JPH11266883A - Fluorescent protein gfp and bfp - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new protein comprising GFP and BFP proteins each having mutations at specific positions of its amino acid sequence, having an intensified fluorescence and able to be applied to researches in the field of cell biology or the like such as the observation of animal cells during culture. SOLUTION: The new GFP protein having mutations of at least Phe64Leu, Val163Ala and Ser175Gly on the amino acid sequence described by the formula, and the new BFP protein having mutations of at least Y66H, Y145F and Phe64Leu on the amino acid sequence described by the formula. They have intensified fluorescence, and properties to emit fluorescence well at 37 deg.C, and enable the observation of animal cells which are cultured at 37 deg.C; and they can be applied to various researches including cell biology. This protein is obtained by transducing a gene encoding the GFP protein derived from Aequorea victoria into a vector, inducing mutation by a site specific mutation method and expressing the vector containing the obtained mutant gene in a host cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to novel fluorescent proteins GFP and BFP.

[0002]

2. Description of the Related Art GFP (Green Fluorescent Protein)
It is a relatively small protein having a molecular weight of 26,900 and consisting of all 238 amino acid residues shown below, which was found in Aequorea victoria (Aequorea victoria) (SEQ ID NO: 1 in the sequence listing).

[0003] Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val 1 5 10 15 Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu 20 25 30 Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys 35 40 45 Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Phe 50 55 60 Ser Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln 70 75 80 His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg 85 90 95 Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val 100 105 110 Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile 115 120 125 Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn 130 135 140 Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly 145 150 155 160 Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val 165 170 175 Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro 180 185 190 Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser 195 200 205 Lys As p Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val 210 215 230 Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys 225 230 235 238 In the present specification, the GFP protein refers to ultraviolet light to It refers to proteins that emit green fluorescence when excited by blue light and do not require special substrates or energy sources such as ATP. In other words, the chromophore-forming reaction of GFP is spontaneous, and the serine-tyrosine-glycine portion at positions 65 to 67 from the amino terminus oxidizes to form an imidazolidine ring and becomes a chromophore (Yuichiro Watanabe Modern Chemistry 12 46-
52 (1995)), R. Heim et al. Proc. Natl. Acad. Sci. USA
91: 12501-12504 (1994)). Because of these properties, a fluorescent image can be obtained simply by connecting the DNA encoding this protein to an appropriate expression vector and introducing it into the target cell to express GFP. It is used to analyze the localization of proteins and proteins visually. However, such GFP is at 37 ° C.
Therefore, there is a problem that the culture must be performed at 30 ° C. for observation with animal cells or the like. Regarding this problem, it has also been reported that mutations of V163A and S175G enhance thermal stability (KRSiemering et al.
urr. Biol. 6, 1653-1663 (1996).

Recently, Mutants of GFP having mutations of Y66H and Y145F introduced into GFP and having different wavelength characteristics (also referred to as mutants; their amino acid sequences are shown below, and the above mutations are underlined) have been developed. However, this emits blue fluorescence when excited by UV light, so BFP (Blue Fluorescent P
rotein) (R. Heim et al. Curr. Biol.
6, 178-182 (1996), R. Heim et al. Proc. Natl. Acad. S
ci. USA 91, 12501-12504 (1994)). In the present specification, the term “BFP protein” refers to a protein that is excited by ultraviolet to blue light, emits blue fluorescence, and does not require a special substrate or an energy source such as ATP. However, the BFP has a problem that the color fading is more severe than that of the GFP, and it is difficult to observe with a microscope or the like. Here, in order to represent the mutation, the position of the mutation is indicated by the specific amino acid sequence number of the wild type, the amino acid before the mutation is described before the number, and the mutated amino acid is described after the number. Shall be.

[0005] Amino acids are represented by one letter or three letters as appropriate.

Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val 1 5 10 15 Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu 20 25 30 Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys 35 40 45 Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Phe 50 55 60 Ser His Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln 66 70 75 80 His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg 85 90 95 Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val 100 105 110 Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile 115 120 125 Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn 130 135 140 Phe Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly 145 150 155 160 Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val 165 170 175 Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro 180 185 190 Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser 195 200 205 Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val 210 215 230 Thr Ala Ala Gla Ily Thr His Gly Met Asp Glu Leu Tyr Lys 225 230 235 238

[0007]

SUMMARY OF THE INVENTION The present invention provides novel fluorescent proteins GFP and BFP.

[0008]

Means for Solving the Problems The present inventor has conducted intensive studies in view of the above problems, and has introduced a novel mutation at a specific position in the amino acid sequence of GFP or BFP. We succeeded in finding GFP or BFP and completed the present invention.

That is, the present invention relates to a conventionally known G
Mutant GFP or mutant BFP was prepared from FP or BFP (hereinafter sometimes referred to as wild type) by introducing a specific mutation at a specific position by various means. From these mutants, a mutant BFP that glows brightly even after UV irradiation for about 1 hour was selected. In other words, the present invention has solved the problem that the conventional BFP was significantly fading compared to GFP and was difficult to observe with a microscope or the like.

Similarly, a mutant of GFP which glows brightly even at 37 ° C. was obtained. That is, for the conventional GFP, 37 ° C.
Thus, the present invention solved the problem that cultivation at 30 ° C. was inevitable for observation with animal cells or the like.

That is, the present invention relates to wild-type GFP (283
Amino acids, GFP having the following mutations were prepared based on the amino acid sequence of SEQ ID NO: 1) in the Sequence Listing, and their fluorescence characteristics and temperature characteristics were examined.

(1) Phe64Leu (2) Val163Ala and Ser175Gly were introduced. (3) Phe64Leu, Val163Ala and Ser175Gly are introduced.

Further, in the present invention, based on the amino acid sequence of the above-mentioned wild-type BFP, a BFP having the following mutations was prepared, and its fluorescence characteristics and temperature characteristics were examined. Here, the introduced mutation was based on the amino acid sequence of wild-type GFP.

(4) Y66H, Y145F: Phe64Leu, Leu236Arg (5) Y66H, Y145F: Phe64Leu (6) Y66H, Y145F: Val163Ala, Ser175Gly (7) Y66H, Y145F: Phe64Leu, Val163Ala, Ser175Gly, Leu236Arg The mutant BFP, GFP, was found to have improved fluorescent properties and thermal stability.
That is, the present invention provides the following novel BFP and GFP,
Further, the present invention provides genes encoding them.

1. The amino acid sequence of SEQ ID NO: 1 contains at least Phe64Leu, Val163Ala and Ser1
GFP protein having a mutation of 75Gly. 2. Phe6 is added to the amino acid sequence of SEQ ID NO: 1 in the sequence listing.
GF having 3 mutations of 4Leu, Val163Ala and Ser175Gly
P protein. 3. A BFP protein having at least mutations of Y66H, Y145F and Phe64Leu in the amino acid sequence of SEQ ID NO: 1 in the sequence listing. 4. A BFP protein having at least mutations of Y66H, Y145F, Phe64Leu, and Leu236Arg in the amino acid sequence of SEQ ID NO: 1 in the sequence listing. 5. The amino acid sequence represented by SEQ ID NO: 1 in the sequence listing has Y66
BFP protein having four mutations of H, Y145F, Phe64Leu and Leu236Arg. 6. The amino acid sequence represented by SEQ ID NO: 1 in the sequence listing contains at least Y66H, Y145F, Phe64Leu, Val163Ala, and Ser175Gl.
BFP protein having mutations y and Leu236Arg. 7. The amino acid sequence represented by SEQ ID NO: 1 in the sequence listing has Y66
H, Y145F, Phe64Leu, Val163Ala, Ser175Gly, Leu236Ar
g BFP protein having six mutations. 8. A gene encoding the GFP protein according to any of 1 or 2 above. 9. A gene encoding the BFP protein according to any of the above items 3 to 7.

Hereinafter, the present invention will be described in detail with reference to embodiments, but nucleic acids and amino acids (1
Abbreviations of letters and three-letter notations) are shown below.

(Nucleic acid) DNA deoxyribonucleic acid A adenine C cytosine G guanine T thymine (amino acid) Ala (A) alanine Arg (R) arginine Asn (N) asparagine Asp (D) aspartic acid Cys (C) cysteine Gln (Q) Glutamine Glu (E) Glutamate Gly (G) Glycine His (H) Histidine Ile (I) Isoleucine Leu (L) Leucine Lys (K) Lysine Met (M) Methionine Phe (F) Phenylalanine Pro (P) Proline Ser (S) Serine Thr (T) Threonine Trp (W) Tryptophan Tyr (Y) Tyrosine Val (V) Valine.

The present invention discloses a nucleic acid molecule encoding GFP or BFP in which at least two or three or more amino acid residues have been substituted. GFP or BFP proteins obtained by these amino acid residue substitutions can be used to monitor gene activity and protein distribution in cells. Gene activity and protein distribution can be monitored by preparing DNA in which DNA encoding GFP or BFP is linked to a target DNA sequence and introducing the DNA into cells. Further, as a method for introducing a DNA marker encoding GFP or BFP into a cell, culturing the cell, and detecting a fluorescent protein, the method described in the following literature can be used (M. Chalfie et al., US Patent No. 5,491,084 (1996); S-
H. Park et al., Protein Science 6: 2344-2349 (1997); MJ
Cormier et al. US Patent No. 5,422,266 (1995).

[0019]

BEST MODE FOR CARRYING OUT THE INVENTION A novel GFP or B according to the present invention
The FP protein is obtained by introducing a specific mutation into a part of the amino acid sequence of wild-type GFP and BFP, and exhibits improved fluorescent properties and thermal stability. Therefore, a protein having at least such an amino acid sequence, and further comprising a novel GFP or BF according to the present invention.
As long as they exhibit improved fluorescent properties and thermal stability based on the P protein, they are included in the present invention. That is, as used in the following examples, when cells of various origins are used, various amino acid sequences other than the amino acid sequences are added to the N-terminus or C-terminus, and according to the present invention. New GFP or BFP
Also included are those that exhibit improved fluorescent properties and thermal stability based on proteins.

Further, the present invention provides a gene encoding the novel protein or a protein containing the protein.

Here, “substantially pure” and “isolated”
The term means a protein from which impurities and components associated with natural products have been removed. Specifically, at least 60-70
A protein is substantially pure if% of the sample shows a single polypeptide chain. The same applies to a few mutants or those having almost identical polypeptide sequences due to chemical modification. Substantially pure protein usually refers to about 85 to 90% or more, preferably about 95% or more, more preferably 99% or more protein. The term is also used for proteins and nucleic acids synthesized using animal cells, E. coli and other prokaryotic cells.

"Isolated" or "purified" nucleic acid means nucleic acid that has been identified or separated from impurity nucleic acids encoding other proteins.

The method for obtaining a novel GFP or BFP according to the present invention is not particularly limited, and an artificial obtaining method by a chemical synthesis method or an obtaining method based on generally known genetic engineering is possible. The latter can be carried out by a genetic engineering technique combining a generally known appropriate vector with a mutation introducing means. Specifically, the following procedure is preferable.

That is, (1) starting from a known GFP or BFP protein to be improved, a gene encoding the protein is introduced into an appropriate vector, and (2) selectively or selectively to the gene by a known method. In this procedure, mutations are introduced at random, and (3) a preferred mutant is selected from the fluorescence intensity, temperature dependency, etc. of the obtained mutant GFP or BFP.

Hereinafter, the above procedure will be described in detail with reference to examples, but the present invention is not limited to these examples.

[0026]

EXAMPLES (I) The genetic engineering technique used in this example is described below.

1. Vector Construction In the present invention, the pGFP-C1 vector (Clontech) G
A DNA obtained by replacing the FP-encoding DNA with GFP DNA derived from phGFP-S65T (Clontech) was used as a basic plasmid (hereinafter referred to as phGFP (101) -C1). This vector is for expression in animal cells, and the entire nucleotide sequence including the vector portion is known. The corresponding amino acid sequence is shown below.

Met Val Ser Lys Gly Glu Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val 1 5 10 15 Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu 20 25 30 Gly Glu Glu Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys 35 40 45 Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Phe 50 55 60 Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln 65 70 75 80 His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg 85 90 95 Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val 100 105 110 Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile 115 120 125 Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn 130 135 140 Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly 145 150 155 160 Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val 165 170 175 Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro 180 185 190 Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser 195 200 205 Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val 210 215 230 Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys 225 230 235 238

Here, the protein encoded by the phGFP-S65T is (i) an amino acid (valine) inserted between the first methionine and the second serine in the amino acid sequence as compared with the wild-type protein derived from jellyfish. (Ii) serine at amino acid number 65 is mutated to threonine; (iii) histidine at amino acid number 231 is mutated to leucine (each underlined in the above amino acid sequence) Wearing). Therefore, for example, the threonine at the amino acid number 65 is actually the 66th amino acid, but in the present specification, the amino acid number corresponding to the wild type is used in accordance with a general customary amino acid number relating to the mutation. That is, an amino acid sequence number from a jellyfish-derived wild-type amino acid sequence is used (amino acid numbers 1 to 238), and the extra valine is added between amino acid numbers 1 and 2. And do not give a number. In fact, such addition of valine is used as an example to explain the embodiment of the present invention, and is not an essential amino acid sequence of the present invention. Therefore, in the following description, whether or not valine is added does not essentially affect the scope of the present invention.

The method for introducing a specific mutation is not particularly limited. For example, the following introduction methods used in Examples in the present invention are possible. That is, D encoding GFP by HindIII from phGFP (101) -C1
By cutting out the NA region and inserting it into the HindIII site of the pUC18 vector or pQE30 vector (Qiagen), pUCGFP
(101) or pQEGFP (101) was prepared. Here, the pQE30 vector is for expression in E. coli.

Using the obtained pUCGFP (101), T65S, Y66H, Y145F
PUCBFP (201) into which the above mutation was introduced was prepared.

Here, Ser at position 65 in the amino acid sequence introduced by the above mutation (T65S) is the same as the wild type due to the mutation.

Further, from the obtained pUCBFP (201), EcoRI
DNA encoding BFP was cut out by digestion with
BlueBFP (201) was prepared by cloning into EcoRI / XhoI site of uescript II KS (-) (Stratagene).

Further, from the obtained pUCBFP (201), HindI
A DNA region encoding BFP is cut out by II digestion, and p
By inserting into the HindIII site of the QE30 vector, p
QEBFP (201) was created. On the other hand, similarly, the above DNA was
01) by replacing with the GFP coding region of the -C1 vector
hBFP (201) -C1 was created.

[0035] 2. Mutagenic Polymerase chain reactio
n (hereinafter referred to as PCR) Furthermore, there is no particular limitation on a method for introducing mutations at random, but in the present invention, the following Mutagenic PCR is used.
Can be preferably used. Mutagenic PCR can be performed according to a known method (CW Dieffenbach,
ed.PCR PRIMER, A Laboratory Manual (Cold Spring H
arbor Laboratory Press) (1995) pp.583-588). In the examples, specifically, the following conditions were used.

10 × mutagenic PCR buffer (70 mM MgCl ₂ ;
500 mM KCl; 100 mM Tris-HCl, pH 8.3 at 25 ° C .; 0.1% (w / v)
gelatin) 10 μl, 10 × dNTP (2 mM dGTP, 2 mM dATP, 10 mM dC
TP, 10 mM dTTP) 10 μl, 10 pmol / μl primer (23mer M
13Universal primer and M13Reverse primer) 3μl, H ₂ O
After adding about 50 ng of plasmid BlueBFP (201) to 62 μl and mixing, 10 μl of 5 mM MnCl ₂ was added and mixed, and 1 μl of Taq Polymeras
e (TaKaRa) was added to perform PCR (using PC-700 manufactured by ASTEC). Perform PCR in three tubes at 94 ° C for 1 minute 45 ° C for 1 minute 7
25, 30, and 35 cycles were performed at 2 ° C. for 1 minute.

After combining each reaction solution and performing phenol-chloroform treatment twice, digestion with BamHI and XhoI, electrophoresis was performed on a 1% agarose gel, the amplified DNA fragment encoding BFP was recovered, and pQE30 (QIAGEN BamHI and SalI sites.

E. coli (JM109) was transformed and spread on LB agar medium containing carbenicillin.
Incubated for 16 hours at ° C. Then, it was left at room temperature for 24 hours. UV (Funakoshi UVTRANSILLUMINATOR FTI-2)
01 UV 365 nm) for 1 hour, and then selected colonies that were visually luminous enough (10 were obtained in the example).

The sequence of the selected plasmid was determined. For variants with potentially significant mutations in the coding region, replace the vector cloning site with pQ
To align with EBFP (201), the coding region was cut out with Hind3, inserted into the HindIII site of pQE30, and inserted into SalI / BglII.
And replaced with a corresponding part of pQEBFP (201) (in the case of the embodiment, the one created from Mutant.10 was used as pQEBFP (202)).

[0040] 3. Mutant by site-directed mutagenesis
The method for introducing a GFP / BFP site-directed mutagenesis is not particularly limited. For example, in the Examples, the protocol of the STRATAGENE Quick Change kit was used. Oligonucleotides shown in Table 2 below were used as primers, and plasmids (about 0.03 μg) obtained by subcloning GFP or BFP cDNA into HindIII site of pUC18 or pQE30 vector shown in Table 3 were used as templates (specifically, PCR conditions were as follows). 16 cycles, 95 ° C, 30 seconds 5
5 ° C. for 1 minute, 68 ° C. for 10 minutes).

(Table 2) ========================================== oligo No sequence 1F TCGTGACCACCTTCTCCCACGGCGTGCA 1R TGCACGCCGTGGGAGAAGGTGGTCACGA 2F GCTGGAGTACAACTTCAACAGCCACAACG 2R CGTTGTGGCTGTTGAAGTTGTACTCCAGC 3F CCTCGTGACCACCCTCTCCCACGGCGTG 3R CACGCCGTGGGAGAGGGTGGTCACGAGG 4F CCTCGTGACCACCCTCACCTACGGCGTG 4R CACGCCGTAGGTGAGGGTGGTCACGAGG 5F GAACGGCATCAAGGCCAACTTCAAGATCC 5R GGATCTTGAAGTTGGCCTTGATGCCGTTC 6F CATCGAGGACGGCGGCGTGCAGCTCGCC 6R GGCGAGCTGCACGCCGCCGTCCTCGATG ======================== ================ (Table 3) ============================== =============================== When introducing the mutation used for template Used for GFP or BFP after mutagenesis Oligo No mutant GFP or BFP ------------------------------------------- ------------------ pUCGFP (101) 1F + 1R pUCGFP101 (+ Y66H) pUCGFP101 (+ Y66H) 2F + 2R pUC (201) pQEGFP (101) 4F + 4R pQEGFP (103) pQEBFP (201) 3F + 3R pQEBFP (203) pQEGFP (101) 5F + 5R pQEGFP101 (+ V163A) pQEGFP101 (+ V163A) 6F + 6R pQEGFP (104) pQEBFP (201) 5F + 5R pQEBFP (201) (+ V163A) pQEBFP (201) (+ V163A) 6F + 6R pQEBFP (204) pQEGFP (104) 4F + 4R pQEGFP (105) pQEBFP (202) 5F + 5R pQEBFP202 (+ (V163A) pQEBFP202 (+ V163R) 6F + 6R pQEBFP (205) ===================================== ===========================

The sequence of the obtained plasmid was determined, and it was confirmed that the desired mutation was contained.

In the examples of the present invention, for the purpose of sorting out the various mutants obtained, 101-105 for GFP and BFP
I named them 201-205. The mutations (Mutation) introduced are as shown in Table 4 below. Also, although not shown in the table, GFP 101 to 105 are all Ser
It contains mutations of 65Thr and His231Leu.

(Table 4) ============================================ ======================= GFP 101 None 103 Phe64Leu 104 Val163Ala, Ser175Gly 105 Phe64Leu, Val163Ala, Ser175Gly ------------ -------------------------------------------------- ----- BFP (BFP has two mutations Y66H and Y145F introduced based on the GFP sequence) 201 Y66H, Y145F: 202 Y66H, Y145F: Phe64Leu, Leu236Arg 203 Y66H, Y145F: Phe64Leu 204 Y66H, Y145F: Val163Ala, Ser175Gly 205 Y66H, Y145F: Phe64Leu, Val163Ala, Ser175Gly, Leu236Arg =============================== ======================================

[0045] 4. Measurement of mutant BFP expression level The measurement of the obtained mutant BFP expression level is not particularly limited, but it is preferable to compare the Mutant BFP expression level in E. coli by SDS-PAGE. Specifically, pQE30 (empty vector)
Alternatively, an overnight culture of Escherichia coli into which the expression vectors of pQEBFP (201) and pQEBFP (202) were introduced was diluted to 1/50, and cultured in 3 ml of 2 × YT carbenicillin medium at 37 ° C. for 3 hours. IPTG was added to each sample to a final concentration of 0.24 mg / ml, and the cells were further cultured for 2.5 hours to induce BFP protein.

100 μl of the solution was centrifuged, and the precipitate was dissolved in a sample buffer. In addition, 1.
3 ml of E. coli was centrifuged at 10,000 rpm for 1 min, and the precipitate was washed with PBS (-), 260μ.
This suspension was freeze-thawed at -80 ° C for 10 minutes, subjected to sonication (Elma Transonic ultrasonic washer 460 / H), and centrifuged at 15000 rpm for 5 minutes to remove soluble proteins. It was separated into insoluble fractions containing inclusion bodies. These were subjected to SDS-PAGE in an amount corresponding to 50 μl of the E. coli culture, and stained with Coomassie brilliant blue.

5. Escherichia coli transfected with various GFPs and BFPs
Comparison of Rusa pQE30 (empty vector) or pQEGFP (101), pQEGFP (10
5) and pQEBFP (201), pQEBFP (202) and pQEBFP (205) were transformed into JM109 and streaked on LB agar medium containing carbenicillin. After incubation at 37 ° C for 24 hours, remove the lid of the plate, turn the plate over, and
(Funakoshi UV TRANSILLUMINATOR FTI-201 UV
365 nm) Photographs were taken.

6. GFP, BFP M by calcium phosphate method
Transfection of utant cDNA into CHO cells and fluorescence
Measurement A. From the pQE vector containing the gene for the mutated GFP and BFP created by the transfection site-directed mutagenesis method, the coding region was cut out by HindIII digestion and replaced with a corresponding part of the phGFP (101) -C1 vector. phGFP (103-105) -C1, phBFP (202-2
05) -C1 was created.

CHO-K1 cells were cultured in an F12 + 10% FBS medium at 37 ° C. and 5% CO ₂ , unless otherwise indicated.
1 × 10 ⁵ cells were seeded on a 6 cm dish and transfected in pairs by the calcium phosphate method the following day (C. Chen and H. Okayama Mol. Cell. Biol. 7:27).
45-2752 (1987)). After the transfection, one was cultured at 37 ° C. and the other was cultured at 30 ° C. for 24 hours. Wash the transfected CHO cells 3 times with 1 × PBS (-), 1%
The cells were lysed with 1 ml of 10 mM Tris-HCl (pH 7.4) containing Triton X-100, and collected in an Eppendorf tube. At 3000rpm
0.5 ml of the supernatant after centrifugation for 5 minutes was diluted 4-fold with the same buffer, and the fluorescence was measured. The blank vector pUcD2S is used as blank.
RαMCS transfected was used. Hitachi F-2000 type spectrofluorometer was used for fluorescence measurement. When measuring GFP, scan the fluorescence from 460 nm to 600 nm at an excitation wavelength of 460 nm, and scan the maximum value around 510 nm for BFP measurement, scan the fluorescence from 360 nm to 500 nm at an excitation wavelength of 360 nm when measuring BFP, and scan the maximum around 445 nm. The value was measured.

[0050] 7. Western blotting CHO cells into pUcD2SRαMCS (empty vector) (T. Tsukamoto et
al. Nature Genet. 11: 395-401 (1995)), phGFP (101) -C.
1, phGFP (105) -C1, phBFP (201) -C1, phBFP (205) -C1, transfected and cultured at 30 ° C., 37 ° C., 8 μl of the undiluted sample used for the previous fluorescence measurement Was used to perform SDS-PAGE on a 12% gel. Horizon blot (AT
Nitrocellulose membrane (Millipore, HAHY) at 2 mA per square centimeter for 90 min using TO
394F0). Take out the membrane,
After washing with 1 × PBS, remove the membrane with 1% skim milk / PBS
And shaken at room temperature for 30 minutes. 1 × PBS membrane
After washing, the plate was immersed in 0.1% skim milk / PBS containing anti-GFP antibody (Clontech) diluted 2000-fold and shaken at 4 ° C. overnight. After washing the membrane with 1 × PBS for 5 minutes, TPBS (0.05% Tr
It was washed three times with iton X-100 / PBS) for 15 minutes. 1000 membranes
The plate was immersed in 0.1% skim milk / PBS containing double-diluted HRP-labeled anti-rabbit IgG antibody (Amersham) and shaken at 4 ° C. for 1 hour. After washing the membrane with 1 × PBS for 5 minutes, TPBS (0.05%
(Triton X-100 / PBS) for 15 minutes three times. After reacting the membrane with a chemiluminescent reagent solution (Amersham ECL) for 1 minute,
Exposure to X-ray film for minutes.

[0051] (II) A new mutant GFP, the amino acid sequence of BFP 1. Mutant BFP sequence determination One of ten mutants obtained (Mutant No. 10)
For, the phenylalanine at position 64 immediately N-terminal to the chromophore was mutated to leucine.

In this mutant clone, another mutation (L236R) was introduced at the C-terminus (Table 1).

Table 1 ============================================= ======== Mutant No. Mutation 1 L (CTT) 1H (CAT) 2 D (GAT) 7Y (TAT) 3 I (ATC) 6T (ACC) 4 Multicloning site deleted 14 bp from BamHI 5 Multiple cloning site deleted 24 bp from BamHI 6 I (ATC) 6 N (AAC) 7 L (CTT) 4 P (CCT), I (ATC) 128 G (GTC), D (GAC) 197 A (GCC), S (AGC) 202C (TGC) 8 L (CTT) 4R (CGT) 9 M (ATG) 1T (ACG), Y (TAC) 39N (AAC), K (AAG) 52E (GAG) 10 K (AAG) 41K (AAA) silent , F (TTC) 64L (CTC), L (CTG) 236R (CGG) ================================= ===================== For this mutant, pQEBFP (20
BFP cDNA was subcloned into the same HindIII site as in 1) to create pQEBFP (202).

2. Mutant BFP in E. coli by SDS-PAGE
Comparison of expression levels of IPT was added to a culture solution of Escherichia coli holding pQEBFP (201) and pQEBFP (202) to express BFP protein. When Escherichia coli was irradiated with ultraviolet light, the fluorescence of Escherichia coli retaining pQEBFP (202) was clearly stronger. When the Escherichia coli protein was analyzed by SDS-PAGE, production of a 31-kDa protein was found to be almost the same in Escherichia coli having both plasmids (FIG. 1, lanes 4, 7).

Further, it was examined whether or not these BFPs were soluble. As a result, BFP (201) having low fluorescence was almost insoluble (FIG. 1, lanes 5 and 6), whereas BFP (202) showed a large amount in the soluble portion. It was recovered (FIG. 1, lanes 8, 9).

3. Fluorescence of Escherichia coli transfected with various GFPs and BFPs
GFP and BFP in which mutations V163A and S175G were further introduced in addition to light comparison F64L were prepared (see Table 4).

To compare the intensity of fluorescence in E. coli, pQ
E30 empty vector or GFP101,105 and BFP201,202,2
Streak of Escherichia coli having pQE30 obtained by subcloning the cDNA of 05 was performed. E. coli transfected with the empty vector is not shining. Escherichia coli subcloned BFP201 before improvement hardly glowed even when exposed to UV,
The subcloned version of 202 glowed brightly in blue. And it was confirmed that 205 shines brighter than 202.

Regarding GFP, green fluorescence was visually observed, and a remarkable difference in brightness was observed between 101 and 105 (FIG. 2).

4. Transfer of GFP, BFP Mutant cDNA to CHO cells
Transfection and fluorescence measurement Because GFP and BFP that shine well in E. coli were obtained, animal cells (C
HO). The results of fluorescence measurement of the prepared cell extract under 37 ° C culture and 30 ° C culture are summarized (Table 5).

========================================== GFP or BFP 37 ° C. 30 ° C 101 30.8 214.6 103 532.1 765.4 104 659.0 697.9 105 2991.1 868.7 201 14.3 166.7 202 304.6 188.6 203 331.3 210.9 204 330.9 265.9 205 901.5 287.7 ====================== ====================

The values shown in the table are blank values based on the obtained fluorescence values.
The value of the empty vector used as the value is subtracted. blan
k was 8.9 at GFP 37 ° C. measurement, 7.14 at 30 ° C. measurement, 64.3 at BFP 37 ° C. measurement, and 50 at 30 ° C. measurement.

Table 6 shows GFP or BF before improvement in 37 ° C. culture.
The fluorescence intensity of P is shown as a relative value assuming that it is 100, and a comparison was made based on the ratio of fluorescence at 37 ° C and 30 ° C. From Table 6, M
BFP (202) with the mutation found by utagenic PCR was 37
The fluorescence was 21 times stronger at ℃. BFP (202) has two mutations (F64L and L236R), but BFP (203) having only F64L has the same level of fluorescence as 202, and this mutation is the cause of the increased fluorescence. it is conceivable that. F
GFP (103) having 64 L had 17 times stronger fluorescence.

On the other hand, BFP (20%) having mutations of V163A and S175G
4) and GFP (104) were 23 times and 21 times brighter, respectively. GFP (105), which combines these mutations with F64L, was 97 times brighter and BFP (205) 63 times brighter.
Furthermore, when the ratios of the fluorescence intensities at 37 ° C. and 30 ° C. were compared, both 101 and 201 before improvement were darker at 37 ° C. than 30 ° C. In the case of F64L alone, the combination of V163A and S175G, the ratio of the fluorescence intensities at both temperatures increased, but GFP (105) and BFP (205) combined with mutations were more than 3 times brighter at 37 ° C. (Table 6).

(Table 6) =========================================== GFP Or BFP 37 ° C 37 ° C / 30 ° C 101 100 0.14 103 1728 0.70 104 2140 0.94 105 9711 3.44 201 100 0.09 202 2130 1.62 203 2317 1.57 204 2314 1.24 205 6304 3.13 =============== ===========================

5. Animals by Western Blotting
Examination of expression level in cells pUcD2SRαMCS (empty vector), phGFP (101) -C1,
phGFP (105) -C1, phBFP (201) -C1, and phBFP (205) -C1 were transfected and cultured at 37 ° C and 30 ° C using an anti-GFP antibody, and the amount of expressed GFP or BFP protein was determined. investigated. A transfection of the empty vector (FIG. 3, lanes 1 and 6) detected a band of about 30 kD, which was not observed.

In the culture at 30 ° C., no remarkable difference was observed between the amounts of GFP and BFP protein expressed before and after the introduction of the mutation (lanes 7-10). Meanwhile, 3
In the culture at 7 ° C., it was found that the mutants (lanes 3 and 5) clearly expressed a large amount of GFP and BFP proteins (FIG. 3, lanes 2-5).

[0067]

[Sequence list] SEQUENCE LISTING <110> CHUGAI PHARMACEUTICAL CO., LTD. <120> Green Fluorescent Proteins and Blue Fluoresc
ent Proteins <130> P98XX-021Y <160> 13 <210> 1 <211> 238 <212> PRT <213> Aequorea victoria <400> 1 Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val 1 5 10 15 Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu 20 25 30 Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys 35 40 45 Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Phe 50 55 60 Ser His Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln 66 70 75 80 His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg 85 90 95 Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val 100 105 110 Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile 115 120 125 Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn 130 135 140 Phe Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly 145 150 155 160 Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val 165 170 175 Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro 180 185 190 Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser 195 200 205 Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val 210 215 230 Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys 225 230 235 238 <210> 2 <211> 28 <212> DNA <213> Artificial <220><223> PCR Probe <400> 2 tcgtgaccac cttctcccac ggcgtgca 28 <210> 3 <211> 28 <212> DNA <213> Artificial <220><223> PCR Probe <400> 3 tgcacgccgt gggagaaggt ggtcacga 28 <210> 4 <211> 29 <212> DNA <213> Artificial <220><223> PCR Probe <400> 4 gctggagtac aacttcaaca gccacaacg 29 <210> 5 <211> 29 <212> DNA <213> Artificial <220><223> PCR Probe <400> 5 cgttgtggct gttgaagttg tactccagc 29 <210> 6 <211> 28 <212> DNA <213> Artificial <220><223> PCR Probe <400> 6 cctcgtgacc accctctccc acggcgtg 28 <210> 7 <211> 28 <212> DNA <213> Artificial <220><223> PCR Probe <400> 7 cacgccgtgg gagagggtgg tcacgagg 28 <210 > 8 <211> 28 <212> DNA <213> Artificial <220><223> PCR Probe <400> 8 cctcgtgacc accctcacct acggcgtg 28 <210> 9 <211> 28 <212> DNA <213> Artificial <220><223> PCR Probe <400> 9 cacgccgtag gtgagggtgg tcacgagg 28 <210> 10 <211> 29 <212> DNA <213> Artificial <220><223> PCR Probe <400 > 10 gaacggcatc aaggccaact tcaagatcc 29 <210> 11 <211> 29 <212> DNA <213> Artificial <220><223> PCR Probe <400> 11 ggatcttgaa gttggccttg atgccgttc 29 <210> 12 <211> 28 <212> DNA <213> Artificial <220><223> PCR Probe <400> 12 catcgaggac ggcggcgtgc agctcgcc 28 <210> 13 <211> 28 <212> DNA <213> Artificial <220><223> PCR Probe <400> 13 ggcgagctgc acgccgccgt cctcgatg 28

[0068]

The effects of the improved mutant BFP and GFP according to the present invention are summarized below.

(1) Mutant obtained by Mutagenic PCR
BFP (202) has enhanced fluorescence in both E. coli and animal cells as compared to before mutagenesis. The mutation B
In the PF clone, the phenylalanine at position 64 is mutated to leucine (F64L), and the leucine at position 236 is mutated to arginine at the C-terminus (L236R).

Mutant BFP having only the 64th mutation
(203) also showed similar enhancement of fluorescence in animal cells, so the responsible mutation of this mutant BFP (202) is F64L.

Such a mutation is presumed to be due to a mechanism similar to the enhancement of fluorescence reported in GFP (T.-T. Yang et al. Nucleic Acids Res. 24: 4592-459).
3 (1996)).

(2) The expression level of the protein and the production of the soluble protein were examined. (I) Comparison of the expression level of MutantBFP in E. coli showed that the protein abundance was the same (SDS
(By -PAGE), mutant BPF (201) is almost insoluble, whereas mutant BPF (202) is more soluble, (ii)
There was also a large difference in the brightness of E. coli. From these results, it was found that the mutant BP
According to the fact that F (201) could not correctly take higher-order structures such as chromophore formation, whereas the mutant BPF (202) had a mutation that made it easier for proteins to adopt more correct higher-order structures. Conceivable.

(3) On the other hand, as a result of Western blotting on animal cells, GFP or BFP
The amount of protein itself is increasing. That is,
In animal cells, it is considered that the protein can take a stable higher-order structure, or the protein structure is stable, so that the protein degradation is slower than before improvement.

(4) By introducing the F64L mutation having the above properties and the other mutations V163A and S175G,
GFP and BFP proteins having the above-mentioned properties and further improved properties at 37 ° C. are obtained.

Therefore, an improved GFP into which such a mutation has been introduced
And BFP have the property of shining well at 37 ° C., and enable observation in animal cells cultured at 37 ° C. These improved GFP and BFP
Can be applied to many researches, including cell biology. The effect according to the present invention described above is shown in FIG.

[Brief description of the drawings]

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows that E. coli carrying each plasmid was subjected to IPT.
G, and SDS-PAGE of the protein was performed. Lanes 1, 4, and 7 are electrophoresis photographs showing the results of electrophoresis of 50 μl of the E. coli culture solution, and lanes 2, 3, 5, 6, 8, and 9 are the results of electrophoresis of 50 μl.

FIG. 2 is a photograph showing fluorescence generated by streaking E. coli carrying each plasmid on a plate, culturing at 37 ° C. overnight, and irradiating with long-wavelength ultraviolet light.

FIG. 3 shows that after transfection of each plasmid into CHO cells, those cultured at 37 ° C. or 30 ° C. are subjected to SDS-PAGE, transferred to a nitrocellulose membrane, and subjected to Western blotting with an anti-GFP antibody. 4 is an electrophoretic photograph showing the results.
Here, the arrow indicates GFP or BFP.

FIG. 4 is a fluorescence photograph showing the effects of the improved BFP and GFP according to the present invention.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁶ Identification symbol FI (C12N 1/21 C12R 1:19) (C12P 21/02 C12R 1:19) (C12P 21/02 C12R 1:91)

Claims (9)

[Claims] [Claim 1] The amino acid sequence of SEQ ID NO: 1 contains at least Phe64Leu, Val163Ala, and Ser175
A GFP protein having a mutation called Gly. 2. A GFP protein having three mutations of Phe64Leu, Val163Ala, and Ser175Gly in the amino acid sequence of SEQ ID NO: 1 in the sequence listing. 3. A BFP protein having at least mutations of Y66H, Y145F and Phe64Leu in the amino acid sequence of SEQ ID NO: 1 in the sequence listing. 4. The amino acid sequence represented by SEQ ID NO: 1 in the sequence listing contains at least Y66H, Y145F, Phe64Leu and Leu23.
BFP protein having a mutation of 6Arg. 5. A BFP protein having four mutations of Y66H, Y145F, Phe64Leu and Leu236Arg in the amino acid sequence of SEQ ID NO: 1 in the sequence listing. 6. The amino acid sequence represented by SEQ ID NO: 1 in the sequence listing contains at least Y66H, Y145F, Phe64Leu, Val163Al
BFP having mutations a, Ser175Gly and Leu236Arg
protein. 7. An amino acid sequence represented by SEQ ID NO: 1 in the sequence listing, wherein Y66H, Y145F, Phe64Leu, Val163Ala, Ser175Gl
y, BFP protein having six mutations, Leu236Arg. A gene encoding the GFP protein according to any one of claims 1 and 2. 9. B according to any one of claims 3 to 7,
Gene encoding FP protein.