JPH11299485A - Method for amplifying nucleic acid and amplification primer for said method - Google Patents

Abstract

PROBLEM TO BE SOLVED: To surely amplify a nucleic acid by subjecting the part of a specific base sequence or the like to a PCR amplification using a primer having a sequence supplementary to said base sequence excluding at least one base in a specific region from the 3'-terminal and a DNA polymerase. SOLUTION: A group of fragments 35, 39 consisting of base sequence parts having a specific base sequence of a nucleic acid or specific fragments having the specific base sequence of a mixture of fragments of the nucleic acid are prepared by introducing an oligomer 30 having a known base sequence into DNA fragments. Besides a modified primer 31 is prepared by substituting at least one base in a range of the fourth base to the sixth base from the 3'-terminal with a base 36 different from that of the base sequence supplementary to the mold DNA fragment 39 to obtain a primer artificially modified in such a manner that it is not complementary to the mold DNA fragment 35. The group of fragments 35, 39 are subjected to a selective PCR amplification by using said modified primer 31 and a DNA polymerase, and thereby an amplification of a nucleic acid is carried out by suppressing a pseudo positive amplification and a pseudo negative amplification, which are encountered in a case where a group of fragments are classified by using a normal PCR or selective PCR.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to polynucleotide analysis, sample preparation and fractionation for polynucleotide analysis, nucleic acid amplification and amplification primers used therefor, and more particularly to DNA polymorphism analysis and RNA expression measurement. The present invention relates to a fingerprint method used, preparation of a DNA sample for DNA base sequence determination, and primers used for these.

[0002]

2. Description of the Related Art Fingerprinting method: A polynucleotide in a living body such as DNA or mRNA is measured,
Attempts to clarify the function of life are becoming active.
For this purpose, (1) a probe test for preparing a DNA probe having a base sequence complementary to the target DNA and checking whether or not the probe hybridizes with the target DNA; (2) a target DNA There is a PCR test in which a certain region of the base sequence is selected, and whether or not PCR amplification is performed using a set of primers, or the length and base sequence of the amplified fragment are checked.

The above test is good for examining a specific DNA region or a specific mRNA, but when examining an unspecified number of DNA regions or a specific mRNA, the types of probes and primers to be used are enormous. Not practical.

[0004] In the first place, since a living body is formed by expressing a great variety of genes in association with each other, it is necessary to comprehensively evaluate the transcriptional expression of genes contained in chromosomes. Also, in an attempt to elucidate cancer or a genetic disease at the DNA level, it is necessary to compare mRNAs in healthy cells and mutant cells or to compare DNA differences in a relatively wide range.

In the measurement of mRNA, first, mR is measured from cells.
The NA is extracted and cDNA is made using the reverser enzyme. c
Since DNA is a mixture of about 10,000 species, it is cloned to obtain individual cDNAs. Since the individual cDNA species obtained by cloning depends on the expression frequency of the original mRNA, the number of identical clones is counted, and the expression frequency of each mRNA can be measured by classifying each clone (Katsuji
Murakawaet. al. , Genomic
s, 23, 379-389 (1994)).

[0006] Also, utilizing the fact that the fragment cleavage site sequences obtained by cleaving cDNA using a class II restriction enzyme are divided into groups according to the base sequence, molecular index method (K. Kato,
Nucleic Acids Res. , 23,3685
-3690 (1995)).

Further, a differential display (Peng) for comparing mRNA expression between cells or organs.
Liang and Arthur B.L. Parde
e, Science 258, 967-972 (199)
2)) and amplified fragment length polymorphism analysis (Amplified
Fragment Length Polymorph
isms) (WO 93/06239) has attracted attention. In these methods, a pattern obtained by PCR-amplifying mRNA using random primers or primers having an arbitrary nucleotide sequence is compared, and mRNA between cells or organs is compared.
It allows comparison of expression.

On the other hand, a fingerprinting method focusing on a genome or a specific DNA region has also been attempted. In the restriction enzyme landmark scanning method, the genome is cut with NotI, which is a rare cutter, and a label is introduced into the cut portion. Next, separation is performed by agarose electrophoresis. After the electrophoretic separation, the separated DNA is re-cut in a gel with a 4-base recognition enzyme, and then the agarose gel is developed on a polyacrylamide plate gel. That is, a technique is devised that two-dimensional electrophoresis can detect DNA fragments derived from a very wide variety of genomes.

[0009] 2. Preparation of DNA Sample for DNA Base Sequence Determination: There is an increasing need for higher efficiency of DNA base sequence determination centering on genome analysis. The DNA fragment is labeled with a conventional radioisotope, and the DNA fragment is subjected to gel electrophoresis.
A method of labeling DNA with a fluorescent substance, irradiating light while performing gel electrophoresis, and automatically optically detecting a DNA fragment instead of a base sequence determination method performed by measuring the length of the DNA fragment and manually (DNA sequencer ) Is becoming popular. In this method, a DNA oligomer as a primer is hybridized to a target DNA, DNA fragments of various lengths used for base sequence determination in complementary strand synthesis using an enzyme are prepared, and the DNA fragments are subjected to gel electrophoresis. The base sequence is determined by examining the size, and is called the Sanger method or dideoxy method. In this method, the length at which the base sequence can be determined at a time is determined by the length separation ability by gel,
It is 700 bases long. Genomes and mRNAs are mostly targeted for nucleotide sequence determination, but even mRNAs are several kilobases long, and genomes are often longer than this. Can not.

The shotgun method has been used to determine the nucleotide sequence of such a long DNA (several K to several tens K bases). In the shotgun method, DNA is randomly cut using ultrasonic waves or the like, a DNA fragment is cloned, embedded in Escherichia coli or the like, and colonies are cultured, and then Escherichia coli in each colony is cultured to increase the number of copies of DNA. Next, the sample DNA is extracted and subjected to DNA analysis such as base sequence determination. In this method, DN contained in the picked-up colony
A contains a fragmented sample DNA, but since it is unknown which part of the sample DNA, the DNA fragment has a high degree of redundancy and corresponds to a DNA fragment 5 to 20 times the DNA chain length to be determined. Must be analyzed and wasteful. In the shotgun method, random fragment preparation is performed in order to clarify the connection of each fragment in principle, and overlapping between fragments is performed. Therefore, it is suitable for long DNA whose nucleotide sequence is completely unknown. Has become a major technique.

[0011] Of note in the field of the ongoing human genome project is that most of the approximately 3 billion base pairs will be elucidated in the early 21st century. In the nucleotide sequence that has already been elucidated, mutations due to diseases in the DNA nucleotide sequence,
Research has begun to elucidate gene functions based on differences in DNA base sequences between individuals. For such purposes, a specific portion (usually a
Exon portions that are significant after sequencing are several kilobases long even if they are long, and several kilobases long even when the mRNA corresponding to the gene actually expressed is sequenced). And nucleotide sequencing is important. That is, once the whole picture of the genome base sequence is known, it is not necessary to prepare random fragments and to overlap the fragments.

On the other hand, a method of sequentially determining a DNA fragment to be determined from the end (primer walking method: Analytical Biochemistry)
y, 222, 237-135 (1994)). In the primer walking method, after the base sequence is determined, the next primer region is selected from the base sequence and the base sequence is determined again by the dideoxy method. Therefore, the base sequence can be determined efficiently with less waste. However, since the base sequence is determined in chronological order, there are disadvantages that it takes time and that it takes time to prepare primers for each analysis.

The present inventors have proposed a method using a prepared set of selective primers as a method for overcoming the above-mentioned drawbacks. In this method, DNA to be sequenced is completely cut with a restriction enzyme such as a 4-base recognition enzyme to prepare a fragment group having no overlap. The base sequence of the generated DNA fragment is unknown except for the base sequence at the part recognized and cut by the enzyme. A primer having a known base sequence hybridizes and does not particularly have a priming site serving as a starting point of complementary strand synthesis. 3 'of the fragment generated there
An oligomer having a known base sequence is bonded to the terminal side to form a priming site. When a primer is hybridized to a DNA fragment to form a DNA extended chain by complementary strand synthesis, two bases at the 3 ′ end of the primer (referred to as selection base sequence) are DN
It is known that the reaction proceeds when it is completely complementary to the A fragment and hybridizes perfectly, but otherwise the reaction is slow.

Therefore, a primer set having any two bases (16 base sequences) added to the 3 ′ end of the base sequence complementary to the introduced oligomer (a total of 16 primers having different base sequences of the terminal 2 bases in total) Primers), and by selecting a set of primers from this, D
A specific fragment having a nucleotide sequence completely complementary to the primer can be selectively amplified and separated from the NA fragment mixture (DN
A Research 1, 231-237 (199
4), Gene, 176, 231-135 (199
6), Electrophoresis 17, 183
3-1740 (1996). In this method, the double-stranded DN
Since PCR amplification is performed with a set of primers corresponding to the material end of A (hereinafter referred to as selection PCR), there are 256 primer sets. If the type of DNA fragments contained in the DNA fragment group is about 40, only specific fragments can be amplified almost certainly. By using selective PCR in this manner, the base sequence of a mixed DNA fragment can be easily determined without duplication using 16 primers without cloning or the like.

[0015]

SUMMARY OF THE INVENTION Many types of mRNA,
It is important to understand the whole picture of a huge DNA like a genome in order to elucidate life phenomena at the level of DNA and gene expression, but at present there is no good method. The above 1. In the detection of mRNA and large DNA by the ordinary amplification by PCR and the PCR described in the above, usually, at most several tens of types of DNA can be examined at once, and up to 10,000 types of mRNA and DNA fragments can be detected. Cannot be detected in one line exhaustion.

In recent years, the technology of a probe chip for arranging 10,000 to 100,000 kinds of probes on a substrate has been advanced, and it has become possible to simultaneously detect many types of mRNAs and DNA fragments using probe hybridization. I have. However, since the probe chip has a small area, the amount of the probe to be fixed is limited, so that it is not suitable for detection of a small amount. In addition, since a means for recovering DNA or the like captured by the hybridization has not been developed, it is disadvantageous in terms of utilizing DNA and mRNA that have been separated from the method using electrophoresis. In the field of molecular biology, it is important that mRNA (or DNA) detected as in a differential display is fractionated and the difference can be confirmed by sequencing.

Differential display, amplification fragment length polymorphism analysis, and restriction enzyme landmark scanning method can be used for fractionation. However, in the differential display method and the analysis of amplified fragment length multisystem, since PCR amplification is used, there are many cases where a false positive amplification or a fragment to be amplified is not amplified (hereinafter, referred to as false negative amplification), and it is not necessarily in vivo. It does not reflect mRNA expression.

In addition, since the restriction enzyme landmark scanning method does not usually use an amplification reaction, there is little false positive problem, but there is a limitation in detection sensitivity. In addition, it is difficult to obtain reproducibility of two-dimensional electrophoresis, and its use has been delayed in the analysis of DNA-related fields where database creation is important.

In any case, in order to obtain or separate information from a very small amount of genome or mRNA, a DNA fragment or cDNA is required.
Fragment amplification is an essential point. That is, the biggest problem is the problem of false positive amplification during amplification. Even if the vicinity of the 3 'end of the primer is not complementary to the template, amplification occurs, though only slightly. Once the wrong template is amplified, the primer and the incorrectly amplified template then have a completely complementary relationship, and amplification occurs at the same rate as the correct template. The biggest problem is the selectivity of primers used for amplification.

On the other hand, in the field of nucleotide sequencing, the emergence of a new nucleotide sequencing method that takes into account the post-genome is desired. However, the shotgun method utilizing the randomness of sample preparation to the maximum is required in advance in a limited region. As described above, it is ineffective for the purpose of detecting a mutation in a region where the nucleotide sequence is known. It is better to obtain an amplified fragment of a specific region by selection PCR or normal PCR and determine the base sequence.
There are many false-positive amplifications and false-negative amplifications at the time, and in many cases, a primer set that can obtain good PCR amplification cannot be obtained.

An object of the present invention is to provide a good DNA amplification with a small number of false positive amplifications, and to provide a new fin-based printing method and a base sequencing method based on this. Another object of the present invention is to provide a novel polynucleotide amplification primer and a polynucleotide amplification method.

[0022]

In order to reduce the number of false positive amplifications and false negative amplifications and amplify only the target DNA, it is necessary to control the hybridization stability near the 3 'end of the primer. 3 'of the primer
Even if the base sequence near the end is non-complementary to the template, it is very slight, but the extension of the length by the DNA polymerase over the gap is a cause of false positive amplification. The occurrence of false positive amplification occurs in general PCR, and is even more remarkable in selective PCR. Primers for selection PCR (selection primers) have a base sequence part (6 to 40 bases, usually 10 to 2
About 0 bases are preferred), and a different base sequence for selection consisting of 1 to 3 bases at the 3 'end following the common base sequence. The selection base sequence portion includes all combinations of one to three bases. The selection primer is a group of primers consisting of a common base sequence portion and a selection base sequence portion, and is composed of a set of a plurality of primers.Each selection primer is selected to partially hybridize to all fragments. PC
In R, false positive amplification occurs remarkably. Since the fidelity of the selection PCR depends on the selected base sequence of 1 to 3 bases at the 3 ′ end of the primer, an extension reaction may occur even if about 1 base is mismatched. For this reason, false positive amplification increases.

FIG. 1 is a diagram illustrating an example of false positive PCR amplification due to primer mismatch. It is assumed that there are DNA fragments 1 and 2 into which a known oligomer 3 has been introduced by ligation. When a complementary strand synthesis reaction is performed with the primers 4 and 5 that form a completely complementary strand with the DNA fragment 1, the complementary strand elongation reaction 6 occurs because the DNA fragment 1 forms a complementary strand with the primers 4 and 5. AG at the 3 'end of the primer 4 and TC at the 3' end of the primer 5 are selection base sequence portions, respectively, and AG and TC are the selection base sequence portions of the primer pair in PCR. The extension reaction product is further extended during the PCR reaction to generate a fragment (PCR product) 9 to give a correct amplification product 9 '. With primers 4 and 5, D
Although the NA fragment 2 is not originally amplified, the base (A) 7 ′ at the second base from the end of the primer 4 is actually
The extension reaction 8 occurs even when it is not complementary to the base (C) 7 of the fragment 2. Once such an extension reaction occurs, the subsequent PCR
Generates a fragment (PCR product) 10 to give an amplification product 10 '. These amplification products 10, 10 'are false positive amplification products.

The most important point to be considered in the present invention is that an extension reaction, that is, amplification can be performed only when hybridization from 1 to 3 bases at the 3 'end of the primer is surely performed. For this reason, in the present invention, the base at a position within a few bases from the 3 ′ end of the primer is artificially replaced with a base that hardly causes hybridization. Hereinafter, a more specific configuration of the present invention will be described with reference to the drawings.

FIG. 2 is a diagram showing the principle of preventing false positive PCR amplification using the primers of the present invention. In FIG. 2, for the sake of simplicity, the description will be made using one strand of DNA. Although it is double-stranded in actual PCR, it can be considered as the same polymerase extension reaction.

(A) In a method for selectively amplifying a specific base sequence site of a polynucleotide to be amplified or a specific fragment in a mixture of polynucleotide fragments by using a DNA polymerase, a DNA involved in mishybridization is used. The fragment (template) is set to 11. As a primer, in the range of the fourth to sixth bases from the 3 ′ end of the conventional primer 12, at least one base is different from a base sequence complementary to a specific base sequence site or a specific fragment of a template, A, C, A primer 13 substituted with any of G and T bases is used. In FIG. 2, a primer 13 is used in which the base 15 ′ (base A) at the fourth base from the 3 ′ end of the conventional primer 12 is replaced with base 15 (base C). That is, the conventional primer 12, 5 '... TGT A C
It has a base sequence of AG3 ', and primer 13 has 5' ...
It has the nucleotide sequence of TGT C CAG3 '. The base to be substituted here may be a base X different from any of A, C, G, and T, for example, inosine. That is, the base sequence of the primer 13 may be 5 ′... TGT X CAG3 ′.

In the primer 13 in which the fourth base 15 ′ from the 3 ′ end of the conventional primer 12 is modified, 5 ′
Although several bases at the end are completely complementary to the template, the substitution of the fourth base from the 3 ′ end forms a gap 16 portion that does not hybridize. Therefore, if there is another mismatch 14 near the 3 'end, hybridization near the end becomes extremely unstable.

That is, in addition to mismatches introduced artificially according to the present invention, when mismatches derived from samples or reaction conditions overlap, the vicinity of the 3 ′ end of primer 13 is released from template 11 as shown in 17 and extension. Reaction (amplification reaction)
Is more difficult to get up. On the other hand, in the extension reaction (amplification reaction) using the conventional primer 12, the extension length reaction 1
7 'happens.

(B) In the present invention, the effect of preventing false-positive amplification can be obtained not only in the improvement of the fidelity of ordinary PCR and extension reaction, but also in the case of using the selected primer.

FIG. 3 shows that when the selection primer was used,
It is a figure explaining that a false positive amplification prevention effect is obtained. Arbitrary common base sequence site 32 and one to three bases for selecting a specific polynucleotide fragment at its 3 'end
In a selection primer having a selection base sequence (base sequence for selection) 33 consisting of an arbitrary combination of base types of bases,
A primer 31 having a base sequence in which at least one base is replaced with a base different from the base sequence complementary to the specific fragment in the range 34 (mutation-introduced portion) of the fourth base to the sixth base from the 3 ′ end is used. This reduces the generation of false positive amplifications.

As shown in FIG. 3, a primer 31 is hybridized to fragment groups 35 and 39 in which an oligomer 30 having a known base sequence is introduced into a DNA fragment. In FIG. _{3, N 1, N 2,} N 3, N 3 ', M, X, Y, n 1, n 2,
n ₃ , m, x, and y represent any of A, C, G, and T bases. Usually, the base sequence portion n ₁ n ₂ n ₃ m corresponds to a part or all of the recognition sequence of the restriction enzyme. Primer 31
The base N ₃ (36 ′) at the fourth base from the 3 ′ end of the conventional primer 31 ′ is replaced with the base N ₃ ′ (36) so that the base sequence does not artificially become complementary to the template DNA. This is a modified primer. That is, the conventional primer 31 ', 5''has the base sequence of primer _{31, 5' ... N 1 N 2} N 3 MXY3 ... N 1 N 2 N 3 'MXY
It has a 3 'base sequence. Note that N ₁ N ₂ N ₃ MXY is n ₁
Complementary to n ₂ n ₃ mxy.

The base to be substituted may be a base X 'different from any of A, C, G and T, for example, inosine.
That is, the base sequence of the primer 31 is changed to 5 ′... N ₁ N ₂ X ′
MXY3 'may be used. For a DNA fragment in which the second base from the 3 'end is a mismatch 37, the base sequence portion 3 in which two of the four bases from the 3' end are non-complementary
6 "and 37, the template 35 and the primer 31 cannot hybridize at this portion as at 38. Therefore, extension reactions such as PCR hardly occur.

For the fragment 39 which must be amplified, the discriminating base portion (selection base sequence) 33 is used as a template 39.
And the non-complementary portion 36 'of the 3' end of the primer 31 'is only one base, so that the DNA polymerase crosses the gap and extends the length 3 reaction.
8 'happens.

The position of the base to be substituted is preferably the fourth or sixth base from the 3 'end, and if the position of the substituted base is further 3' from the fourth or sixth base, the pyrimerase extension reaction is carried out. May be disturbed. When the position of the base to be substituted is at least 7 bases away from the 3 'end, the effect of preventing false positive amplification is reduced. When only one base was substituted, the substitution of the fourth base from the 3 'end was most effective.

(C) The substitution of at least one base in the base sequence of A or T with C or G in the range from the fourth base to the sixth base from the 3 ′ end is a false positive. It is effective not only in preventing amplification but also in terms of false negative amplification. This point will be described in detail in Examples. This is particularly effective for a primer in which the fourth base from the 3 'end is substituted.

(D) When introducing a mutation of 2 bases, it is preferable to replace 2 bases out of 4 to 6 bases. In this case, at least one base should be replaced from A or T to C or G. It is effective. Nevertheless, when two bases are substituted and there are many false-negative amplifications, one base is changed from A or T to C
Alternatively, use of inosine or a universal base (a base that forms a complementary strand with any base but is less stable than a normal base) by substituting G with the remaining one base is suitable.

(E) In the cases (A) to (D), the selective amplification reaction or DNA fragmentation is carried out by utilizing the difference of several bases following the restriction enzyme recognition site of the restriction enzyme-cleaved DNA fragment (or cDNA). This is particularly effective when classifying groups.

(F) The actual amplification using the selection primer of the present invention comprises the steps of: fragmenting a double-stranded sample DNA with a restriction enzyme to obtain a DNA fragment; adding an oligomer to the DNA fragment; Has a common base sequence consisting of a base sequence substantially complementary to the base sequence recognized by the sequence and the restriction enzyme, has a combination of base types of 1 to 3 bases at the 3 ′ end, and selects a specific DNA fragment A step of selecting and amplifying a specific DNA fragment using a primer set comprising a primer having a selection base sequence for the amplification of the DNA sample. Can be achieved by using the polynucleotide amplification primer described in (1).

(G) The measurement of the expression profile of mRNA includes the steps of obtaining cDNA using mRNA by reverse transcriptase, fragmenting cDNA with restriction enzymes,
A step of adding an oligomer to the NA fragment, having a common base sequence consisting of a base sequence substantially complementary to the base sequence of the oligomer and a base sequence recognized by a restriction enzyme, and having a base of 1 to 3 bases at the 3 ′ end Combinations of species, specific D
A step of selecting and amplifying a specific DNA fragment using a primer set comprising a primer having a selection base sequence for selecting an NA fragment, the method comprising the steps of: ) To (D) can be achieved by using the polynucleotide amplification primers described in (D) to (D).

Of course, the base sequence can also be determined using the same kind of primer (selection primer) as the one using a polynucleotide such as DNA amplified by the primer and the amplification method of the present invention.

Hereinafter, the present invention will be summarized. According to the nucleic acid amplification method of the present invention, (1) a base sequence site having a specific base sequence of a nucleic acid, or a specific fragment having a specific base sequence in a nucleic acid fragment mixture, is located within a range from the fourth base to the sixth base from the 3 ′ end. Selectively amplifying by PCR using a primer having a base sequence complementary to a specific base sequence except for at least one base and a DNA polymerase; (2) a base sequence site having a specific base sequence of a nucleic acid, or a nucleic acid The specific fragment having the specific base sequence in the fragment mixture is replaced with a base A in the range of the fourth to sixth bases from the 3 ′ end of the base sequence complementary to the specific base sequence.
Alternatively, it is characterized in that PCR is selectively performed using a DNA polymerase and a primer having a base sequence substantially complementary to a specific base sequence in which at least one base of base T is replaced with base G or base C. .

The nucleic acid amplification method of the present invention comprises the steps of: fragmenting a nucleic acid into a plurality of nucleic acid fragments using a restriction enzyme; adding an oligomer having a known base sequence to the 3 ′ end of the nucleic acid fragment; A primer having a common base sequence having a base sequence complementary to the common base sequence consisting of the base sequence recognized by the above and the base sequence of the oligomer, and a base sequence for selection consisting of 1 to 3 bases at the 3 ′ end (or Primers with different selection base sequences)
(A) a primer (or primer group) having the same base sequence as the common base sequence except for at least one base in the range from the first base to the third base from the 3 ′ end of the common base sequence,
Or (b) a primer having a base sequence in which at least one base A or base T in the range from the first base to the third base from the 3 ′ end of the common base sequence is replaced with base G or base C (or a primer group) ) Is used to convert a specific nucleic acid fragment to P
And a step of CR amplification.

In the method for analyzing a mixture of nucleic acid fragments of the present invention, the nucleic acid fragment amplified by the nucleic acid amplification method using the primer group (a) or (b) is used for each base sequence of the base sequence for selection. It is characterized in that an electrophoresis pattern obtained by electrophoresis is a fingerprint print. The base sequence for selection is
Since all combinations of 1 to 3 bases selected from bases A, T, G and C, the number of base sequences for selection is 1 base,
In the case of 2 bases and 3 bases, all combinations are 4, 1
6, 64 patterns, and the number of electrophoresis patterns constituting the fingerprint by selective PCR is 16, 256, 409
It becomes 6.

The amplification primer of the present invention is a nucleic acid amplification method for selectively amplifying a base sequence site having a specific base sequence of a nucleic acid or a specific fragment having a specific base sequence in a mixture of nucleic acid fragments using a DNA polymerase. In the amplification primer used in the method, the amplification primer is (I)
Having a base sequence complementary to the specific base sequence except for at least one base in the range from the fourth base to the sixth base from the 3 ′ end; (II) 3 ′ of the base sequence complementary to the specific base sequence
At least one base A or base T in the range from the fourth base to the sixth base from the terminal was replaced with base G or base C,
It is characterized by having a base sequence substantially complementary to the specific base sequence.

Also, the amplification primer of the present invention comprises a step of fragmenting a nucleic acid into a plurality of nucleic acid fragments using a restriction enzyme, and a step of adding an oligomer having a known base sequence to the 3 ′ end of the nucleic acid fragment; It has a common base sequence having a base sequence complementary to the common base sequence consisting of the base sequence recognized by the restriction enzyme and the base sequence of the oligomer, and a different base sequence for selection consisting of 1 to 3 bases at the 3 ′ end. PCR amplification of a specific nucleic acid fragment using a primer group, wherein the amplification primer is (III) 3 nucleotides from the first base from the 3 ′ end of the common base sequence. A primer group having the same base sequence as the common base sequence except for at least one base in the range of bases, (IV) 3 to 3 bases from the 3 ′ end of the common base sequence It is characterized in that it is a primer group having a base sequence in which at least one base of base A or base T in the range of bases is replaced with base G or base C.

[0046]

DETAILED DESCRIPTION OF THE INVENTION To prevent false positive amplification due to mismatched hybridization of primers,
What is necessary is just to make the 3 'end of the used primer hard to approach the template DNA. An attempt was made to improve the selectivity of 2 bases at the 3 ′ end by modifying the base sequence near the base sequence for discrimination (for selection) at the 3 ′ end to reduce the stability of hybridization. If the stability of the hybridization near the 3 'end is reduced, the primer end is easily dissociated from the DNA fragment when the terminal 2 bases are mismatched. When a selection primer is used, since there is a common base sequence portion, only the stability near the 3 ′ end can be controlled without impairing the stability of the entire primer.

In this example, a 8.7 kb human-derived DN
A case in which A is cleaved with the 4-base recognition enzyme NlaIII and a specific DNA fragment is amplified and separated from the generated fragment group will be described. The base sequences of this DNA fragment group have different base sequences, and most of the fragments are
The base sequence of several bases at both ends following the restriction enzyme cleavage site differs for each fragment. Each fragment is separated by selective PCR using the difference in the two base sequences at both ends following the restriction enzyme cleavage site. In this embodiment, a method for suppressing false positive amplification will be mainly described.
The specific contents of the implementation are shown below.

Sample: As a model sample, a 8.7 kb human-derived DNA clone is cleaved with a restriction enzyme to prepare a DNA fragment mixture in which an adapter base sequence is bound to the 3 ′ end. This 8.7 kb DNA was digested with the restriction enzyme Hsp9.
The fragment was cleaved with 2II, and a known base sequence adapter was ligated to both 3 'ends with DNA ligase. That is, 400 fmol of the cleaved DNA was converted to 10 mM MgCl ₂ and 15 mM KC.
10 mM Tris-HCl (pH 7.4)
Dissolve in solution and add 40 units of Hsp92II (Pro
(Mega, UK) and reacted at 37 ° C. for 2 hours for complete cleavage. After recovering the DNA by ethanol precipitation, the phosphate group at the 5 'end was removed with alkaline phosphatase.

Adapter (5'pACTGGCCGTC
GTTT3 ') (20 pmol) and a helper oligomer (5'AAACGACGGCCAGTCATGp
3 ′) (20 pmol) and 400 fmol of cleavage D
The mixture was added to the NA fragment mixture to make 40 μL (microliter), and ligation high (TOYOBO) 20 μL was added.
L was added, and a ligation reaction was performed at 16 ° C. for 16 hours.

By the ligation reaction, the adapter base sequence (ACTGGC) was added only to the 3 ′ end of each DNA fragment.
(CGTCGTTT) is introduced. The ligation reaction is a reaction that connects a phosphate group at the 5 ′ end of the DNA and an OH at the 3 ′ end. In the method shown here, ligation between the adapters is suppressed because the 5 terminal of the helper oligomer is modified with a phosphate group.
Since the phosphate group at the 5 'end of the NA fragment has been removed, D
Recombination between NA fragments can be prevented. For this reason, the adapter was surely introduced.

After the reaction, QIAquick PCR Pu
rifation Kit (QIAGEN Gm
After removing unreacted adapters using bH, Hilden Germany), the fragments into which the adapters were introduced were recovered by ethanol precipitation.

Primer set for selective PCR: Primers were ordered from Sawasdee Technology (Tokyo). Three types of selection primer sets having the following base sequences (SEQ ID NOs: 1, 2, and 3) were prepared. N is an arbitrary A,
C, G, and T. NN is a base sequence portion for selection.

5'CGTTTGTAAAACGACGGC
CAGTCATGNNN3 '... set 1 5'CGTTGTAAAACGACGGCCAGTCA
C GNN3 '... set 2 5' CGTTGTAAAACGACGGCCAGTCA
A GNN3 '... set 3 Set 1 contains the recognition base sequence C of the restriction enzyme Hsp92II.
It can recognize ATG and form a complete complementary strand with the template DNA fragment. In set 2, the fourth base from the 3 'end is T to C
The structure has changed. Set 3 has a structure in which the fourth base from the 3 ′ end is changed from T to A.

Selective PCR: PCR amplification of a group of DNA fragments was performed using various combinations of selected primers. Amplification is performed in a volume of 25 μL, and the conditions described below are conditions per container used for PCR. After the primer was previously dispensed to the microplate, another mixed solution was added, and the reaction was started by hot start. That is, 1
The content per container is the DNA fragment group (5 fmol).
Two primers (10 pmol / μL) in 05 μL
0.5 μL each and Taq polymerase (5 units / μL, Pharmacia, product number 27-0799)
0.075 μL, 50 mM KCl, 1.5 mM Mg
Tris-HCl buffer containing Cl ₂ (pH 9.0)
2.5 μL and 20 μL of H ₂ O.

After denaturing the mixture at 90 ° C. for 2 minutes, dNTP substrate (2.5 mM dATP, dCT
2 μL of a mixture of P, dGTP and dTTP)
The thermocycling reaction was started. The thermal cycle is 94
Basically, 35 cycles of 30 ° C. (denaturation) at 30 ° C., 30 seconds (annealing) at 66 ° C., and 60 seconds (elongation) at 72 ° C. were repeated. The PCR product was in 1 × TAE buffer (1 m
M EDTA, 40 mM Tris-HCl-Acet
, pH 8.0) and 2% Synagar
ose-2 (Diversified Biotec)
h. , Boston, MA, product number SYNAG-2)
Electrophoresis was performed using the gel as a carrier. The electrophoretically separated band was fluorescently stained with 1 × TAE buffer containing 0.5 microgram / mL ethidium bromide, and subjected to FM bio-
Analysis was performed using a 100 image analyzer (Hitachi).

FIG. 4 is an example of the results of electrophoretic separation showing the results of selective PCR. FIG. 4 (a) shows a selection PCR using a normal primer base sequence (5 ′... CA T GXY3 ′ (XY: fragment identification (selection) base sequence): set 1).
The following shows an example of the result of performing the above. FIG. 4 (b), conventional primer nucleotide sequence (5 '...... CA T GXY3' (XY: fragment identification (for selection) nucleotide sequence)) base 4 base from 3 'end of the primer having the nucleotide sequence of Modify T to base C,
Primers (5 '...
... This is an example of performing selective PCR using CA C GXY 3 ′ (XY: fragment identification (selection) base sequence): set 2).

FIG. 4C shows the trace of FIG.
(D) shows the trace of FIG. 4 (b). 41 and 42 shown in FIGS. 4A and 4B (FIGS. 4C and 4D).
Is a molecular weight marker. FIG. 4 (a) and FIG. 4 (b)
The primer pairs (eg, AG / GG, AA / TC,...) Shown in FIG. 4 (c) and FIG.
1 of the pair consisting of the two types of primers used for
Six examples are shown. The group shown in 43 is the XY of the primer.
This is an example in which a DNA fragment whose base sequence completely matches was amplified. The group indicated by 44 is an example of a fragment in which XY is not complementary and represents a false positive amplification product.

As is clear from the comparison between FIG. 4 (a) and FIG. 4 (b) (FIG. 4 (c) and FIG. 4 (d)), the fourth base from the 3 ′ end was changed from T to C. Primer (5 '... C
A C GXY3 ': when using the Set 2) (Fig. 4
In (b)), false positive amplification was dramatically reduced. This primer has a modified base sequence at a site 2 bases away from the 3′-end fragment identification (for selection) base sequence XY (the fourth base from the 3′-end of the primer).
In the first elongation reaction, the DNA is not completely complementary to the template DNA fragment. Therefore, the stability of the complementary strand hybrid between the vicinity of the 3 ′ end of the primer and the template is low.
Identification of the 3 'end of the primer (for selection)
In the case of complementation with the template DNA, a polymerase elongation reaction occurs because the 3 bases at the 3 'end form a hybrid with the template DNA.

However, when the discrimination (for selection) two-base portion XY is mismatched with the template, two out of the four bases at the 3 'end are mismatched, and a complementary hybrid with the template cannot be formed. Therefore, it is considered that false positive amplification could be prevented by using a primer modified at the fourth base from the 3 'end.

Since the effect cannot be expected even if a portion far away from the 3 'end is modified, when Hsp92II which is CATG is used as the restriction enzyme recognition site, the base sequence at the fourth base from the 3' end must be changed. Was effective.

Even when a primer in which the 4th base from the 3 ′ end was changed from T to A (5 ′... CA A GXY3 ′ (XY: fragment identification (selection) base sequence): set 3), a false positive was obtained. Amplification was reduced. However, the amount of a specific amplification product was determined by changing the primer (5 ′.
Compared to the case of using a C GXY3 '(Set 2)), it was about 20% to 50%. Base sequence CACG
Has a higher dissociation temperature Tm than the base sequence CAAG. For the primer 5 '... CA C GXY (set 2), in the first hybridization with the template DNA, the fourth base from the 3' end is mismatched, so that the dissociation temperature Tm is lowered and the discriminating ability of the two bases ( Selectivity) is improved. However, once the extension reaction occurs, it is considered that in the second and subsequent extension reactions, the dissociation temperature Tm near the end increases and the amplification amount of the specific DNA fragment increases. This indicates that the base sequence of A or T at the fourth to sixth bases from the 3 ′ end of the primer can be converted to C or G to prevent false negative amplification.

Next, a large annealing temperature dependence of the greatest effect on selected PCR in FIG. 5 (primer 5 '...... CA C G
The results of investigation on XY (set 2) are shown in the form of an electrophoresis pattern. FIG. 6A shows FIG.
6 (b) is the trace of FIG. 5 (b), and FIG.
(C) is the trace of FIG. 5 (c), and FIG. 6 (d) is the trace of FIG.
The trace of (d) is shown. Reference numerals 41 to 44 shown in FIGS. 5 and 6 are the same as those in FIG. 4, and 43 is the amplification result of a pair of primers having two selected bases complementary to the DNA fragment in the reaction solution. An electrophoresis pattern,
44 is the electrophoresis pattern (false positive product) of the amplification result when there is no complementary fragment. FIG. 5A (or FIG. 6)
(A)), FIG. 5 (b) (or FIG. 6 (b)), FIG. 5 (c)
(Or FIG. 6 (c)), FIG. 5 (d) (or FIG. 6 (d))
Have annealing temperatures of 55 ° C., 60 ° C., 66 ° C., 7
It is an electrophoresis pattern of the amplification result in the case of 0 degreeC. At the annealing temperature of 55 ° C., some false positive amplification products were observed. All 16 specific by-products have annealing temperatures of 5
Obtained in the range 5 ° C to 66 ° C. In the primer pair of CC and GG, specific fragment amplification and false positive amplification competed, but only the specific amplification product was obtained at an annealing temperature of 60 ° C to 66 ° C. At 70 ° C., an increased by-product could not be obtained because the annealing temperature was too high. Other false positive products also decrease with increasing annealing temperature,
It almost disappeared at 66 ° C. PCR based on the above facts
Then, to reduce false positive products, set the annealing temperature to 66.
It is necessary to increase to ℃.

The prevention of false positive amplification in selective PCR has been described above. However, it is practically important to solve the problem of false negative in which selective PCR does not amplify even if a fragment to be amplified exists. . Since the selection primer has a common sequence, it has an ability to hybridize equally to all DNA fragments, which means that the sequence of the 2 'salt at the 3' end greatly affects the extension reaction.

FIG. 7 is a diagram showing an example of the results of electrophoretic separation showing the results of selective PCR when the primer concentration was changed. FIG. 7B is a trace of FIG. 7A.
Reference numerals 41 to 44 shown in FIG. 7 are the same as the numbers in FIG. When the amount of fragments amplified by various combinations of primers was examined, AA, AT (however, not shown in FIG. 7),
It was found that the amplification rate of the primers having TA and TT at the ends was lower than that of PCR using another primer pair (an example of amplification using a primer pair of CG and TG). The amplification rate of the AA and TA primer pairs was so low that almost no by-product was detected. For this reason,
This is probably due to the low Tm of AA, AT, TA and TT terminals. Thus, when the primer concentration was increased by three times to 0.6 pmol / μL in order to compensate for the low Tm, an increased by-product at the same level as when amplified with the CG and TG primer pair could be obtained. That is, from the results shown in FIG. 7, it can be seen that the primer concentration should be increased in order to prevent false negative amplification.

The above results were effective not only with the restriction enzyme Hsp92II but also with other restriction enzymes such as Sau3AI and AluI. That is, generally, in PCR, in order to enhance the discriminating ability (selectivity) of the 3 ′ end of the primer, the fourth to sixth bases from the 3 ′ end of the primer complementary to the base sequence of the template DNA are used. , A or T was converted to C or G, and it was found that it was effective to convert those portions to base sequences that were non-complementary to the base sequence of the template DNA.

Determination of the base sequence of the selected PCR product: The primer (5 ′... CA C GXY (set 2)) in which the fourth base from the 3 ′ end was changed from T to C was XY
= AC, XY = TT primer pair (5 '...
PC using CA C GAC, 5 '... CA C GTT)
After R amplification, QIAquick PCR Puri
The PCR product amplified by the Fibration Kit and ethanol precipitation was recovered. Selection product 1 pmo labeled with 25 fmol of PCR product and sulfolodamine 101
l and Thermo Sequenase (RPN244
Cycle sequencing reaction was carried out using a kit (Amersham, UK). The thermal cycle is 94
30 ° C (denature) at 30 ° C for 30 seconds (annealing)
Is performed 25 times, and then at 94 ° C. for 30 seconds and at 72 ° C. for 3 seconds.
Ten cycles of 0 seconds were performed. After ethanol precipitation, the nucleotide sequence was determined using a Hitachi fluorescent DNA sequencer SQ-5500.

FIG. 8 shows a PCR product of 580 bases in length amplified using selection primers having base sequences AC and TT as identification (selection) base sequences (actual base length is 5 bases).
It is an example of a base sequence determination result (23 bases). The large peak 50 at the position of 523 bases is a peak generated by extension of the labeled primer to the end point of the PCR product. At both ends of the PCR product, the base sequence determined was 509 bases because the accuracy of base sequence determination deteriorated.

The determined nucleotide sequence was 97.3% identical to the nucleotide sequence determined by the cloning method.
At the center of the base sequence excluding 13 bases near both ends,
The agreement was 99.8%. This result indicates that the selected PCR
Indicates that the nucleotide sequence can be determined without subcloning a DNA fragment having an unknown nucleotide sequence. Only one
Six types of selective primer sets were prepared in advance, and it was confirmed that the base sequences of various regions could be amplified from a wide range of long DNA and the base sequence could be determined.

In the present invention, by controlling the hybridization stability near the 3 'end of the primer used, false positive amplification and false negative amplification can be reduced to achieve the desired D
Amplify only NA.

[0070]

According to the present invention, there is an effect of reducing so-called false positive amplification in which PCR amplification occurs in a state where the vicinity of the 3 'end of the primer is non-complementary to the template DNA.
In addition, the base sequence near the 3 'end of the primer and the template DN
Since the dissociation temperature Tm of the complementary bond to the base sequence of A is low, the template DNA to be amplified is not amplified, which is an effect of reducing so-called false negative amplification. With these effects, PC
The reliability of R is improved. Therefore, when classifying mixed DNA fragments and cDNA fragments by selective PCR, which is difficult with the conventional technology, all fragments can be detected more reliably.
Also, when a specific region in a mixed DNA fragment, a cDNA fragment or a long fragment is fractionated by using PCR, it is possible to more reliably fractionate these regions. Will be possible. According to the present invention, non-cloning nucleotide sequencing of a DNA mixture, which had a low success rate in the prior art, can be reliably performed.

(Sequence listing) SEQ ID NO: 1 Sequence length: 27 Sequence type: Number of nucleic acid strands: Single strand Topology :: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CGTTGTTAAAACGACGGCCAGTCATG
NN SEQ ID NO: 2 Sequence length: 27 Sequence type: Nucleic acid Number of strands: Single-stranded Topology-: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CGTTGTAAAACGACGGCCATCCACG
NN SEQ ID NO: 3 Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology-: linear Sequence type: other nucleic acids Synthetic DNA sequence CGTTGTAAAACGACGGCCATCCAAG
NN

[Brief description of the drawings]

FIG. 1 is a diagram illustrating an example of false positive PCR amplification due to primer mismatch.

FIG. 2 is a diagram showing the principle of preventing false positive PCR amplification using the primers of the present invention.

FIG. 3 is a diagram for explaining that a false positive amplification preventing effect can be obtained by using the selection primer of the present invention.

FIG. 4 is a view showing an example of the results of electrophoretic separation showing the results of selective PCR in an example of the present invention.

FIG. 5 shows P using primers in an example of the present invention.
Electrophoresis pattern showing annealing temperature dependence of CR amplification.

FIG. 6 is the trace of FIG. 5 of the present invention.

FIG. 7 is a diagram showing an example of the results of electrophoretic separation showing the results of selective PCR when the primer concentration is changed in the example of the present invention.

FIG. 8 is a diagram showing an example of determining a base sequence of a DNA amplification product obtained by selective PCR in an example of the present invention.

[Explanation of symbols]

1, 2, 11, 35, 39: sample DNA fragment, 3: known oligomer linked by ligation, 4, 5: selection primer, 6: complementary strand extension reaction, 7, 7 ': non-complementary partial base sequence, 8 ... Complementary strand extension reaction by mishybridization of primer and sample DNA, 9, 9 '... P
CR product, 10, 10 '... PCR product by false positive amplification, 12, 31' ... conventional primer, 13, 31 ... primer of the present invention, 14, 16, 36 ", 37 ... template D
Non-complementary nucleotide sequence between NA and primer, 15, 36
... parts whose bases are modified to be non-complementary to the template DNA in the present invention, 15 ', 36' ... bases of normal primers,
17, 38: a state in which the 3 ′ terminal portion of the primer is released from the template DNA; 17 ′, 38 ′: an extension reaction portion;
30: an oligomer of a known base sequence, 32: a common base sequence portion, 33: a discriminating (selection) base sequence portion, 34: a mutagenized portion.

Claims (22)

[Claims] 1. A nucleotide sequence having a specific nucleotide sequence having a specific nucleotide sequence in a nucleic acid or a specific fragment having a specific nucleotide sequence in a mixture of nucleic acid fragments is obtained by removing at least one nucleotide in the range of the fourth to sixth nucleotides from the 3 ′ end. A nucleic acid amplification method comprising selectively performing PCR amplification using a primer having a base sequence complementary to the specific base sequence and a DNA polymerase. 2. The nucleic acid amplification method according to claim 1, wherein the nucleic acid is cDNA obtained by using mRNA for reverse transcriptase.
A nucleic acid amplification method, characterized in that: 3. The nucleic acid amplification method according to claim 1, wherein the nucleic acid fragment comprises cD obtained by obtaining mRNA using reverse transcriptase.
A nucleic acid amplification method, which is a fragment obtained by fragmenting NA with the restriction enzyme. 4. A base sequence having a specific base sequence of a nucleic acid, or a specific fragment having a specific base sequence in a mixture of nucleic acid fragments, from a base sequence complementary to the specific base sequence from the fourth base from the 3 ′ end. Base A or base T in the range of the sixth base
A primer having a base sequence substantially complementary to the specific base sequence in which at least one base is replaced with base G or base C, and selectively using a DNA polymerase
A nucleic acid amplification method comprising performing R amplification. 5. The nucleic acid amplification method according to claim 4, wherein the nucleic acid is cDNA obtained by using mRNA for reverse transcriptase.
A nucleic acid amplification method, characterized in that: 6. The nucleic acid amplification method according to claim 4, wherein the nucleic acid fragment comprises cD obtained by obtaining mRNA using reverse transcriptase.
A nucleic acid amplification method, which is a fragment obtained by fragmenting NA with the restriction enzyme. 7. A step of fragmenting a nucleic acid into a plurality of nucleic acid fragments using a restriction enzyme, a step of adding an oligomer having a known base sequence to the 3 ′ end of the nucleic acid fragment, and a step of recognizing a base recognized by the restriction enzyme. In a primer group having a common base sequence having a base sequence complementary to the common base sequence consisting of the sequence and the base sequence of the oligomer and a different base sequence for selection consisting of 1 to 3 bases at the 3 ′ end,
PCR amplification of the specific nucleic acid fragment using a primer group having the same base sequence as the common base sequence except for at least one base in the range from the first base to the third base from the 3 ′ end of the common base sequence A method of amplifying a nucleic acid. 8. The nucleic acid amplification method according to claim 7, wherein the nucleic acid fragment comprises cD obtained by obtaining mRNA using reverse transcriptase.
A nucleic acid amplification method, wherein NA is a fragment obtained by fragmentation with the restriction enzyme. 9. An electrophoresis pattern obtained by electrophoresing the nucleic acid fragment amplified by the nucleic acid amplification method according to claim 7 for each base sequence of the selection base sequence, as a fingerprint. A method for analyzing a mixture of nucleic acid fragments. 10. A step of fragmenting a nucleic acid into a plurality of nucleic acid fragments using a restriction enzyme, a step of adding an oligomer having a known base sequence to the 3 ′ end of the nucleic acid fragment, and a step of recognizing a base recognized by the restriction enzyme. In a primer group having a common base sequence having a base sequence complementary to the common base sequence consisting of the sequence and the base sequence of the oligomer and a different base sequence for selection consisting of 1 to 3 bases at the 3 ′ end, The specific nucleic acid using a primer group having a base sequence in which at least one base of base A or base T in the range of the first base to the third base from the 3 ′ end of the common base sequence is replaced with base G or base C And a step of PCR-amplifying the fragment. 11. The nucleic acid amplification method according to claim 10, wherein the nucleic acid fragment is a fragment obtained by fragmenting mRNA obtained by using mRNA from reverse transcriptase with the restriction enzyme. Characteristic nucleic acid amplification method. 12. An electrophoresis pattern obtained by electrophoresing the nucleic acid fragment amplified by the nucleic acid amplification method according to claim 10 for each base sequence of the base sequence for selection, as a fingerprint. A method for analyzing a mixture of nucleic acid fragments. 13. A step of fragmenting a nucleic acid into a plurality of nucleic acid fragments using a restriction enzyme, a step of adding an oligomer having a known base sequence to the 3 ′ end of the nucleic acid fragment, and a step of recognizing a base recognized by the restriction enzyme. A primer having a common base sequence having a base sequence complementary to a common base sequence consisting of a sequence and the base sequence of the oligomer, and a base sequence for selection consisting of 1 to 3 bases at the 3 ′ end; Using a primer having the same base sequence as the common base sequence except for at least one base in the range from the first base to the third base from the 3 ′ end of the sequence,
R amplification step. 14. The nucleic acid amplification method according to claim 13, wherein the nucleic acid fragment is a fragment obtained by fragmenting cDNA obtained by reverse transcriptase from mRNA using the restriction enzyme. Characteristic nucleic acid amplification method. 15. A method for analyzing a mixture of nucleic acid fragments, wherein the nucleic acid fragments amplified by the nucleic acid amplification method according to claim 13 are subjected to electrophoresis. 16. A step of fragmenting a nucleic acid into a plurality of nucleic acid fragments using a restriction enzyme, a step of adding an oligomer having a known base sequence to the 3 ′ end of the nucleic acid fragment, and a step of recognizing a base recognized by the restriction enzyme. A primer having a common base sequence having a base sequence complementary to a common base sequence consisting of a sequence and the base sequence of the oligomer, and a base sequence for selection consisting of 1 to 3 bases at the 3 ′ end; Base A in the range of the first to third bases from the 3 'end of the sequence
Or PCR-amplifying the specific nucleic acid fragment using a primer having a base sequence in which at least one base of base T is replaced with base G or base C. 17. The nucleic acid amplification method according to claim 16, wherein the nucleic acid fragment is a fragment obtained by fragmenting cDNA obtained by using mRNA from a reverse transcriptase with the restriction enzyme. Characteristic nucleic acid amplification method. 18. A method for analyzing a mixture of nucleic acid fragments, wherein the nucleic acid fragments amplified by the nucleic acid amplification method according to claim 16 are subjected to electrophoresis. 19. A primer for use in a nucleic acid amplification method for selectively PCR-amplifying a nucleotide sequence having a specific base sequence of a nucleic acid or a specific fragment having a specific base sequence in a mixture of nucleic acid fragments using a DNA polymerase. At
The amplification primer is 6 nucleotides from the third base from the 3 ′ end.
An amplification primer having a base sequence complementary to the specific base sequence except for at least one base in the range of bases. 20. An amplification primer for use in a nucleic acid amplification method for selectively amplifying a nucleotide sequence having a specific base sequence of a nucleic acid or a specific fragment having a specific base sequence in a mixture of nucleic acid fragments using a DNA polymerase. At
The amplification primer has a base sequence complementary to the specific base sequence, wherein at least one base of the base A or base T ranging from the fourth base to the sixth base from the 3 ′ end is replaced with base G or base C, An amplification primer having a base sequence substantially complementary to the specific base sequence. 21. A step of fragmenting a nucleic acid into a plurality of nucleic acid fragments using a restriction enzyme, a step of adding an oligomer having a known base sequence to the 3 ′ end of the nucleic acid fragment, and a step of recognizing a base recognized by the restriction enzyme. Identified using a primer group having a common base sequence having a base sequence complementary to the common base sequence consisting of the sequence and the base sequence of the oligomer, and a different selection base sequence consisting of 1 to 3 bases at the 3 ′ end. PCR-amplifying the nucleic acid fragment of the above-mentioned nucleic acid fragment, wherein the amplification primer is at least in the range of the first to third bases from the 3 ′ end of the common base sequence. Except for one base,
A primer for amplification, which is a group of primers having the same base sequence as the common base sequence. 22. A step of fragmenting a nucleic acid into a plurality of nucleic acid fragments using a restriction enzyme, a step of adding an oligomer having a known base sequence to the 3 ′ end of the nucleic acid fragment, Identified using a primer group having a common base sequence having a base sequence complementary to the common base sequence consisting of the sequence and the base sequence of the oligomer, and a different selection base sequence consisting of 1 to 3 bases at the 3 ′ end. And a step of PCR-amplifying the nucleic acid fragment. The amplification primer comprises a base in the range of the first to third bases from the 3 ′ end of the common base sequence. A primer for amplification, which is a primer group having a base sequence in which at least one base of A or base T is replaced by base G or base C.