acid Synthetic DNA AAATGATCAC CGGCAAAGAC 20 SEQ ID NO: 7 Sequence length: 21 Sequence type: Nucleic acid Number of strands: Single-stranded Topology: Linear Sequence type : Other nucleic acid synthetic DNA AAACATAGCC ATTCCAAGAC C 21 SEQ ID NO: 8 Sequence length: 20 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA TGGTCCGGTG TGAATATCCC 20 sequence Number: 9 Sequence length: 20 Sequence type: Nucleic acid number of strands: Single-stranded Topology: Linear Sequence type: Other nucleic acid Synthetic DNA TCATAGCAAC GTATAGCGGC 20 SEQ ID NO: 10 Sequence length: 20 Sequence Type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA GTTCAATCGT CACGAGAGCG 20 SEQ ID NO: 11 Sequence length: 21 Sequence type: Nucleic acid strand number: Single strand topology : Type of linear sequence: Other nucleic acid Synthetic DNA TCCTAGGAAA CAGCAGATGC C 21

[Brief description of the drawings]

FIG. 1 shows a physical map near the AGR locus on Arabidopsis chromosome 5.

Continued on the front page (51) Int.Cl. ⁶ Identification symbol FI C12P 21/02 G01N 33/53 D G01N 33/53 33/566 33/566 33/577 B 33/577 C12N 5/00 C // (C12N 5/10 C12R 1:91) (C12P 21/02 C12R 1:91) (72) Inventor Toshiharu Kauchi 8916-5 Takayamacho, Ikoma City, Nara Prefecture Nara Institute of Science and Technology Graduate School of Science and Technology, (72) Invention Kazuki Utsuno 8916-5 Takayamacho, Ikoma City, Nara Prefecture Nara Institute of Science and Technology Graduate School of Bioscience

Claims (14)

[Claims] 1. A protein consisting of the amino acid sequence of SEQ ID NO: 1, or an amino acid sequence having one or more amino acids substituted, deleted, or added in the protein, and having the amino acid sequence of SEQ ID NO: 1. A protein having the same function as a sequence protein. 2. It consists of the nucleotide sequence of SEQ ID NO: 2.
A protein encoded by a DNA that hybridizes with the DNA, the protein having the same function as the protein having the amino acid sequence of SEQ ID NO: 1. 3. A DNA encoding the protein according to claim 1 or 2. A vector comprising the DNA according to claim 3. 5. A transformed cell that carries the DNA of claim 3 so that it can be expressed. 6. The method for producing a protein according to claim 1, comprising a step of culturing the cell according to claim 5. 7. An antisense DNA against the DNA according to claim 3 or a part thereof. A vector comprising the antisense DNA according to claim 7. 9. A transformed plant cell which has the DNA according to claim 3 or the antisense DNA according to claim 7 in an expressible manner. 10. A plant comprising the transformed plant cell according to claim 9. 11. The plant according to claim 10, wherein a root gravity stimulus response is altered. 12. A propagation medium for the plant according to claim 11. An antibody that binds to the protein according to claim 1 or 2. 14. A DNA which specifically hybridizes with the DNA according to claim 3 and has a chain length of at least 15 nucleotides.