JPH11221076A - Cloning of specific gene - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for accurately and efficiently cloning a gene specifically expressed in cells or cDNA in a more reproducible way, and to obtain a cDNA fragment specifically expressed in the cells and a probe having the same. SOLUTION: This method comprises obtaining a cDNA small fragment library consisting of 5'-linker X-(16 bases having a Rsal cleavage site (AC) on the 5' side)-linker Y-3' by subjecting a cDNA specimen to treatment with the restriction enzyme Rsal, ligation with an optional linker X, treatment with the restriction enzyme BsmFl and ligation with an optional linker Y different from the linker X and then cloning 14 bases following the Rsal cleavage site (AC) specific to the cDNA specimen from the library. According to this invention, since differences in functions and morphology in optional two cells can be elucidated as differences in the state of gene expression, this method can be widely applied to all biological phenomena under physiological conditions or morbid conditions.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a method for cloning a gene whose expression or expression level is specifically increased or decreased in a cell or cDNA, a cDNA fragment and a probe specific to a test cell.

[0002]

2. Description of the Related Art It is considered that one species of organism has a specific gene, and with some exceptions such as immune cells, the gene sequence is common regardless of how it is differentiated. In the case of humans, the total number of genes is estimated to be at most about 100,000. In most cases, all biological phenomena, including cell differentiation and proliferation, various pathological conditions such as cancer, aging, infectious diseases, and immune diseases, and normal physiological phenomena, are almost always defined by the type and amount of expressed genes. It is becoming clear today.

[0003] In other words, if it is possible to identify genes whose expression is specifically increased or decreased in a certain state of a cell, it is possible to roughly estimate the state of the cell only by measuring the fate of those genes. Become. For this reason, efforts are currently being made to elucidate the context-specific genes of cells in various parts of the world, but as described above, the total number of genes is as large as 100,000 humans. It is virtually impossible to grasp the expression status of all genes under all conditions of cells, and since there are many types of genes that are commonly expressed in all cells, this method is wasteful. Therefore, if we can selectively extract and examine only genes specific to the situation,
This will greatly contribute from the viewpoint of the cost-effectiveness of economic and human resources.

To this end, a number of so-called "differential screening" methods have been devised and tried. These are classical differential colony (plaque) hybridizations, and some methods using modern polymerase chain reaction (PCR) and DNA binding reagents. These can be compared directly with each other after removing common parts by hybridizing with cDNA or RNA of each other, using special reagents that cross-link to DNA, or developing a small amount of isotope-labeled sample on a sequence gel. A method has been devised to find a specific gene in combination with a method.

However, these are, in fact, PC materials that require large amounts of raw materials (eg, human tissue).
At present, it is barely successful in only a limited number of laboratories because of the bias of repeating R and the lack of reproducibility of the results. Therefore,
There is an urgent need among medical biologists in various fields to develop a simple method that overcomes these difficulties.

[0006] On the other hand, Okubo et al. Cut a double-stranded cDNA with the 4b enzyme Sau 3AI to obtain a cDNA library consisting only of the 3 'terminal portion of mRNA, cloned it, and randomly sequenced the nucleotide sequence. It was reported that a gene expression profile was obtained (Nature Genet. 2,
173 (1992)). However, the length of each clone obtained by this method is on average about 300 bases,
Sequencing must be performed on a clone-by-clone basis. Thus, the total number of finally sequenced mRNAs was only about 1000 per cell type, far from the true gene expression profile in the cells.

[0007] In addition, such Velculescu restriction enzyme Nla III
By combining Fok I and Fok I, a library of 9 bases (Science 270, 484 (1995)) and Nla III
A library of 10 bases has been obtained by the combination of Bsm FI and Bsm FI (Cell 88, 243 (1997)). However,
This method is significantly inferior in terms of reliability representing mRNA. That is, for example, for 10 bases, 1 of 4
Zero powers, or 1048576 combinations, are possible, indicating that once every 1 million bases a 10 base sequence of any kind appears. m
As described above, the types of RNA are about 100,000 and the average chain length is about 2,000 bases, so that the total length is about 200 million bases. Any sequence of 10 bases in a base sequence of this length will appear 200 times on average. This makes it difficult to determine whether one small fragment represents one mRNA. With 9 bases, the uncertainty is further increased and is not a problem. Furthermore, Velculescu et al. Make a tail-to-tail blunt-end connection between small fragments in constructing a library. This operation has a problem that the length of the small fragments is uncertain and the efficiency is extremely reduced.

Accordingly, the object of the present invention is to provide a more reproducible
An object of the present invention is to provide a method for accurately and efficiently cloning a gene specifically expressed in a cell or cDNA, a cDNA fragment specifically expressed in the cell, and a probe containing the same.

[0009]

The present inventors have conducted various studies to solve the above-mentioned problems, and as a result, have found that Rsa I, a kind of 4-base recognition enzyme, and Bsm FI, a type IIS enzyme.
And a cD connected with different linkers at both ends of the 16 bases cleaved by these enzymes.
When a small NA fragment library was obtained and screened, it was found that a 14-base gene specifically expressed in cells could be cloned accurately, efficiently, and with good reproducibility. We have found that a DNA fragment consisting of bases is useful as a probe for detecting a cell-specific gene, and completed the present invention.

That is, the present invention provides a method for treating a test cDNA with a restriction enzyme Rsa I, arbitrarily linking a linker X,
By performing the Bsm FI treatment and the optional linker Y linkage different from linker X, 5′-linker X- (5 ′
A cDNA small fragment library consisting of 16 bases having an RsaI cleavage site (AC) on the side thereof ) -linker Y-3 'was obtained, and Rsa specific to a test cDNA was obtained from the library.
It is intended to provide a method for cloning a specific gene in a test cDNA, which comprises cloning 14 bases following an I cleavage site (AC).

[0011] The present invention also provides a method for cloning a test cell-specific gene, which comprises performing the above-mentioned operation using cDNA of a test cell mRNA as the test cDNA.

Further, the present invention provides a 5 'restriction enzyme Rsa I
CDNA consisting of 14 bases following the cleavage site (AC)
Provide fragments.

Further, the present invention provides a cDNA fragment consisting of 18 bases having a GTAC sequence on the 5 'side.

Further, the present invention provides a probe for detecting a specific gene comprising a cDNA fragment comprising the above 14 or 18 bases or a labeled product thereof.

[0015]

DESCRIPTION OF THE PREFERRED EMBODIMENTS Test cD used in the method of the present invention
NA is not particularly limited as long as it is cDNA for mRNA, and cD obtained by allowing reverse transcriptase to act on mRNA.
NA. If cDNA is synthesized from total RNA of a test cell and the method of the present invention is performed using the cDNA as a test sample, cloning of a specific gene of the test cell becomes possible. 1 μg of the total RNA used in the present invention is sufficient. 1 μg of total RNA corresponds to 1 mg of cells. Therefore, the present invention is particularly effective when handling a valuable human tissue sample or the like that can be obtained only by needle biopsy or the like. In addition, as the test cells, mRN
A may be any cell having a poly A tail, and in the case of a eukaryotic cell, it does not matter whether it is a protozoan, fungus, plant cell or animal cell.

The restriction enzyme Rsa I used in the present invention is
It is an enzyme that recognizes the base sequence GTAC and cleaves DNA between T and A. On the other hand, the restriction enzyme Bsm FI is an enzyme that recognizes the base sequence GGGAC and cleaves 14 bases after the 3 'side of the sequence.

The linker X and the linker Y used in the present invention are not particularly limited as long as they have a cohesive end with 16 bases having an RsaI cleavage site (AC) on the 5 ′ side of interest. It must not be complementary to itself or another linker. In addition, from the viewpoint of designing primers when amplifying the target DNA fragment by PCR after obtaining the target DNA fragment, it is preferable to select those linkers that do not match the known base sequence as much as possible.

A more preferred linker X has a base sequence GGG at the 3 'end. Because the cDNA
After linked to the linker X 5 'side of the Rsa I fragment, B
This is because, by the action of sm FI, the site of 14 bases on the 3 ′ side following the GGGAC is selectively cleaved, and the desired 14 bases can be easily obtained.

By the way, when the present inventor repeated the above-mentioned method of Velculescu and the like, all of them produced only artifacts,
No reliable assembly of small fragments from mRNA (cDNA) resulted. This is thought to be because the linker used had exactly the same 3'-terminal sequence, and the linker dimer was preferentially formed when the linker was connected to cDNA. This linker dimer is preferentially amplified during PCR and is a potential source of artifacts. Also, for the same reason that the linkers have the same 3 'end structure, they provide primers on the outer portion of the linker to avoid primer dimer generation. However, this ingenuity does not improve the efficiency of the catastrophic defect of linker dimer amplification at the expense of the amplification efficiency. On the other hand, the linker connection method of the present invention uses a small fragment cD with two kinds of linkers X and Y different from each other.
It is carried out by sandwiching the NA monomer from both sides, and there is no possibility of dimer formation from the viewpoint of the two linker 3 'terminal structures. The two primers for PCR also have completely different sequences, including the 3 'terminal structure, and can be set a few bases (cDNA side) from the linker connection site, so that the linker and the cDNA are theoretically well connected. Only what has been amplified is amplified.

The method of the present invention comprises the steps of 5'-linker X- (5 '
Obtaining a cDNA small fragment library consisting of 16 bases having an RsaI cleavage site (AC) on the side thereof ) -linker Y-3 '(step (a)); and an Rsa specific to a test cDNA from the library. And a step of cloning the 14 bases following the I cleavage site (AC) (step (b)).

In the step (a), for example, (1) a test cDNA having a labeled oligonucleotide bound to the 3 'side is treated with a restriction enzyme RsaI , and a 5'-RsaI site (AC)
Obtaining a labeled oligonucleotide DNA fragment, (2)
At the Rsa I site (AC) of the DNA fragment obtained in (1),
Linking a linker X having GGG on the 3 'side, (3)
The DNA fragment obtained in (2) was treated with a restriction enzyme Bsm FI to obtain a DNA fragment in which a linker X was linked to the 5 'side of 16 bases having an RsaI cleavage site (AC) derived from the test cDNA. 5) -Linker X- (1 having a Rsa I cleavage site (AC) derived from the test cDNA) by linking a linker Y to the 3 'side of the DNA fragment obtained in (3).
It is preferably carried out by obtaining a cDNA small fragment library consisting of (6 bases) -linker Y-3 '.

Here, examples of the labeled oligonucleotide include solid-phase-immobilized oligonucleotides, coenzyme-labeled oligonucleotides, etc., but solid-phase-immobilized oligonucleotides are preferred in view of reproducibility and recoverability of the target fragment. Latex bead-immobilized oligonucleotides, magnet bead-immobilized oligonucleotides and the like are more preferred, and latex bead-immobilized oligonucleotides are particularly preferred. Furthermore, oligo dT is particularly preferred as the oligonucleotide portion of the labeled oligonucleotide. The schematic diagram of step (a) when solid-phase immobilized oligo dT is used as the labeled oligonucleotide,
As shown in FIG.

[0023] When using the 3 'side labeled oligonucleotide bound cDNA as a test cDNA is, Rsa this
I, and if collected based on the label, Rs
Only DNA-labeled oligonucleotide DNA fragments having an aI site (AC) are obtained. Here, when a solid phase immobilized substance such as latex beads is used as the label, the target fragment can be easily obtained by simply collecting only the solid phase.

Next, when a linker X having a base sequence GGG is ligated to the 3 'side of the obtained DNA fragment, 5'-
A linker- Rsa I fragment conjugate is obtained.

Further, when the 5'-linker X- RsaI fragment-conjugated product is treated with Bsm FI, as described above, Bsm F
I recognizes GGGAC and cleaves 14 bases on the 3 'side of it, so that a DNA fragment in which linker X is linked to the 5' side of 16 bases having an RsaI cleavage site (AC) derived from the test cDNA is obtained. Can be Here, the recovery of the target fragment, when using a solid phase immobilized body as a label,
It is only necessary to remove the solid phase and recover the liquid phase.

Next, on the 3 'side of the obtained fragment, a linker Y
Are linked to form “5′-linker-X- (test cDN
16 bases having an Rsa I cleavage site (AC) from A)
-A library of small cDNA fragments consisting of "linker Y-3 '" is obtained.

Since the thus obtained library has an arbitrary linker connected to both ends, it can be easily amplified by the polymerase chain reaction (PCR) using the linker as a primer. The portion derived from the cDNA sandwiched between the two linkers X and Y is only 5 'AC
, And the length is represented by a constant length for all cDNAs, so that the risk of artifacts due to differences in amplification efficiency by PCR is minimal.

Next, step (b) will be described. In the step (b), the 14 bases following the RsaI cleavage site (AC) specific to the test cDNA are selected. Therefore , a control cDNA different from the test cDNA is subjected to the same operation as described above. cDNA
A library of small fragments derived from each other was obtained, and the common 14 fragments were obtained by a hybridization method using both small fragment libraries.
After removing the bases, the 14 bases following the RsaI cleavage site (AC) specific to the test cDNA may be cloned.

As the hybridization method,
Specifically, a method using RNA (for example, FIG. 2) and a method using DNA (for example, FIG. 3) can be considered. Since the cDNA small fragment library is prepared using the same linker (linker X and Y) for both the analyte and the control, they are separately prepared before hybridization so that the same linker is not included in each sample. restriction enzymes (e.g., Nco I and Bsp LU11I, hereinafter respectively referred to as Nco and Bsp) previously removed by one in. By this treatment, a hybrid is formed only at the portion derived from the cDNA. That is, when it is desired to identify and clone a cDNA specific to the test cDNA, a sense strand is prepared from a fragment of the test cDNA small fragment library cut with Bsp using appropriate primers and a heat-resistant DNA polymerase, and hybridized. The antisense strand to be soybean is prepared from RNA polymerase or heat-resistant DNA from a control cDNA small fragment library cut with Nco.
Made using polymerase. These are mixed (for example, at a molecular ratio of about the former 1 and the latter about 10) and hybridized. After incubation for a certain period of time, the hybridized fraction (the cDNA portion common to both cDNA libraries) was removed, and the remaining non-hybridized fraction was replaced with the test cDNA.
An excess amount of the antisense strand made from the small fragment library cut with Nco is added, and hybridization is performed again. Since the hybrid-forming fraction is derived from the specific gene of interest, it is collected. This may be extended by reverse transcriptase or DNA polymerase, amplified by PCR, and subjected to ordinary means of cloning to nucleotide sequence determination.

As a preferred cloning means, there is a method in which the fractionated band is subjected to PCR under conditions not containing an isotope, and then incorporated into a known plasmid and sequenced. Alternatively, a TA cloning kit can be used.

The 5 'restriction enzyme Rsa I thus obtained
CDNA consisting of 14 bases following the cleavage site (AC)
The fragment is specific for the gene specific to the test cDNA, ie, the mRNA of the test cell. Therefore, by cloning cDNA derived from a certain cell using the method of the present invention, it is possible to quantitatively analyze a gene that is specifically expressed in a situation where the cell is placed. By accumulating such information, it is possible to diagnose a disease (eg, cancer, infectious disease, etc.).

A 18-base DNA fragment obtained by linking GTAC to the 5 'side of the 14-base cDNA fragment is also a cDNA fragment derived from the test cDNA. The cDNA fragment consisting of 18 bases is also specific to the test cell.

Therefore, the above-mentioned cDNA fragment consisting of 14 bases, the above-mentioned cDNA fragment consisting of 18 bases, or a labeled product thereof is a good probe for the cDNA to be tested, and by using these as a probe, the cDNA to be tested, Test cells can be measured. Therefore, these probes are useful as diagnostic probes for test cells, for example, probes for diagnosing various diseases. Here, examples of the label include a label with a radioisotope, an enzyme, and the like.

[0034]

The present invention will be described in more detail with reference to the following examples, which should not be construed as limiting the invention thereto.

Example 1 (a) Cultured T cell line Molt4 and HIV NL
MRNA was isolated from cells infected with the -4 strain, and cDNA was obtained using reverse transcriptase. The specific gene was cloned for each cDNA as follows.

First, double-stranded cDNA was synthesized using oligo dT latex beads as primers (see FIG. 1). Next, this cDNA was cleaved with Rsa I, and the latex bead portion precipitated by centrifugation was recovered. As shown in the figure, a cD having a Rsa I site closest to the 3 'end of the cDNA was obtained.
A fraction containing the NA fragment was obtained. Next, a linker (linker X) was ligated to the cut end using T4 DNA ligase. There were at least three ways to do this, all of which were possible.

1) A blunt end connection is made directly to the blunt end generated by Rsa I cleavage. The linker in this case is

5′-TACAGGATACGCCATGGGG-3 ′ 3′-ATGTCCTATGCGGGTACCC-5 ′

Was obtained.

2) treating the RsaI terminus with Taq DNA polymerase in the presence of dCTP, adding 1 base C to the 3 'terminus,

5'-AC ... 3'-CTG ...

The protruding end is formed. This is followed by a cohesive end connection, in which case the linker is

5′-TACAGGATACGCCATGGGG-3 ′ 3′-ATGTCCTATGCGGTACC-5 ′

Was

3) treating the RsaI end with T4 DNA polymerase in the presence of dATP, dGTP and dCTP to remove one base T from the 3 ′ end,

5'-AC ... 3'-G ...

The protruding end is formed. This is followed by a cohesive end connection, in which case the linker is

5′-TACAGGATACGCCATGGGG-3 ′ 3′-ATGTCCTATGCGGTACCCT-5 ′

Was obtained.

Next using the restriction enzyme Bsm FI sites caused by these linkers connection (GGGAC), Bs
performed m FI cutting, partial turn not latex beads as opposed to the previous, i.e. to recover the supernatant. Since the cleavage site of this enzyme is GGGACN (10/14), the recovered portion contains the cDNA derived from the cDNA following the linker.
Bases will be included (excluding the common AC2 residue from the RsaI site).

This part is called dATP, dCTP, dGTP
And TaT DNA polymerase reaction in the presence of dTTP, a protruding end having one A at the 3 'end was generated, and a second linker (linker Y) was cohesively connected to this end. The linker in this case is

5'-CATGTGTCGCAACTGACT-3 '3'-TGTACACAGCGTGTGACTGA-5'

Was

Now, a total of 53 base pairs of D including 14 base pairs derived from cDNA with both ends sandwiched between known linkers
A group of NAs, a small fragment cDNA library, was obtained. This is the primer 5'-TACAGGG
ATACGCCATGGGAC-3 '(primer x)
And 5'-TAGTCAGTTGCGACACATGT
Using -3 '(primer y), it can be easily amplified by PCR with Taq DNA polymerase. In this example, amplification was performed 15 times, and this was stored as a small fragment cDNA library, and a part thereof was taken out and used for selection of the following specific clones.

(B) The selection of specific clones depends on the principle of hybridization, but the method using RNA (FIG. 2) and the method using DNA to remove small base sequence fragments common to the two libraries (FIG. 3).

1) Selection method using RNA (FIG. 2) First, one small fragment cDNA library (for example, FIG. 2)
In A, the A-library was cut with Bsp and XN
A portion was recovered and subjected to an unequal amplification reaction using the primer x and Taq DNA polymerase.
A single-stranded DNA consisting of the sequence is prepared. Next, PCR is performed with primer y (primer T3y) in which the promoter sequence of primer x and T3 is linked to the 5 'end to prepare a small fragment cDNA library with a T3 promoter sequence (the T7 promoter sequence is connected to primer y). However, an SP6 promoter sequence is also possible). The sequence of primer T3y is

5'-GGGTATTAACCCTCA
CTAAAGGGAAGTAGTCAGTTGGGAC
ACATGT-3 '

Was

After cutting this library with the restriction enzyme NcoI , the X portion was removed and the library was digested with T3 RNA polymerase.
An in vitro transcription reaction is performed to prepare an antisense strand RNA for the NY portion as shown in FIG.

Similarly, the sense DN was obtained from the B-library.
A and antisense RNA are prepared. Next, these sense strand DNA and antisense strand RNA are cross-wise (i.e., B-library RNA for DNA from A-library and A-library for DNA from B-library). RNA) of about 1
Mix and hybridize in pairs. The fraction that formed a hybrid in this reaction is common to both libraries, and the single-stranded DNA remaining after the RNase treatment is recovered. This DNA
When an antisense RNA made from the same library is added, it can be recovered as a DNA-RNA hybrid.
If a reverse transcription reaction is carried out using this, a portion specific to each library that has become XNY can be recovered as single-stranded DNA. After PCR using primers x and primer y which, cut with Nco and Bsp, since these enzymes produces the same cohesive end, incorporating the DNA fragment Nco I site of the plasmid vector p Nco 1, determining the nucleotide sequence I do. p Nco 1 plasmid pUC11
The multiple cloning site between the Eco RI and Hind III sites of 9 was removed and replaced with

5′-AATTCCATGGGATCATGA-3 ′ 3′-GGTACCTATAGTACTTCGA-5 ′

Is incorporated.

2) Selection method using DNA (FIG. 3) Small fragment cDNA obtained from two cells to be compared
The library, cut with each Nco or Bsp,, recovering NY and XN fragments. These are subjected to unequal amplification reaction using primer y or primer x and Taq DNA polymerase, respectively, to synthesize single-stranded antisense NY chains and sense XN chains. These sense strands and antisense strands are mixed in a crosswise manner at the same molecular ratio as in 1) above, and hybridization is carried out. The fraction that does not form a hybrid is collected and then hybridized with the antisense strand DNA fragment from the library from which the sense strand itself was derived. The hybrid fraction is collected, and a partial hybrid elongation reaction is performed with T4 DNA polymerase (or Klenow DNA fragment or other DNA polymerase),
It is a complete double-stranded DNA. This is amplified by PCR using primer x and primer y. This was cleaved with similarly Nco and Bsp the above 1), p Nco
1 and base sequence determination is performed.

(C) As described above, the Mol of the T cell line
A comparison was made between t4 and cells infected with HIV NL-4. That is, identification and cloning of genes whose expression is specifically increased by HIV infection and genes whose expression is specifically suppressed on the contrary.

Tables 1 and 2 show some of the small fragments identified by this method. These nucleotide sequences were subjected to homology search against an existing database. Table 1 shows HIV
Some of the small fragments that are thought to increase in expression due to infection of HIV (ie, small fragments specifically found in the library of HIV-infected cells) are shown in Table 2, and conversely, expression is suppressed by HIV infection. Small fragments (ie, those found specifically in a library of uninfected cells).

[0066]

[Table 1]

[0067]

[Table 2]

TGGGTCTC found in the first row of Table 1
The TCTGGT sequence is a part of the sequence of HIV,
The fact that it was specifically observed in infected cells indicates that the method of the present invention is accurate. In addition, there were surprising ones such as apolipoprotein AII, tubulin, serum albumin and β2 integrin D subunit, and also contained some unknown base sequences. On the other hand, small fragments (that is, mRNAs whose expression is considered to be suppressed by HIV infection) obtained from a library from HIV-uninfected Molt4 cells include ribosomal proteins L7 and L3.
1, stathmin, cytoskeletal γ-actin,
Some unknown sequences were included in addition to ubiquitin, dihydrolipoate dehydrogenase, lactate dehydrogenase, and the like.

In Tables 1 and 2, the numbers shown before the base sequence as mf ID are random combinations of 14 bases (total of 268,
435, 456 patterns) in the order of ACGT. That is, it is as follows.

[0070] The AAAAAAAAAAAAAA 000000001 (or simply 1) AAAAAAAAAAAAAC the 000000002 (or simply 2) AAAAAAAAAAAAAG the 000,000,003 (or simply 3) AAAAAAAAAAAAAT the 000,000,004 (or simply 4) AAAAAAAAAAAACA the 000,000,005 (or simply 5) ....... TTTTTTTTTTTTGT 268435452 TTTTTTTTTTTTTTA 268435453 TTTTTTTTTTTTTTC 268435454 TTTTTTTTTTTTTTG to 2684435455 TTTTTTTTTTTTTTT to 2684435456

As a result, any sequence consisting of 14 bases can be assigned to one of these 9-digit numbers. These numbers are called mf ID (small fragment ID).

(D) Next, to ascertain whether the small fragments identified by this method accurately reflect the actual expression specificity in each cell, how much the identified sequence is actually At a frequency of 2. The small fragment cDNA library obtained in the first step of the method is useful for this purpose. That is, a large number of small fragments contained in a small fragment cDNA library represented by 14 bases corresponding to mRNA on a one-to-one basis may be randomly sequenced in large numbers. Individual small fragments constituting the small fragment cDNA library according to the invention can be cut out with Nco and Bsp, yet sticky ends generated by these enzymes are the same, can be connected a number of small fragments. This is the nature of the enzyme (T4 DNA ligase) used for ligation and has been recognized since the discovery of this enzyme (J. Biol.
Chem. 234, 4543 (1968)). The ligated small fragment is pNco
Incorporation into a single fragment and determination of the nucleotide sequence can reveal the sequence of about 20 small fragments in one operation. Approximately 2500 samples were sequenced to elucidate the 50,000 sequences that could roughly elucidate the type and number of mRNAs expressed in the cells.

Tables 3 and 4 show a part of the number of appearances of mRNA obtained as a result of sequencing about 50,000 small fragments from the two libraries. It was clear that all the sequences shown in Tables 1 and 2 were fully supported by the results obtained when comparing the two libraries directly. In addition, small fragment cDNA
Direct sequencing of the library requires more mRN
The differences in the expression of A were revealed (Tables 3 and 4 also show some mRNAs with such differential expression).

[0074]

[Table 3]

[0075]

[Table 4]

(E) Next, using the small fragment thus obtained, it was tested whether the mRNA itself from which the small fragment was derived could be cloned in the first place, ie, whether the small fragment was useful as a probe. Was. Although the base length of the small fragment derived from mRNA described in the present invention is 14, an Rsa I site must exist at the 5 'upstream, so the total length is calculated by adding 4 bases of this recognition sequence GTAC. It can be a probe of 18 bases. Tables 1 and 2
18 bases (5'-GTACC)
ATGCGGGCCACACG-3 ') was synthesized, the 5' end of which was labeled with ³² P, and Molt prepared by a conventional method was used.
The results of plaque hybridization performed on the cDNA library No. 4 are shown in FIG. Positive clones were easily identified as is clear from FIG. 4, and there was no problem in purifying the clones by secondary and tertiary screening. 18 bases were found to be long enough to form such a stable hybrid and could function perfectly as a probe for full-length cDNA cloning.

[0077]

According to the present invention, it is possible to detect and clone a test cDNA or a gene specifically expressed in a test cell with good reproducibility. According to the present invention, a difference in function and morphology between any two cells can be clarified as a difference in gene expression state, so that it can be widely applied to analysis of all biological phenomena under physiological conditions or pathological conditions.

[Brief description of the drawings]

FIG. 1. Step (a) (small fragment c)
BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic diagram showing one embodiment of a method for producing a DNA library).

FIG. 2 is a schematic diagram showing one embodiment of a screening method using a complementary RNA in step (b) of the method of the present invention.

FIG. 3 is a schematic diagram showing one embodiment of a screening method using a complementary strand DNA in step (b) of the method of the present invention.

FIG. 4 is a diagram showing the results of plaque hybridization using the 18-base probe of the present invention.

Claims (8)

[Claims] 1. A test cDNA is treated with a restriction enzyme Rsa I, ligated with an optional linker X, treated with a restriction enzyme Bsm FI, and ligated with an optional linker Y different from the linker X to give a 5′-linker X- ( A small cDNA library consisting of a 16-base linker-Y-3 'having an RsaI cleavage site (AC) on the 5' side was obtained, and an RsaI cleavage site (A
A method for cloning a specific gene in a test cDNA, which comprises cloning 14 bases subsequent to C). 2. A cDNA small fragment library is obtained by (1) treating a test cDNA having a labeled oligonucleotide bound to the 3 ′ side with a restriction enzyme RsaI, and treating it with 5′- RsaI.
Site (AC) —A labeled oligonucleotide DNA fragment was obtained. (2) Rsa I site (AC) of the DNA fragment obtained in (1)
(3) A DNA fragment obtained in (2) is treated with a restriction enzyme Bsm FI to obtain an Rsa I cleavage site (AC) derived from the test cDNA.
Having linker X linked to the 5 'side of 16 bases having
A fragment was obtained. (4) A linker Y was ligated to the 3 'side of the DNA fragment obtained in (3) to obtain a 5'-linker X- (test cDN
The cloning method according to claim 1, wherein a small cDNA library comprising a 16-base-linker Y-3 'having an RsaI site (AC) derived from A is obtained. 3. The cloning method according to claim 2, wherein the labeled oligonucleotide is a latex bead-bound oligo dT. 4. The cloning of a 14-base gene following the Rsa I cleavage site (AC) specific to the test cDNA is carried out by hybridization between the test cDNA-derived small fragment library and the control cDNA-derived small fragment library. The cloning method according to any one of claims 1 to 3, wherein the common 14 bases are removed. 5. A method for cloning a gene specific to a test cell, wherein the cDNA of the test cell mRNA is used as the test cDNA according to claim 1. 6. A 5′- restriction enzyme Rsa I cleavage site (A
CDNA fragment consisting of 14 bases following C). 7. A cDNA fragment consisting of 18 bases having a GTAC sequence on the 5 ′ side. 8. A probe for detecting a specific gene, comprising the cDNA fragment according to claim 6 or 7 or a labeled product thereof.