JPH11313576A - Chimera animal and its preparation - Google Patents

Abstract

PROBLEM TO BE SOLVED: To produce a non-human chimera animal by maintaing and expressing a giant DNA fragment in individual animal, useful, e.g. for the treatment of hereditary diseases by transferring an exogenic chromosome (fragment) into a cell having multipotent differentiation property by the fusion with a micro-cell containing an exogenic chromosome (fragment). SOLUTION: A non-human chimera animal is produces by producing a micro- cell having a size of >=670 kb, preferably >=1 Mb (a million base pairs) and containing one or more exogenic chromosomes (fragments) containing a region encoding an antibody and transferring the above one or more exogenic chromosomes (fragments) into a cell holding multipotent differentiation property by the fusion with the micro-cell. The micro-cell containing one or more exogenic chromosomes (fragments) is preferably derived from a hybrid cell produced by the fusion of a cell containing one or more exogenic chromosomes (fragments) (e.g. normal human diploid cell) and a cell having high micro-cell forming capability (e.g. mouse A9 cell).

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a chimeric non-human animal, a method for producing the same and a method for using the same. With the chimeric non-human animal of the present invention, 1M which was hitherto impossible
It becomes possible to maintain and express an exogenous giant DNA fragment of b (million base pairs) or more in an animal individual. Therefore, by utilizing this, it becomes possible to produce an animal individual that retains and expresses the full length of a gene encoding a biologically active substance, for example, the full length of a human antibody gene. A biologically active substance obtained from this animal, for example, a humanized antibody has utility as a pharmaceutical. -Functional analysis of human giant genes (histocompatible antigens, dystrophin, etc.) in animal individuals becomes possible. -It can be used to create animal models for human dominant genetic diseases and chromosomal abnormalities.

[0002]

2. Description of the Related Art A technique for expressing a foreign gene in an animal individual, that is, a technique for producing a transgenic animal, is useful not only for obtaining information on the in vivo function of the gene, but also for identifying a DNA sequence that regulates gene expression ( For example, Magram et al., Nature, 315: 338, 1985), human disease model animal development (Yamamura et al., Manual disease model mouse, Nakayama Shoten, 1994), and further breeding of livestock (eg, Muller et al., Experientia, 47: 923, 1991), which has been used to produce useful substances (for example, Vela
nder et al., PNAS, 89: 12003, 1992). Mice have been most frequently used for gene transfer so far.
Mice, which have been studied in detail as experimental animals and embryo engineering techniques have been established, can be said to be the most suitable mammals for this purpose.

[0003] There are roughly two known methods for introducing a foreign gene into a mouse individual. One is to inject DNA into the pronucleus of the fertilized egg (Gordon et al., PNAS, 77: 7380, 1980), and the other is to use embryonic stem cells that retain totipotency (hereinafter referred to as embryonic stem cells).
A method for producing chimeric mice by introducing DNA into ES cells (Takahashi et al., Development, 102: 259, 198)
8). In the latter case, in chimeric mice, ES
Only cells and tissues that contributed cells, all cells in progeny obtained through germ cells derived from ES cells,
The transgene is retained in the tissue. A number of transgenic mice have been produced using these techniques.

[0004] However, at present, there is a limit to the size of DNA that can be introduced, which greatly limits the range of application of this technology. The limitation depends on the size of the DNA that can be cloned, and one of the largest DNA fragments introduced so far is about 6 cloned into the yeast artificial chromosome (YAC).
70 kb DNA fragment (Jakobovits et al., Nature, 362: 25
5, 1993). In this experiment, YAC-bearing yeast and mouse ES
This was done by fusing the cells. In YAC, it is said that foreign DNA of up to about 2 Mb can be cloned (Den Dunnen et al., Hum. Mol. Genet., 1:19, 1992).
), It is known that the frequency of recombination between homologous DNA sequences is high in budding yeast cells, and it may be difficult to stably maintain a human DNA fragment having many repetitive sequences in a complete form. In fact, 20-40% of the YAC libraries containing human genomic DNA have undergone some recombination (G
reen et al., Genomics, 11: 584, 1991).

Another approach has been to microdissect metaphase chromosomes obtained from cultured human cells and inject fragments (presumed to be 10 Mb or more) into fertilized mouse eggs (Richa et al., Science, 245: 175, 1989). In the resulting mouse individual, a human-specific DNA sequence (Alu
Sequence was detected, but human gene expression was not confirmed. In addition, in the chromosome preparation method used here, when fixing chromosomes to a slide glass, methanol itself is used, so that the DNA itself is inevitably fragmented into small pieces, and the injected DNA is a continuous DNA. It is unlikely that it exists. In any case, 1M to date
It can be said that there is no example of introducing and expressing a sequence of b or more foreign DNA fragments into a mouse individual.

Useful and interesting human genes that are desired to be introduced into mice: antibodies (eg, Cook et al., Nature
Genetics, 7: 162, 1994), T cell receptor (Hood et al., Col.
d Spring Harbor Symposia on Quantitative Biology,
Vol. LVIII, 339, 1993), histocompatible antigens (Carrol et al.,
PNAS, 84: 8535, 1987), dystrophin (DenDun)
It is known that the coding region itself has a size exceeding 1 Mb. In particular, human immunoglobulin heavy chains (〜1.5 Mb, Cook et al., Supra), light chain κ (〜3 Mb, Zach
au, Gene, 135: 167, 1993), light chain λ (~ 1.5 Mb, Frippia
t et al., Hum. Mol. Genet., 4: 983, 1995), it is desired to produce a mouse that retains and expresses the full length gene, but this is not possible with the current technology (Nikkei Biotech,
1993.7.5.).

[0007] Many of the genes responsible for dominant genetic diseases in humans and chromosomal disorders (such as Down's syndrome) that cause birth defects are not cloned, and only rough positional information on chromosomes can be used. For example, the G band obtained by Giemsa staining of metaphase chromosomes usually has several Mb to 1 Mb.
It has a size of 0 Mb or more. Therefore, even if it is clear that a certain causal gene exists on a specific G band, it is necessary to introduce a chromosome fragment (several Mb or more) around the causative gene in order to introduce these abnormal traits into mice. Is necessary, but this is not possible with the current technology.
Here, there is a demand for the development of a technique for introducing and expressing a foreign DNA exceeding 1 Mb, which is a limitation of the conventional technique, into a mouse individual.

[0008] In cultured animal cells, it is possible to introduce a DNA having a size exceeding the above-mentioned limit by conventional techniques. This is mainly due to chromosomes (about 50-300Mb in humans).
Is the medium). Several methods for transferring chromosomes into cells have been reported (eg, McBr
ide et al., PNAS, 70: 1258, 1973), among which the microcell method is considered to be the most suitable method for introducing only one desired chromosome (Koi et al., Jpn. J. Cancer).
Res., 80: 413, 1989). A structure called a microcell is one in which one to several chromosomes are enveloped in a nuclear membrane and a plasma membrane. It is possible to introduce a small number (often one) of chromosomes by isolating microcells induced by drugs that inhibit pituitary formation in certain cells and fusing them with recipient cells. The library of monochromosomal hybrid cells that retain only one human chromosome obtained by this method is used to map known genes and identify chromosomes where unknown tumor suppressor genes, cell senescence genes, etc. are present. (Eg, Saxon et al., EMBO
J., 5: 3461, 1986). Furthermore, it is also possible to fragment a chromosome and to introduce a part of the chromosome by irradiating the microcell with gamma rays (Koi et al., Science, 260: 361, 1).
993). That is, the microcell method is considered to be suitable as a method for introducing DNA of 1 Mb or more into animal cultured cells.

[0009] The expectation that mouse individuals can be produced from cultured cells will stably maintain totipotency.
The discovery of ES cells (Evans et al., Nature, 292: 154, 1981) has ensured its existence. Foreign cells, various mutations, and mutations due to target gene recombination can be introduced into this ES cell, and genetic modification at the mouse individual level can be freely performed (for example, Mansour et al.,
Nature, 336: 348, 1988). On the other hand, the size of a foreign DNA fragment that can be cloned into the aforementioned YAC vector has been considered to be the limit in terms of introducing large DNA. The conventional technique of chromosome transfer, which can introduce DNA exceeding its size into cultured cells, has never been used for gene transfer at the level of individual mice, and it has been considered difficult to achieve this (Muramatsu et al., Transgenic biology, Kodansha Scientific, p143-, 1989).

[0010] The reasons are as follows. -When human chromosome transfer is carried out using normal karyotype mouse ES cells as recipient cells, it is to introduce chromosomal abnormality itself. Previously, large genetic aberrations at the chromosomal level that could be identified by microscopy were thought to be often fatal to mouse development (Grop
p. et al., J.Exp.Zool., 228: 253, 1983; Shinichi Aizawa, Bio Manual Series 8 Gene Targeting, Yodosha,
1995).

The human chromosomes that can be obtained are usually those of differentiated somatic cells such as finite-growth normal fibroblasts or cancer cells, and the chromosomes derived from such somatic cells are undifferentiated ES cells. If introduced into cells, they may cause ES cells to differentiate (Muller et al., Nature, 311: 438, 1984) or to age (Sugawara, Science, 247: 7).
07, 1990).

[0012] If somatic cell-derived chromosomes are introduced into the early embryo, whether they can function properly in embryonic development as germ cell-derived chromosomes and carry specific gene expression in various tissues and cells There is very little research on the problem. One of the major differences between the two is the chromosome
Presumed to be the methylation state of DNA. This changes with cell differentiation, suggesting an important role in tissue-specific gene expression (Ceder, Cell, 53: 3, 1988).
For example, site-specific DNA essential for antibody gene activation
Regarding the recombination reaction, when a methylated substrate is introduced into B cells, it is reported that the methylation state is maintained after replication and inhibits the recombination reaction (Hsieh et al., EMBO J.,
11: 315, 1992). In addition, de novo methylation is more likely to occur in established cells than in vivo (Antequera et al., Cell, 62: 503, 1990). Thus, from previous studies, it was not easy to imagine that the probably highly methylated antibody genes of fibroblasts and human-mouse hybrid cells are normally expressed in mouse B cells.

Here, two related reports by Illmensee et al. (PNAS, 75; 1914, 1978; PNAS, 76:
879, 1979). One report is that chimeric mice were prepared from a fusion strain obtained by whole cell fusion of human sarcoma cells and mouse EC cells, and another from rat hepatoma cells and mouse EC cells. In these reports, a number of questions were pointed out in the experimental results, and their credibility is considered to be low (Noguchi et al., Mouse Teratoma, Rigaku Corp., Section 5, 1987). Despite the hope that a repeat test as early as one day is desired, there is no report that this experiment could be reproduced 17 years after the report. Therefore, according to these reports, it has been thought that it was not possible to maintain a foreign chromosome in a mouse individual and express a gene on the chromosome. Under these circumstances, it has been considered difficult to introduce and express as large a DNA as a chromosome fragment into an animal individual such as a mouse, and there has been no study on this problem since the above-mentioned report by Illmensee et al.

[0014]

Accordingly, the present invention provides a chimeric non-human animal which carries a foreign chromosome or a fragment thereof and expresses a gene on the chromosome or a fragment thereof, and a progeny thereof, and the above-mentioned chimeric non-human animal An object of the present invention is to provide a method for producing the same. Another object of the present invention is to provide tissues and cells derived from the chimeric non-human animal and its progeny.

Another object of the present invention is to provide a hybridoma produced by fusing cells derived from the chimeric non-human animal and its progeny with myeloma cells. Still another object of the present invention is to provide a method for producing a biologically active substance that is an expression product of a gene on a foreign chromosome or a fragment thereof using an individual, tissue or cell of a non-human animal. And

[0016]

Means for Solving the Problems As a result of extensive studies to solve the above problems, the present inventors introduced chromosomes derived from normal human fibroblasts or partial fragments thereof into mouse ES cells by the microcell method, We succeeded in obtaining a stable strain. Furthermore, a chimeric mouse was obtained from this ES cell line, which retained human chromosomes in its normal tissue and expressed a plurality of human genes including a human antibody heavy chain gene. By this series of methods, we have made it possible to retain large DNA fragments in individuals and to express genes on the DNA fragments, which were not possible before.

The gist of the present invention is as follows. 1. Producing a microcell containing one or more foreign chromosomes or fragments thereof, and fusing with the microcell,
A method for producing a chimeric non-human animal, which comprises transferring the single or plural foreign chromosomes or fragments thereof to cells having pluripotency.

2. Producing a microcell containing one or more foreign chromosomes or fragments thereof, and transferring the single or plural foreign chromosomes or fragments thereof to cells having pluripotency by fusion with the microcells. A method for producing a cell containing pluripotency which contains single or plural foreign chromosomes or fragments thereof.

3. A chimeric non-human animal that can be prepared by the above-described method 1, retains a single or multiple foreign chromosomes or fragments thereof, and expresses genes on the chromosomes or fragments thereof, and the single or multiple foreign A progeny that retains a chromosome or a fragment thereof and expresses a gene on the chromosome or a fragment thereof. 4. A cell which can be prepared by the above-mentioned method 2 and which contains a single or plural foreign chromosomes or fragments thereof and retains pluripotency. 5. Use of the cell that retains the pluripotency of 4 above for producing a chimeric non-human animal.

6. A non-human animal and its progeny, which retain one or more foreign chromosomes or fragments thereof and express genes on said chromosomes or fragments thereof, obtained by crossing said chimeric non-human animal or progeny thereof. 7. A tissue derived from the above 3 chimeric non-human animals or progeny thereof or the above 6 non-human animals or progeny thereof. 8. Cells derived from the above 3 chimeric non-human animals or progeny thereof or the above 6 non-human animals or progeny thereof. 9. A hybridoma produced by fusing the cell of 8 with myeloma cells.

10. The above three chimeric non-human animals or progeny thereof or the above six non-human animals or progeny thereof,
A non-human animal produced by crossing with a non-human animal of a strain deficient in the same or homologous gene as the gene on the chromosome or a fragment thereof, and progeny thereof.

11. Expression of a gene on one or more foreign chromosomes or fragments thereof in an individual, tissue or cell of the chimeric non-human animal or progeny thereof or the non-human animal or progeny thereof, A method for producing a biologically active substance, comprising recovering a biologically active substance as a product thereof.

12. The above 3 chimeric non-human animals or progeny thereof or the above 6 non-human animals or progeny thereof,
Mating with a non-human animal of a strain deficient in the same or homologous gene as the gene on the chromosome or a fragment thereof, in the individual, tissue or cell of the offspring born, the single or multiple foreign chromosomes Alternatively, a method for producing a biologically active substance, comprising expressing a gene on a fragment thereof and collecting a biologically active substance as a product thereof.

Hereinafter, the present invention will be described in detail. A mouse individual carrying a human chromosome or a fragment thereof and expressing a gene on the chromosome or a fragment thereof is: (3) Preparation of chimeric mouse using the above-mentioned mouse cells (4) Human chromosome retention in chimeric mouse and human gene expression confirmation process Can be obtained by Here, as a non-human animal that retains a human chromosome or a fragment thereof and expresses a gene on the chromosome or a fragment thereof,
A mouse was taken as an example (hereinafter, this mouse is referred to as "human chromosome-introduced mouse").

Here, the human chromosome refers to a complex of natural DNA and protein derived from human cells. There are 23 normal chromosomes (24 males) and 46 normal chromosomes, each with about 50-30
Although it is said to contain DNA of 0 Mb length, the present invention also includes a partial fragment that can be stably replicated and distributed as an independent chromosome, and a partial fragment that is translocated and stably retained on a mouse chromosome. It is. The size of the DNA is usually greater than 1 Mb, but can be less. A feature of the present invention is that a human gene is retained and expressed in a mouse individual using a chromosome itself as a medium without performing cloning in Escherichia coli, yeast, or the like or extracting DNA from cells.

The human chromosome-introduced mouse refers to a mouse that retains one or more human chromosomes or a fragment thereof in all or some of its normal somatic cells.
Furthermore, in all or some of the normal somatic cells,
Refers to those expressing one or more human genes on the human chromosome.

(1) Preparation of Chromosome Donor Cell Holding Labeled Human Chromosome or a Fragment thereof A chromosome donor cell includes: 1) a human chromosome labeled with a marker selectable by a recipient cell; And 3) a cell having a high microcell-forming ability, which does not contain any human chromosome other than the above. As a material for providing human chromosomes, any cell line, cancer cells, or primary cultured cells derived from humans can be used, but the possibility of abnormalities such as chromosome deletion and amplification is low and culture is easy. Normal fibroblasts are suitable when considered.

First, regarding 1), the human cell is a drug (G41)
8, puromycin, hygromycin, blasticidin) can be transformed with a vector expressing a marker gene such as resistance. As the promoter for controlling the expression of the marker used herein, one that works efficiently not only in human cells but also in recipient cells such as mouse ES cells is desirable. For this purpose, the SV40 enhancer is linked to the herpes simplex virus thymidine kinase promoter (Katoh et al., Cell Struct. Funct., 12: 575, 198).
7), mouse PGK-1 promoter (Soriano et al., Cell, 64:
693, 1991). Electroporation (Ishida et al., Introduction to Cell Engineering Experiment Operation, Kodansha, 19
92) by carrying out transformation and selecting
It is possible to obtain a library of human cell transformants in which the introduced marker genes are randomly inserted into 46 human chromosomes of 23 species.

Regarding 3), since many human normal cells have very low microcell-forming ability, the above transformants are transformed into cells having high microcell-forming ability, for example, mouse A9 cells (Os
himura, M., Environ. Health Perspect., 93:57, 1991)
And whole cell fusion can impart a forming ability. It is known that human chromosomes are selectively lost in mouse-human hybrid cells. You can do it.

Further, in order to satisfy the condition 2), it is desirable to obtain a microcell from this cell fusion strain and to fuse it again with mouse A9 cells. Also in this case, it is considered that most of the microcell fusion strains obtained by selecting with the marker on the human chromosome satisfy the conditions of 1), 2) and 3). Identification of the marked human chromosome was performed by PCR (polymerase chain reaction, Saiki et al., Science, 239: 487, 1988), Southern blot analysis (Ausubel et al., Current protocols) in mouse-human monochromosomal hybrid cells obtained at the final stage. in
molecular biology, John Wiley & Sons, Inc., 199
4), FISH (fluorescence in situ hybridization, Lawrence et al., Cell, 52:51, 1988). When a specific chromosome is desired to be introduced, the above process is repeated for many human cell transformant clones to search for those in which the target chromosome is marked. Alternatively, the above process can be performed on a mixture of human cell transformant clones, and human chromosomes can be identified from the resulting large number of mouse-human monochromosomal hybrid cells. Furthermore, a marker gene can be inserted into a specific site by homologous recombination targeting a DNA sequence on a chromosome desired to be introduced (Thomas et al., Cell, 51: 503, 1987).

By irradiating gamma rays to microcells prepared from mouse-human hybrid cells, marked human chromosomes can be fragmented and introduced into mouse A9 cells. Even when the microcell is not irradiated with gamma rays, a partially fragmented human chromosome may be transferred at a certain rate. In these cases, the resulting microcell fusion strain retains a marked fragment of the human chromosome. These can be used when it is desired to introduce a chromosome partial fragment into a recipient cell.

(2) Transfer of Human Chromosome or Fragment thereof to Mouse Cells Retaining Pluripotency The embryonic carcinoma cells (EC cells, Hanaoka et al., Differentiation, 48: 83, 199
1), embryonic stem cells (ES cells, Evans et al., Nature, 292: 154,
1981), embryonic germ cells (EG cells, Matsui et al., Cell, 7
0: 841, 1992) have been reported to contribute to normal somatic cells by injection or co-culture into early mouse embryos, ie, chimeric mice can be produced. ES, EG
Cells are particularly capable, often contributing also to germ cells, and can produce progeny derived from the cell. EC cells are obtained mainly from germ cell carcinomas, ES cells are obtained from the inner cell mass of blastocysts, and EG cells are obtained from primordial germ cells that appear early in development. As the recipient cells for human chromosome transfer in the present invention, these cell lines and mutants thereof, and all undifferentiated cells that can differentiate into all or some normal somatic cells in mouse individuals can be used.

As a material for transferring a human chromosome to a recipient cell, a microcell prepared from the human chromosome donor cell obtained in (1) or a microcell irradiated with gamma rays can be used. Transfection into recipient cells is performed by fusing recipient cells and microcells by the method described in <Seikigen, Cell Engineering Handbook, Yodosha, 1992>. In microcell donor cells, certain human chromosomes or fragments thereof carry selectable markers in recipient cells. From this, any human chromosome or a fragment thereof can be introduced by selecting a strain holding the gene or chromosome or a fragment thereof to be introduced by PCR, Southern blot analysis, FISH analysis or the like as in (1). It is possible. In addition, by sequentially introducing a plurality of chromosomes or fragments thereof holding different selectable markers, recipient cells holding these at the same time can also be obtained. Furthermore, it is also possible to select a cell line in which the number of introduced chromosomes has been increased from existing cell lines into which human chromosomes have been introduced. This is usually achieved by increasing the concentration of the selective agent added to the culture.

It is confirmed as follows that the recipient cell selected by a marker (eg, G418 resistance) on the human chromosome retains all or a part of the human chromosome retained by the donor cell. You. Using genomic DNA extracted from the selected recipient cells, a human-specific repetitive sequence (L1, Alu et al., Korenberg et al., Cell, 53: 391,
1988), by Southern analysis using human genes and the like. PCR using human gene-specific primers
Method and a human chromosome-specific probe (Lichter et al., Human
Genetics, 80: 224, 1988) by chromosome analysis such as fluorescence in situ hybridization (FISH).

(3) Preparation of chimeric mouse from human chromosome-introduced ES cells The preparation of chimeric mice from the ES cell line obtained in (2)
<Shinichi Aizawa, Bio Manual Series 8 Gene Targeting, Yodosha, 1995>.
It is desirable to use the conditions already examined for each ES cell line for the selection of the stage of development, strain, etc. of the host embryo for efficient chimeric mouse production.
For example, TT2 cells derived from CBA × C57BL / 6 F1 (wild color, Yagi
Et al., Analytical Biochemistry, 214: 70, 1993), it is preferable to use an 8-cell stage embryo derived from Balb / c (white, CLEA Japan) or ICR (white, CLEA Japan) as a host embryo.

(4) Retention of Human Chromosome in Chimeric Mice and Expression of Human Gene The contribution ratio of ES cells in mice born from embryos injected with ES cell lines can be roughly determined by the coat color. However, just because there is no contribution to hair color cannot be concluded that there is no contribution from other organizations. More detailed, retention of human chromosome in each tissue of chimeric mouse, Southern analysis using genomic DNA extracted from each tissue, PCR
And so on.

Gene expression on the introduced human chromosome is confirmed as follows. Expression of mRNA from human chromosomes was determined by RT-PCR using RNA from tissues (Kawasaki et al., PNAS, 8
5: 5698, 1988), by Northern blotting (Ausubel et al., Supra). Protein level expression was determined by enzyme-linked immunosorbent assay (ELISA, Toyama and Ando, Monoclonal antibody experiment manual, Kodansha Scientific, 1987; Ishikawa, Ultrasensitive enzyme immunoassay, Academic Publishing Center, 1993), Western blotting (Ausubel et al.,
Or the isozyme analysis using the difference in electrophoretic mobility (Koi et al., Jpn. J. Cancer Res., 80: 413, 198).
9) is detected. Furthermore, the retention of human chromosomes and the expression of genes on the chromosomes in chimeric mouse cells,
This can be confirmed by the appearance of resistant cells due to drug resistance marker gene expression in chimeric mouse-derived primary culture cells.

For example, for a chimeric mouse prepared from ES cells carrying human chromosome 14 in which a human immunoglobulin heavy chain is present, human IgM, Ig
G, IgA, etc. can be detected by an enzyme immunoassay using an anti-human Ig antibody that minimizes cross-reactivity with the mouse antibody. In addition, this chimeric mouse is immunized with a human-derived antigen (for example, human serum albumin), and hybridomas obtained by fusing its spleen cells with mouse myeloma (Ando and Chiba, Introduction to Monoclonal Antibody Experimental Procedures,
Hybridomas producing human immunoglobulin heavy chains can be obtained by screening Kodansha Scientific, 1991) by ELISA.

The method of producing a chimeric non-human animal that retains a human chromosome or a fragment thereof and expresses a gene on the chromosome or a fragment thereof has been described above using a mouse as an example.
In the present invention, a chromosome or a fragment thereof transferred to a chimeric non-human animal is not limited to a human-derived one, and it is possible to widely transfer a foreign chromosome or a fragment thereof and express a gene on the chromosome or a fragment thereof. It is. Here, the “foreign chromosome” is transferred to a cell that retains pluripotency and is characterized in that the gene on the chromosome or a fragment thereof is expressed in a chimeric non-human animal, and its origin is The species to be used is not particularly limited. Further, according to the method of the present invention, not only chimeric mice but also other chimeric animals such as mammals such as rats and pigs and other chimeric animals can be produced. Establishment of ES cells or ES-like cells in animal species other than mice has been described in rats (Iannaccone et al., Dev. Biol., 163, 288-, 199).
4), pig (Wheeler et al., Reprod. Fertil. Dev., 6, 56)
3-, 1994), cattle (Sims et al., Proc. Natl. Acad. Sci. US
A, 91, 6143-6147, 1994), and has also been tried in medaka, chicken, and the like (transgenic animals, protein and nucleic acid enzymes, extra edition, October 1995, Kyoritsu Shuppan). In addition, it has been known that unfertilized eggs in which sheep are transplanted with ES-like cells (ED cells) and nuclei derived from epithelial-like cells obtained by passage of the cells for 10 or more generations are normal ( Campbell et al., Nature, 380, 64-, 1996). By transferring a foreign chromosome using these ES or ES-like cells as recipient cells, a chimeric non-human animal that retains a foreign chromosome or a fragment thereof and expresses a gene on the chromosome or a fragment thereof can be produced as in the case of a mouse. .

In the present invention, the cells retaining the pluripotency into which a foreign chromosome or a fragment thereof is transferred are not limited to the aforementioned ES cells, EC cells, and EG cells. For example, a foreign chromosome or a fragment thereof can be transferred to bone marrow stem cells, and treatment of a genetic disease or the like can be performed by transplanting the bone marrow stem cells into a living body. In a chimeric non-human animal, when an ES cell having a foreign chromosome differentiates into its germ cell, a transchromosome or fragment is also observed in a progeny obtained by reproduction, and the progeny is a gene on the introduced chromosome or fragment. Express.

Using the chimeric non-human animal or its progeny obtained as described above, a gene on a foreign chromosome or a fragment thereof is expressed, and the product is recovered, whereby a biologically active substance is obtained. Can be manufactured. Specifically, a chimeric non-human animal or its progeny can be bred under conditions capable of expressing a gene on a foreign chromosome or a fragment thereof, and then the expression product can be recovered from the animal's blood, ascites, and the like. Alternatively, conditions for expressing a gene on a foreign chromosome or a fragment thereof, such as a chimeric non-human animal or its progeny, a tissue or cell thereof, or an immortalized tissue thereof (eg, a hybridoma immortalized by fusion with a myeloma cell) or the like. The expression product can then be recovered from the culture. Furthermore, foreign chromosomes or fragments thereof extracted from tissues, cells, or immortalized tissues of these chimeric non-human animals or progeny thereof, DNAs constituting the foreign chromosomes or fragments thereof, and furthermore, chimeric non-human CD derived from a foreign chromosome or a fragment thereof retained in an animal or its progeny tissue, cell, or immortalized tissue or cell
NA is converted to animal cells or insect cells (eg, CHO cells, BHK cells, liver cancer cells, myeloma cells, SF9
Cells, etc.), and culturing the cells under conditions capable of expressing the gene on the foreign chromosome or a fragment thereof, and then recovering the expression product (eg, a specific antigen-specific antibody protein, etc.) from the culture be able to. The expression product can be recovered according to a known method such as centrifugation, and further purified according to a known method such as ammonium sulfate fractionation, partition chromatography, gel filtration chromatography, adsorption chromatography, and preparative thin-layer chromatography. be able to. Biologically active substances include any substance encoded on a foreign chromosome, and include, for example, antibodies, particularly human antibodies. For example, cloning a human antibody gene on the chromosome from an immortalized cell such as a spleen cell or a hybridoma thereof of the obtained chimeric animal, and introducing the gene into a Chinese hamster ovary cell (CHO) or myeloma cell to produce a human antibody (Lynette et al., Biotechnology, 10, 1121-, 1992; Beb
bington et al., Biotechnology, 10, 169-, 1992).

The human Nos. 2, 14, and 22 obtained by the present invention
Chimeric mice harboring chromosome (fragment) and their progeny are the functions of the human antibody heavy chain (on chromosome 14), light chain κ (on chromosome 2), and light chain λ (on chromosome 22) genes. Most of the sequence can be retained. That is, a known transgenic mouse into which a part of a human antibody gene has been introduced using a yeast artificial chromosome or the like (Green et al., Nature Genetic
s, 7, 13-, 1994, Lonberg et al., Nature, 368, 856-, 199
It is possible to express a very diverse human antibody repertoire closer to that observed in humans compared to 4). Also, the second +14 obtained by the present invention
Chimeric mice and their progeny that simultaneously hold chromosomes (fragments) such as Nos. 22 and 14 and their chromosomes (fragments) such as Nos. 2 + 14 and 22 obtained by crossing them Mice and their progeny are capable of producing fully human antibodies in which both the heavy and light chains are of human origin. These mice can generate an antigen-specific human antibody against human-derived antigens by treating them as foreign substances. This property is very useful for obtaining therapeutic human monoclonal or polyclonal antibodies (Green et al., Supra, Lonberg).
Et al., Supra). On the other hand, in order to increase the efficiency of obtaining a human antibody having a high affinity for a specific antigen, it is desired to produce a mouse that does not produce a mouse antibody but produces only a human antibody (Green et al., Supra, Lonberg et al., Supra). In the present invention, this is typically achieved by the following methods A or B using known techniques.

Method A: A method using mouse antibody-deficient ES cells and mouse antibody-deficient chimeric host embryos. Method B: A method in which progeny retaining the human chromosome are obtained from a human chromosome-introduced chimeric mouse and crossed with a mouse strain deficient in a mouse antibody gene. Hereinafter, typical examples of the methods A and B will be specifically described below.

Specific Procedure of Method A One of the mouse antibody heavy chain genes present in two copies in mouse ES cells was homologously recombined with the target gene (Joyner et al., Ge
ne Targeting, 1993, IRL PRESS).
Sequences that can be subsequently removed by site-specific recombination, such as loxP sequences (recombined with Cre recombinase, Sauer et al., Supra, FLP recombinase-FRT
O'Gorman et al., Science, 251, 1351-, 1991 using sequences.
The marker gene such as the G418 resistance gene sandwiched between them is inserted.

2. The above drug-resistant mouse ES cells in which one antibody heavy chain gene has been disrupted are cultured in the presence of a high concentration of a drug, and a strain having a high concentration of drug resistance is selected. Screening these strains yields strains in which both antibody heavy chain genes have been disrupted (Shinichi Aizawa, supra). 3.
2. In the mouse ES cells in which both antibody heavy chain genes obtained in the above were disrupted, 1. An enzyme gene causing a site-specific recombination reaction between the recombination sequences inserted on both sides of the drug resistance gene, such as the Cre recombinase gene (Sauer et al., Supra)
, And a recombination reaction occurs between the loxP sequences to select drug-sensitive strains in which the drug resistance gene inserted into both antibody heavy chain genes has been removed (Seiji Takatsu et al., Experimental Medicine Supplement, Basic technology of research, p255-, 1995, Yodosha).

4. The above steps 1 to 3 are repeated for the mouse antibody light chain κ gene, and finally a drug-sensitive strain completely deficient in the antibody heavy chain and κ chain is obtained. Human chromosome 14 containing a human antibody heavy chain gene marked with a drug resistance marker (eg, G418 resistance gene) by microcell fusion using 5.4 strain (antibody heavy chain, κ chain deficient mouse ES cell) as a recipient cell (Fragment). Human chromosome 2 (fragment) containing a human antibody light chain gene marked with a drug resistance marker different from 5 (for example, puromycin resistance gene) by microcell fusion using the strain obtained in 6.5 as a recipient cell or Introduce chromosome 22 (fragment) or both.

7. Mouse strains that cannot produce their own antibodies (eg, RAG-2 knockout mice, Shinkai
Et al., Cell, 68, 855-, 1992; membrane-type μ chain knockout mouse; an embryo obtained from Kitamura et al., Nature, 350, 423-, 1991) was used as a host embryo to produce a chimeric mouse with ES cells obtained in 6. create. 8. Most functional in the resulting chimeric mice
B lymphocytes are derived from ES cells (Seiji Takatsu et al., Experimental Medicine Supplement, Basic Techniques for Immunological Research, p234-, Yodosha, 1995).
Since these B lymphocytes lack mouse heavy chains and kappa chains, only human antibodies are produced mainly from functional human antibody genes on the transchromosome.

Specific Procedure of Method B From a chimeric mouse carrying a human chromosome containing a human antibody heavy chain, light chain κ or light chain λ or a fragment thereof, passable progeny that stably retain them are obtained. 2.1. Mouse strain expressing the human antibody heavy chain or light chain obtained in the above, or a mouse strain expressing both human antibody heavy and light chains obtained by crossing them, and a mouse strain lacking its own antibody gene (Eg, membrane-type μ chain knockout mouse, light chain κ knockout mouse, Chen et al., EMBO J., 3, 821-, 1993), and homozygous for deletion of mouse antibody heavy chain and light chain κ. And human antibody heavy chain (No. 14) + light chain κ
(No. 2), antibody heavy chain (No. 14) + light chain λ (No. 22) or human antibody heavy chain (No. 14) + light chain κ (No. 2) + light chain λ (22
No.) is obtained. In this mouse strain, since the mouse antibody heavy chain and light chain κ genes are deficient, only human antibodies are mainly produced from functional human antibody genes on the transchromosome. The methods A and B described above are used not only for human antibodies,
It can be used to efficiently obtain the product of any gene present on a foreign chromosome.

[0049]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples.

[0050]

Example 1 (Example 1) Preparation of chromosome donor cell holding human chromosome (fragment) labeled with G418 resistance Plasmid pSTneoB containing G418 resistance gene (Katoh et al., Ce
ll Struct. Funct., 12: 575, 1987; Japanese Collecti
on of Research Biologicals (JCRB), DepositNumber:
VE039) is linearized with the restriction enzyme SalI (Takara Shuzo), and human normal fibroblast HFL-1 (obtained from RIKEN Cell Bank, RCB025)
Introduced in 1). The HFL-1 cells were trypsinized, Dulbecco's phosphate buffer so as to 5x10 ⁶ cells / ml (PB
After suspension in S), electroporation was performed using Gene Pulser (Bio-Rad) in the presence of 10 μg DNA (Ishida et al., Introduction to Cell Engineering Experiments, Kodansha, 199
2). A voltage of 1000 V with a capacity of 25 μF was applied at room temperature using a 4 mm long electroporation cell (165-2088, Bio-Rad). 15% electroporated cells
Eagle F12 medium (hereinafter F1) supplemented with fetal bovine serum (FBS)
2), and 3 to 6 100 mm tissue culture plastic dishes (Corning). 200 μg one day later
The medium was replaced with F12 medium containing 15% FBS containing / ml G418 (GENETICIN, Sigma). About 100 colonies formed after 2 to 3 weeks were collected into 52 groups as one group, and were again inoculated on a 100 mm petri dish and cultured.

Mouse A9 cells (Oshimura, Environ. Health)
Perspect., 93:57, 1991, JCRB0211) supplemented with Dulbecco's modified Eagle's medium (hereinafter D) supplemented with 10% fetal bovine serum (FBS).
MEM) in a 100 mm Petri dish. 52 groups of G418-resistant HFL-1 cells were treated with 15% fetal bovine serum (FBS) and 2
In F12 supplemented with 00 μg / ml G418, each was cultured in a 100 mm petri dish. After trypsin treatment, mouse A9 cells and HFL-1 cells are mixed with each quarter to half, and
DM inoculated in a Petri dish and added with 10% fetal bovine serum (FBS)
The cells were cultured for half to one day in an equal mixture of EM and F12 supplemented with 15% fetal bovine serum (FBS). Cell fusion was performed according to the method described in (Shimizu et al., Cell Engineering Handbook, Yodosha, p.127-, 1992). After washing the cell surface twice with DMEM, the cells were treated with 2 ml of PEG (1: 1.4) solution for 1 minute, and further replaced with 2 ml of PEG (1: 3) solution and treated for 1 minute. PEG
After absorbing the solution and washing three times with serum-free medium (DMEM),
The cells were cultured in a normal medium (10% FBS, DMEM) for one day. Cells were dispersed by trypsinization and ouabain (1x10 ^-5 M,
The suspension was suspended in a double selection medium (10% FBS, DMEM) containing Sigma) and G418 (800 μg / ml), and seeded on three 100 mm dishes. After culturing for about 3 weeks, the resulting colonies were dispersed with trypsin treatment, and cultured in a selection medium (10% FBS, DMEM) containing G418 (800 μg / ml).

The cells were dispersed by trypsin treatment, and the two groups were combined into one and cultured in six 25 cm ² centrifugal flasks (coaster, 3025) until the cell density reached about 70 to 80% saturation. The medium was replaced with a culture solution (20% FBS, DMEM) containing colcemide (0.05 μg / ml, demecorsin, Wako Pure Chemical) and cultured for 2 days to form microcells. Remove the culture solution and preheat (37 ° C) cytochalasin B
(10 μg / ml, Sigma) Fill the solution into a centrifuge flask,
Insert the flask for centrifugation into an acrylic centrifuge container at 34 ° C,
Centrifugation was performed at 8000 rpm for 1 hour. The microcell was suspended in a serum-free medium, filtered through a filter and purified. Mouse A9
The purified micronuclei were added to a 25 cm ² flask in which the cells were cultured to 80% saturation, and fused with a PEG solution. The cells were cultured in a selection medium containing G418, and colonies were isolated. The human chromosome (# 2, # 4, # 14, # 22) retained by each clone was identified as follows. All experimental procedures and reagents other than the above are described in <Shimizu et al., Cell Engineering Handbook, Yodosha, p.127->
Followed.

(1) PCR analysis The isolated cells were cultured, and the cells were purified from Puregene DNA Isolati
A genomic DNA was extracted using an on kit (Gentra System). Using this genomic DNA as a template, clones retaining human chromosomes 2, 4, 14, and 22 were obtained by PCR using human chromosome-specific primers. Selected. PCR amplification uses about 0.1 μg of genomic DNA (Innis et al., PCR Experiment Manual, HBJ
Publishing Bureau, 1991, Thermal Cycler GeneAmp 9600, Pe
rkin-Elmer). Taq polymerase was manufactured by Perkin-Elmer, and the reaction conditions were 94 ° C for 5 minutes and 1 minute.
After cycling, denaturation 94 ° C for 15 seconds, annealing 54 ~
35 cycles were performed at 57 ° C. for 15 seconds (appropriately changed depending on primers) and at 72 ° C. for 20 seconds. Primers are the genes present on each chromosome (O'Brien, Genetic Maps, 6th edition, Boo
k5, Cold Spring Harbor Laboratory Press, 1993) and polymorphic markers (Polymorphic STS Primer Pair, BIO
Company S; Weissenbach et al., Nature 359: 794, 1992; Walter
Et al., Nature Genetics, 7:22, 1994). Gene primers were prepared based on base sequences obtained from databases such as GenBank and EMBL. The names of the polymorphic primers and the sequences of the gene primers are shown in the following Examples for each chromosome (No. 2: Examples 1, 4).
No .: Example 6, No. 14: Example 9, No. 22: Example 2). 2
For the identification of chromosome chromosome, the following genetic markers and polymorphic markers (Polymorphic STS Primer Pair, BIOS: D:
2S207, D2S177, D2S156, D2S159 BIOS).

Cκ (immunoglobulin kappa constant):
5'-TGGAAGGTGGATAACGCCCT (SEQ ID NO: 1), 5'-TCATTCTCC
TCCAACATTAGCA (SEQ ID NO: 2) FABP1 (fatty acid binding protein-1 liver): 5'-GC
AATCGGTCTGCCGGAAGA (SEQ ID NO: 3), 5'-TTGGATCACTTTGG
ACCCAG (SEQ ID NO: 4) Vk3-2 (immunoglobulin kappa variable): 5'-CTCTCC
TGCAGGGCCAGTCA (SEQ ID NO: 5), 5'-TGCTGATGGTGAGAGTGA
ACTC (SEQ ID NO: 6) Vk1-2 (immunoglobulin kappa variable): 5'-AGTCAG
GGCATTAGCAGTGC (SEQ ID NO: 7), 5'-GCTGCTGATGGTGAGAGT
GA (SEQ ID NO: 8)

(2) Fluorescence In Situ Hybridization (FISH) FISH analysis was performed by Matsubara et al., FISH experimental protocol, Shujunsha,
1994), humans 2, 4, 14, 22
Chromosome-specific probe (CHROMOSOME PAINTING SYSTE
M, Cambio).

For example, the clone retaining chromosome 2 is 2
One or more clones were obtained in 10 of the 6 groups (745 clones). Among them, 5 clones were positive for all primers specific to chromosome 2 used. These clones were subjected to FISH analysis. FISH analysis (Matsubara et al., FI
According to the method described in SH Experimental Protocol, Shujunsha, 1994), a human chromosome 2 specific probe (CHROMOSOME PAI)
NTING SYSTEM, CANBIO). In the cells positive for all primers, human chromosome 2 is almost completely observed, and in some of the clones positive for only some primers, independent chromosomes smaller than human chromosome 2 are observed, or Cells having chromosomes in a form fused to chromosomes other than human chromosome 2 were also observed (FIG. 1). In FIG. 1, the row indicates the clone name, and the column indicates the primers used for PCR. ● indicates positive, and × indicates negative. The bottom line shows the form of human chromosome 2 observed by FISH. Those not described were not implemented. Similarly, human No. 4, 14
A9 cells retaining chromosomes # 22 and 22 were obtained.

(Example 2) Introduction of human chromosome 22 into mouse ES cells by the microcell method Human chromosome 22 obtained in (Example 1) was used as a chromosome donor cell.
A mouse A9 cell line carrying chromosome 7 (hereinafter referred to as A9 / # 22) was used. Mouse ES cell line as chromosome recipient cells
E14 (obtained from Martin L. Hooper, Hooper et al., Nature, 3
26: 292, 1987). The culture method of E14 is <Shinichi Aizawa,
Bio Manual Series 8, Gene Targeting,
According to the method described in Yodosha, 1995>, a G418-resistant STO cell line (obtained from Osaka University, Prof. Hisato Kondo) treated with mitomycin C (Sigma) was used as a vegetative cell. First Shimizu et al. (Cell engineering handbook, Yodosha, 1992) in accordance with the reported method of, microcells were prepared from about 10 ⁸ A9 / # 22. The whole amount of the obtained microcell was suspended in 5 ml of DMEM. After about 10 ⁷ cells of E14 were dispersed with trypsin, DM
After washing three times with EM and suspending in 5 ml of DMEM, it was combined with the microcell and centrifuged at 1250 rpm for 10 minutes to remove the supernatant. The precipitate is well loosened by tapping, and a 1: 1.4 PEG solution (5 g P
EG1000, <Wako Pure Chemical>, 1 ml DMSO <Sigma> dissolved in 6 ml DMEM) 0.5 ml, and leave at room temperature for 1 minute 30 seconds, then 10 ml DM
EM was added slowly. Immediately, the supernatant was removed by centrifugation at 1250 rpm for 10 minutes, and the precipitate was suspended in 30 ml of an ES cell medium, and seeded on three 100 mm-diameter tissue culture plastic dishes (Corning) pre-coated with vegetative cells. Twenty-four hours later, the medium was replaced with a medium containing 300 μg / ml G418 (GENETICIN, Sigma), and then the medium was replaced every day. After 1 week to 10 days, drug resistant colonies appear. The frequency of appearance was 0-5 per 10 ⁷ E14 cells. The colonies were picked up, proliferated, suspended in 1 ml of a 5 × 10 ⁶ preservation medium (medium for ES cells + 10% DMSO <Sigma>), and stored frozen at −80 ° C. At the same time, genomic DNA from 10 ⁶ to 10 ⁷ cells for each drug-resistant strain was
It was prepared with olation Kit (GentraSystem).

Fragmentation of human chromosome 22 was performed by irradiating microcells with gamma rays (Koi et al., Science,
260: 361, 1993). About 10 ⁸ A9 / # 22 microcells obtained from suspended in DMEM of 5 ml, the Ganmaseru 40 (manufactured by Atomic Energy of Canada Limited) was irradiated with gamma rays 60Gy on ice (1.2 Gy / min × 50 min). Microcells gamma irradiated fusion like the unirradiated microcells result of performing drug resistant strains selected, the frequency of occurrence of drug-resistant strains E14 10 ⁷ cells per
~ 7. The drug-resistant strain was cryopreserved and DNA was obtained in the same manner as in the case of non-irradiation. The non-irradiated microcell drug resistant strains E14 / # 22-9 and E14 / # 22-10 and the gamma-irradiated microcell drug resistant strains E14 / # 22-14 and E14 / # 22-25 have the following retained chromosomes (1) To (3).

(1) PCR analysis (FIG. 2) Genes present on human chromosome 22 (Genetic Maps, supra) and a polymorphic marker (Polymorphic STS Primer Pair, BIOS Inc.) using genomic DNA of the drug-resistant strain as a template: D22S31
5, D22S275, D22S278, D22S272, D22S274; Nature 359:
794, 1992) was detected by PCR. GenBank, E
The sequence of a gene primer oligonucleotide prepared based on a base sequence obtained from a database such as MBL is described.

PVALB (parvalbumin): 5'-TGGTGGCTGAAAG
CTAAGAA (SEQ ID NO: 9), 5'-CCAGAAGAATGGTGTCATTA (SEQ ID NO: 10) MB (myoglobin): 5'-TCCAGGTTCTGCAGAGCAAG (SEQ ID NO:
11), 5'-TGTAGTTGGAGGCCATGTCC (SEQ ID NO: 12) DIA1 (cytochrome b-5 reductase): 5'-CCCCACCCATGAT
CCAGTAC (SEQ ID NO: 13), 5'-GCCCTCAGAAGACGAAGCAG (SEQ ID NO: 14) Igλ (immunoglobulin lambda): 5'-GAGAGTTGCAGAAGGG
GTGACT (SEQ ID NO: 15), 5'-GGAGACCACCAAACCCTCCAAA (SEQ ID NO: 16) ARSA (arylsulfatase A): 5'-GGCTATGGGGACCTGGGCTG
(SEQ ID NO: 17), 5'-CAGAGACACAGGCACGTAGAAG (SEQ ID NO: 1
8)

Using about 0.1 μg of genomic DNA as a template,
PCR amplification (Innis et al., Supra) was performed on 0 primers. As a result, the unirradiated 2 strains were all primers,
With respect to the two strains irradiated with gamma rays, an amplification product of the expected length was detected for some primers. The above results are shown in FIG. In FIG. 2, a schematic chromosome map based on the G band image of human chromosome 22 on the left side,
For some of the markers whose positions are known, it is shown which band they are located in (O'Brien, GENETIC
MAPS, 6th edition, BOOK 5, etc.). The arrangement of the gene and polymorphism markers can be obtained from information (Scienc
e, HUMAN GENETIC MAP, 1994, Nature Genetics, 7:22,
1994, Nature 359: 794, 1992, etc.), indicating a rough positional relationship, and the order is not always accurate.
Regarding the four G418-resistant E14 cell lines, the marker where the expected amplification product was detected by PCR was indicated by ■, and the marker not detected was indicated by □. The lower side shows the observation results by FISH analysis. A9 / # 22 is a chromosome donor cell.

(2) Southern blot analysis Southern blot analysis is a human-specific repetitive sequence.
L1 sequence (10 ⁴ to 10 ⁵ copies present per haploid genome,
Obtained from RIKEN DNA Bank, Nucleic acids research, 13;
7813, 1985, about 2 μg of genomic DNA treated with a restriction enzyme (BglII, Takara Shuzo) using a 1.4 kb EcoRI-BamHI fragment derived from pUK19A as a probe <Ausubel et al., Current
Protocols in Molecular Biology, John Wiley & Son
s, Inc., 1994>. As a result, a number of bands hybridizing with the human L1 sequence were detected in each drug-resistant strain DNA. For the two unirradiated strains, the pattern and the ratio of human chromosomal DNA to mouse genomic DNA estimated from the concentration of each band were A9 / # 22.
It was equivalent to that of The overall signal intensity of the gamma-irradiated strains, when compared to A9 / # 22, correlated with the degree of deletion indicated by PCR analysis.

(3) Fluorescence In Situ Hybridization (FISH) FISH analysis was performed using the method described in Matsubara et al., FISH experimental protocol, Shujunsha,
1994) using a probe specific to human chromosome 22 (CHROMOSOME PAINTING SYSTEM, Cambio). As a result, in most of the observed division images, E14 / # 22-9 was translocated to the mouse chromosome, and the other three strains detected human chromosome 22 as an independent chromosome. By the above experiment, the obtained G418 resistant strain E14 / # 22-
9. It was confirmed that E14 / # 22-10 retained all or most of human chromosome 22, and E14 / # 22-14 and E14 / # 22-25 retained partial fragments thereof.

Example 3 ES Carrying Human Chromosome 22
Production of chimeric mice from cells
1995>. G4 obtained in (Example 2) and confirmed to retain human chromosome 22
18-resistant ES cell line E14 / # 22-9 was started from the frozen stock, and C57BL / 6 × C3H F1 female mouse (CLEA Japan) was transformed into C3H
The blastocyst stage embryos obtained by crossing with male mice (CLEA Japan) were injected at 10 to 15 embryos per embryo. Approximately 10 embryos injected with ES cells per uterus were implanted into the uterus of a foster parent ICR mouse (CLEA Japan) 2.5 days after the pseudopregnancy treatment. The results are shown in (Table 1).

[0065]

[Table 1]

As a result of transplantation of a total of 166 injected embryos, 29 offspring mice were born. The chimeric individual is determined by whether or not a light gray color derived from the E14 cell is observed in the wild color (dark brown) derived from the host embryo in the coat color. Of the 29 animals born, there is a distinctly light gray part in the coat color, that is, E14
The number of individuals that contributed to the cells was 16 animals. The highest contribution was about 40% for K22-22. From this result, mouse ES cell line E14 / # 2 carrying human chromosome 22
It was confirmed that 2-9 had the ability to form chimeras, that is, the ability to differentiate into normal tissues of mouse individuals.

Example 4 ES Carrying Human Chromosome 22
Retention of human chromosomal DNA in each tissue of the cell-derived chimeric mouse In addition to the determination based on coat color (Example 3), the retention of the introduced chromosome was confirmed by PCR using genomic DNA prepared from the tail as a template. A tail was obtained from chimeric mice over 3 weeks after birth according to the method described in <Matsuya Katsuki, Manual of Developmental Engineering Experiments, Kodansha Scientific, 1987>, and genomic DNA was obtained using Puregene DNA Isolation Kit.
Was extracted. Using this genomic DNA as a template (Example 2)
The amplification product was confirmed using PVALB and D22S278 among the polymorphic primers used in the above. Analysis was performed on 10 of the individuals contributing to coat color, and as a result, in all the individuals, an amplification product by at least one of the primers was confirmed.

The Southern analysis was performed in the same manner as in (Example 2)
Using the L1 sequence as a probe, 6 chimeric mice,
This was performed on 2 μg of tail genomic DNA of one non-chimeric mouse. As a result, the presence of a large number of human L1 sequences was observed in all chimeric individuals, and the pattern was E14 / # 2
It was similar to 2-9. The amount ratio to the mouse genome was the largest at about 10% (FIG. 3). In FIG. 3, 2 μg of genomic DNA digested with BglII was used for each lane. ^The signal was detected by an image analyzer BAS2000 (Fuji Photo Film Co., Ltd.) using the ³² P-labeled human L1 sequence as a probe. From right, chimeric mouse (K22-6,7,
8,9,10,11,12: 9 is non-chimera tail-derived genomic DNA and control DNA (C: C is E14 / # 22-9 and E14 genome
DNA mixed at a weight ratio of 1: 9).
The DNA molecular weight is shown on the left side, and the chimera rate of each chimera individual is shown on the right side (-: 0%, +: 1010%, ++: 10 to 30%).

Furthermore, for the chimeric individual (K22-7) which contributed about 5% to the coat color, the brain, liver, muscle, heart, spleen, thymus, ovary and kidney were subjected to ISOGEN (Nippon Gene).
To obtain genomic DNA, and for each tissue,
MB and DI among the gene primers used in (Example 2)
PCR analysis was performed using A1. As a result, amplification products expected in all tissues were confirmed for both primers. The results obtained with the DIA1 primer are shown in FIG. After electrophoresing the PCR product on a 2% agarose gel,
It was detected by ethidium bromide staining. In each lane of FIG. 4, B: brain, L: liver, SM: skeletal muscle, H: heart, Sp:
Spleen, Th: thymus, Ov: ovary, K: kidney, nc: non-chimeric mouse tail DNA (negative control), pc: human fibroblast (HFL-1) DNA (positive control). From these results, it was confirmed that E14 / # 22-9 contributed to various normal tissues in mouse individuals and retained human chromosome 22.

Example 5 ES Carrying Human Chromosome 22
Expression of human genes in cell-derived chimeric mice As a sample for confirming human gene expression, the tail of an individual (K22-7), whose hair color contributed about 5%, was frozen and crushed with liquid nitrogen and then crushed. Using. It is a mixture of tissues such as skin, bone, muscle, blood and the like. ISOG from this
Extract total RNA using EN (Nippon Gene) and RT-PC
By the R method, mRNA of human-myoglobin (MB) and human-cytochrome b5 reductase (DIA1) was detected. RT-PCR was performed according to the method described in <Innis et al., PCR Experiment Manual, HBJ Press, 1991>. The primer for the reverse transcription reaction was a random hexamer oligonucleotide (100 pmol final concentration, manufactured by Takara Shuzo), and the reverse transcriptase was BRL.
(Superscript) was used. Primers used for amplification using cDNA as a template are described. MB: 5'-TTAAGGGTCACCCAGAGACT (SEQ ID NO: 19), 5'-TGTAG
TTGGAGGCCATGTCC (SEQ ID NO: 20) DIA1: 5'-CAAAAAGTCCAACCCTATCA (SEQ ID NO: 21), 5'-GCC
CTCAGAAGACGAAGCAG (SEQ ID NO: 22)

As a result, amplification products specific to mRNA of both genes were detected (FIG. 5). The RT-PCR product was electrophoresed on a 2% agarose gel and then detected by ethidium bromide staining. In FIG. 5, M is a marker (HindIII digested λ DNA + HaeIII digested φX174 DNA, Takara Shuzo), MB is human myoglobin, DIA1 is human cytochrome b5 reducerase, WT
Indicates a wild type C3H mouse.

Further, the same individual (K22-7) was subjected to ISOGEN from brain, heart, thymus, liver, spleen, kidney, ovary and skeletal muscle.
Was used to extract total RNA, and RT-PCR was performed on each organ using the above two primers. As a result, expected amplification products were confirmed in DIA1 in all organs and in MB only in heart and skeletal muscle (FIG. 6). Myoglobin is known to be expressed specifically in muscle cells (Bassel-Duby et al., MCB, 12:50
24, 1992), indicating that the gene on the introduced human chromosome can be subjected to normal tissue-specific expression control in mouse individuals. The PCR product was electrophoresed on a 2% agarose gel and then detected by ethidium bromide staining. In FIG. 6, each lane is from left to right: B: brain, H: heart, Th: thymus,
L: liver, Sp: spleen, K: kidney, Ov: ovary, SM: skeletal muscle, M:
Markers (above) are shown. The lower band observed in the MB results is considered a non-specific product. That is,
It was confirmed that the introduced human chromosome 22 could function in a normal tissue of a chimeric mouse.

(Example 6) Introduction of human chromosome 4 or a partial fragment thereof into ES cells As a chromosome donor cell, the human 4 chromosome obtained in (Example 1) was used.
A mouse A9 cell line carrying chromosome 7 (hereinafter referred to as A9 / # 4) was used. Mouse ES cell line as chromosome recipient cells
E14 (same as in Example 2) was used. Microcell fusion experiments and selection of G418 resistant strains were performed as in (Example 2). The frequency of occurrence of drug-resistant strains E14 10 ⁷ cells per 1 to 2
Was individual. Cryopreservation of the drug-resistant strain and acquisition of genomic DNA were performed in the same manner as in (Example 2). Drug resistant strains E14 / # 4-4, E
The retention of human chromosome 4 or a fragment thereof in 14 / # 4-7 and E14 # 4-11 was confirmed by the following (1) to (3).

(1) PCR analysis (FIG. 7) Genes present on human chromosome 4 (O'Brien, Genetic Maps, 6th edition, B
ook 5, Cold Spring Harbor Laboratory Press, 1993)
And polymorphic markers (Polymorphic STS Primer Pair BI
OS company: D4S395, D4S412, D4S422, D4S413, D4S418, D4S42
6, F11; Nature 359: 794, 1992) was detected by PCR. The sequence of the gene primer oligonucleotide prepared based on the base sequence obtained from databases such as GenBank and EMBL is described.

HD (huntington disease): 5'-TCGTTCCTG
TCGAGGATGAA (SEQ ID NO: 23), 5'-TCACTCCGAAGCTGCCTTTC
(SEQ ID NO: 24) IL-2 (interleukin-2): 5'-ATGTACAGGATGCAACTCCTG
(SEQ ID NO: 25), 5'-TCATCTGTAAATCCAGCAGT (SEQ ID NO: 26) KIT (c-kit): 5'-GATCCCATCGCAGCTACCGC (SEQ ID NO: 2
7), 5'-TTCGCCGAGTAGTCGCACGG (SEQ ID NO: 28) FABP2 (fatty acid binding protein 2, intestina
l): 5'-GATGAACTAGTCCAGGTGAGTT (SEQ ID NO: 29), 5'-CC
TTTTGGCTTCTACTCCTTCA (SEQ ID NO: 30)

As a result of performing PCR amplification on the above 11 primers, expected amplification products were confirmed for all or some of the three primers. E14 /
Some strains, such as strains # 4-4 and E14 / # 4-7, had deletions in some regions. The results are shown in FIG. In FIG. 7, a schematic chromosome map based on the G band image of human chromosome 4 is shown on the left side, and which band is located for some markers whose positions are known (Examples). 2). The arrangement of the genes and polymorphism markers shows a rough positional relationship based on information available up to now (see Example 2), and the order is not always accurate. PCR for three G418 resistant E14 cell lines
The marker for which the expected amplification product was detected
, The undetected markers are indicated by □. On the lower side
Observation results by FISH analysis are shown. A9 / # 4 indicates a chromosome donor cell.

(2) Southern blot analysis (FIG. 8) Southern blot analysis was performed in the same manner as in (Example 2), using E14 / # 4-
4. Genomic DNA obtained from E14 / # 4-7 was probed with the human L1 sequence. As a result, a large number of bands hybridizing with the human L1 sequence were detected in both strains of DNA. Compared to A9 / # 4, the overall signal intensity correlated with the degree of deletion indicated by PCR analysis. In FIG. 8, 2 μg of genomic DNA digested with BglII was used for each lane. ^The signal was detected by an image analyzer BAS2000 (Fuji Photo Film Co., Ltd.) using the ³² P-labeled human L1 sequence as a probe. In FIG. 8, each lane is, from the left, 1: A9 / # 4 (chromosome donor cells), 2: A9 / # 4 + A9 (1:
2), 3: A9 / # 4 + A9 (1: 9), 4: A9, 5: E14 / # 4-7, 6: E14 / # 4
-4 is indicated. Nos. 2 and 3 are mixtures of two types of DNA at the ratios shown in parentheses. The left side shows the DNA molecular weight.

(3) Fluorescence In Situ Hybridization (FISH) The FISH analysis was performed in the same manner as in (Example 2), using a human chromosome 4 specific probe (CHROMOSOME PAINTING SYSTEM, Cambio).
This was performed using As a result, human chromosome 4 or a partial fragment thereof was detected in almost all division images of all three strains. E14 / # 4-4 was translocated to the mouse chromosome, and the other two strains existed as independent chromosomes. The relative size of the observed human chromosomes was consistent with that estimated from the results of the PCR analysis. The above experiments revealed that the obtained G418-resistant strain retained all of human chromosome 4 or a partial fragment thereof.

(Example 7) Preparation of chimeric mouse from ES cell holding human chromosome 4 partial fragment G418-resistant ES cell line E14 / # 4- confirmed to retain human chromosome 4 partial fragment 4. E14 / # 4-7 was started from the frozen stock, and 10 to 15 blastocyst-stage embryos obtained in the same manner as in (Example 3) were injected per embryo. 2.5 after pseudopregnancy
Approximately 10 embryos injected with ES cells per uterus were implanted into the uterus of a foster parent ICR mouse (CLEA Japan). The results are shown in (Table 2).

[0080]

[Table 2]

As a result of transplanting a total of 240 injected embryos, 13 offspring mice were born. The chimeric individual is determined by whether or not a light gray color derived from the E14 cell is observed in the wild color (dark brown) derived from the host embryo in the coat color. Of the 13 animals born, there is a clearly light gray part in the coat color, that is, E14
Seven individuals contributed the cells. The highest contribution rate was about 15% in one individual derived from E14 / # 4-7. From these results, mouse ES cell lines E14 / # 4-4 and E14 / # 4-7, which retain human chromosome 4 partial fragment, retain chimera-forming ability, that is, ability to differentiate into normal tissues of mouse individuals. It was confirmed that it was holding.

Example 8 Human Chromosome DNA in Chimeric Mice Derived from ES Cells Containing a Partial Fragment of Human Chromosome 4
(1) Among chimeric mice obtained by PCR analysis (Example 7), one individual derived from E14 / # 4-7 (K # 4-7-1: chimera rate: approx. 5%) and one individual derived from E14 / # 4-4 (K # 4-4-41: chimera rate: about 5%), genomic DNA was prepared from the tail in the same manner as in (Example 4). Using that as a template, PCR analysis was performed on the polymorphic marker F11 detected at E14 / # 4-7 and E14 / # 4-4 among the primers for chromosome 4 analysis shown in (Example 6). As a result, expected amplification products were detected in both individuals.

(2) Southern analysis (FIG. 9) Southern analysis was performed on one E14 / # 4-7-derived individual (K # 4-7-1: chimera rate about 5%), as in (Example 2). Using the human L1 sequence as a probe, 2 μg of tail-derived genomic DNA was used. As a result, the existence of a large number of human L1 sequences was confirmed, and the pattern was similar to E14 / # 4-7. The ratio to the mouse genome was about 10% of E14 / # 4-7. In FIG. 9, 2 μg of tail-derived genomic DNA digested with BglII was used for each lane. Human L1 sequence labeled with ³² P as a probe, the signal image analyzer BAS2000
(Fuji Photo Film Co., Ltd.). The left side shows the DNA molecular weight. Each lane shows from the left 1: K # 4-7-1, 2: blank, 3: E14 / # 4-7.

(3) G418 resistance test of tail-derived fibroblasts Among chimeric mice, one individual derived from E14 / # 4-7 (K # 4-7-
1: chimera rate about 5%), one individual derived from E14 / # 4-4 (K # 4-4-4)
1: a chimera rate of about 5%), fibroblasts were prepared from the tail as follows. Similar to DNA preparation (Example 4), the tail of the chimeric mouse was cut by 5 mm to 10 mm, washed several times with PBS / 1 mM EDTA, cut with a scalpel to remove the epidermis,
Finely chop the internal tissue with a scalpel. Tissue strips 5 ml P
Transfer the BS / 1mM EDTA to the tube and leave it at room temperature for 30 minutes to 1 hour. Thereafter, the supernatant is removed leaving 1 ml of PBS / EDTA, 1 ml of 0.25% trypsin / PBS is added, and the tissue is sufficiently loosened while tapping or pipetting at room temperature for 5 to 10 minutes. Centrifuge at 1000 rpm for 10 minutes.
Suspend in M (10% FCS) and inoculate on a 35 mm Petri dish. 7-1
After the culture on day 0, the cells were detached from the dish by trypsin treatment, and about 10 ⁴ cells per seed were seeded on two 35 mm dishes, and G418 having a final concentration of 400 μg / ml was added to one of them, and the cells were incubated for 5 to 7 days. Culture and observe the live cells in each dish. Under these conditions, fibroblasts derived from wild-type ICR mice die almost 100% in the presence of G418. As a result,
The presence of G418 resistant fibroblasts was observed in both individuals. From these results, it was confirmed that E14 / # 4-7 and E14 / # 4-4 contributed to various normal tissues in mouse individuals and retained human chromosome 4 partial fragments.

(Example 9) Introduction of human chromosome 14 or a fragment thereof into mouse ES cells Human chromosome 14 obtained in (Example 1) was used as a chromosome donor cell.
A mouse A9 cell line carrying chromosome 7 (hereinafter referred to as A9 / # 14) was used. Mouse ES cell line as chromosome recipient cells
TT2 (purchased from Lifetech Oriental, Yagi et al., An
alytical Biochem., 214: 70, 1993). The culture method of TT2 was according to the method described in <Shinichi Aizawa, Bio Manual Series 8, Gene Targeting, Yodosha, 1995>, and the vegetative cells were G41 treated with mitomycin C (Sigma).
8 resistant primary cultured cells (purchased from Lifetech Oriental) were used. Microcell fusion experiments and selection of G418 resistant strains were performed in the same manner as in (Example 2). The frequency of occurrence of drug-resistant strain was 3-6 per 10 ⁷ TT2 cells. Cryopreservation of the drug-resistant strain and acquisition of genomic DNA were performed in the same manner as in (Example 2).

Fragmentation of human chromosome 14 was performed by irradiating the microcells with gamma rays (Koi et al., Science,
260: 361, 1993). About 10 ⁸ A9 / # 14 microcells obtained from suspended in DMEM of 5 ml, the Ganmaseru 40 (above), was irradiated with gamma rays 30Gy on ice (1.2 Gy / min × 25
Minutes). Gamma irradiated microcells unirradiated microcell as well as fusion, result of performing drug resistant strains selected, the frequency of occurrence of drug-resistant strains was 3 per 10 ⁷ TT2 cells. The drug-resistant strain was cryopreserved and DNA was obtained in the same manner as in (Example 2). The retention of human chromosome 14 or partial fragment in G418-resistant strains 1-4 and 1-5 by transfer of non-gamma-irradiated microcells, and G418-resistant strains 3-1 and 3-2 by transfer of gamma-ray (30 Gy) -irradiated microcells is as follows: (1),
Confirmed by (2).

(1) PCR analysis (FIG. 10) Genes present on human chromosome 14 (O'Brien, Genetic Maps, 6th edition,
Book 5, Cold Spring Harbor Laboratory Press, 1993
) And polymorphic markers (Polymorphic STS Primer Pair)
BIOS: D14S43, D14S51, D14S62, D14S65, D14S66, D
14S67, D14S72, D14S75, D14S78, D14S81, PCI; Nature
359: 794, 1992; Nature Genetics, 7:22, 1994) was detected by PCR. The sequence of the gene primer oligonucleotide prepared based on the base sequence obtained from databases such as GenBank and EMBL is described.

NP (nucleoside phosphorylase): 5'-ATA
GAGGGTACCCACTCTGG (SEQ ID NO: 31), 5'-AACCAGGTAGGTTGAT
ATGG (SEQ ID NO: 32) TCRA (T-cell receptor alpha): 5'-AAGTTCCTGTGATGTC
AAGC (SEQ ID NO: 33), 5'-TCATGAGCAGATTAAACCCG (SEQ ID NO: 34) MYH6 (myosin heavy chain cardiac): 5'-TGTGAAGGAGG
ACCAGGTGT (SEQ ID NO: 35), 5'-TGTAGGGGTTGACAGTGACA
(SEQ ID NO: 36) IGA2 (immunoglobulin alpha-2 constant): 5'-CTGAGA
GATGCCTCTGGTGC (SEQ ID NO: 37), 5'-GGCGGTTAGTGGGGTCTT
CA (SEQ ID NO: 38) IGG1 (immunoglobulin gamma-1 constant): 5'-GGTGTC
GTGGAACTCAGGCG (SEQ ID NO: 39), 5'-CTGGTGCAGGACGGTGAG
GA (SEQ ID NO: 40) IGM (immunoglobulin mu constant): 5'-GCATCCTGACCG
TGTCCGAA (SEQ ID NO: 41), 5'-GGGTCAGTAGCAGGTGCCAG (SEQ ID NO: 42) IGVH3 (immunoglobulin heavy variable-3): 5'-AGTG
AGATAAGCAGTGGATG (SEQ ID NO: 43), 5'-GTTGTGCTACTCCCAT
CACT (SEQ ID NO: 44)

Using the genomic DNAs of the four drug-resistant strains as templates, PCR amplification was carried out in the same manner on the above 18 primers (Example 2). confirmed. Drug resistant strains obtained using gamma-irradiated microcells
1 and 3-2 tended to have a partial deletion of chromosome 14. Also, even when using an unirradiated microcell
Some strains, such as strains 1-4, were deleted. The above results are shown in FIG. In FIG. 10, a schematic chromosome map based on the G band image of human chromosome 14 on the left side,
For some of the markers whose positions are known, which band is located is shown (see Example 2).
The arrangement of the genes and polymorphism markers indicates a rough positional relationship based on information available up to now (see Example 2), and the order is not always accurate. Four kinds
Regarding the G418-resistant TT2 cell line, the marker where the expected amplification product was detected by PCR was indicated by ■, and the marker that was not detected was indicated by □. A9 / # 14 is a chromosome donor cell. The right end shows the result of Example 11 (1).

(2) Fluorescence In Situ Hybridization (FISH) FISH analysis was performed using the method described in Matsubara et al.
1994), using a human chromosome 14-specific probe (CHROMOSOME PAINTING SYSTEM, Cambio). As a result, human chromosome 14 or a partial fragment thereof was found in most mitotic images of all four strains.
Observed as independent chromosomes. The relative size of the observed human chromosomes was consistent with that estimated from the results of the PCR analysis. G418 obtained by the above experiment
It was confirmed that the resistant strains 1-4, 1-5, 3-1 and 3-2 retain all of human chromosome 14 or a partial fragment thereof.

(Example 10) Production of chimeric mouse from ES cells carrying human chromosome 14 fragment G418-resistant ES cells obtained by (Example 9) and confirmed to carry human chromosome 14 4 shares (1-4,3-1,3-
2, 1-5) from frozen stock, ICR or MC
8 to 10 embryos obtained at the 8-cell stage obtained by mating H (ICR) (CLEA Japan) male and female mice were injected per embryo. After culturing overnight in an ES medium (Example 9) to generate blastocysts, the uterus of a foster parent ICR mouse (CLEA Japan) 2.5 days after pseudopregnancy was treated with about 10 injected embryos per uterus on one side. Was transplanted. The results are shown in (Table 3).

[0092]

[Table 3]

As a result of transplanting a total of 494 injected embryos, 64 offspring mice were born. The chimeric individual is determined based on whether a wild color (dark brown) derived from TT2 cells is observed in white from the host embryo (ICR) in coat color. was born
Eight of the 64 animals had a wild color part in coat color, that is, ES cells contributed. The highest contribution rate was about 80% in one individual from 1-4. From these results, the G418-resistant ES cell lines (1-4, 1-5, 3-1 and 3-2) retaining human chromosome 14 or a fragment thereof retain chimera-forming ability; It was confirmed that the cells had the ability to differentiate into normal tissues.

Example 11 Confirmation of Retention of Human Chromosome 14 Fragment in ES Cell-Derived Chimeric Mouse Retaining Human Chromosome 14 Retention of Human Chromosome 14 Partial Fragment in Chimeric Mouse Obtained in Example 10 Was confirmed by the following (1) to (3). (1) PCR analysis using DNA derived from various tissues One of the chimeric mice derived from 3-1 (K3-1-1: chimera rate: about 25%) was genomic from the tail as in (Example 4).
DNA was prepared. Using it as a template, one of the primers for chromosome 14 analysis shown in (Example 9) detected in 3-1
PCR analysis was performed for all four species. As a result, expected amplification products were detected for all 14 species (No. 10).
Figure).

Further, for the same individual (K3-1-1), the brain,
Puregene DNA Isola from kidney, spleen, heart, liver, thymus
Genomic DNA was obtained with the Action Kit, and PCR analysis was performed on each tissue using IGM primers (Example 9). As a result, expected amplification products were confirmed in all tissues (FIG. 11). The PCR product was electrophoresed on a 2% agarose gel and then detected by ethidium bromide staining. In FIG. 11, each lane is from left to right: B: brain, K: kidney, Sp: spleen, H: heart, L: liver, Th: thymus, pc: human fibroblast (HFL-1) DNA (positive control) , Nc: Non-chimeric mouse tail DNA (negative control), M: Marker (HindIII digested λ DNA + HaeIII digested φX174 DNA, Takara Shuzo)
Is shown.

(2) G418 resistance test of tail-derived fibroblasts Among chimeric mice, two individuals derived from 3-2 (K3-2-1: chimera rate about 25%, K3-2-3: chimera rate about 50) %), 1 individual from 1-4 (K
1-4-1: chimera rate of about 80%), fibroblasts were prepared from the tail as follows. 3 as in DNA preparation (Example 4)
~ 6 weeks old chimera mouse tail cut 5mm ~ 10mm, PBS /
After washing several times with 1mM EDTA, a cut is made with a scalpel to remove the epidermis, and the internal tissue is finely minced with a scalpel. Transfer the tissue debris to a tube containing 5 ml PBS / 1 mM EDTA,
Leave at room temperature for 1 minute to 1 hour. Thereafter, the supernatant is removed leaving 1 ml of PBS / EDTA, 1 ml of 0.25% trypsin / PBS is added, and the tissue is loosened while tapping or pipetting at room temperature for 5 to 10 minutes. Centrifuge at 1000 rpm for 10 minutes,
The precipitate is suspended in 2 ml of DMEM (10% FCS) and seeded on a 35 mm petri dish. After culturing for 7 to 10 days, the cells are detached from the Petri dish by trypsin treatment, and about 10 ⁴ cells are seeded per Petri dish on four 35 mm Petri dishes.
G418 is added and cultured for 5 to 7 days, and the number of viable cells in each petri dish is counted. Under these conditions, fibroblasts derived from wild-type ICR mice die almost 100% in the presence of G418.
The ratio of the number of viable cells in the selection medium to the number of viable cells in the non-selection medium is the same as in the G418-resistant ES cell line-derived fibroblasts, assuming that the growth rate of G418-resistant fibroblasts is equivalent under the two conditions. Is considered to reflect the contribution rate of the fibroblast population. As a result, as shown in FIG.
The presence of G418-resistant fibroblasts was observed in all individuals. First
In FIG. 2, the resistance rate was obtained by averaging the values obtained from two sets of selected / unselected 35 mm dishes for each individual.
ICR indicates wild type ICR mouse.

(3) FISH of G418-resistant fibroblasts derived from the tail
Analysis The G418 obtained in (2) above was obtained in the same manner as in (Example 2).
FISH analysis of resistant fibroblasts (derived from K3-2-3, K1-4-1) was performed. The probe used was a human whole DNA extracted from HFL-1 cells (Example 1) labeled with FITC (Matsubara et al., FISH experimental protocol, Shujunsha, 1994). As a result, in each of the two individuals, a human-stained partial fragment independent of most of the division images was observed. From these results, it was confirmed that the TT2 cell line retaining the human chromosome 14 partial fragment contributed to various normal tissues in a mouse individual and retained the human chromosome 14 partial fragment.

Example 12 ES of Human Chromosome 2 Partial Fragment
Introduction into cells As a chromosome donor cell, human 2 obtained in (Example 1) was used.
Mouse A9 cell W23 (hereinafter A9 /
# 2 W23). The mouse ES cell line TT2 (Example 9) was used as a chromosome recipient cell. Microcell fusion experiments and selection of G418 resistant strains were performed as in (Example 2). Frequency of drug-resistant strain was 1-3 per 10 ⁷ TT2 cells. Cryopreservation of drug resistant strains, genomic DN
A acquisition was performed in the same manner as in (Example 2). Drug resistant strain 5-
The retention of the human chromosome 2 partial fragment in 1, 5-2, and 5-3 was confirmed by the following (1) and (2).

(1) PCR analysis Among the genes (Genetic Maps, supra) present on human chromosome 2 using the genomic DNA of the drug-resistant strain as a template, Cκ and FABP1 detected in chromosome donor cell A9 / # 2 W23 The presence was detected by PCR. As a result of PCR amplification of each primer, expected amplification products of both primers were confirmed in all three strains.

(2) Fluorescence In Situ Hybridization (FISH) FISH analysis was performed in the same manner as in (Example 2), using a human chromosome 2 specific probe (CHROMOSOME PAINTING SYSTEM, Camb.
io). As a result, human chromosome 2 partial fragments were detected as independent chromosomes in almost all division images of all three strains. Its size is A9 / # 2 W23
Was equivalent to that observed in. By the above experiment,
It was confirmed that the obtained G418-resistant strain retained a human chromosome 2 partial fragment.

Example 13 Production of Chimeric Mice from ES Cells Retaining Human Chromosome 2 Fragment G418 Resistance Obtained from Example 12 and Confirmed to Retain Human Chromosome 2 Partial Fragment The ES cell line 5-1 was started from a frozen stock, and 10 to 12 embryos per embryo were injected into an 8-cell stage embryo obtained by mating male and female mice with ICR or MCH (ICR) (CLEA Japan). After culturing overnight in an ES medium (Example 9) to generate blastocysts, the uterus of a foster parent ICR mouse (CLEA Japan) 2.5 days after pseudopregnancy was treated with about 10 injected embryos per uterus on one side. Was transplanted. The results of chimera production are shown in (Table 4).

[0102]

[Table 4]

As a result of transplanting a total of 264 injected embryos, 51 offspring mice were born. The chimeric individual is determined based on whether a wild color (dark brown) derived from TT2 cells is observed in white from the host embryo (ICR) in coat color. was born
Out of the 51 animals, 18 had an apparent wild-colored portion of the coat color, that is, ES cells contributed. The highest contribution was about 80%. These results indicate that G418-resistant ES cells (5-
It was confirmed that 1) retains the ability to form a chimera, that is, retains the ability to differentiate into a normal tissue of a mouse individual.

(Example 14) Detection of human antibody heavy chain in serum of a chimeric mouse into which a human chromosome 14 fragment was introduced The concentration of human antibody in the serum was measured using an enzyme-linked immunosorbent assay (ELISA). ELISA followed the method described below. Toyama and Ando, Monoclonal Antibody Experiment Manual, Kodansha, 1987; Ando and Chiba,
Introduction to Monoclonal Antibody Experimental Procedures, Kodansha, 1991; Ishikawa, Ultrasensitive Enzyme-Linked Immunosorbent Assay, Academic Publishing Center, 1993; Ed
Harlow and David Lane, Antibodies A Laboratory Man
ual, Cold Spring Harbor Laboratory, 1988; A. Doyle
and JB Griffiths, Cell & Tissue Culture: Labora
tory Procedures, John Wiley & Sons Ltd., 1996. With reference to the methods described in these documents, improvements such as performing the reaction time and temperature overnight at 4 ° C. were made depending on the measurement system. The antibody or antigen against the human immunoglobulin to be measured is reduced to about 0.5 to 10 μg / ml (100 to 5000
And the ELISA plate was coated overnight at 4 ° C. Serum samples were measured using PBS supplemented with 5% mouse serum (Sigma, M5905) for dilution of blocking, sample and labeled antibodies, and PBS supplemented with 1% fetal bovine serum was used to measure hybridoma culture supernatants. . When diluting the chimeric mouse serum 20-fold, the dilution was performed using PBS. After washing the coated plate, blocking was performed for 1 hour or more. After washing the plate, the sample was added and incubated for 30 minutes or more. After washing the plate, add enzyme-labeled anti-human immunoglobulin antibody diluted 100 to 5000 times,
After incubating for 1 hour or more, the plate was washed and a substrate solution was added to develop color. In addition, depending on the measurement system, the biotin-labeled antibody was used in basically the same manner as described above. After washing the plate, adding an avidin-enzyme complex thereto, incubating the plate, washing the plate, and adding a substrate solution. The absorbance was measured using a microplate reader (Biotech, EL312e).

Chimeric mice 29 to 35 days after birth (Example
10, blood was collected from K3-1-2, K3-2-2, K3-2-3) and analyzed by ELISA. Anti-human IgM mouse monoclonal antibody (Sigma, I638) diluted in 50 mM carbonate-bicarbonate buffer pH 9.6
5) was coated on a 96-well microtiter plate, and a serum sample diluted with PBS supplemented with mouse serum (Sigma, M5905) was added. Then, after adding a peroxidase-labeled anti-human IgM goat antibody (Tago, 2392) and incubating, an ABTS substrate (Kirkegaard & Perry Laboratories In
c., 506200), the enzyme activity was evaluated by the absorbance at 405 nm. Purified human IgM antibody (Organon Technica, 6001-1590) or human IgG antibody (Sigma, I450
6) was set as standard. Standards were serially diluted in PBS supplemented with mouse serum. For human IgG measurement, an anti-human IgG goat antibody (Sigma, I3382) was immobilized on a plate and detected with a peroxidase-labeled anti-human IgG goat antibody (Sigma, A0170). The results are shown in (Table 5). Both human IgM and IgG were detected.

A chimeric mouse carrying a human chromosome 14 fragment three times on days 27, 34, and 41 (Example 1)
0, K3-1-1, K3-2-1), 2 ml of human serum albumin (HSA, Sigma, A3782) dissolved in PBS was adjuvanted (MPL + TDM).
Emulsion, RIBI ImmunochemReseach Inc.) and immunized 0.25 mg / ml with 0.2 ml. This chimeric mouse serum was also analyzed by ELISA. The result is
(Fig. 14, Fig. 14). The results show that the concentration of human antibodies in the serum of chimeric mice immunized with HSA increased after immunization,
In humans, 18 μg / ml of human IgM and 2.6 μg / ml of IgG were detected in serum 17 days after immunization. The titer of the human antibody was not significant in the serum of the mouse into which the human chromosome had not been introduced.

[0107]

[Table 5]

(Example 15) Obtaining a human antibody heavy chain-producing hybridoma from a human chromosome 14-introduced chimeric mouse (Example 14) On day 44, the spleen was removed, and fused with myeloma cells to prepare a hybridoma. Hybridoma production method is described in Ando, Introduction to Monoclonal Antibody Experimental Procedures, Kodansha Scientific, 19
According to the method described in <91>, myeloma cells
P53X63-Ag.8.653 (purchased from Dainippon Pharmaceutical, 05-565) was used. The cells were spread on 10 96-well plates, cultured for one week, and the culture supernatant was analyzed by ELISA. The ELISA method was carried out in the same manner as in Example 14 by immobilizing an anti-human IgM mouse monoclonal antibody (Sigma, I6385) on a plate.
I got one. Using HSA as an antigen, a solution having a concentration of 5 μg / ml was prepared in a 50 mM carbonate-bicarbonate buffer at pH 9.6, and 100 μl was dispensed into all wells of an ELISA plate. Anti-human IgA + IgG + IgM goat antibody labeled with peroxidase (Kirkegaard & Pe
rry Laboratories Inc., 04-10-17). One positive clone was confirmed in 10 plates. This clone was one of the six human IgM positive clones. This clone (H4B7) was further cultured, the culture supernatant was diluted, and EL was obtained using a peroxidase-labeled anti-human IgM goat antibody (Tago, 2392) using HSA as an antigen as described above.
When ISA was performed, a decrease in absorbance was observed with an increase in the dilution rate of the culture supernatant. On the other hand, human IgM (Organon Technica, 6001-1590) was added at 2 μg / ml depending on the culture medium.
Absorbance was low in the sample diluted at 1 irrespective of the dilution ratio.
This suggests that the antibody produced by the hybridoma H4B7 is an antibody specific for HSA (No. 15).
Figure). In FIG. 15, the horizontal axis shows the dilution rate of the culture supernatant sample, and the vertical axis shows the absorbance at 405 nm.

(Example 16) Remarking of G418-resistant human chromosome 2 fragment by puromycin resistance A9 carrying a G418-resistant human chromosome 2 fragment
Cells (W23) (see Example 1 and FIG. 1) were treated in a 100 mm Petri dish.
The cells were cultured in a selection medium (10% FBS, DMEM) containing G418 (800 μg / ml). The plasmid pPGKPuro (purchased from WHITEHEAD INSTITUTE, Dr. Peter W. Laird) containing the puromycin resistance gene was linearized with a restriction enzyme SalI (Takara Shuzo) before transfection. Cells are trypsinized and 5x10 ⁶
Dulbecco's phosphate buffer (PB
After suspension in S), electroporation (see Example 1) was performed using Gene Pulser (Bio-Rad) in the presence of 10 μg DNA. A voltage of 1000 V with a capacity of 25 μF was applied at room temperature using a 4 mm-long electroporation cell (Example 1). Electroporated cells were seeded on 3 to 6 100 mm dishes. 10 μg / m after 1 day
l puromycin (Sigma, P-7255) and G418 (80
0 μg / ml). About 200 colonies formed after 2 to 3 weeks were collected as one group. The cells were cultured for each of the three populations in two to three 25 cm ² flasks to form microcells and to form 25 cm ²
It was fused with mouse A9 cells cultured in a flask in the same manner as in Example 1. The cells were transferred to two 100 mm dishes and cultured in the above double selection medium containing G418 and puromycin, and two double drug resistant clones were obtained from one of the three populations. In this clone, it is highly possible that a puromycin resistance marker was introduced into the human chromosome 2 fragment.

(Example 17) Introduced human chromosome doubling in human chromosome-introduced ES cells An ES cell line (E14 / # 14-36) carrying a human chromosome 14 fragment marked with a G418 resistance gene was isolated at a high concentration of G418. By culturing the cells in a medium supplemented with Escherichia coli, ES cell clones in which the human chromosome was doubled were obtained (Bio Manual Series 8, Gene Targeting, Yodosha, 1995). G
Primary cells of 418-resistant mice (purchased from Lifetech Oriental) were seeded in 100 mm dishes without mitomycin treatment and used as vegetative cells. E14 for this 100mm petri dish
/ # 14-36, and half a day later, the medium was replaced with a medium having a G418 concentration of 16 mg / ml. The medium was changed every 1-2 days, and after one week, the G418 concentration was adjusted to 1
The culture was continued at 0 mg / ml, and 15
Individuals were taken out and cultured, and the chromosome was analyzed by FISH using a human No. 14-specific probe (see Example 9). As a result 8
The human chromosome 14 fragment was doubled in the clone.

(Example 18) Human chromosome 2 partial fragment and 1
Obtaining a mouse ES cell line simultaneously retaining a partial chromosome 4 fragment Among the double drug resistant clones obtained in (Example 16), PG1 was used as a microcell donor cell, and a microcell transfer experiment using wild type A9 cells as a recipient cell, It was confirmed that the partial fragment of human chromosome 2 carried by PG1 was further marked with a puromycin resistance gene. Microcell acquisition and fusion with A9 cells were performed in the same manner as in (Example 1). As a result, a total of 59
G418 resistant colonies appeared. After replacing these colonies with a medium containing 8 μg / ml of puromycin, the culture was further performed for 3 days. As a result, 45 (76%) colonies survived. In the microcell method, one recipient cell
In many cases, only one or a small number of chromosomes are transferred.
This shows that the chromosome partial fragment is marked by the puromycin resistance gene. In addition, human
For detection of each marker gene on the chromosome 2 partial fragment, A
PSTneo for 9 / # 2 W23 (G418 resistance only: Example 16)
B (Example 1) and PG1 were subjected to FISH analysis using pPGKPuro (Example 16) as a probe (Matsubara et al., FISH experimental protocol, Shujunsha, 1994). As a result, A9 / # 2 W23
In each, two signals were observed, one on each sister chromatid of the human chromosome 2 partial fragment identified in (Example 12). This is the 1 on human chromosome 2 partial fragment.
Indicates that pSTneoB is inserted at the location. Also, PG1
In total, four signals were observed on chromosome fragments of the same size. Since pSTneoB and pPGKPuro have homologous sequences in the vector portion, pSTneoB is also detected by the pPGKPuro probe. That is, of the four signals observed in PG1, two are considered to be pSTneoB and one of the two signals is derived from pPGKPuro. From these results, human 2 retained by PG1
It was confirmed that the partial chromosome fragment was marked by both G418 resistance and puromycin resistance.

This PG1 cell line was used as a chromosome donor cell in order to obtain mouse ES cells that simultaneously retain the human chromosome 2 partial fragment and the chromosome 14 partial fragment. As a chromosome recipient cell, a G418-resistant TT2 cell line 1-4 (Example 9), which already contains a partial fragment of human chromosome 14, was used. Microcell fusion experiments and selection of puromycin resistant strains were 0.
Other than that of Example 9 at a puromycin concentration of 75 μg / ml
The procedure was the same as in the case of selection of 418 resistant strains. The frequency of appearance of puromycin-resistant strains as a result was 3 to ⁷ per 107 cells of 1-4 cells. Since these puromycin-resistant strains grow even in the presence of 300 μg / ml G418, G418
It was confirmed that resistance was maintained at the same time. Cryopreservation and genomic DNA acquisition of the double drug resistant strain were performed in the same manner as in (Example 2). Retention of human chromosome 2 partial fragment and human chromosome 14 partial fragment are double drug resistant strains PG5, PG15, PG16
Was confirmed by (1) below, and PG15 was further confirmed by (2).

(1) PCR Analysis Of the genes (Genetic Maps, supra) present on human chromosome 2 and 14 using the double drug resistant strain genomic DNA as a template, chromosome 2 was obtained (Example 12; A9 / # 2 W23), 14
As for the chromosome No. (Example 9; TT2 / # 14 1-4), PCR amplification was performed for each of the primers whose presence was confirmed. As a result, expected amplification products were confirmed for all the primers in all three strains. Was.

(2) Fluorescence In Situ Hybridization (FISH) FISH analysis was performed using, as in (Example 11), whole human DNA labeled with FITC as a probe. As a result, two large and small human chromosome fragments were confirmed in most of the division images. The larger one (Example 9; TT2 / # 14 1-
The partial fragment identified by the human chromosome 14-specific probe in 4) and the smaller fragment (Example 12; TT2 / # 25-1) equivalent to the partial fragment identified by the human chromosome 2-specific probe It was the size. (Figure 16) shows the results. In the figure, the chromosome with low brightness is derived from a mouse, and the two large and small chromosome fragments (indicated by arrows) whose brightness is high due to the fluorescence of FITC are derived from humans.
It is considered to be a partial chromosome fragment. By the above experiment, the obtained double resistant ES cell line was a partial fragment of human chromosome 2, 14
It was confirmed that a partial fragment of chromosome number was retained at the same time.

(Example 19) Human chromosome 2 partial fragment and 1
A chimeric mouse was prepared from a mouse ES cell line simultaneously retaining a partial chromosome 4 fragment (Example 18).
G41 confirmed to retain a partial chromosome fragment
8, puromycin double resistant TT2 cell lines PG5, PG15, PG1
Launch 6 from frozen stock, ICR or MCH (ICR)
(Clea Japan) 10-12 embryos per embryo were injected into 8-cell stage embryos obtained by mating male and female mice. After culturing overnight in an ES cell culture medium (Example 9) to generate blastocysts, the uterus of a foster parent ICR mouse (CLEA Japan) 2.5 days after pseudopregnancy was treated with about 10 cells per uterus Injected embryos were implanted. The results of chimera production are shown in (Table 6).

[0116]

[Table 6]

As a result of transplanting a total of 551 injected embryos, 73 offspring mice were born. The chimeric individual is determined based on whether a wild color (dark brown) derived from TT2 cells is observed in white from the host embryo (ICR) in coat color. was born
Out of the 73 animals, 23 had an apparent wild color part in the coat color, that is, the contribution of ES cells was observed. These results indicate that the ES cell lines (PG5, PG15, PG16) that retain the human chromosome 2 partial fragment and the chromosome 14 partial fragment retain chimera-forming ability; It was confirmed that it was retained.

(Example 20) Human chromosome 2 partial fragment and 1
Detection of Human Antibody in Serum of ES Cell-Derived Chimeric Mouse Simultaneously Retaining Chromosome 4 Partial Fragment Among the chimeric mice prepared in (Example 19), KPG-15
(9 weeks old; derived from PG5, chimera rate 10%), KPG-18 (5 weeks old; PG
Human serum albumin (HSA, Sigma, A3782) dissolved in PBS and adjuvant (MPL + TDM Emulsion, RIBI Immunochem Reseach In
c.) to prepare a 0.25 mg / ml HSA solution to immunize 0.2 ml. Blood was collected from chimeric mice immediately before and 8 days after immunization, and human antibody μ chain and human antibody κ chain in serum were analyzed by ELIS.
It was detected using Method A (see Example 14). Anti-human goat antibody (VECTOR LABORATORIES, INC., AI-3060) diluted with 50 mM carbonate-bicarbonate buffer pH 9.6 was coated on a 96-well microtiter plate, and a serum sample was added. Human antibody κ chain goat antibody (VE
CTOR LABORATORIES, INC., BA-3060), incubate and add a complex of biotinylated horseradish peroxidase and avidin DH (VECTOR LABORATORIES, INC., Vectas)
After adding and incubating tain ABC kit PK4000), enzyme activity is evaluated by absorbance at 450 nm by adding 3,3 ', 5,5'-tetramethylbenzidine (TMBZ, Sumitomo Bakelite, ML-1120T) as a peroxidase substrate. did. Known concentration of human IgG with purified kappa chain (Sigma, I-388
Using 9) as a standard, serial dilution was performed with PBS supplemented with mouse serum. 50 μm carbonate-bicarbonate buffer for μ-chain
An anti-human μ-chain mouse monoclonal antibody (Sigma, I-6385) diluted at pH 9.6 was coated on a 96-well microtiter plate, a serum sample was added, and a peroxidase-labeled anti-human μ-chain mouse antibody (The Binding Site Lim
ited, MP008) and incubate before adding TMBZ
(Sumitomo Bakelite, ML-1120T) was added to evaluate the enzyme activity by absorbance at 450 nm. Known concentration of human IgM with purified μ chain (Organon Technica, 6001-1590)
With mouse serum (Sigma, M5905) as standard
Was diluted step by step. As a result, both the human antibody μ chain and κ chain were detected before immunization in both individuals, and their serum concentrations increased after immunization (Tables 7 and 8).

[0119]

[Table 7]

[0120]

[Table 8]

From these results, it was confirmed that the human antibody heavy chain and light chain genes function in the ES cell-derived chimeric mouse having the human chromosome 2 partial fragment and the chromosome 14 partial fragment.

(Example 21) Detection of anti-HSA human antibody γ-chain in serum of a chimeric mouse into which a human chromosome 14 fragment had been introduced A chimeric mouse (K9, K11; both TT2 cell line 3-2
Origin and chimera rate are 50% and 30%, respectively)
4 times a day, 93 days, 107 days, 133 days (K9) or 74
HSA was immunized three times on day 88, day 111 (K11) as in Example 20. An antibody containing human γ-chain to human serum albumin in the serum of the chimeric mouse was detected by ELISA (see Example 14). HSA diluted with 50 mM carbonate-bicarbonate buffer pH 9.6 (Sigma, A 3782)
Was coated on a 96-well microtiter plate, a sample was added, and then a peroxidase-labeled anti-human IgG mouse antibody (Pharmingen, 08007E) was added and incubated. Then, O-phenylenediamine (OPD, Sumitomo Bakelite, ML -1130O) was added to evaluate the enzyme activity by absorbance at 490 nm. The titer of anti-HSA human IgG in the serum of chimeric mice immunized with HSA increased after immunization. In control ICR mice, anti-HSA after HSA immunization
Human IgG titers were at background levels. The results are shown in (FIG. 17). In FIG. 17, the horizontal axis shows the number of days after immunization of the chimeric mouse with HSA, and the vertical axis shows the absorbance at 490 nm. From these results, it was confirmed that in a chimeric mouse having a human chromosome 14 partial fragment, an antibody titer of antigen-specific human IgG occurs in response to HSA antigen stimulation.

(Example 22) Detection of human antibody λ chain in serum of a chimeric mouse into which a human chromosome 22 fragment had been introduced A 9-month-old chimeric mouse (Example 3, K22-7; chimera rate 10
%), And the human antibody λ chain in the serum was detected by ELISA (see Example 14). Anti-human antibody λ chain goat antibody diluted with 50 mM carbonate-bicarbonate buffer pH 9.6 (VEC
TOR LABORATORIES, INC., AI-3070) is coated on a 96-well microtiter plate, a serum sample is added, and then a biotin-labeled anti-human antibody λ chain goat antibody (VECTOR LABOR)
ATORIES, INC., BA-3070), incubate and add a complex of biotinylated horseradish peroxidase and avidin DH (VECTOR LABORATORIES, INC., Vectastain ABC)
After adding and incubating kit PK4000, TMBZ (Sumitomo Bakelite, ML-112) is used as a peroxidase substrate.
The enzyme activity was evaluated by the addition of 0T) by the absorbance at 450 nm. A human IgG (Sigma, I-4014) having a purified λ chain and a known concentration was used as a standard, and serially diluted with PBS supplemented with mouse serum. A human antibody λ chain at a concentration corresponding to 180 ng / ml human IgG was detected in the chimeric mouse. From these results, it was confirmed that the human antibody λ chain gene functions in the chimeric mouse having human chromosome 22.

(Example 23) Detection of human antibody kappa chain in serum of a chimeric mouse into which a human chromosome 2 fragment was introduced A 5-week-old chimeric mouse (Example 13, K2-8, chimera rate: 70%)
%) And 9-week-old chimeric mice (Example 13, K2-3, K2-
4, K2-12, and chimera rates were 50%, 20%, and 80%, respectively), and human antibody kappa chain in serum was detected by ELISA (Example 14). 50 mM carbonate-bicarbonate buffer pH 9.6
Human antibody κ chain goat antibody diluted with VECTOR LABORATOR
IES, INC., AI-3060) on a 96-well microtiter plate, add serum sample, and then biotin-labeled anti-human antibody κ chain goat antibody (VECTOR LABORATORIESIES, INC.)
C., BA-3060), incubate and add biotinylated horseradish peroxidase and avidin DH complex (VE
After adding and incubating CTOR LABORATORIES, INC., Vectastain ABC kit, TMBZ (Sumitomo Bakelite,
ML-1120T) was added to evaluate the enzyme activity by absorbance at 450 nm. Using human IgG (Sigma, I-3889) having a purified κ chain of a known concentration as a standard, it was serially diluted with PBS supplemented with mouse serum. The results are shown in (Table 9).

[0125]

[Table 9]

In chimeric mice (Examples 13, K2-3 and K2-4) carrying the human chromosome 2 fragment,
HSA was immunized three times a day, 102 days (Example 20). 63 days after birth in chimeric mice (K2-12), 77
The human antibody kappa chain against HSA in the serum of the chimeric mouse was detected by ELISA on four days, day 91 and day 116 (see Example 14). 50 mM carbonate-bicarbonate buffer p
HSA (Sigma, A 3782) diluted in H9.6 is coated on a 96-well microtiter plate, a sample is added, and then a biotin-labeled anti-human antibody κ-chain goat antibody (VECTOR LABOR)
ATORIES, INC., BA-3060) and incubate with a complex of biotinylated horseradish peroxidase and avidin DH (VECTOR LABORATORIES, INC., Vectastain ABC kit), and then incubate with OPD (Sumitomo Bakelite) as a peroxidase substrate. , ML-1130O) was added to evaluate the enzyme activity by absorbance at 490 nm. The titer of anti-HSA human kappa chain in the serum of chimeric mice immunized with HSA increased after immunization. On the other hand, control ICR mice
The titer of the HSA human antibody kappa chain was at the background level. The results are shown in (FIG. 18). In FIG. 18, the horizontal axis represents the number of days since the chimeric mouse was first immunized with HSA, and the vertical axis represents the absorbance at 490 nm. From these results, it was confirmed that the human antibody κ chain gene functions in the chimeric mouse retaining the human chromosome 2 partial fragment, and that the antibody titer of antigen-specific human Igκ occurs in response to HSA antigen stimulation. .

Example 24 Acquisition of Hybridoma Producing Human Antibody Heavy Chain (μ or γ Chain) from Human Chromosome 14-Introduced Chimeric Mouse On the 136th day after birth from chimeric mouse K9 immunized with HSA in (Example 21) The spleen was removed and fused with myeloma cells to produce a hybridoma. The hybridoma was prepared according to the method described in <Ando / Chiba, Introduction to Monoclonal Antibody Experimental Procedures, Kodansha Scientific, 1991>, and Sp-2 / O-Ag14 (Dainippon Pharmaceutical, 05- 554). ORIGEN Hybrido for culture
ma Cloning Factor (HCF, Boxui Brown) 10%
And spread the mixture into eight 96-well plates.
G418 was added at 1 mg / ml. Culture supernatant after 1 to 3 weeks
Analysis was performed by the ISA method (see Example 14). The μ-chain was coated on a 96-well microtiter plate with an anti-human μ-chain mouse monoclonal antibody (Sigma, I-6385) diluted with 50 mM carbonate-bicarbonate buffer pH 9.6, a sample diluted with PBS was added, and then peroxidase was added. After adding and incubating a labeled anti-human μ-chain mouse antibody (The Binding Site Limited, MP008), 2,2-azinozyme (3-ethylbenzthiazoline-6-sulfonic acid) diammonium salt (ABTS, Kirkegaard & Perry Laboratories In) was used as a substrate.
c., 04-10-17) to obtain 7 positive wells. For the γ chain, an anti-human γ chain mouse monoclonal antibody (Sigma, I-6260) is coated on a 96-well microtiter plate, a sample diluted with PBS is added, and then a peroxidase-labeled anti-human γ chain mouse antibody (Pharmingen, 08007E) and incubate,
BTS (Kirkegaard & Perry Laboratories Inc., 04-10-1
7) to obtain two human antibody γ chain positive wells.

(Example 25) Acquisition of human antibody light chain-producing hybridoma from human chromosome 2 introduced chimeric mouse Chimeric mouse K2-3 immunized with HSA in (Example 23)
At 105 days after birth, the spleen was taken out and fused with myeloma cells to prepare a hybridoma. The hybridoma was prepared according to the method described in <Ando / Chiba, Introduction to Monoclonal Antibody Experimental Procedures, Kodansha Scientific, 1991>, using P3X63Ag8.653 (Dainippon Pharmaceutical, 05-565) as myeloma cells. did. Add 10% HCF (Boxy Brown) to the culture medium, spread it on 10 96-well plates, add 3 mg / ml G418 to the culture medium 3 days later, culture for 1 to 3 weeks and culture wells where colonies have appeared The supernatant was analyzed by ELISA. ELISA was performed in the same manner as in (Example 23), and two clones positive for human antibody κ chain were obtained.

(Example 26) Remarking of human chromosome 22 marked with G418 resistance by puromycin resistance ), (Example 16)
Remarking of human chromosome 22 by puromycin resistance was performed in the same manner as described above. Approximately 200 double drug resistant strain colonies obtained by electroporating pPGKPuro into γ2 cells are considered as one group, and three groups (P1, P2,
Microcells were transferred to wild-type mouse A9 cells using P3) as a donor cell. As a result, six from P1, one from P2,
Three double drug resistant clones were obtained from P3. Among the obtained double drug resistant clones, human chromosome 22 is further marked by puromycin resistance gene by microcell transfer experiment using P3 derived 6-1 as a microcell donor cell and wild type A9 cell as recipient cell Was confirmed (Example 18). Microcell acquisition and fusion with A9 cells were performed in the same manner as in (Example 1). As a result, 11 days after the transfer to the microcell, 28 G418-resistant colonies appeared. After replacing these colonies with a medium containing 8 μg / ml puromycin, the cells were further cultured for 3 days.
One (75%) colony survived. In the microcell method, since only one or a small number of chromosomes are often transferred to one donor cell, both resistance genes are simultaneously transferred at a high rate, that is, 6-1 holds G
This shows that human chromosome 22 labeled with 418 resistance is further marked with a puromycin resistance gene.

(Example 27) Acquisition of human antibody heavy chain variable region cDNA from hybridoma producing human antibody heavy chain and determination of base sequence Human antibody heavy chain (IgM) obtained in (Example 15)
H4B7 (HSA-specific) among hybridomas producing
And H8F9 (non-specific) from ISOGEN (Nippon Gene)
Was used to obtain total RNA. Ready-T cDNA synthesis
Using the o-Go T-primed 1st strand kit (Pharmacia), 5 μg of total RNA was used for each. The following primers (Larrick et al., BIO / TECHNOLOGY,
7, 934-, 1989; Word et al., Int. Immunol., 1, 296-, 1989.
PCR) was performed to amplify the human antibody heavy chain variable region.

CM1 (human IgM constant region): 5'-TTGTATTTCCA
GGAGAAAGTG (SEQ ID NO: 45) CM2 (same as above): 5′-GGAGACGAGGGGGAAAAGGG (SEQ ID NO: 4
6) HS1 (human heavy chain variable region): 5'-ATGGACTGGACCTGGAGG (AG)
TC (CT) TCT (GT) C (SEQ ID NO: 47) (mixture of 8 types) HS2 (same as above): 5′-ATGGAG (CT) TTGGGCTGA (GC) CTGG (GC) TTT
(CT) T (SEQ ID NO: 48) (mixture of 16 species) HS3 (same as above): 5'-ATG (AG) A (AC) (AC) (AT) ACT (GT) TG (GT)
(AT) (GCT) C (AT) (CT) (GC) CT (CT) CTG (SEQ ID NO: 49) (6
(144 types of mixtures) * () indicates that the base at that position is a mixture consisting of any of the parentheses.

For both H4B7 and H8F9, the first PCR was HS1 × CM1,
Perform the combination of the three primers HS2 × CM1 and HS3 × CM1 (94 ° C. for 1 minute, 50 ° C. for 2 minutes, 72 ° C. for 3 minutes, 40 cycles, using PerkinElmer Co., Ltd., Thermal Cycler 140). HS1 × CM2, HS2 × CM2, HS3
It was amplified again with the primer of × CM2 (temperature conditions were the same as described above for 30 cycles). The amplification product was detected by ethidium bromide staining after 1.5% agarose electrophoresis. As a result, H4B7 was about 490 bp with HS3 × CM2 primer.
Amplified product was confirmed. For H8F9, HS3
Since a faint band was confirmed at the same position with the × CM2 primer, it was amplified again with this primer (temperature conditions were 30 cycles as above). As a result, the amplification product was detected as a very strong signal. According to the method of Ishida et al. (Gene Expression Experiment Manual, Kodansha Scientific, 1995), these PCR products were obtained using pBlueScriptII SK + (Str
(atagene) was cloned into the SmaI site of the vector.
Of the plasmids into which the amplification products were inserted, # 2, # 3, # 4 (H4
For B7), # 11, # 13, and # 14 (H8F9), the nucleotide sequence of the amplification product was determined using an automatic fluorescence sequencer (Applied Bio System). The obtained nucleotide sequence and predicted amino acid sequence have already been reported for human antibody VH regions (Marks et al., Eur. J. Immunol. 21, 985-, 1991) and JH regions (Ravetch et al., Cell, 27, 583). -, 1981), it was found that both H4B7 and H8F9 consist of a combination of the VH4 family and JH2. This result indicates that a fully functional human antibody heavy chain protein is produced in the chimeric mouse carrying the human chromosome 14 partial fragment.

(Example 28) Acquisition of human antibody kappa chain cDNA from spleen of chimeric mouse expressing human antibody kappa chain and determination of nucleotide sequence Obtained in (Example 13) Chimeric mice that have been confirmed to express
CDN synthesized from K2-8 spleen in the same manner as in (Example 5)
For A, the following primers (Larrick et al., BIO / TECHNO
LOGY, 7, 934-, 1989; Whitehurst et al., Nucleic Acids R
es., 20, 4929-, 1992) to amplify the human κ chain variable region. Liver-derived cDNA obtained from K2-8 as a negative control, and (Example 10)
Spleen-derived cDNA obtained from TT2 / # 143-2 chimeric mouse K3-2-2.

KC2 (human Igκ chain constant region): 5'-CAGAGGCA
GTTCCAGATTTC (SEQ ID NO: 50) KC3 (same as above): 5'-TGGGATAGAAGTTATTCAGC (SEQ ID NO: 5
1) KVMIX (human Igκ chain variable region): 5'-ATGGACATG (AG) (AG)
(AG) (AGT) (CT) CC (ACT) (ACG) G (CT) (GT) CA (CG) CTT (SEQ ID NO: 52) (mixture of 3456 species) * () indicates that the base at that position is A mixture consisting of any of the above.

The PCR was carried out using a combination of KVMIX × KC2 and KVMIX × KC3 primers under the conditions of 94 ° C. for 15 seconds, 55 ° C. for 15 seconds, 72 ° C. for 20 seconds and 40 cycles (using Perkin Elmer Co., Ltd., thermal cycler 9600). The amplification product was detected by ethidium bromide staining after 1.5% agarose electrophoresis.
As a result, the expected combination of both is about 420bps
(KC2), an amplification product having a length of about 450 bps (KC3) was detected. On the other hand, no specific amplification product was detected in the two negative controls. These amplification products are available from Ishida et al. (Gene Expression Experiment Manual, Kodansha Scientific,
1995), pBlueScriptII SK + (Stratagene
Was cloned into the vector at the SmaI or EcoRV site. KVMIX x K
The nucleotide sequence of the amplification product was determined for one C2-derived VK- # 1 clone using an automatic fluorescence sequencer (Applied Bio System). Since the obtained nucleotide sequence does not include a termination codon from the start codon of the human Igκ chain to the constant region, it is considered that the cloned amplification product encodes a functional human Igκ chain variable region. In addition, human antibody Vκ regions already reported (Klein et al., Eur. J. Im.
munol., 23, 3248-, 1993), Jκ region (Whitehurst et al.,
As a result of comparison with the nucleotide sequence of
It turned out to consist of a combination of κ4. This result indicates that a fully functional human antibody kappa chain protein was produced in the chimeric mouse carrying the human chromosome 2 partial fragment.

Example 29 Detection and Quantification of Human Antibody γ Chain Subclass and μ Chain in Serum of Chimeric Mice Carrying Human Chromosome 14 Fragment (Example 10) and
K16A; derived from 1-4, chimera ratio 70, 50%), blood was collected, and the concentration of human antibody γ chain subclass in serum was determined according to EL (Example 14).
It was detected using the ISA method.

[Measurement of Human IgG1] An anti-human IgG antibody (Sigma, I-6260) was diluted with PBS and coated on a 96-well microtiter plate. A serum sample was added, followed by a peroxidase-labeled anti-human IgG1 antibody (Pharmingen, 08027E), followed by incubation with TMBZ.
(Sumitomo Bakelite, ML-1120T) was added to evaluate the enzyme activity by absorbance at 450 nm. Purified human IgG1 of known concentration (Sigma, I-3889) was used as a standard and serially diluted with PBS supplemented with mouse serum.

[Measurement of Human IgG2] An anti-human IgG2 antibody (Sigma, I-9513) was diluted with PBS and coated on a 96-well microtiter plate. A serum sample was added and then a peroxidase-labeled anti-human IgG antibody (Sigma, A-017
After adding 0) and incubating, the enzyme activity was evaluated by the absorbance at 450 nm by adding TMBZ (Sumitomo Bakelite, ML-1120T). Purified human IgG2 (Sigma, I-4139) of known concentration was used as a standard and serially diluted with PBS supplemented with mouse serum.

[Measurement of human IgG3] An anti-human IgG3 antibody (Sigma, I-7260) was diluted with 100 mM glycine hydrochloride buffer pH 2.5 and left at room temperature for 5 minutes.
Diluted 10-fold with 7.0 and coated a 96-well microtiter plate. A serum sample was added and then a peroxidase-labeled anti-human IgG antibody (Pharmingen, 080
After addition of 07E) and incubation, TMBZ (Sumitomo Bakelite, ML-1120T) was added to evaluate the enzyme activity by absorbance at 450 nm. Purified human IgG3 (Sigma, I-4389) having a known concentration was used as a standard and serially diluted with PBS supplemented with mouse serum.

[Measurement of human IgG4] An anti-human IgG4 antibody (Sigma, I-7635) was diluted with 100 mM glycine hydrochloride buffer pH 2.5 and left at room temperature for 5 minutes.
Diluted 10-fold with 7.0 and coated a 96-well microtiter plate. A serum sample was added and then a peroxidase-labeled anti-human IgG antibody (Pharmingen, 080
After addition of 07E) and incubation, TMBZ (Sumitomo Bakelite, ML-1120T) was added to evaluate the enzyme activity by absorbance at 450 nm. Purified human IgG4 (Sigma, I-4639) of known concentration was used as a standard, and serially diluted with PBS supplemented with mouse serum.

[Measurement of Human IgM] For the μ chain, an anti-human μ chain mouse monoclonal antibody (Sigma,
I-6385) was coated on a 96-well microtiter plate, a serum sample was added, and a peroxidase-labeled anti-human μ-chain mouse antibody (The Binding Site Limited, MP00
8) After adding and incubating, the enzyme activity was evaluated by the absorbance at 450 nm by adding TMBZ (Sumitomo Bakelite, ML-1120T) as a peroxidase substrate. , 6001-1590) as standard and mouse serum (Sigma, M590)
It was serially diluted with PBS to which 5) was added. Table 10 shows the results. Chimeric mice K15A and K16A in two individuals IgG1, IgG2, IgG3,
All subclasses of IgG4 and IgM were detected.

[0142]

[Table 10]

Example 30 Obtaining Mouse ES Cell Line (TT2) Having Human Chromosome 22 To obtain mouse ES cells (TT2) having human chromosome 22 as chromosome donor cells (Example 26) 6-
1 (A9 / # 22, G418, puromycin resistance) cell line was used. A wild-type TT2 cell line (Example 9) was used as a chromosome recipient cell. The microcell fusion experiment and the selection of the puromycin-resistant strain were performed in the same manner as in the selection of the G418-resistant strain (Example 9) except for the puromycin concentration of 0.75 μg / ml. The frequency of appearance of the result emerging puromycin resistant clones was 1-2 per 10 ⁷ TT2 cells. Cryopreservation of the puromycin-resistant strain and acquisition of genomic DNA were performed in the same manner as in (Example 2). The retention of human chromosome 22 is as follows for puromycin resistant strain PG22-1 (1),
Confirmed by (2).

(1) PCR analysis Using puromycin-resistant strain genomic DNA as a template,
Among the genes (Genetic Maps, supra) present on chromosome number, the presence is confirmed in (Example 2; A9 / # 22) 10
As a result of PCR amplification of the seed primers, all the markers present in (Example 2; A9 / # 22) were detected.

(2) According to the method shown in Southern blot analysis (Example 2), using the human L1 sequence as a probe,
The determination was performed on genomic DNA derived from the negative control wild-type TT2, chromosome donor cell 6-1 and puromycin-resistant TT2 cell line PG22-1. The results are shown in (Fig. 19). On the left side of the figure
The DNA molecular weight was indicated. The band pattern in PG 22-1 is 6
Since the signal intensity was almost the same as that of -1 and the signal intensity was almost the same, it was confirmed that chromosome 22 in the 6-1 cell line was certainly transferred to PG22-1. From the above experiment, it was confirmed that the puromycin-resistant TT2 cell line PG22-1 retained all or most of human chromosome 22.

(Example 31) Preparation of chimeric mouse from mouse ES cell line (TT2) carrying human chromosome 22 Obtained from (Example 30) and confirmed to carry human chromosome 22 Puromycin resistant TT2 cell line PG22-
Start 1 from frozen stock, ICR or MCH (ICR)
(Clea Japan) 10-12 embryos per embryo were injected into 8-cell stage embryos obtained by mating male and female mice. After culturing overnight in an ES cell culture medium (Example 9) to generate blastocysts, the uterus of a foster parent ICR mouse (CLEA Japan) 2.5 days after pseudopregnancy was treated with about 10 cells per uterus Injected embryos were implanted.

The results of chimera production are shown in (Table 11). Total
Implantation of 266 injected embryos resulted in 36 offspring mice. The chimeric individual is determined based on whether a wild color (dark brown) derived from TT2 cells is observed in white from the host embryo (ICR) in coat color. Of the 36 animals born, 8 had an apparent wild-colored coat color, ie, ES cells contributed. These results indicate that ES cell line carrying human chromosome 22 (TT2 derived, PG22-1)
Was confirmed to have the ability to form a chimera, that is, the ability to differentiate into a normal tissue of a mouse individual.

[0148]

[Table 11]

Example 32 Detection and Quantification of Human Antibody λ Chain in Serum of Chimeric Mouse Carrying Human Chromosome 22 Human Example Concentration of Serum in Serum of Chimeric Mouse KPG22-1 to 3 in Example 31 Was quantified using the ELISA method according to (Example 14). Blood was collected from two-month-old chimeric mice, and the human antibody λ chain in the serum was detected by ELISA. Anti-human immunoglobulin λ chain antibody diluted with PBS (VECTOR LABORATORIES,
INC., IA-3070) is coated on a 96-well microtiter plate, a serum sample is added, and then a biotin-labeled anti-human immunoglobulin λ chain antibody (VECTOR LABORATORIE
S, INC., BA-3070), incubate and add a complex of biotinylated horseradish peroxidase and avidin DH (VECTOR LABORATORIES, INC., Vectastain ABC kit)
After adding and incubating, the enzyme activity is evaluated by the addition of TMBZ (Sumitomo Bakelite, ML-1120T) at an absorbance of 450 nm. PB with mouse serum
Serially diluted with S. The results are shown in Table 12. From this result, it was confirmed that the human antibody λ chain gene functions in the chimeric mouse having chromosome 22.

[0150]

[Table 12]

(Example 33) Detection of anti-human HSA human λ chain in serum of human chromosome 22-introduced chimeric mouse Chimeric mice (Example 31, KPG22-3) were 79 days old, 94 days old.
HSA was immunized three times a day for 110 days (Example 20). The human antibody λ chain in the serum was subjected to EL according to (Example 14).
It was detected using the ISA method. HSA (Sigma, A 3782) diluted to 5 μg / ml in 50 mM carbonate-bicarbonate buffer pH 9.6
Is coated on a 96-well microtiter plate, a serum sample is added, and then a biotin-labeled anti-human immunoglobulin λ chain antibody (VECTOR LABORATORIES, INC., BA-307
0), incubate and add biotinylated horseradish peroxidase and avidin DH complex (VECTOR LABOR
ATORIES, INC., Vectastain ABC kit) and incubate, then TMBZ (Sumitomo Bakelite, ML-1120T)
Was evaluated by the absorbance at 450 nm. HSA
The titer of anti-HSA human λ chain in the serum of the chimeric mouse immunized with increased after immunization. On the other hand, in the control ICR mouse, HSA
The titer of the anti-HSA human antibody λ chain after immunization was at the background level. The results are shown in (FIG. 20). In FIG. 20, the horizontal axis shows the number of days since the chimeric mouse was first immunized with HSA, and the vertical axis shows the absorbance at 450 nm. From these results, it was confirmed that the human antibody λ chain gene functions in the chimeric mouse carrying human chromosome 22, and that the antibody titer of antigen-specific human Igλ increases upon stimulation with HSA antigen.

(Example 34) Acquisition of a human antibody light chain-producing hybridoma from a human chromosome 22-introduced chimeric mouse Similarly to (Example 25), a birth of a chimeric mouse KPG22-3 immunized with human albumin in (Example 33) On day 113, the spleen was taken out and fused with myeloma cells to prepare a hybridoma. Hybridoma production was performed according to the method described in <Ando / Chiba, Introduction to Monoclonal Antibody Experimental Procedures, Kodansha Scientific, 1991>, and SP-2 / O-Ag14 (Dainippon Pharmaceutical, 05- 554) was used. Add 10% HCF (Air Brown) to the culture
The cells were spread on five 96-well plates, cultured for 1 to 3 weeks, and the culture supernatant of the well where colonies appeared was analyzed by ELISA. ELI
The SA method was performed in the same manner as in (Example 33), and four clones positive for human antibody λ chain were obtained.

Example 35 Acquisition of Mouse ES Cell Line Containing Human Chromosome 22 Partial Fragment and Chromosome 14 Partial Fragment Acquisition of Mouse ES Cell Line Containing Human Chromosome 22 and Chromosome 14 Partial Fragment Therefore, the 6-1 (A9 / # 22, G418, puromycin-resistant) cell line obtained in (Example 26) was used as a chromosome donor cell. As a chromosome recipient cell, a G418-resistant TT2 cell line 1-4 (Example 9), which already contains a partial fragment of human chromosome 14, was used. The microcell fusion experiment and the selection of the puromycin-resistant strain were performed in the same manner as in the selection of the G418-resistant strain (Example 9) except for the puromycin concentration of 0.75 μg / ml. Frequency of occurrence of this result emerging puromycin resistant clones was 1-2 1-4 10 ⁷ cells per. These puromycin resistant strains have 300 μg / ml G
Proliferation even in the presence of 418 confirmed that G418 resistance was also maintained. Cryopreservation and genomic DNA acquisition of the double drug resistant strain were performed in the same manner as in (Example 2). Retention of human chromosome 22 and human chromosome 14 partial fragments was confirmed for the dual drug resistant strain PG22-5 by the following PCR analysis. Human 22 using double-drug resistant strain genomic DNA as template
Of the genes present on chromosome 14 and chromosome 14 (Genetic Maps, supra), for chromosome 22 (Example 2 ; A9 / # 2
2) About chromosome 14 (Example 9; TT2 / # 14 1-4)
As a result of performing PCR amplification on each of the primers confirmed to be present in Chromosome 22, 3 out of 10 markers (D22S275, D22S315, Igλ) for chromosome 22, and TT2 / # 14 1-4 for chromosome 14 All the markers present in were detected. From the above experiment, it was confirmed that the obtained double-resistant TT2 cell line simultaneously retained a partial fragment of human chromosome 22 and a partial fragment of chromosome 14.

(Example 36) Production of a chimeric mouse from a mouse ES cell line simultaneously retaining a partial fragment of human chromosome 22 and a partial fragment of chromosome 14 14
G41 confirmed to retain a partial chromosome fragment
8. A puromycin double-resistant TT2 cell line PG22-5 was established from a frozen stock, and ICR or MCH (ICR) (CLEA Japan) was used for mating of male and female mice. Each was injected. After culturing overnight in an ES cell culture medium (Example 9) to generate blastocysts, the uterus of a foster parent ICR mouse (CLEA Japan) 2.5 days after pseudopregnancy was treated with about 10 cells per uterus Injected embryos were implanted.

The results of chimera production are shown in (Table 13). Total
As a result of transplanting 302 injected embryos, 16 offspring mice were born. The chimeric individual is determined based on whether a wild color (dark brown) derived from TT2 cells is observed in white from the host embryo (ICR) in coat color. Out of the 16 animals born, 5 had an apparent wild-colored coat color, that is, the contribution of ES cells was observed. From this result, the ES cell line (PG22-5) that retains the human chromosome 22 partial fragment and the chromosome 14 partial fragment retains the chimera-forming ability,
That is, it was confirmed that the mouse had the ability to differentiate into normal tissues.

[0156]

[Table 13]

Example 37 Detection and Quantification of Human Antibody λ Chain and Human Antibody μ Chain in ES Cell-Derived Chimeric Mouse Serum Containing Both Human Chromosome 22 Partial Fragment and Chromosome 14 Partial Fragment (Example 36) ) Chimeric mice (KPG22-9, 10, and 1)
2) was immunized with HSA. KPG22-9 and KPG22-10 were immunized at 11 weeks of age, and blood was collected 2 weeks later. KPG22-1
2 was immunized twice at 7 and 9 weeks of age, and blood was collected 2 weeks after the second immunization. Serum was used to detect human antibody μ chain, human antibody λ chain, and an antibody having human λ chain and human μ chain using ELISA according to (Example 14).

For detection of a fully human antibody, an anti-human immunoglobulin λ chain antibody diluted with PBS (Kirkegaard & Perry Lab)
oratories Inc., 01-10-11) was coated on a 96-well microtiter plate, a serum sample was added, and then a peroxidase-labeled anti-human immunoglobulin μ chain antibody (The
After adding and incubating Binding Site Limited, MP008), TMBZ (Sumitomo Bakelite, ML-1120T) was added as a peroxidase substrate to evaluate the enzyme activity by absorbance at 450 nm.
PBS supplemented with IgM (Dainippon Pharmaceutical, U13200) mouse serum
The concentration of the human antibody in the serum was determined by comparing it with the one diluted step by step. The human antibody μ chain and human antibody λ chain were detected and quantified by ELISA in the same manner as in (Example 29) and (Example 32). The results are shown in Table 14. Λ in chimeric mice
Both the strand and the μ strand were detected. An antibody having human antibody μ chain and λ chain was also detected. These results indicate that the human antibody λ chain gene and the human antibody μ in the ES cell-derived chimeric mouse having the human chromosome 22 partial fragment and the
The chain genes function simultaneously, confirming that some B cells produce complete antibodies in which both the heavy and light chains are human.

As a control, a chimeric mouse (K9) retaining only human chromosome 14 (Example 10), human
The concentration of the antibody having a human antibody λ chain and μ chain in the serum of a chimeric mouse (KPG22-2) that retains only chromosome 22 (Example 31) is at the background level, and the detection system here is human λ It was confirmed that only a complete antibody having a chain and a μ chain was detected.

[0160]

[Table 14]

Example 38 Detection of Human Antibodies in Serum of ES Cell-Derived Chimeric Mouse Simultaneously Retaining Partial Fragment of Human Chromosome 2 and Partial Fragment of Chromosome 14 (Antibody Having Human κ Chain and Human μ Chain) In contrast to the chimeric mouse KPG-15 (TT2ES clone PG5 derived, chimera rate 10%) prepared in Example 19), human serum albumin (HSA,
Sigma, A3782) and adjuvant (MPL + TDM Emulsion, R
0.25mg / ml by mixing with IBI Immunochem Reseach Inc.)
Was prepared, and 0.2 ml was immunized three times, and blood was collected. In addition, chimeric mouse KPG-26 (TT2ES) of 6 weeks of age (Example 19)
Blood was collected from clone PG6 (chimera rate: 40%). The concentration of the fully human antibody in the serum was detected by ELISA according to (Example 14). Anti-human immunoglobulin κ chain antibody diluted with PBS (Kirkegaard & Perry Laboratories Inc., 01-10-1
0) was coated on a 96-well microtiter plate, and a serum sample diluted with PBS supplemented with mouse serum (Sigma, M5905) was added.
After adding and incubating MP008), TMBZ (Sumitomo Bakelite, ML-1120T) was added as a peroxidase substrate, and the enzyme activity was evaluated at an absorbance of 450 nm. , 6001-1590) as standard and mouse serum added
Was diluted step by step. About κ chain and μ chain (Example 2
The concentration was determined in the same manner as in (0). The results are shown in Table 15.
An antibody having human antibody μ chain and κ chain was detected. Human antibodies in the serum of a chimeric mouse (K9) that retains only human chromosome 14 (Example 10) as a control and a chimeric mouse (K2-9) that retains only human chromosome 2 (Example 13) The concentration of the antibody having κ and μ chains was 0.002 mg / ml or less, which was at the background level. From these results, the human antibody κ chain gene and the human antibody μ chain gene function simultaneously in the ES cell-derived chimeric mouse retaining the human chromosome 2 partial fragment and the chromosome 14 partial fragment, and in some B cells, It was confirmed that a complete antibody in which both light chains were human was produced.

[0162]

[Table 15]

(Example 39) Obtaining a mouse ES cell line (TT2F, XO) carrying a partial fragment of human chromosome 2 Mouse ES cell (XO) carrying a partial fragment of human chromosome 2
For the acquisition, the PG1 cell line obtained in (Example 16) was used as a chromosome donor cell. As chromosome recipient cells (39,
It has been reported that the chromosome composition of the TT2F cell line (Shinichi Aizawa, Biomanual Series 8, Gene Targeting, Yodosha, 1995) has a chromosome composition of XO) and chimeric mice (Lifetech Oriental) Purchase) was used. The microcell fusion experiment and the selection of the puromycin-resistant strain were carried out in the same manner as in the selection of the G418-resistant strain (Example 9) except for the puromycin concentration of 0.75 μg / ml. The frequency of puromycin-resistant strains that appeared as a result was 5 out of 10 ⁷ TT2F cells. Cryopreservation and genomic DNA acquisition of these puromycin-resistant strains were performed in the same manner as in (Example 2). Retention of the partial fragment of human chromosome 2 was confirmed for the drug-resistant strains P-20 and P-21 by the following PCR analysis. Among the genes (Genetic Maps, supra) present on human chromosome 2 using the drug-resistant strain genomic DNA as a template, (Example 1; A9 / # 2 w2
Primers Cκ, FABP1, Vκ confirmed to exist in 3)
As a result of performing PCR amplification on three types of 1-2, both strains
The expected amplification products were confirmed for all the primers of the species. From the above experiment, it was confirmed that the obtained puromycin-resistant ES cell line (TT2F, XO) retained a partial fragment of human chromosome 2.

(Example 40) Production of chimeric mouse from mouse ES cell line (TT2F, XO) retaining human chromosome 2 partial fragment Obtained from (Example 39) and retaining human chromosome 2 partial fragment The puromycin-resistant TT2F cell line P-21 was confirmed to be
(ICR) (CLEA Japan) 10 to 12 embryos per embryo were injected into an 8-cell stage embryo obtained by mating male and female mice. After culturing overnight in ES cell culture medium (Example 9) to generate blastocysts,
Approximately 10 injection embryos were transplanted into the uterus of a foster parent ICR mouse (CLEA Japan) 2.5 days after the pseudopregnancy treatment.

As a result of transplanting a total of 141 injected embryos, 20 offspring mice were born. The chimeric individual is determined based on whether a wild color (dark brown) derived from TT2 cells is observed in white from the host embryo (ICR) in coat color. The results of chimera production are shown in (Table 16). Of the 20 births, 9 had an apparent wild-colored coat color, that is, 9 individuals were able to contribute ES cells. Four of them were chimeric mice with completely wild coat color (derived from ES cells). From these results, it was confirmed that the ES cell line (P-21), which retains the partial fragment of human chromosome 2, retains the ability to form chimeras, that is, retains the ability to differentiate into normal tissues of mouse individuals. Was.

[0166]

[Table 16]

Example 41 Detection and Quantification of Human Antibody κ Chain in Serum of TT2F-Derived Chimeric Mice Carrying Human Chromosome 2 Partial Fragment (Example 40) -21-derived, 100% chimera rate, K2-1F-4F), and the serum concentration of human antibody κ chain in serum was quantified by ELISA in the same manner as in (Example 20). The results are shown in Table 17. Use ES cells for TT
It was confirmed that the human antibody κ chain gene functions in the chimeric mouse also as 2F.

[0168]

[Table 17]

Example 42 Detection of Human Chromosome Retention in the Offspring of Chimeric Mice Derived from Mouse ES Cells (TT2F, XO) Carrying a Partial Fragment of Human Chromosome 2 Among Female Chimeric Mice Obtained by (Example 40) K2-1F, K
It was examined whether 2-4F (both color chimera ratio 100%) produced ES cell-derived progeny by mating with male ICR mice. In this cross ICR male mice (albino, recessive)
Eggs derived from TT2F cells (wild color: dominant) in chimeric mice fertilized by sperm of origin produce wild-colored offspring and white eggs from ICR-derived eggs. Viable offspring mice (K2-1F: 10 mice, K2-
4F: 5 animals) showed a wild color, which is a hair color derived from ES cells. Genomic DN prepared from the tail of these offspring mice
For A, the retention of human chromosome fragments was examined by PCR. As a result of PCR amplification of three primers whose presence was confirmed in P-21 (Example 39), P out of 4 out of 10 (K2-1F) and 2 out of 5 (K2-4F) The presence of the three markers detected in -21 was confirmed. The results of the PCR of 15 offspring mice are shown in FIG. 21. On the right side of the figure, the marker (φX174, HaeIII fragment, Nippon Gene) and the DNA molecular weight of the main band are indicated by arrows, and the length of the amplification product expected by each primer is indicated by an arrow on the left side. The right side shows the results of using the DNA derived from the tail of the parent chimeras K2-1F and K2-4F as a positive control. These results indicate that the TT2F cell line P-21 carrying a partial fragment of human chromosome 2 differentiates into a functional egg in chimeric mice,
This indicates that a partial fragment of chromosome 2 has been transmitted.

(Example 43) Detection of human chromosome retention in progeny of chimeric mice derived from mouse ES cells (TT2, XY) carrying a partial fragment of human chromosome 2 Among chimeric mice obtained in (Example 13), K2 -18
(Male, chimera rate 70%), K2-19 (female, chimera rate 60%) and non-chimeric females of the same litter were mixed and crossed to examine whether ES cell-derived progeny would be born. Since TT2 cells have a (40, XY) chromosome structure, they may have differentiated into functional spermatozoa in male chimera K2-18. In that case, ICR fertilized by sperm derived from TT2 cells (wild color, dominant) in chimeric mice
Wild-colored offspring are born from ova derived from (white: recessive). Total number of surviving offspring obtained by mating 11
Ten of the 0 animals exhibited a wild color, which is the hair color derived from ES cells. PCR of genomic DNA prepared from the tail of 7 of these 10 wild-colored mouse mice
It was examined by the method. The two primers (Cκ, FABP1) confirmed to exist in strain 5-1 (TT2 / # 2fg., Example 12) and the Vκ1-2 primer shown in (Example 1)
As a result of R amplification, the presence of all three markers was confirmed in 2 out of 7 mice. This result indicates that the TT2 cell line 5-1 carrying the human chromosome 2 partial fragment differentiated into functional spermatozoa in chimeric mice, and the human chromosome 2 partial fragment was transmitted to progeny derived from the sperm. Is shown.

Example 44 Detection and Quantification of Human Antibody κ Chain in Serum of Chimeric Mouse Progeny The chimeric mouse progeny K2-1F-1 to 10 and K2-
The concentration of human antibody kappa chain in the serum of 4F-1 to 5 was quantified by ELISA. Blood was collected from mice about 4 to 6 weeks old after birth, and the human antibody κ chain in the serum was detected by ELISA in the same manner as in (Example 20). The results are shown in Table 18 together with the results of chromosome retention obtained in (Example 42). It was confirmed that the human antibody κ chain gene functions also in offspring born from chimeric mice.

[0172]

[Table 18]

(Example 45) Analysis of chimeric mouse spleen cells transfected with a partial fragment of human chromosome 14 Analysis by flow cytometry was performed according to the method described in the following literature. The Biochemical Society of Japan, New Chemistry Experiment Course, 12 Molecular Immunology I-Immune Cells and Cytokines-1989, Tokyo Chemistry; Cancer Research Division, Institute of Medical Science, The University of Tokyo, Cell Engineering Separate Volume 8, New Cell Engineering Experiment Protocol, 1991, Shujunsha;
A. Doyle and JBGriffiths, “Cell & Tissue Cultur
e: Laboratory Procedures ", published by John Wiley
& Sons Ltd., 1996. A spleen was taken out from a 6-month-old chimeric mouse (KPG06; derived from PG16, chimera rate: 30%) of (Example 19), treated with an ammonium chloride aqueous solution, and then treated with fluorescein isoform in PBS containing 1% rat serum. Cells were stained with thiocyanate (FITC) labeled anti-mouse CD45R (B220) antibody (Pharmingen, 01124A). After washing, a biotin-labeled anti-human IgM antibody (Pharmingen, 08072D) or a biotin-labeled anti-human λ chain antibody (Pharmingen, 08152) as a control in PBS containing 5% mouse serum.
After reaction with D), the cells were stained with streptavidin phycoerythrin (Pharmingen, 13025D) and analyzed by flow cytometry (Becton Dickinson, FACSort). As a control, an ICR mouse having no human chromosome was similarly analyzed. FIG. 22 shows the results. In the figure, the horizontal axis represents human IgM, and the vertical axis represents CD45R (B220). A 4% increase in the cell population that is B-cell marker CD45R-positive (FITC) and human IgM-positive (PE) confirms the presence of cells expressing the human antibody μ chain on the cell surface in chimeric mice Was done.

(Example 46) Cloning of human antibody gene variable region from cDNA derived from spleen of chimeric mouse expressing human antibody heavy chain, κ chain, and λ chain and determination of base sequence (Example 29), (Example 23) , (Example 32), chimeric mouse K15A (derived from strain 1-4, produced by the method shown in Example 10), K2-8, which was confirmed to express human antibody heavy chain, κ chain, and λ chain, respectively. (Produced in Example 13), cDNA synthesized from spleen-derived RNA of KPG22-2 (produced in Example 31) in the same manner as in (Example 5) using the following primers
PCR was performed to amplify each human antibody gene variable region. Spleen-derived cDNA obtained from non-chimeric mouse ICR was used as a negative control. Primers not described in the references were prepared based on nucleotide sequences obtained from databases such as Genbank.

K15A (heavy chain) For the constant region: HIGMEX1-2: 5'-CCAAGCTTCAGGAGAAAGTGATGGAGTC (SEQ ID NO: 53) HIGMEX1-1: 5'-CCAAGCTTAGGCAGCCAACGGCCACGCT (used for 2nd PCR of VH3BACK) (SEQ ID NO: 54) For the variable region: VH1 / 5BACK (59 ° C, 35cycles, Marks et al., Eur. J. Immnol., 21, 985-, 1991), VH4BACK (59 ° C, 35cycles, Marks et al., Supra), VH3BACK (1st PCR: 59 ° C, 35cycles, 2ndPCR: 59 ℃, 35cycles, Marks et al., Supra)

K2-8 (light chain kappa) For the constant region: KC2H: 5'-CCAAGCTTCAGAGGCAGTTCCAGATTTC
(SEQ ID NO: 55) For variable region: Vk1 / 4BACK (55 ° C, 40cycles, Marks et al., Eu
r. J. Immnol., 21, 985-, 1991), Vk2BACK (55 ℃, 40
cycles, Marks et al., supra), Vk3BACK (55 ℃, 40cycles,
Marks et al., Supra)

KPG22-2 (light chain λ) For the constant region: CλMIX (a mixture of the following three primers in an equimolar ratio) IGL1-CR: 5′-GGGAATTCGGGTAGAAGTCACTGATCAG (SEQ ID NO: 56) IGL2-CR: 5'-GGGAATTCGGGTAGAAGTCACTTATGAG (SEQ ID NO: 57) IGL7-CR: 5'-GGGAATTCGGGTAGAAGTCACTTACGAG (SEQ ID NO: 58) For the variable region: Vλ1LEA1 (55 ° C., 40 cycles, Williams et al.,
Eur. J. Immunol., 23, 1456-, 1993), Vλ2MIX (55 ° C,
40cycles, Vλ2LEA1, V reported in Williams et al.
λ2JLEAD mixed in equimolar ratio), Vλ3MIX (55 ℃,
40 cycles, Vλ3LEA1, V reported in Williams et al.
λ3JLEAD, Vλ3BACK4 mixed in equimolar ratio)

For each of the constant region × variable region (heavy chain 3
Species, three types of κ chains and three types of λ chains) at 94 ° C for 15 seconds, and annealing temperatures of 15 for each variable region primer.
Cycle, 72 ° C for 20 seconds, the number of cycles indicated for each variable region primer (PerkinElmer, Thermal Cycler)
9600). 2nd PCR in VH3BACK
Re-amplified the amplification product of 1stPCR with the combination of the primers (HIGMEX1-1 × VH3BACK). All amplification products are 1.
After 5% agarose electrophoresis, it was detected by ethidium bromide staining. As a result, in all combinations,
Amplification products of the expected length (heavy chain: around 470 bp, light chain κ: around 400 bp, light chain λ: around 510 bp) were detected. On the other hand, no specific amplification product was detected at the same position in all of the negative controls. These amplification products
After extraction from agarose gel using prep.A.gene (Bio-Rad), treatment with restriction enzymes (heavy chain: HindIII-PstI, light chain κ: HindIII-PvuII, light chain λ: HindIII-EcoRI) was performed, and pU
HindIII, PstI site (heavy chain), HindIII, HincII site (κ chain), HindIII, EcoRI of C119 (Takara Shuzo) vector
It was cloned into the site (λ chain). For the following plasmids (the number of clones shown on the right) among the plasmids into which the amplification products have been inserted, an automated fluorescence sequencer (Applyed Bio Sy
stem company), the nucleotide sequence of the amplification product was determined.

HIGMEX1-2 × VH1 / 5BACK: 10 clones ・ HIGMEX1-2 × VH4BACK: 8 clones ・ HIGMEX1-2 (2nd PCR, HIGMEX1-1) × VH3BACK: 5 clones ・ KC2H × Vκ1 / 4BACK: 6 Clones ・ KC2H × Vκ2BACK: 7 clones ・ KC2H × Vκ3BACK: 4 clones ・ CλMIX × Vλ1LEA1: 5 clones ・ CλMIX × Vλ2MIX: 6 clones ・ CλMIX × Vλ3MIX: 5 clones

The obtained base sequence was ligated to DNASIS (Hitachi Softw
are Engneering) .As a result, all are human-derived sequences, and all of the κ and λ chains, and 21 of the 23 heavy chains in total, are functional sequences that do not contain a stop codon from the initiation codon to the constant region. Met. Excluding identical sequences from the determined sequences, 17 types of heavy chain, 11 types of κ chain, and 12 types of λ chain respectively identified different variable region sequences.

Example 47 Analysis of Human Antibody Gene Variable Region Nucleotide Sequence from cDNA Derived from Chimeric Mouse Spleen Expressing Human Antibody Heavy, κ, and λ Chains The nucleotide sequence determined in Example 46 The following points were analyzed for the heavy chain (17 clones, κ chain 11 clones, and λ chain 12 clones). 1. 1. Identify known germline V gene fragments used in each variable region sequence 2. Identify known germline J gene fragments used in each variable region sequence 4. Identify known germline D fragments used in heavy chain variable region. 4. Identify addition of N region in heavy chain variable region based on results of 1, 2, 3. Determination of amino acid sequence derived from each variable region nucleotide sequence

The results are shown in (Table 19). For 1 and 2, homology search with germline V and J fragments registered in Genbank was performed by DNASIS and identified. The VH fragment (Cook et al., Nature gentics, 7, 162-, 1994) and the Vκ fragment (Klein et al., Eur. J. Immunol, 23, 3248-, 199
3), the Vλ fragment follows the notation (Williams et al., Supra)
It is described in the table together with each V fragment family name. For DNA No. 3, a homology search with the germline D fragment described in the report of (Ichihara et al., The EMBOJ., 7, 13, 4141-, 1988) was performed using DNA.
It was performed by SIS, and it was determined as an index that there was a continuous match of 8 bp or more, and the results are shown in the table. For DN * (Green et al., Na
ture Genetics, 7, 13-, 1994)
It is considered a family fragment. 1 (V) for 4;
Based on the results of 2 (J) and 3 (D), a nucleotide sequence not found in any of the germline fragments was regarded as an N region. As a result, the N region was observed in 11 of the 13 species identified as the D region, and the average length was 8.7 bp. With regard to 5, each base sequence was converted to a one-letter amino acid sequence using DNASIS. Only the CDR3 region is shown in the table. On the right side of the table, the names of the primers used for cloning each variable region and the names of the clones are shown.

[0183]

[Table 19]

(Example 48) Preparation of targeting vector for knockout of antibody gene (heavy chain, light chain kappa) of TT2 (or TT2F) ES cell Mouse antibody gene (heavy chain, light chain kappa) was disrupted in TT2 ( Or TT2F) Transfection of human chromosome 14 fragment marked with G418 resistance gene (Example 9) and human chromosome 2 (Example 18) or chromosome 22 (Example 35) marked with puromycin resistance gene It is possible to do. Using such mouse antibody gene (heavy chain, light chain κ) gene disrupted TT2 (or TT2F) ES cells into which human chromosome 14 + 2 or human chromosome 14 + 22 has been introduced, (heavy chain + κ chain:
Example 19, heavy chain + λ chain: In the chimeric mouse prepared by the method of Example 36), it is expected that an antibody mainly composed of human heavy and light chains will be produced. The abbreviations and the like of the restriction enzymes in FIGS. 23 to 27 shown below are as follows.

Restriction enzymes: Kp: KpnI, B: BamHI, RI: EcoR
I, RV: EcoRV, N: NotI, SII: ScaII, Sca: ScaI,
Sfi: SfiI, Sm: SmaI, X: XhoI, SI: SalI, dKp: del
etionof KpnI, (X): XhoI cleavage site from lambda vector. Dotted line: pBluescript SKII (+) plasmid DNA

[0186]

1. Preparation of LoxP-pstNEO plasmid containing LoxP sequence on both sides of G418 resistance gene After knocking out the antibody gene of TT2 (or TT2F) cells, in order to remove the G418 resistance gene, remove both ends of G418 resistance gene (Example 1). Cre recombination (Sauer et al., Pro
Natl. Acad. Sci. USA, 85, 5166-, 1988), the LoxP sequence (Sauer et al., supra), which must be in the same orientation. The pstNEO gene was excised from the pSTneoB plasmid DNA (Example 1) with the restriction enzyme XhoI, the DNA fragment was purified by agarose gel electrophoresis, and both ends were blunt-ended with T4 DNA polymerase (Takara Blunting end kit). Plasmid DNA pBS246 containing LoxP sequence
(Plasmid pBS246, loxP2 Cassette Vector, US Pate
nt 4959317) was purchased from GIBCO BRL. An XhoI recognition sequence modified by inserting an XhoI linker DNA into the EcoRI and SpeI cleavage sites of this plasmid was used. The above pstNEO DN was inserted into the EcoRV cleavage site of this modified pBS246.
The A fragment was inserted to obtain the plasmid LoxP-pstNEO (No. 23).
Figure).

2. Isolation of genomic DNA clones containing C57BL / 6-derived antibody heavy chain Cμ (IgM constant region) and light chain Jκ-Cκ (Igκ junction region and constant region) TT2 (or TT2F) cells were obtained from F
Since it is derived from one mouse, a genomic DNA clone derived from a C57BL / 6 mouse was used to prepare an antibody gene knockout vector. Genomic DNA library is Lambda D from Clontech adult C57BL / 6N male liver
The NA library was used. The following synthetic DNA sequence (60 mer) was used as a probe for screening.

Heavy chain Cμ probe: 5′-ACC TTC ATC GTC CT
C TTC CTC CTG AGC CTC TTC TAC AGCACC ACC GTC ACC C
TG TTC AAG-3 '(SEQ ID NO: 59) Light chain kappa probe: 5'-TGA TGC TGC ACC AAC TGT ATC CAT
CTT CCC ACC ATC CAG TGA GCA GTT AAC ATC TGG AGG-
3 ′ (SEQ ID NO: 60) The isolated lambda clone was analyzed, and a DNA fragment containing the heavy chain Cμ or the light chain Jκ-Cκ was subcloned into pBluescript SKII (+) plasmid (Stratagene) (heavy chain
Cμ: FIG. 24; light chain Jκ-Cκ: FIG. 25). Using these DNA fragments, a targeting vector for disrupting mouse antibody genes in TT2 (or TT2F) ES cells was prepared as follows.

3. Preparation of mouse antibody heavy chain gene disruption vector plasmid Genomic DNA containing mouse antibody heavy chain constant region prepared in 2
DNA fragment (BamHI to XhoI) containing the second to fourth exons in the region encoding Cμ of LoxP-p
Replaced with stNEO gene (Fig. 26). The transcription direction of pstNEO is opposite to the transcription direction of the antibody gene.
This plasmid DNA was amplified using Escherichia coli JM109 and purified by cesium chloride equilibrium centrifugation (Introduction to Cell Engineering Experiment Operation, published by Kodansha in 1992). Purified plasmid DN
A is cut at a single site with the restriction enzyme SacII and TT2 (or
TT2F) Used for transfection into ES cells. The antibody heavy chain portion is located upstream of Cμ as a probe for transformant genomic DNA Southern blot to detect clones in which homologous recombination has occurred with the targeting vector in transformant TT2 (or TT2F) ES cells The DNA fragment (about 500 base pairs) of the switch region to be used was used. This DNA
The fragment was obtained by PCR-amplifying 129 mouse genomic DNA under the following conditions.

Sense primer: 5'-CTG GGG TGA GCC G
GA TGT TTT G-3 '(SEQ ID NO: 61) Antisense primer: 5'-CCA ACC CAG CTC AGC CCA
GTT C-3 '(SEQ ID NO: 62) Template DNA: EcoRI digested 129 mouse genomic DNA 1 μg Reaction buffer, deoxynucleotide mix, TaqD
NA polymerase used by Takara. Reaction conditions: 94 ° C, 3 minutes, 1 time → 94 ° C, 1 minute; 55 ° C, 2
Min; 72 ° C, 2 minutes; 3 times → 94 ° C, 45 seconds; 55 ° C, 1 minute; 72
Degree C, 1 minute; 36 times

After confirming that the amplified DNA could be cut at one site with the restriction enzyme HindIII as indicated in the Genbank database, it was subcloned into the EcoRV cleavage site of the pBluescript plasmid. This plasmid DNA (S8) was digested with restriction enzymes BamHI and XhoI, and a PCR fragment (about 550 base pairs) purified by agarose gel electrophoresis was used as a probe. TT transformed with targeting vector
2 (or TT2F) ES cells genomic DNA with restriction enzymes EcoRI and Xho
After digestion with I, separation by agarose gel electrophoresis, Southern blot is performed, and detection is performed using the above probe.

[0193] 4. Preparation of mouse antibody gene light chain k disruption vector Preparation of DNA fragment (EcoRI to SacII) containing J region (J1 to J5) of genomic DNA containing mouse antibody light chain κJ region and constant region prepared in 2 LoxP-pstNEO gene (Fig. 27). The transcription direction of pstNEO is the same as the transcription direction of the antibody gene. This plasmid
DNA was amplified using Escherichia coli JM109 and purified by cesium chloride equilibrium centrifugation. Purified plasmid DNA
Is cut at a single site with the restriction enzyme KpnI to
2F) Used for transfection into ES cells. Light chain Jκ-Cκ as a probe for transformant genomic DNA Southern blot to detect clones in which the antibody heavy chain portion has undergone homologous recombination with the targeting vector from among the transformant TT2 (or TT2F) ES cells Genomic DNA (25th
3) DNA fragment (XhoI to EcoRI; about 1.4 kbp). Transform the genomic DNA of TT2 (or TT2F) ES cells transformed with the targeting vector with the restriction enzyme EcoRI.
After digestion with agarose gel electrophoresis, Southern blotting is performed, and detection is performed using the above probe.

(Example 49) Acquisition of mouse ES cell antibody heavy chain gene-disrupted strain In order to obtain an antibody heavy chain gene homologous recombinant, (Example 48) -3
The antibody heavy chain targeting vector created in Step 1 was linearized with the restriction enzyme SacII (Takara Shuzo), and then used (Shinichi Aizawa, Bio Manual Series 8, Gene Targeting, Yodosha, 19
The cells were introduced into mouse ES cells TT2F according to the method of 95). Trypsinize TT2F cells and adjust to 2.5x10 ⁷ cells / ml in HBS
And 5 μg DNA was added thereto, and electroporation was performed using a Gene Pulser (Biorad, without connecting a resistor unit). A voltage of 250 V with a capacitance of 960 μF was applied at room temperature using a 4 mm long electroporation cell. Transfer the electroporated cells to 20 ml ES
100m suspended in the medium and pre-soaked with feeder cells
m The cells were seeded on two tissue culture plastic dishes (Corning). Similarly, experiments using 10, 15 μg DNA were also performed.
One day later, the medium was replaced with a medium containing 300 μg / ml G418 (GENETICIN, Sigma). A total of 176 colonies formed after 7 to 9 days were picked up, and each was grown to confluence in a 12-well plate, and 4/5 thereof was added to 0.2 ml of a storage medium (ES medium + 10% DMSO <Sigma>). ) And stored frozen at -80 ° C. The remaining 1/5 was seeded on a 12-well gelatin-coated plate, cultured for 2 days, and genomic DNA was obtained by the method described in (Example 2). These G418-resistant TT2F cell genomic DNAs were digested with restriction enzymes EcoRI and XhoI (Takara Shuzo), separated by agarose gel electrophoresis, and subjected to Southern blot.
(Example 48) Homologous recombinants were detected with the probe shown in -3. As a result, 3 out of 176 strains were homologous recombinants. Wild-type TT2F cells and homologous recombinants # 131, # 1
The results of 41 Southern blot analyzes are shown in FIG. 28 (left lane). In wild-type TT2F cells, 2
Bands (a, b) of the book are detected. In the homologous recombinant, it is expected that any of these bands will disappear and a band (c) will newly appear at the bottom. # 131,
In # 141, the band of a disappeared, and the band of c newly appeared. The size of the DNA is shown on the left side of the figure. That is, in these clones, one allele of the antibody heavy chain gene was disrupted by homologous recombination.

(Example 50) Preparation of chimeric mice from antibody heavy chain homologous recombinant ES cells The antibody heavy chain homologous recombinant TT2F cell line # 131 obtained in (Example 49) was set up from a frozen stock. ICR or MCH (IC
R) (CLEA Japan) 8 obtained by mating of male and female mice
Cell stage embryos were injected 10-12 per embryo. After culturing overnight in an ES cell culture medium (Example 9) to generate blastocysts, the uterus of a foster parent ICR mouse (CLEA Japan) 2.5 days after pseudopregnancy was treated with about 10 cells per uterus Injected embryos were implanted. As a result of transplanting a total of 94 injected embryos, 22 offspring mice were born. The chimeric individual has a host color (IC
The determination is made based on whether a wild color (dark brown) derived from TT2F cells is observed in the white derived from R). Of the 22 animals born, there is a clearly wild color part in the coat color, that is, ES
Eighteen individuals showed a contribution of cells. Of these, 16 females were female chimeric mice (80% or more) of wild color (derived from ES cells). From this result, it was confirmed that the antibody heavy chain homologous recombinant ES cell line # 131 retains the chimera-forming ability. Since many individuals among the obtained chimeric mice are females showing a very high contribution rate, it is highly possible that ES cells have differentiated into functional germ cells (eggs). Two female chimeras showing 100% contribution rate among chimeric mice
As a result of crossing with CH (ICR) male mice, all born offspring exhibited wild color. These offspring were derived from # 131 (see Example 42) and are thought to have transmitted the disrupted antibody heavy chain allele in one out of two mice.

(Example 51) Antibody heavy chain homologous recombinant
Acquisition of double disrupted strain ES in which one side allele was destroyed by insertion of G418 resistance gene
It has been reported that in a cell line, it is possible to obtain a strain in which both alleles are destroyed by screening for a high-concentration G418-resistant strain obtained by increasing the G418 concentration in the culture solution and culturing (Aizawa) Shinichi et al., Bio Manual Series 8, Gene Targeting, Yodosha, 199
Five). Based on this, we developed the TT2F antibody heavy chain homologous recombinant #
The following experiments were performed for 131 and # 141 in order to obtain the disrupted strains of both alleles. First, lethal G4 for both # 131 and # 141
For the 18 concentration assay, 10 plates of 35 mm dishes each (in this example, the vegetative cells were not treated with mitomycin G418
Primary resistant cultured cells were used. (See Example 9), about 100 cells were seeded per cell, and 0, 0.5, 1, 2, 3, 5, 8, 1
The cells were cultured for 10 days in an ES medium containing 0, 15, 20 mg / ml of G418 (GENETICIN, Sigma). As a result, clear colonies were observed up to a concentration of 3 mg / ml, but no colony formation was observed at 5 mg / ml. Based on these results, the minimum lethal concentration was determined to be 5 mg / ml, and high concentration G418-resistant strains were selected at the respective concentrations of 4, 5, 6, 7, and 8 mg / ml. # 131, # 141
Approximately 10 per 100 mm Petri dishes for each
^Six cells were inoculated and cultured in an ES medium containing G418 at each of the above concentrations (5 stages, two dishes at each concentration). Twelve days after the start of the culture, clear colonies (# 131: 12 strains, # 141: 10 strains) were picked up in 7 mg and 8 mg / ml dishes, and cryopreservation and DNA acquisition were performed in the same manner as in (Example 49). The genomic DNA of these high-concentration G418-resistant strains was
After digestion with RI and XhoI (Takara Shuzo), and separation by agarose gel electrophoresis, Southern blot was performed, and strains in which both alleles were disrupted were detected with the probe shown in (Example 48) -3.
As a result, one strain (# 131-3) derived from the # 131 strain was obtained as a double-sided allele-disrupted strain. The results of Southern blot analysis of the 6 strains derived from # 131 are shown in FIG. 28. Wild type
In TT2F cells, two wild-type bands (a, b) are detected by digestion with EcoRI and XhoI. One-sided allele homologous recombinant (# 13
In (1, # 141), the upper band a disappears, and a new band c appears (Example 49). Further, it is expected that the other wild type band b disappears due to the destruction of both side alleles, leaving only the destruction type band c. This band pattern was observed in the clone 3 (# 131-3) in the figure. That is, this clone has both alleles of the antibody heavy chain gene disrupted.

(Example 52) Antibody heavy chain-deficient homozygote TT2F
Removal of G418 Resistance Marker Gene from Cell Line The G418 resistance marker gene of the antibody heavy chain bilateral allele disrupted strain (high-concentration G418 resistant strain # 131-3) obtained in Example 51 was removed by the following procedure. An expression vector pBS185 (BRL) containing a Cre recombinase gene that causes site-specific recombination between the loxP sequences (Example 48-1) inserted on both sides of the G418 resistance marker gene (Shinichi Aizawa, Biomanual Series 8, Gene Targeting, Yodosha, 1995,
And Seiji Takatsu et al., Experimental Medicine Separate Volume, Basic Technology for Immunological Research,
p255-, 1995, Yodosha). # 131-3 cells were treated with trypsin, suspended in HBS to a concentration of 2.5 × 10 ⁷ cells / ml, 30 μg of pBS185 DNA was added, and electroporation was performed using a Gene Pulser (Biorad, without connecting a resistor unit). Rations.
A voltage of 250 V with a capacitance of 960 μF was applied using a 4 mm long electroporation cell (Example 1). The electroporated cells were suspended in 5 ml of ES medium, and seeded on one 60 mm tissue culture plastic Petri dish (Corning) pre-seeded with feeder cells. Two days later, the cells were trypsinized, and 100, 200, and 300 per petri dish were placed on three 100 mm Petri dishes containing the feeder cells.
The cells were seeded again to become cells. The same procedure was performed under the condition that only the settings of the gene pulsar (resistance unit connection, resistance value infinity) were changed. A total of 96 colonies formed 7 days later were picked up, treated with trypsin, divided into two, and inoculated on two 48-well plates on which feeder cells were seeded and two 48-well plates that had only been subjected to gelatin coating. The latter was cultured in a medium containing 300 μ / ml of G418 (GENETICIN, Sigma) for 3 days, and G418 resistance was determined based on the survival rate. As a result, 6 clones died in the presence of G418. These G418-sensitive strains are grown in a 35 mm Petri dish until confluent, 4/5 of which is suspended in 0.5 ml of a storage medium (ES medium + 10% DMSO <Sigma>) and stored frozen at -80 ° C. did. The remaining 1/5 was seeded on a 12-well gelatin-coated plate, cultured for 2 days, and genomic DN was obtained by the method described in (Example 2).
A got. Genomic DNA of these G418-sensitive TT2F cell lines
Was digested with restriction enzyme EcoRI (Takara Shuzo), separated by agarose gel electrophoresis, and subjected to Southern blotting. A 3.2 kb XhoI fragment derived from pSTneoB containing the G418 resistance gene (probe A)
As a result, removal of the G418 resistance gene was confirmed. As a result, # 131-3
No band hybridizing with probe A observed in the above was detected in the susceptible strain.
From these results, it was confirmed that the G418-resistant marker gene was certainly removed from the obtained G418-sensitive strain. Furthermore, pBS185 DNA was EcoRI-purified in the same manner as above.
As a result of performing Southern analysis using the digested probe B,
Since no specific band hybridizing with probe B was detected in these G418-sensitive strains, it is considered that pBS185 containing Cre recombinase was not inserted into the chromosome of the sensitive strain. That is, these susceptible strains were obtained by using the antibody light chain knockout vector (G418) shown in Example 48-4.
(The loxP sequence is present on both sides of the resistance gene).

(Example 53) Introduction of human chromosome 14 (antibody heavy chain) into an antibody heavy chain-deficient ES cell line Mouse ES cells lacking the endogenous antibody heavy chain obtained by (Example 52) Strain (TT2F-derived, G418-sensitive) (Example
As shown in 9), human chromosome 14 (including the antibody heavy chain gene) marked with the G418 resistance gene is introduced by the microcell method. PC in the resulting G418 resistant strain
R analysis and the like (Example 9) confirm the retention of human chromosome 14 (fragment) containing the human antibody heavy chain gene.

(Example 54) Introduction of a human chromosome 2 fragment or chromosome 22 into an antibody heavy chain-deficient ES cell line carrying human chromosome 14 (fragment) Example 1 An antibody heavy chain-deficient mouse ES cell line that retains chromosome
18 and 35), a fragment of human chromosome 2 (antibody light chain κ) marked by the puromycin resistance gene.
Gene or human chromosome 22 (including the antibody light chain λ gene) is introduced by the microcell method. Retention of human chromosome 14 (fragment) and chromosome 2 fragment or chromosome 22 (fragment) in the resulting puromycin and G418 double drug resistant strains is confirmed by PCR analysis and the like (Examples 18 and 35).

Example 55 14 Including Human Antibody Heavy Chain Gene
An endogenous antibody heavy chain-deficient mouse harboring chromosome 7 (fragment)
Creation of chimeric mice from ES cells (Example 53) including human antibody heavy chain gene obtained in 14
Creation of a chimeric mouse from an endogenous antibody heavy chain gene-deficient mouse ES cell line retaining chromosome 7 (fragment) (Example 10)
This is performed by the method shown in FIG. In the chimeric mouse obtained here, the human antibody heavy chain produced by the B cell derived from the ES cell line is detected by the method described in (Example 14).
Further, since the antibody heavy chain gene functional in the ES cell-derived B cells is only derived from humans on the transchromosome, most of the ES cell line-derived B cells produce human antibody heavy chains.

(Example 56) Endogenous antibody heavy chain-deficient mouse ES retaining human chromosomes 14 + 2 and 14 + 22 (fragments)
Generation of Chimeric Mouse from Cells Chimeric mouse from endogenous antibody heavy chain gene-deficient mouse ES cell line carrying human chromosome 14 + 2 and chromosome 14 + 22 (fragment) obtained in (Example 54) Examples 19 and 3
6) Perform the method shown in the above. In the chimeric mouse obtained here, the human antibody heavy chain and light chain κ or light chain λ are detected in the B cells derived from the ES cell line by the method shown in (Examples 14, 23, 32). Also, as in (Example 55), the functional antibody heavy chain gene in this ES cell-derived B cell is only human-derived on the transchromosome. Produce chains. Furthermore, as shown in (Examples 37 and 38), fully human antibody molecules in which both the heavy and light chains are derived from humans are detected.

(Example 57) Endogenous antibody heavy chain-deficient mouse ES retaining human chromosomes 14 + 2 and 14 + 22 (fragments)
Acquisition of a human antibody-producing hybridoma from a cell-derived chimeric mouse In the same manner as in (Examples 15, 25, and 34), a chimeric mouse prepared in (Example 56) is immunized with an antigen of interest, a spleen is removed, and myeloma cells are isolated. Cell fusion is performed to create a hybridoma. After culturing for 1 to 3 weeks, the culture supernatant is analyzed by ELISA. ELISA method (Examples 14, 15, 21, 24, 25, 33, 34, 3
7, 38) to obtain human antibody positive and human antibody positive and immunized antigen-specific clones.

Example 58 Acquisition of Antibody Light Chain Gene-Disrupted Strain from Antibody Heavy Chain-Deficient Homozygous Mouse ES Cells (Example 52) Antibody Heavy Chain-Deficient Homozygous TT2F Cell Line (G418 Sensitivity) , A homologous recombinant in which the antibody light chain gene has been further disrupted is obtained by the following procedure. (Example
The antibody light chain targeting vector prepared in 48-4) was linearized with the restriction enzyme KpnI (Takara Shuzo), and the TT2F cell line (described in Shinichi Aizawa, Bio Manual Series 8, Gene Targeting, Yodosha, 1995) was used according to the method described above. G418 sensitivity)
Introduce to. A colony formed after 7 to 9 days was picked up, cryopreserved by the method described in (Example 49), and genomic DNA
To get. G418 resistant strain genomic DNA was converted with restriction enzymes EcoRI and No.
After digestion with tI (Takara Shuzo), separation by agarose gel electrophoresis and Southern blot analysis, homologous recombinants are detected with the probe shown in (Example 48-4).

(Example 59) Antibody from light chain homologous recombinant
Acquisition of Double-Disrupted Strain For the TT2F antibody light-chain homologous recombinant (and antibody heavy-chain-deficient homozygote) obtained in (Example 58), a strain in which both alleles of the light chain are disrupted is obtained by the following procedure. A high-concentration G418-resistant strain was obtained in the same manner as in (Example 51),
Perform acquisition. High concentration G418 resistant strain Genomic DNA for restriction enzyme E
After digestion with coRI and NotI (Takara Shuzo), and separation by agarose gel electrophoresis, Southern blotting is performed, and the strain in which both alleles are disrupted is detected with the probe shown in (Example 48-4).

Example 60 Removal of G418 Resistance Marker Gene from Antibody Light Chain-Deficient Homozygous (and Antibody Heavy Chain-Deficient Homozygous) TT2F Cell Line (Example 59) Bilateral alleles of antibody light chain obtained by (Example 59) The G418-resistant marker gene of the disrupted strain (high-concentration G418-resistant strain) is removed by the procedure shown in (Example 52). The expression vector pBS185 (BRL) containing the Cre recombinase gene that causes site-specific recombination between the loxP sequences (Example 48-1) inserted on both sides of the G418 resistance marker gene was prepared according to the method described in (Example 52). Introduce to stocks. The G418-sensitive strain obtained in the same manner as in (Example 52) was grown to confluence in a 35 mm Petri dish, and 4/5 thereof was grown in 0.5 ml of a storage medium (ES
Medium + 10% DMSO <Sigma>) and store frozen at -80 ° C. The remaining 1/5 was seeded on a 12-well gelatin-coated plate, cultured for 2 days, and genomic DN was obtained by the method described in (Example 2).
Get A. These G418-sensitive TT2F cell genomic DNAs were digested with the restriction enzyme EcoRI (Takara Shuzo), separated by agarose gel electrophoresis, and subjected to Southern blot.
Confirm removal of the 18 resistance gene.

(Example 61) Introduction of human chromosome 14 (antibody heavy chain) into ES cell line deficient in antibody heavy and light chains Endogenous antibody heavy and light chains obtained by (Example 60) In a mouse ES cell line (TT2F-derived, G418-sensitive) deficient in both of the above, human chromosome 14 (including the human antibody heavy chain gene) marked by the G418 resistance gene as shown in (Example 9) was microcellularly analyzed. Introduced by G4 obtained
In 18 resistant strains, retention of human chromosome 14 (fragment) containing the human antibody heavy chain gene is confirmed by PCR analysis or the like (Example 9).

(Example 62) Antibody heavy chain and light chain deletion and human
Human 2 to ES cell line carrying chromosome 14 (antibody heavy chain)
Introduction of the chromosome (light chain κ) into the mouse ES cell line (TT2F-derived, G418-resistant) that lacks the endogenous antibody heavy and light chains and retains human chromosome 14 obtained in Example 61 As shown in Example 18), a partial fragment of human chromosome 2 (including the human antibody light chain kappa gene) marked with a puromycin resistance gene is introduced by a microcell method. In the obtained puromycin and G418 double drug resistant strain, retention of human chromosome 14 (fragment) and chromosome 2 fragment is confirmed by PCR analysis and the like (Example 18).

(Example 63) Antibody heavy chain and light chain deletion and human
Human 22 to ES cell line carrying chromosome 14 (antibody heavy chain)
Introduction of Chromosome No. (Light Chain λ) Into a mouse ES cell line (derived from TT2F, G418 resistant) lacking the endogenous antibody heavy and light chains and retaining human chromosome 14 obtained in Example 61 As shown in Example 35), human chromosome 22 (including the human antibody light chain λ gene) marked with a puromycin resistance gene is introduced by a microcell method. In the obtained puromycin and G418 double resistant strain, retention of human chromosome 14 (fragment) and human chromosome 22 (fragment) is confirmed by PCR analysis and the like (Example 35).

(Example 64) Human No. 2 (antibody light chain κ), 14
Of endogenous antibody heavy and light chain deficient mouse ES cells that simultaneously retain chromosome No. 22 (antibody heavy chain) and chromosome 22 (antibody lambda chain), or mouse ES cells that simultaneously retain three human chromosomes To obtain human chromosome 2 or 22, blasticidin resistance (Izumi et al., Exp. Cell. Res., 197, 229, 199).
1), hygromycin resistance (Wind et al., Cell, 82, 321-,
Marking by insertion of a marker gene (1995). This is performed by the method described in (Examples 16 and 26).
A mouse ES cell line (TT2F-derived, G418-resistant, which is deficient in the endogenous antibody heavy and light chains and has a human chromosome 14 (fragment) and a partial chromosome 2 fragment obtained in (Example 62)).
In the same manner as in (Example 9), human chromosome 22 (including the human antibody light chain λ gene) marked with blasticidin resistance or hygromycin resistance is introduced into (puromycin resistance). As feeder cells for ES cell culture, use those suitable for each selection marker. If a hygromycin resistance marker is used, primary cultured fibroblasts (Johnson
Et al., Nucleic Acids Research, vol. 23, No. 7, 1273-,
1995). It is confirmed by PCR analysis and the like (Examples 9, 18, and 35) that the obtained G418, puromycin, hygromycin (or blasticidin) triple resistant strain retains the above three types of human chromosomes (fragments). You. A mouse ES cell line (TT2F-derived, G418-resistant, puromycin-deficient in the endogenous antibody heavy chain and light chain obtained in (Example 63) and carrying human chromosome 14 (fragment) and a partial fragment of chromosome 22. Introducing a fragment of human chromosome 2 marked with a hygromycin or blasticidin resistance gene into C. resistance).

(Example 65) Endogenous antibody heavy chain retaining a chromosome (fragment) containing human antibody gene (heavy chain + light chain)
Creation of chimeric mice from light chain gene deficient mouse ES cells (Examples 61, 62, 63, 64) Endogenous antibody heavy chain and light chain gene deficient mice that retain chromosomes (fragments) containing human antibody genes obtained in (Examples 61, 62, 63, 64) Preparation of chimeric mice from ES cell lines is performed by the method described in (Example 10) and the like. In the chimeric mice obtained here, mouse antibodies produced by B cells derived from host embryos and human antibodies mainly produced by B cells derived from ES cell lines were shown in (Examples 14, 23, 32). Detected by method. Further, since the antibody heavy chain and light chain κ genes functional in the ES cell-derived B cells are only those derived from humans on the transchromosome, most of the ES cell-derived B cells are human antibody heavy chains and light chains. Produces the chain κ (Lonberg et al.,
Nature, 368, 856-, 1994). Further, (Examples 37 and 3
By the method described in 8), a fully human antibody molecule in which both the heavy and light chains are derived from human is detected.

(Example 66) Endogenous antibody heavy chain retaining a chromosome (fragment) containing a human antibody gene (heavy chain + light chain)
Obtaining human antibody-producing hybridoma from chimeric mouse derived from ES cell derived from light chain gene-deficient mouse The chimeric mouse obtained in (Example 65) is immunized with the desired antigen in the same manner as in (Example 25), and the spleen is removed. To produce a hybridoma.
After culturing for 1 to 3 weeks, the culture supernatant is analyzed by ELISA. ELISA method (Examples 14, 15, 21, 22, 23, 24, 25, 33, 34, 37,
38) to obtain human antibody positive and human antibody positive and immunized antigen-specific clones.

(Example 67) Preparation of chimeric mouse with heavy chain gene-deficient host embryo Endogenous antibody heavy chain one-sided allele deficient prepared in (Example 49)
Among the offspring of the chimeric mice derived from the TT2F cell line, those showing the wild color are selected by Southern analysis or PCR (Example 49), etc., to retain the defective allele (the expected probability is 1/2). Southern analysis (see Example 49) of offspring mice born from mating of male and female individuals of these antibody heavy chain-deficient heterozygotes, μ-chain expression on the surface of lymphocytes (Kitamura et al., Nature, 350, 423-, 1991) To obtain an antibody heavy chain-deficient homozygote that lacks both side alleles and can hardly produce its own functional antibody (the expected probability is 1/4, membrane-type μ chain deficiency Results in mice: Kitamura et al., Nature, 350, 423-, 19
91). Embryos obtained by crossing homozygous male and female individuals reared in a clean environment can be used as a host for the production of chimeric mice. In this case, the functional B cells in chimeric mice are mostly derived from the injected ES cells. Other mouse strains that are unable to make functional B cells themselves, such as RAG-2 deficient mice (Shinkai et al., Cell, 68, 855-, 1992), can be used for this purpose as well. Endogenous antibody heavy and light chain deletions obtained in this system (Examples 62, 63, 64) and human numbers 14 + 2 or 14 + 22 or 1
Using a mouse ES cell line retaining chromosomes 4 + 2 + 22 (fragment), chimeric mice are prepared by the method shown in (Example 10) and the like. In the obtained chimeric mouse, ES cell-derived B
Human antibody heavy chain functional on cells (on chromosome 14),
It produces antibodies consisting mainly of human heavy and light chains from the light chain κ (on chromosome 2) and light chain λ (on chromosome 22) genes.

(Example 68) Introduction of human chromosome 14 (fragment)
Preservation of human chromosome in progeny of ES cell-derived chimeric mouse Same method as in (Example 9), and mouse ES of (Example 9)
A mixture of a chimeric mouse having human chromosome 14 (fragment) obtained using the method of replacing cells with TT2F (39, XO, Example 39) and a wild-type ICR mouse (Albino, CLEA Japan) Mating. The retention of a human chromosome 14 fragment in genomic DNA prepared from the tail of a born wild-colored offspring mouse is examined by PCR (see Examples 9, 42, and 43). The mouse ES cell line carrying human chromosome 14 (fragment) differentiates into functional eggs or sperm in chimeric mice as shown in (Example 42) and (Example 43), and Human chromosome 14 (fragment) can be transmitted. That is, it is possible to establish a subcultureable mouse strain that retains chromosome 14 (fragment) containing the human antibody heavy chain gene. In this example and the following Examples 69 to 74, human chromosome 14 (fragment) is a human antibody heavy chain gene, human chromosome 2 (fragment) is a human antibody κ chain gene, and human chromosome 22 (fragment) is Refers to each containing a human antibody λ chain gene.

(Example 69) Introduction of human chromosome 22 (fragment)
Retention of human chromosome in progeny of ES cell-derived chimeric mouse Same method as in (Example 30), and mouse of (Example 30)
A chimeric mouse having human chromosome 22 (fragment) obtained by using a method in which ES cells are replaced with TT2F (39, XO) and an ICR mouse are mixed and crossed. The retention of a human chromosome 22 fragment in genomic DNA prepared from the tail of a born wild-colored offspring mouse is examined by PCR (Examples 30 and 4).
2, 43). Mouse ES cell lines carrying human chromosome 22 or a partial fragment thereof were obtained in Examples 42 and 4
As shown in 3), it differentiates into functional eggs or sperm in chimeric mice, and human chromosome 22 (fragment) can be transmitted to the progeny derived therefrom. That is, it is possible to establish a subcultureable mouse strain that retains chromosome 22 (fragment) containing the human antibody light chain λ gene.

(Example 70) Preparation by crossing of mouse individuals simultaneously retaining a human chromosome 2 fragment and a chromosome 14 (fragment) A human chromosome 2 fragment obtained in (Example 42) or (Example 43) Genomic DNA prepared from the tail of a child mouse born by crossing a mouse strain retaining the human chromosome 14 (fragment) obtained in (Example 68) with a mouse strain retaining the 42, 43) to obtain an individual that simultaneously retains the human chromosome 2 partial fragment and the human chromosome 14 (fragment).

Example 71 Human Chromosome 22 (Fragment)
Creation by crossing of mouse individuals simultaneously holding chromosome 14 (fragment) A mouse strain holding human chromosome 22 (fragment) obtained in Example 69 and a human chromosome 14 obtained in Example 68 The genomic DNA prepared from the tail of the offspring mouse born by breeding the mouse strain carrying the fragment) is analyzed by the PCR method or the like (Examples 30, 42, 43), and human chromosome 22 (fragment) and human 14 Obtain an individual that simultaneously retains chromosome number (fragment).

(Example 72) Preparation by crossing of mouse individuals simultaneously retaining a human chromosome 2 fragment, a chromosome 14 (fragment) and a chromosome 22 (fragment) (Example 71) Fragment) and a mouse strain harboring human chromosome 14 (fragment) (Example
Genomic DNA prepared from the tail of the offspring mouse born by crossing with the mouse strain carrying the human chromosome 2 fragment obtained in 42, 43) was subjected to PCR and the like (Examples 9, 30, 42, 4).
3) Analysis of human chromosome 22 (fragment) and human 1
An individual is obtained which simultaneously holds three human chromosomes, chromosome 4 (fragment) and a partial fragment of human chromosome 2. Alternatively, human chromosome 2 (fragment) obtained in (Example 70) and human 14
Mouse strain harboring chromosome 7 (fragment) (Example 69)
Similarly, by crossing with a mouse strain that retains the human chromosome 22 fragment obtained in the above, a mouse individual that simultaneously retains three types of human chromosomes is obtained.

(Example 73) Preparation by crossing of mouse strains that mainly produce fully human antibodies No. 2 + 14 (Example 70), No. 14 + 22 (Example 7)
1), No. 2 + No. 14 + No. 22 (Example 72) A mouse strain retaining the chromosome was converted to an endogenous antibody heavy chain (Example 67; Kitamura et al., Na
ture, 350, 423-, 1991), light chain κ (Zou et al., EMBO J., 1
2, 811-, 1993; Chen et al., EMBO J., 12, 821-, 1993)
PCR analysis of mice harboring chromosomes 2 + 14, 14 + 22, or 2 + 14 + 22 (Examples 9, 30, 42, 43)
To establish a mouse strain that produces mainly predominantly humans (Green et al., Nature Genetics, 7, 13-, 1994,
Lonberg et al., Nature, 368, 856-, 1994).

(Example 74) Obtaining a human antibody-producing hybridoma from a mouse strain having a human chromosome containing a human antibody gene obtained by crossing (Examples 42, 43, 68, 69, 70, 7
A mouse individual having a human chromosome containing the human antibody gene obtained in 1, 72, 73) is immunized with the desired antigen, the spleen is removed, and the cell is fused with myeloma cells to prepare a hybridoma. After culturing for 1 to 3 weeks, the culture supernatant is analyzed by ELISA. ELISA method (Examples 14, 15, 21, 22, 25, 3
3, 34, 37, 38) to obtain human antibody positive and human antibody positive and immunized antigen-specific clones.

(Example 75) Detection and quantification of mouse IgM in the serum of a chimeric mouse derived from a mouse antibody heavy chain bilateral allele disrupted TT2F cell line The mouse antibody heavy chain bilateral allele disrupted TT2F cell line obtained in (Example 51) (# 131-3) From the offspring mice born by the method shown in (Example 40), the chimera rate was
The detection and quantification of mouse IgM in serum was performed for three individuals of 0%, 50% and 99%. ELISA was performed by collecting blood from chimeric mice about 2 weeks old and measuring the mouse IgM concentration in the serum (Example 14).
Quantification was performed using the method. Anti-mouse IgM antibody diluted in PBS
(Kirkegaard & PerryLaboratories Inc., 01-18-03) was fixed, and then a serum sample diluted in PBS supplemented with 5% FBS was added. Peroxidase-labeled anti-mouse IgM antibody (Kirk
egaard & PerryLaboratories Inc., 074-1803)
The absorbance at 450 nm was measured using TMBZ as a substrate. Purified mouse IgM (Pharmingen, 03081D) was used as a standard and diluted stepwise with PBS supplemented with FBS. The results are shown in Table 20.
Of the chimeric mice derived from TT2F cells in which both alleles of the mouse antibody heavy chain have been disrupted, those with a chimera rate of 99%
It was confirmed that the IgM concentration was low and the mouse heavy chain gene of the ES cells hardly functioned.

[0221]

[Table 20]

[0222]

Industrial Applicability According to the present invention, there is provided a chimeric non-human animal which retains one or more foreign chromosomes or fragments thereof and expresses a gene on the chromosome or fragments thereof.
Using the chimeric non-human animal of the present invention, a biologically active substance can be produced. The present invention has provided pluripotent cells that retain one or more foreign chromosomes or fragments thereof and express genes on the chromosomes or fragments thereof. The cells can be used to treat a genetic disease such as by bone marrow transplantation.

[0223]

[Sequence List] SEQUENCE LISTING <110> KIRIN BEER KABUSHIKI KAISHA <120> CHIMERIC ANIMAL AND METHOD FOR PRODUCING THE SAME <130> P99-0160 <140> <141> <150> JP 7-242340 <151> 1995-08- 29 <150> JP 8-027940 <151> 1996-02-15 <160> 62 <170> PatentIn Ver. 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 1 tggaaggtgg ataacgccct 20 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 2 tcattctcct ccaacattag ca 22 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 3 tgtaggggac ctggagcctt g 21 <210> 4 <211> 21 <212 > DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 4 ttgacaactc acctggacta g 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223 > Description of Artificial Sequence: synthetic DNA <400> 5 ctctcctgca gggccagtca 20 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 6 tgctgatggt gagagtgaac tc 22 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 7 agtcagggca ttagcagtgc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 8 gctgctgatg gtgagagtga 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 9 tggtggctga aagctaagaa 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 10 ccagaagaat ggtgtcatta 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 11 tccaggttct gcagagcaag 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA < 400> 12 tgtagttgga ggccatgtcc 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 13 ccccacccat gatccagtac 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 14 gccctcagaa gacgaagcag 20 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 15 gagagttgca gaaggggtga ct 22 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400 > 16 ggagaccacc aaaccctcca aa 22 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 17 ggctatgggg acctgggctg 20 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 18 cagagacaca ggcacgtaga ag 22 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220 > <22 3> Description of Artificial Sequence: synthetic DNA <400> 19 ttaagggtca cccagagact 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 20 tgtagttgga ggccatgtcc 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 21 caaaaagtcc aaccctatca 20 <210> 22 <211> 20 <212 > DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 22 gccctcagaa gacgaagcag 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 23 tcgttcctgt cgaggatgaa 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 24 tcactccgaa gctgcctttc 20 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 25 atgtacagga tgcaactcct g 21 <210> 26 <211> 2 0 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 26 tcatctgtaa atccagcagt 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 27 gatcccatcg cagctaccgc 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 28 ttcgccgagt agtcgcacgg 20 <210> 29 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 29 gatgaactag tccaggtgag tt 22 <210> 30 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 30 ccttttggct tctactcctt ca 22 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 31 atagagggta cccactctgg 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA < 400> 32 aaccaggtag gttgatatgg 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 33 aagttcctgt gatgtcaagc 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 34 tcatgagcag attaaacccg 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 35 tgtgaaggag gaccaggtgt 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 36 tgtaggggtt gacagtgaca 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 37 ctgagagatg cctctggtgc 20 <210> 38 <211> 20 < 212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 38 ggcggttagt ggggtcttca 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223 > Descrip tion of Artificial Sequence: synthetic DNA <400> 39 ggtgtcgtgg aactcaggcg 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 40 ctggtgcagg acggtgagga 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 41 gcatcctgac cgtgtccgaa 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 42 gggtcagtag caggtgccag 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 43 agtgagataa gcagtggatg 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 44 gttgtgctac tcccatcact 20 < 210> 45 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 45 ttgtatttcc aggagaaagt g 21 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 46 ggagacgagg gggaaaaggg 20 <210> 47 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 47 atggactgga cctggaggrt cytctkc 27 <210> 48 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 48 atggagyttg ggctgasctg gstttyt 27 <210> 49 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 49 atgrammwac tktgkwbcwy sctyctg 27 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 50 cagaggcagt tccagatttc 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 51 tgggatagaa gttattcagc 20 <210> 52 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: syntheti c DNA <400> 52 atggacatgr rrdycchvgy kcasctt 27 <210> 53 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 53 ccaagcttca ggagaaagtg atggagtc 28 <210 > 54 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 54 ccaagcttag gcagccaacg gccacgct 28 <210> 55 <211> 28 <212> DNA <213 > Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 55 ccaagcttca gaggcagttc cagatttc 28 <210> 56 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 56 gggaattcgg gtagaagtca ctgatcag 28 <210> 57 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 57 gggaattcgg gtagaagtca cttatgag 28 <210> 58 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 58 gggaattcgg gtagaagtca cttacgag 28 <210 > 59 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 59 accttcatcg tcctcttcct cctgagcctc ttctacagca ccaccgtcac cctgttcaag 60 <210> 60 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 60 tgatgctgca ccaactgtat ccatcttccc accatccagt gagcagttaa catctggagg 60 <210> 61 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 61 ctggggtgag ccggatgttt tg 22 <210> 62 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400 > 62 ccaacccagc tcagcccagt tc 22

[0224]

[Sequence Listing Free Text] The sequences of SEQ ID NOs: 1 to 62 are nucleotide sequences of synthetic DNA.

[Brief description of the drawings]

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows A containing human chromosome 2 (fragment).
The results of 9 cell analysis (PCR analysis) are shown.

FIG. 2 shows that human chromosome 22 (fragment) is retained in the E14 resistant strain (PCR analysis).

FIG. 3 is an electrophoretic photograph showing that a human L1 sequence is retained in a chimeric mouse derived from chromosome 22-introduced ES cells (Southern analysis).

FIG. 4 is an electrophoresis photograph showing the state of retention of human chromosomes in a human chromosome 22-introduced chimeric mouse organ (PCR analysis).

FIG. 5 is an electrophoretic photograph showing the results of human gene expression (RT-PCR) in a human chromosome 22-introduced chimeric mouse.

FIG. 6 is an electrophoresis photograph showing the result of human gene expression (RT-PCR) in the organ of a chimeric mouse into which human chromosome 22 has been introduced.

FIG. 7 shows that human chromosome 4 (fragment) is retained in the E14 resistant strain (PCR analysis).

FIG. 8 is an electrophoresis photograph showing the results of detection (Southern analysis) of the human L1 sequence in a human chromosome 4 transfected E14 cell line.

FIG. 9 is an electrophoretic photograph showing that a human L1 sequence is retained in a human chromosome 4 introduced ES cell-derived chimeric mouse (Southern analysis).

FIG. 10 shows that human chromosome 14 (fragment) is retained in the TT2-resistant strain (PCR
analysis).

FIG. 11 is an electrophoresis photograph showing retention of human chromosomes in a chimeric mouse organ derived from human chromosome 14-transfected ES cells (PCR analysis).

FIG. 12 shows the results of a G418 resistance test of tail-derived fibroblasts.

FIG. 13 shows the human antibody IgM concentration (ELISA) in the serum of a human serum albumin-immunized chimeric mouse.

FIG. 14 shows the concentration of human antibody IgG (ELISA) in the serum of human serum albumin-immunized chimeric mice.

FIG. 15 shows the results of analysis (ELISA) of human IgM-producing hybridoma clone H4B7.

FIG. 16 shows a mouse ES cell line (TT2 cell line P
15 is a photograph of a chromosome morphology showing the result of FISH analysis of G15).

FIG. 17 shows an increase in anti-human serum albumin human IgG antibody titer in serum of human serum albumin-immunized chimeric mouse.

FIG. 18 shows an increase in the anti-human serum albumin human Igκ antibody titer in the serum of a human serum albumin-immunized chimeric mouse.

FIG. 19 is an electrophoresis photograph showing the results of detection (Southern analysis) of the human L1 sequence in the human chromosome 22-introduced TT2 cell line.

FIG. 20 shows an increase in anti-human serum albumin human Igλ antibody titer in serum of a human serum albumin-immunized chimeric mouse.

FIG. 21 shows that the human chromosome 2 partial fragment is retained in the offspring of the human chromosome 2 partial fragment-introduced chimeric mouse (PCR analysis).

FIG. 22 shows the presence of cells expressing human μ-chain on the cell surface in the spleen of a human chromosome 14-introduced chimeric mouse (flow cytometric analysis).

FIG. 23 shows the structure of LoxP-pstNEO plasmid DNA.

FIG. 24 shows the structure of genomic DNA of mouse antibody heavy chain Cμ.

FIG. 25 shows the structure of genomic DNA of mouse antibody light chain κ.

FIG. 26 shows a mouse antibody heavy chain targeting vector, the structure of a probe for Southern blot, and a DNA fragment to be detected in a homologous recombinant.

FIG. 27 shows a mouse antibody light chain κ targeting vector, the structure of a probe for Southern blotting, and a DNA fragment to be detected in a homologous recombinant.

FIG. 28 is an electrophoretic photograph showing the results of Southern analysis of a mouse antibody heavy chain homologous recombinant and a homologous recombinant-derived high-concentration G418-resistant strain.

Continued on the front page (72) Inventor Mitsuo Oshimura 86 Nishimachi, Yonago City, Tottori Prefecture Within the Department of Life Sciences, Faculty of Medicine, Tottori University (72) Inventor Isao Ishida 3 Miyaharacho, Takasaki City, Gunma Prefecture Kirin Beer Co., Ltd.

Claims (45)

[Claims] 1. A microcell containing a single or a plurality of foreign chromosomes or a fragment thereof is prepared, and the single or plural foreign chromosomes or a fragment thereof are transferred to a cell having pluripotency by fusion with the microcell. A method for producing a chimeric non-human animal, which comprises transferring. 2. A microcell containing a single or multiple foreign chromosomes or a fragment thereof is prepared, and the single or multiple foreign chromosomes or a fragment thereof is transferred to cells having pluripotency by fusing with the microcell. A method for producing a cell that retains pluripotency and contains a single or a plurality of foreign chromosomes or a fragment thereof, wherein the method comprises transferring. 3. The method according to claim 1, wherein the single or plural foreign chromosomes or fragments thereof have a size exceeding 670 kb. 4. The method according to claim 3, wherein the size of one or more foreign chromosomes or fragments thereof is 1 Mb (million base pairs) or more. 5. The method according to claim 1, wherein the foreign chromosome or a fragment thereof contains a region encoding an antibody. 6. A hybrid cell prepared by fusing a cell containing a single or a plurality of foreign chromosomes or a fragment thereof with a cell having a high microcell forming ability and a cell containing a single or a plurality of foreign chromosomes or a fragment thereof. The method according to claim 1, wherein the method is derived from: 7. A microcell containing one or more foreign chromosomes or fragments thereof, wherein the microcell is derived from a cell produced by fusing a microcell derived from the hybrid cell with a cell having a higher microcell-forming ability. 7. The method of claim 6, wherein: 8. The cell containing one or more foreign chromosomes or fragments thereof is a normal human diploid cell.
The described method. 9. The cells having high microcell forming ability are mouse A
The method according to any one of claims 6 to 8, wherein the method is 9 cells. 10. The method according to claim 1, wherein the cells having pluripotency are ES cells. 11. The foreign chromosome or a fragment thereof contains the gene of interest, and the cell retaining pluripotency is disrupted by deleting the same or homologous gene as the gene of interest on the foreign chromosome or fragment thereof. 3. The method according to claim 1 or 2, wherein 12. The same or homologous gene as the target gene is added to a cell having pluripotency which has the same or homologous gene as the target gene on the foreign chromosome or a fragment thereof disrupted. The method according to claim 1, wherein after transferring the exogenous chromosome or a fragment thereof, a chimera of the cell and a non-human animal embryo of a strain deficient in the same or homologous gene as the target gene is prepared. 13. The method according to claim 12, wherein the non-human animal of the strain deficient in the same or homologous gene as the target gene has been produced by a target gene homologous recombination method. 14. The chimeric non-human animal has one or more foreign chromosomes or fragments thereof, expresses genes on the foreign chromosomes or fragments thereof, and is capable of transmitting the foreign chromosomes or fragments thereof to progeny. Claim 1
The described method. 15. The method according to claim 1, wherein the chimeric non-human animal is a mammal. 16. The method according to claim 15, wherein the mammal is a mouse. 17. A cell that retains pluripotency and contains a single or multiple foreign chromosomes or fragments thereof. 18. The cell according to claim 17, wherein the single or plural foreign chromosomes or fragments thereof have a size exceeding 670 kb. 19. Use of the cell according to claim 17 or 18 for producing a chimeric non-human animal. 20. A chimeric non-human animal that holds one or more foreign chromosomes or fragments thereof and expresses a gene on the foreign chromosomes or fragments thereof, or the above-described single or multiple foreign chromosomes or fragments thereof And its progeny that express the gene on the foreign chromosome or fragment thereof. 21. The chimeric non-human animal or progeny thereof according to claim 20, wherein the single or plural foreign chromosomes or fragments thereof have a size exceeding 670 kb. 22. A non-human that retains one or more foreign chromosomes or fragments thereof obtained by crossing the chimeric non-human animal or progeny thereof according to claim 20, and expresses a gene on the foreign chromosomes or fragments thereof Animal or
A progeny thereof that retains one or more foreign chromosomes or fragments thereof and expresses a gene on the foreign chromosome or fragments thereof. 23. A tissue derived from the chimeric non-human animal according to claim 20 or progeny thereof or the non-human animal according to claim 22 or progeny thereof. 24. A cell derived from the chimeric non-human animal or progeny thereof according to claim 20, or a non-human animal or progeny thereof according to claim 22. 25. The cell according to claim 24, which is a B cell. 26. A hybridoma produced by fusing the cell of claim 24 with a myeloma cell. 27. The chimeric non-human animal according to claim 20, which carries one or more foreign chromosomes or a fragment thereof, and expresses a gene on said foreign chromosome or a fragment thereof, or the non-human progeny thereof according to claim 22. A non-human animal produced by crossing a human animal or a progeny thereof with a non-human animal of a strain deficient in the same or homologous gene as the gene, or the above-mentioned single or plural foreign chromosomes or A progeny that retains the fragment and expresses the foreign chromosome or the gene on the fragment. 28. A gene on a single or plural foreign chromosomes or fragments thereof in the chimeric non-human animal or its progeny according to claim 20, or the individual, tissue or cell of the non-human animal or its progeny according to claim 22 And producing a biologically active substance as a product thereof. 29. The method according to claim 28, wherein the cell of the chimeric non-human animal is a B cell. 30. The B cell fused with a myeloma cell,
30. The method of claim 29, wherein the method is immortalized. 31. The method according to any one of claims 28 to 30, wherein the biologically active substance is an antibody. 32. The antibody of claim 31, wherein the antibody is a mammalian antibody.
The described method. 33. The method of claim 32, wherein said mammalian antibody is a human antibody. 34. The chimeric non-human animal according to claim 20, which retains one or more foreign chromosomes or a fragment thereof, and expresses a gene on the foreign chromosome or a fragment thereof, or a non-human progeny thereof or the non-human non-human animal according to claim 22. A human animal or a progeny thereof is crossed with a non-human animal of a strain deficient in the same or homologous gene as the gene, and in the individual, tissue or cell of the offspring born, the single or multiple foreign chromosomes described above Alternatively, a method for producing a biologically active substance, comprising expressing a gene on a fragment thereof and collecting a biologically active substance as a product thereof. 35. A non-human animal that retains and expresses at least one human antibody gene having a size of more than 670 kb. 36. The non-human animal according to claim 35, which retains and expresses at least one human antibody gene having a size of 1 Mb or more. 37. The human antibody gene is a human heavy chain gene,
36. The non-human animal of claim 35, wherein the non-human animal is selected from the group consisting of a human light chain κ gene, a human light chain λ gene, and combinations thereof. 38. The non-human animal antibody gene identical or homologous to the human antibody gene is deleted.
The non-human animal according to any one of the above. 39. The non-human animal according to claim 38, wherein the deficiency of the non-human animal antibody gene which is the same as or homologous to the human antibody gene is due to disruption of the non-human animal antibody gene by homologous recombination. 40. A hybridoma obtained by fusing the spleen cells of the non-human animal according to any one of claims 35 to 39 with myeloma cells. 41. A non-human animal that expresses at least one class or subclass of a human antibody. 42. The non-human animal of claim 41, wherein the class or subclass of the human antibody is selected from IgM, IgG, IgE, IgA, IgD and subclasses thereof, and combinations thereof. 43. A non-human animal that holds one or more foreign DNAs having a total base length exceeding 670 kb and expresses a gene on the foreign DNA, or holds the single or multiple foreign DNAs. , Its progeny expressing the gene on the DNA. 44. The non-human animal or progeny thereof according to claim 43, wherein the non-human animal has one or more foreign DNAs having a total base length of 1 Mb or more and expresses a gene on the foreign DNA. 45. A microcell containing a single or multiple foreign chromosomes or a fragment thereof is prepared, and the single or multiple foreign chromosome or a fragment thereof is transferred to a blastocyst-derived cultured cell by fusion with the microcell. Transferring and transplanting to an unfertilized egg enucleated with the nucleus of the cell,
A method for producing a transgenic non-human animal.