JPH11155572A - 4(r)-hydroxy-2-ketoglutaric acid aldolase and dna coding for the enzyme - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide the subject enzyme enabling industrially advantageous production of 4(R)-hydroxy-2-ketoglutaric acid, etc., useful as a synthetic raw material for pharmaceuticals, etc. SOLUTION: A DNA coding for e.g. 4(R)-hydroxy-2-ketoglutaric acid aldolase having the amino acid sequence of the formula, collectable from Bacillus sp. DC187 strain (FERM BP-4646), etc., and catalyzing the reaction to exclusively produce 4(R)-hydroxy-2-ketoglutaric acid from glyoxylic acid and pyruvic acid without forming 4(S)-hydroxy-2-ketoglutaric acid is introduced into a host cell via a vector to obtain a transformant. Subject enzyme produced by the culture of the transformant is made to react with glyoxylic acid and pyruvic acid in an aqueous medium to obtain 4(R)-hydroxy-2-ketoglutaric acid. 4(R)-hydroxy-L- glutamic acid and 4(R)-hydroxy-L-proline are produced by using the aqueous medium containing the transformant, an amino group donor, a carbohydrate and glyoxylic acid.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to an enzyme 4 (R) -hydroxy-2-ketoglutarate aldolase which catalyzes a reaction for producing 4 (R) -hydroxy-2-ketoglutarate from glyoxylic acid and pyruvic acid. DNA encoding an enzyme, a recombinant DNA obtained by incorporating the DNA into a vector, a transformant obtained by introducing the recombinant DNA into a host cell, and 4 (R) using the transformant
-Hydroxy-2-ketoglutaric acid [hereinafter referred to as 4 (R) K
HG], 4 (R) -hydroxy-L-glutamic acid [hereinafter abbreviated as 4 (R) HG] or 4 (R) -hydroxy-L-proline [abbreviated as 4 (R) HYP]
A method for producing the same.

[0002]

2. Description of the Related Art From pyruvic acid and glyoxylic acid, 4-
4-hydroxy-2-ketoglutarate aldolase (hereinafter referred to as KAL), which produces hydroxy-2-ketoglutarate
The activity has been reported to exist in several organisms, but not only 4 (R) -hydroxy-2-ketoglutarate but also 4 (S) -hydroxy-2-ketoglutarate. 4-hydroxy-2-ketoglutaric acid aldolase [hereinafter referred to as 4 (R) -hydroxy-2-ketoglutarate aldolase]
(R) KAL] is not known [Methods in E
nzymology 41 partB, 115, EEDekker & U. Maitra,
J. Biol. Chem., 257 , 5079 (1972)].

As a method for producing 4 (R) KHG, erythro-4-hydroxy-L-glutamic acid is chemically deaminated (Methods in Enzymology, 17 partB, 27).
5), a method of decomposing and removing 4 (S) -hydroxy-2-ketoglutaric acid from racemic-4-hydroxy-2-ketoglutaric acid synthesized from oxaloacetic acid and glyoxylic acid [J. C.
Soc. Perkin Trans., 1 , 1085 (1992)], a biocatalyst having an activity of generating 4 (R) KHG from pyruvate and glyoxylate can be converted to pyruvate or pyruvate by the biocatalyst. A method of reacting a compound with glyoxylic acid (JP-A-7-289284) is known.

The former two methods are not practical because the raw materials are expensive or the yield is low. Although the latter method is practical, a more economical method is desired. 4
(R) HG is produced by chemically synthesized DL-4-.
Ammonia and NAD to hydroxy-2-ketoglutaric acid
A method in which glutamate dehydrogenase is allowed to act in the presence of PH, and the resulting 4- (R) 4 (S) racemic 4-hydroxyglutamic acid is separated by ion exchange chromatography (Me
thods in Enzymology, 17 part B, 277) or a compound capable of converting a biocatalyst having an activity of generating 4 (R) HG from pyruvate and glyoxylate in the presence of an amino group donor into pyruvate or pyruvate by the biocatalyst And glyoxylic acid (JP-A-8-80198)
Etc. are known.

The former method is not practical because it requires expensive raw materials and an optical resolution operation. Although the latter method is practical, a more economical method is desired. As a method for producing 4 (R) HYP, in addition to a method of separating and purifying from a collagen hydrolyzate, Clonostakis,
A method of culturing a microorganism belonging to the genus Gliocladium or Nectria and extracting it from the culture (Japanese Unexamined Patent Publication No.
236980), a microorganism having an activity of converting 4-hydroxy-2-ketoglutaric acid to 4-hydroxy-L-proline was used.
A method of acting on -hydroxy-2-ketoglutaric acid (JP-A-3-26695) is known. However, any of these methods requires high costs for raw materials or separation and purification, and is not an excellent production method.

[0006]

SUMMARY OF THE INVENTION An object of the present invention is to provide 4 (R) KHG, which is useful as a raw material for synthesizing pharmaceuticals and the like.
An object of the present invention is to provide a method for industrially advantageously producing (R) HG and 4 (R) HYP.

[0007]

According to the present invention, 4 (S) -hydroxy-2-ketoglutaric acid is not produced from glyoxylic acid and pyruvic acid.
Enzyme 4 that catalyzes the reaction producing only ketoglutaric acid 4
(R) -hydroxy-2-ketoglutarate aldolase [4 (R) KAL], DNA encoding the enzyme, D
Recombinant DNA obtained by incorporating NA into a vector,
A transformant obtained by introducing the recombinant DNA into a host cell, 4 (R) KHG using the transformant, 4 (R)
HG or 4 (R) HYP.

Further, an amino group donor and 4 (R) KH
The present invention relates to a method for producing 4 (R) HYP using a biocatalyst having an activity of producing 4 (R) HYP from G.

[0009]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described below in detail.
A reaction for producing only 4 (R) -hydroxy-2-ketoglutaric acid without producing 4 (S) -hydroxy-2-ketoglutaric acid from glyoxylic acid and pyruvic acid as 4 (R) KAL of the present invention. Any enzyme can be used as long as it is an enzyme that catalyzes, for example, a polypeptide having the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 1
Has an amino acid sequence in which one or more amino acids are substituted, deleted or added, and does not produce 4 (S) -hydroxy-2-ketoglutaric acid from glyoxylic acid and pyruvic acid. And polypeptides having an activity of catalyzing a reaction for producing only 4 (R) -hydroxy-2-ketoglutaric acid.

The amino acid sequence represented by SEQ ID NO: 1 has an amino acid sequence in which one or more amino acids have been substituted, deleted or added, and is derived from glyoxylic acid and pyruvic acid by
A polypeptide having an activity of catalyzing a reaction that does not produce 4 (S) -hydroxy-2-ketoglutaric acid but only produces 4 (R) -hydroxy-2-ketoglutaric acid is
Nucleic Acids Research, 10 , 6487 (1982), Proc. Na
tl. Acad. Sci., USA, 79 , 6409 (1982), Proc. Natl.
Acad. Sci., USA, 81 , 5662 (1984), Science, 224, 14
31 (1984), PCT WO85 / 00817 (1985), Nature, 316 , 60.
1 (1985), Gene, 34 , 315 (1985), Nucleic Acids Rese
arch, 13 , 4431 (1985), Current Protocols
In Molecular Biology (Current Protocol
s in Molecular Biology), Chapter 8 Mutagenesis of Clon
ed DNA, and can be prepared according to the method described in John Wiley & Sons, Inc. (1989).

The DNA of the present invention includes
(R) KAL-encoding DNA,
Examples thereof include DNA having the base sequence represented by SEQ ID NO: 2 or 3, and DNA that hybridizes with the DNA under stringent conditions.

The DNA capable of hybridizing with the DNA of the present invention under stringent conditions refers to a DNA having the nucleotide sequence of SEQ ID NO: 2 or 3 as a probe, a colony hybridization method, a plaque
D obtained by using a hybridization method or a Southern blot hybridization method
NA, specifically, 0.7% using a filter on which DNA derived from colonies or plaques was immobilized.
After hybridization at 65 ° C in the presence of ~ 1.0 M NaCl, a 0.1- to 2-fold concentration of SSC solution (the composition of a 1-fold concentration SSC solution is 150 mM sodium chloride and 15 mM sodium citrate. And DNA that can be identified by washing the filter under 65 ° C. conditions.

[0013] Hybridization is performed by using Molecular Cloning: A Laboratory Manual (Molec).
ular Cloning, A laboratory manual), 2nd edition (Sambrook, Fritsch, Maniacis (M
aniatis), Cold Spring Harbor Laboratory Press (Cold Spring Harbor Laboratory Pre)
ss), 1989, hereinafter abbreviated as Molecular Cloning, 2nd edition], and the like. Specific examples of the hybridizable DNA include a DNA having at least 60% or more homology with a nucleotide sequence selected from the nucleotide sequences represented by SEQ ID NOs: 2 and 3, and a DNA having at least 80% homology.
NA, more preferably DN having 95% or more homology
A can be given.

The DNA of the present invention can be obtained from a microorganism having an activity of producing 4 (R) -hydroxy-2-ketoglutaric acid from glyoxylic acid and pyruvic acid. Examples of the microorganism include microorganisms belonging to the genus Bacillus, and specifically, Bacillus sp. OC187 strain. The Bacillus sp. OC187 strain is a strain isolated from the soil by the present inventors and based on the Budapest Treaty,
FE to the Institute of Biotechnology and Industrial Technology, Institute of Industrial Science on March 19
Deposited as RM BP-4646.

A method for obtaining a DNA encoding 4 (R) KAL from a microorganism having an activity of producing 4 (R) -hydroxy-2-ketoglutaric acid from glyoxylic acid and pyruvic acid will be described below. From a microorganism having an activity of producing 4 (R) -hydroxy-2-ketoglutaric acid from glyoxylic acid and pyruvic acid, a normal DNA isolation method, for example, a phenol method [Biochim. Biophys. Acta., 7
2 , 619 (1963)] to prepare chromosomal DNA of the microorganism. The obtained chromosomal DNA is cleaved with an appropriate restriction enzyme, and the restriction fragment is inserted into a vector DNA to construct a DNA library of the microorganism chromosome. Using this DNA library, a host microorganism is transformed. The activity of producing 4 (R) -hydroxy-2-ketoglutaric acid from glyoxylic acid and pyruvic acid is measured for the obtained transformant. A DNA containing the gene of interest can be obtained from a transformant having enhanced activity compared to the parent strain.

This series of operations can be performed according to a known in vitro recombination technique (Molecular Cloning, 2nd edition). 4 from glyoxylic acid and pyruvic acid
As a vector DNA for constructing a chromosomal DNA library of a microorganism having an activity of producing (R) -hydroxy-2-ketoglutarate, any phage vector, plasmid vector, or the like can be used as long as it can autonomously replicate in Escherichia coli K12 strain. But can be used. Specifically, ZAP Express (Stratagies, Strategies,
5 , 58 (1992)], pBluescriptII SK (+) [Nucleic Acids Research, 1
7 , 9494 (1989)], λzap II (Stratagene), λgt10, λgt11 [DNA cloning
A Practical Approach (DNA Cloning, A
Practical Approach), 1 , 49 (1985)), Lambda Blue
Mid (manufactured by Clonetech), λExCell (manufactured by Pharmacia), pT7T318U (manufactured by Pharmacia), pcD2 (Molecular and Cellular Biology (Mol. Cell. Biol.), 3 , 280 (1983)), p
UC18 [Gene, 33 , 103 (1985)], pS
TV29 (manufactured by Takara Shuzo) and the like.

As the host microorganism, any microorganism belonging to Escherichia coli can be used. Specifically, Escherichia coli XL1-Blue MRF ′ [Stratagies, 5 , 81 (1992)], Escherichia coli
C600 [Genetics, 39 , 440 (195
4)), Escherichia coli Y1088 [Science, 222 , 778 (1
983)), Escherichia coli Y1090 (Science, 222 , 778
(1983)], Escherichiacoli NM522 [Journal of Molecular Biology (J. Mol. Biol.), 1
66 , 1 (1983)), Escherichia coli K802 (J. Mol. Bio
l., 16 , 118 (1966)), Escherichia coli JM105, Esch
E. coli ATCC 33625 and the like are used.

The DNA fragment encoding 4 (R) KAL is used as it is or after digestion with an appropriate restriction enzyme or the like, and then incorporated into a vector by a conventional method, and a commonly used nucleotide sequence analysis method, for example, the dideoxy method of Sanger et al. Pro
c. Natl. Acad. Sci. USA, 74 , 5463 (1977)] or 373A DNA sequencer (Perkin Elmer) to analyze the DNA. Determine the nucleotide sequence.

The 4 (R) KAL thus determined
For example, the nucleotide sequence shown in SEQ ID NO: 2 can be mentioned as the nucleotide sequence of DNA encoding The DNA of the present invention can also be prepared by chemically synthesizing with a DNA synthesizer based on the determined DNA base sequence. Examples of the DNA synthesizer include a DNA synthesizer manufactured by Shimadzu Corporation using a thiophosphite method and a DNA synthesizer model 392 manufactured by Perkin Elmer using a phosphoramidite method.

[0020] DN encoding 4 (R) KAL of the present invention
In order to express 4 (R) KAL from A in host cells, Molecular Cloning 2nd Edition and Current
Protocols in Molecular Biology
The methods described in Supplements 1 to 34 and the like can be used. That is, by constructing a recombinant vector in which the DNA of the present invention is inserted downstream of a promoter of an appropriate expression vector and introducing it into a host cell, a transformant that expresses 4 (R) KAL of the present invention is obtained. Obtainable.

As the host cell, any cell can be used as long as it can express the gene of interest, such as bacteria, yeast, animal cells, insect cells and the like. As the expression vector, those capable of autonomous replication in the above-mentioned host cell or integration into a chromosome and containing a promoter at a position where the DNA of the present invention can be transcribed are used.

When a prokaryote such as a bacterium is used as a host cell, the expression vector for the DNA of the present invention is capable of autonomous replication in the prokaryote, and has a promoter, a ribosome binding sequence, the DNA of the present invention, and a transcription termination sequence. , It is preferable to be constituted. A gene that controls the promoter may be included. Examples of expression vectors include pKK233-2 (Pharmacia), pSE280 (Invitrogen), pGEMEX-1 (Promega), pQE
-8 (QIAGEN), pKYP10 (JP-A-58
-110600), pKYP200 [Agric. Biol. Che
m., 48 , 669 (1984)], pLSA1 [Agric. Biol. Che.
m., 53 , 277 (1989)], pGEL1 [Proc. Natl. Acad.
Sci., USA, 82 , 4306 (1985)], pBluescript (STRAT
AGENE), pTrs30 [ Escherichia coli JM109 / pT
rS30 (FERM BP-5407)], pTr
s32 [ Escherichia coli JM109 / pTrS32 (FERM
BP-5408)], pGHA2 [ Escherichi
a coli IGHA2 (FERM BP-400 ) from the preparation]
pGKA2 [ Escherichia coli IGKA2 (FERM BP
-6798)], pTerm2 (Japanese Unexamined Patent Publication No. 3-2)
2979, US4686191, US4939094,
US5160735), pGEX (Pharmacia), p
ET system (Novagen), pSupex, pACY
C184, pSTV29 (Takara Shuzo), pCG1, p
CS116 (Japanese Patent Application Laid-Open No. Hei 6-277082).

The promoter may be any promoter as long as it can be expressed in a host cell such as Escherichia coli.
For example, trp promoter (P trp), lac promoter (P lac), P _L promoter, can be mentioned promoters from P _R such promoters, E. coli or phage, or the like. In addition, a promoter in which two P trps are connected in series (P trp x2), a tac promoter, a T7 promoter, a P
An artificially designed and modified promoter such as the letI promoter can also be used.

As the ribosome binding sequence, Shine-
It is preferable to use a plasmid in which the distance between the Dalgarno (Shine-Dalgarno) sequence and the initiation codon is adjusted to an appropriate distance (for example, 6 to 18 bases). Any DNA encoding 4 (R) KAL may be used as long as it encodes 4 (R) KAL, and the base sequence of the DNA should be a codon optimal for expression in a host microorganism. High expression can be achieved by substituting and using a base.
Using E. coli as a host, a specific example of a DNA encoding 4 (R) KAL in which the bases have been substituted so as to have optimal codons for expression includes the base sequence shown in SEQ ID NO: 3.

In the recombinant vector of the present invention, a transcription termination sequence is not always necessary for expression of the DNA of the present invention, but it is preferable to arrange a transcription termination sequence immediately below a structural gene. D encoding 4 (R) KAL of the present invention
As a plasmid containing NA, for example, pKSR22
2, pKSR303, pKSR321, pKSR803
And the like. Es is an Escherichia coli containing pKSR303
cherichia coli NHK46 / pKSR303 was fed to the Institute of Biotechnology and Industrial Technology, Institute of Industrial Science and Technology, 1-3-1 Higashi, Tsukuba, Ibaraki, Japan (Postal Code 305) on August 12, 1997.
Deposited as RM BP-6051.

Examples of the host cell include microorganisms belonging to the genera Escherichia, Klebsiella, Serratia, Corynebacterium, Brevibacterium, Pseudomonas, Bacillus, etc., for example, Escherichia coli XL1-Blue,
Escherichia coli XL2-Blue, Escherichia coli DH1, E
scherichia coli MC1000 , Escherichia coli KY3276, E
scherichia coli W1485, Escherichia coli JM109, E
scherichia coli HB101, Escherichia coli No.49, Es
cherichia coli W3110, Escherichia coli NY49, Esch
erichia coli ATCC33625, Escherichia coli ATCC1130
3, Bacillus subtilis , Bacillus amyloliquefacines ,
Brevibacterium immariophilum ATCC14068, Brevibacte
rium saccharolyticum ATCC14066, Brevibacterium fla
vum ATCC14067, Brevibacterium lactofermentum ATCC1
3869, Corynebacterium glutamicum ATCC13032, Coryn
ebacterium acetoacidophilum ATCC13870, Microbacte
rium ammoniaphilum ATCC15354, Klebsiela oxytoca AT
CC8724, Serratia marsecens ATCC13880 and the like.

As a method for introducing a recombinant vector, any method for introducing DNA into the above host cells can be used. For example, a method using calcium ions [Proc. Natl. Acad. Sci. USA, 69 , 2110 (1972)),
Protoplast method (JP-A-63-2483942) and the like can be mentioned. When using yeast strains as host cells,
As an expression vector, for example, YEP13 (ATCC3711)
5), YEp24 (ATCC37051), YCp50 (ATCC3741)
9) etc. can be used.

As the promoter, any promoter can be used as long as it can be expressed in yeast strains. For example, promoters of glycolytic genes such as hexose kinase, gal 1 promoter, gal 10 promoter, heat shock Promoters such as polypeptide promoter, MFα1 promoter, CUP1 promoter and the like can be mentioned.

As the host cells, Saccharomyces cerevisae , Schizosaccharomyces pombe , Kluyveromyces lactis , Trichosporon pullulan
s ), Schwanniomyces
alluvius ) and the like.

As a method for introducing a recombinant vector, any method for introducing DNA into yeast can be used. For example, an electroporation method [Methods.
nzymol., 194 , 182 (1990)), spheroplast method (Pr
oc. Natl. Acad. Sci. USA, 84 , 1929 (1978)], lithium acetate method [Journal of Bacteriology (J.B.
acteriol.), 153 , 163 (1983)].

When an animal cell is used as a host, pAGE107 [Japanese Unexamined Patent Application Publication No.
22979; Cytotechnology, 3 , 1
33, (1990)], pAS3-3 (JP-A-2-27075), pC
DM8 [Nature, 329 , 840, (1987)],
pcDNAI / Amp (Invitrogen), pR
EP4 (manufactured by Invitrogen) pAGE103 [J.
Biochem., 101 , 1307 (1987)], pAGE210 and the like.

Any promoter can be used as long as it can be expressed in animal cells. For example, the IE (imme) of cytomegalovirus (human CMV) can be used.
diateearly) gene promoter, SV40 early promoter or metallothionein promoter. Further, an enhancer of the IE gene of human CMV may be used together with the promoter.

Examples of the host cells include Namalwa cells which are human cells, COS cells which are monkey cells,
Chinese hamster cells, CHO cells, H
BT5637 (JP-A-63-299) and the like. As a method for introducing a recombinant vector, any method for introducing DNA into animal cells can be used. For example, an electroporation method [Cytotechno
, 3 , 133 (1990)], the calcium phosphate method (Japanese
2-227075), lipofection method [Proc. Natl. Acad.
Sci. USA, 84 , 7413 (1987)].

When an insect cell is used as a host, for example, Baculovirus Expression Vectors A Laboratory Manual (Baculovirus Expre
ssion Vectors, A Laboratory Manual), 4 (R) KAL is expressed by the method described in Current Protocols in Molecular Biology Supplement 1-34, Bio / Technology, 6 , 47 (1988). be able to.

That is, after the recombinant gene transfer vector and the baculovirus are co-transfected into insect cells to obtain the recombinant virus in the culture supernatant of the insect cells, the recombinant virus is further infected into the insect cells and 4 (R ) KAL can be expressed. Examples of the gene transfer vector used in the method include pVL1392 and pVL139.
3, pBlueBacIII (both from Invitrogen) and the like.

Examples of the baculovirus include, for example, Autographa californica nuclea polyhedrosis virus, which is a virus that infects night insects.
(Autographa californica nuclear polyhedrosis viru
s) etc. can be used. As insect cells, Spo
Sf9, Sf2 which are ovarian cells of doptera frugiperda
1 [Baculovirus Expression Vectors, A Laboratory Manual, WH Freeman and Company
d Company), New York (1992)], T
High5 (manufactured by Invitrogen) which is an ovarian cell of richoplusia ni can be used.

As a method for preparing a recombinant virus, the above-mentioned recombinant gene transfer vector and the above baculovirus are co-transfected into insect cells by, for example, the calcium phosphate method (Japanese Patent Laid-Open No. 2-227075), the lipofection method [Proc.
Natl. Acad. Sci. USA, 84 , 7413 (1987)]. As a method for expressing the gene, secretory production, fusion protein expression, and the like can be performed according to the method described in Molecular Cloning, 2nd edition, etc., in addition to direct expression.

The transformant obtained as described above is cultured in a medium, the 4 (R) KAL of the present invention is produced and accumulated in the culture, and collected from the culture to obtain the 4 (R) KAL of the present invention. R) KAL can be manufactured. The method for culturing the transformant of the present invention in a medium can be performed according to a usual method used for culturing a host. A culture medium for culturing a transformant obtained by using a prokaryote such as Escherichia coli or a eukaryote such as yeast as a host contains a carbon source, a nitrogen source, inorganic salts, and the like which can be used by the organism. Either a natural medium or a synthetic medium can be used as long as the medium can efficiently culture C.

The carbon source may be any one which can be assimilated by the organism, such as glucose, fructose, sucrose, molasses containing these, carbohydrates such as starch or hydrolyzed starch, and organic acids such as acetic acid and propionic acid. And alcohols such as ethanol and propanol. Examples of the nitrogen source include ammonium salts of inorganic or organic acids such as ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, and ammonium phosphate, other nitrogen-containing compounds, peptone, meat extract, yeast extract, corn steep liquor, and casein. A hydrolyzate, soybean meal, a soybean meal hydrolyzate, various fermentation cells, and digests thereof can be used.

As the inorganic substance, potassium (II) phosphate, potassium (II) phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, calcium carbonate and the like can be used. The cultivation is usually performed under aerobic conditions such as shaking culture or deep aeration stirring culture. The culturing temperature is preferably 15 to 40 ° C, and the culturing time is usually 10 to 96 hours. During the culture, the pH was 3.0.
Keep at ~ 9.0. The pH is adjusted using an inorganic or organic acid, an alkaline solution, urea, calcium carbonate, ammonia, or the like.

[0041] If necessary, an antibiotic such as ampicillin or tetracycline may be added to the medium during the culture. When culturing a microorganism transformed with an expression vector using an inducible promoter as a promoter, an inducer may be added to the medium as necessary. For example, when culturing a microorganism transformed with an expression vector using the lac promoter, isopropyl-β-D-thiogalactopyranoside or the like is used. When culturing a microorganism transformed with an expression vector using the trp promoter, indole acryl is used. An acid or the like may be added to the medium.

As a medium for culturing a transformant obtained by using an animal cell as a host, a commonly used RPMI is used.
Il640 medium, Eagle's MEM medium, or a medium in which fetal calf serum or the like is added to these mediums can be used. The cultivation is usually performed under conditions such as in the presence of 5% CO ₂ .
The culturing temperature is preferably 35 to 37 ° C, and the culturing time is usually 3 to 37 ° C.
7 days.

If necessary, antibiotics such as kanamycin and penicillin may be added to the medium during the culture.
As a medium for culturing a transformant obtained by using an insect cell as a host, generally used TNM-FH medium (manufactured by Pharmingen), Sf-900 II
SFM medium (manufactured by Gibco BRL), ExCell400,
ExCell405 [all manufactured by JRH Biosciences] can be used.

The culturing temperature is preferably 25 to 30 ° C., and the culturing time is usually 1 to 4 days. If necessary, an antibiotic such as gentamicin may be added to the medium during the culture. In order to isolate and purify 4 (R) KAL expressed by the above method from the culture of the above transformant, a conventional method for isolating and purifying enzymes may be used.

For example, when 4 (R) KAL of the present invention is expressed in a lysed state in cells, the cells are recovered by centrifugation after completion of the culture, suspended in an aqueous buffer, and then subjected to ultrasonic crushing. The cells are crushed with a French press, a Manton Gaurin homogenizer, a Dynomill or the like to obtain a cell-free extract. From the supernatant obtained by centrifuging the cell-free extract, a normal enzyme isolation and purification method, that is, a solvent extraction method, a salting out method using ammonium sulfate, a desalting method, a precipitation method using an organic solvent, Anion exchange chromatography using a resin such as diethylaminoethyl (DEAE) -Sepharose, DIAION HPA-75 (manufactured by Mitsubishi Kasei), S-Sepharose FF
(Manufactured by Pharmacia), a cation exchange chromatography method using a resin, a hydrophobic chromatography method using a resin such as butyl sepharose, phenyl sepharose, a gel filtration method using a molecular sieve, an affinity chromatography method, and a chromatofocusing method. A purified sample can be obtained by using a method or an electrophoresis method such as isoelectric focusing, alone or in combination.

When the 4 (R) KAL is expressed in an insoluble form in the cells, the cells are similarly recovered, crushed, and centrifuged to obtain a precipitate fraction.
After recovering the 4 (R) KAL by an ordinary method,
(R) The insoluble form of KAL is solubilized with a polypeptide denaturant. The solubilized solution is diluted or dialyzed into a solution containing no polypeptide denaturing agent or having a concentration of the polypeptide denaturing agent that is so low that 4 (R) KAL is not denatured.
After (R) KAL is made to have a normal three-dimensional structure, a purified sample can be obtained by the same isolation and purification method as described above.

When the 4 (R) KAL of the present invention is secreted extracellularly, the 4 (R) KAL can be recovered in the culture supernatant. That is, the culture is treated by a method such as centrifugation as described above to obtain a soluble fraction, and a purified sample is obtained from the soluble fraction by using the same isolation and purification method as described above. be able to.

Also, 4 (R) expressed by the above method was used.
KAL can also be produced by a chemical synthesis method such as the Fmoc method (fluorenylmethyloxycarbonyl method) and the tBoc method (t-butyloxycarbonyl method).
Also, Kuwawa Trading (US Advanced ChemTech), Perkin Elmer Japan (US Perkin-Elmer), Pharmacia Biotech (Pharmacia Biotec, Sweden)
h), Aloka (U.S. Protein Technology Instrument)
Co., Ltd.), Kurabo Industries (US Synthecell-Vega), Japan Perceptive Limited (US PerSeptive),
It can also be synthesized using a peptide synthesizer such as Shimadzu Corporation.

Biocatalyst I derived from the transformant obtained above and having an activity of producing 4 (R) KHG from glyoxylic acid and pyruvic acid, pyruvic acid and glyoxylic acid are present in an aqueous medium. To produce 4 (R) KHG in an aqueous medium,
By collecting (R) KHG from the aqueous medium, 4
(R) KHG can be produced.

As the biocatalyst I, any of the cultures, cells and processed cells of the transformants obtained above can be used. Examples of the treated cells include dried cells, freeze-dried substances, surfactant or organic solvent-treated substances, enzyme-treated substances, ultrasonically-treated substances, mechanically triturated substances, cell protein fractionation [4 (R) Crude enzyme or purified enzyme of KAL], immobilized cells and processed cells, and the like.

The biocatalyst I concentration was 0.1 in terms of wet cell weight.
It is 1 to 200 g / l, preferably 5 to 100 g / l.

Examples of the aqueous medium include buffers such as water, phosphate, carbonate, acetate, borate, citrate, and Tris; alcohols such as methanol and ethanol; esters such as ethyl acetate; Aqueous solutions containing organic solvents such as ketones such as acetone, and amides such as acetamide are exemplified. If necessary, Triton X-100 (manufactured by Nacalai Tesque) or Nonion HS2
A surfactant such as 04 (manufactured by NOF Corporation) or an organic solvent such as toluene or xylene may be added at about 0.1 to 20 g / l.

The concentration of pyruvic acid and glyoxylic acid is 1 to 200 g / l, preferably 20 to 200 g / l.
It is. Compounds that can be converted to pyruvate by biocatalyst I can also be used as an alternative to pyruvate. Examples of the compound include glucose, fructose, sucrose, maltose, starch, starch hydrolyzate, sugars such as molasses, and organic acids such as acetic acid, lactic acid, and gluconic acid.

To the aqueous medium, the biocatalyst I, pyruvic acid and glyoxylic acid were added at the above concentrations, and the temperature was 15 to 80.
C., preferably at 25 to 60 ° C., under a condition of pH 3 to 11, preferably at pH 5 to 9 for 0.5 to 96 hours,
4 (R) KHG can be produced. During the initial or intermediate culture of cells used as biocatalyst I, pyruvate and glyoxylic acid were added at the above concentrations, and 4 (R) K
HG can also be manufactured. At that time, pyruvic acid or a compound that is converted into pyruvic acid by the recombinant strain may be added in advance as a culture substrate, or may be added together with glyoxylic acid.

Further, the biocatalyst I is the transformant described above, and further has 1) the ability to produce 4 (S) -hydroxy-2-ketoglutaric acid from glyoxylic acid and pyruvic acid. A transformant having one or more properties selected from 2) auxotrophic for lipoic acid and 3) low or no malate synthase activity is derived from 4 (R) KHG Is preferred for the production of Examples of the microorganism of such a transformant include, for example, Escherichia coli K-12 strain substrain NHK40 [lipoic acid auxotrophy (lip), 4KAL deletion (eda)], Corynebacterium glutamicum AT
CC13032 strain and the like. The Escherichia coli NHK40 strain has been deposited as FERM BP-5919 with the Research Institute of Biotechnology and Industrial Technology on April 16, 1997 based on the Budapest Treaty.

4 (R) KH produced by the above production method
G can be isolated using a commonly used organic acid purification method. As the purification method, for example, 4 (R) KHG can be isolated from the reaction supernatant from which solids have been removed by centrifugation by combining operations such as an ion exchange resin and a membrane treatment method. By causing the transformant, amino group donor, saccharide and glyoxylic acid described above to be present in an aqueous medium, 4 (R) HG is produced in the aqueous medium, and the produced 4 (R) HG is converted into the aqueous medium. By collecting from the medium, 4 (R) HG can be produced.

The concentration of the transformant is 0.1 to 200 g / l, preferably 5 to 100 g / l in terms of wet cell weight. As the aqueous medium, the aqueous medium described in the method for producing 4 (R) KHG can be used. Examples of the amino group donor include inorganic ammonium salts such as ammonia, ammonium sulfate, ammonium chloride and urea, and various amino acids such as glutamic acid. The concentration of the amino group donor is 0.1 to 100.
g / l, preferably 1 to 50 g / l.

As the saccharide, any one can be used as long as the above transformant can be assimilated, and glucose, fructose, sucrose, maltose, starch, starch hydrolyzate, molasses and the like can be used. The concentration of carbohydrate and glyoxylic acid is 1 to 200 g / l, preferably 10 to 200 g / l.
g / l.

The above-mentioned transformant, saccharide and glyoxylic acid are added to an aqueous medium at the above concentrations, and the temperature is 15 to 80 ° C.
Preferably 25-60 ° C, pH 3-11, preferably p
The reaction was carried out for 0.5 to 96 hours under the conditions of H5 to 9 and 4
(R) HG can be produced.

During the initial or intermediate culture of the above transformant,
Glyoxylic acid can be added at the above concentration to produce 4 (R) HG. Further, the transformant described above further comprises 1) 4 (S)-from glyoxylic acid and pyruvic acid.
Has no ability to produce hydroxy-2-ketoglutarate, 2) has auxotrophy for lipoic acid, 3) has low or no malate synthase activity, and 4) has no phosphoenolpyruvate carboxylase activity. Those derived from a transformant having one or more properties selected from properties are preferred for the production of 4 (R) HG. As a microorganism of such a transformant,
For example, Escherichia coli K-12 substrain NHK
40 [lipoic acid requirement (lip), 4KAL deficiency (ed
a)], Corynebacterium glutamicum ATCC1
3032 strain, Escherichia coli K-12 strain substrain N
HK46 strain [lip, eda, malate synthase deficiency (glc), phosphoenolpyruvate carboxylase deficiency (ppc)] and the like. The Escherichia coli NHK46 strain has been deposited on April 16, 1997 with the Institute of Biotechnology, Industrial Science and Technology as FERM BP-5920 based on the Budapest Treaty.

The transformant described above, an amino group donor,
The presence of saccharide and glyoxylic acid in the aqueous medium produces 4 (R) HYP in the aqueous medium, and the produced 4 (R) HYP is collected from the aqueous medium to obtain 4 (R) HYP. Can be manufactured. The concentration of the transformant is 0.1 to 200 g / in terms of wet cell weight.
l, preferably 5 to 100 g / l.

As the aqueous medium, the aqueous medium described in the method for producing 4 (R) KHG can be used.
Examples of the amino group donor include inorganic ammonium salts such as ammonia, ammonium sulfate, ammonium chloride and urea, and various amino acids such as glutamic acid. The concentration of the amino group donor is 0.1 to
100 g / l, preferably 1 to 50 g / l.

The saccharide may be any one which can be assimilated by the above transformant, and glucose, fructose, sucrose, maltose, starch, starch hydrolyzate, molasses and the like can be used. The concentration of carbohydrate and glyoxylic acid is 1-200 g / l, preferably 10-200
g / l.

The above-mentioned transformant, saccharide and glyoxylic acid are added to an aqueous medium at the above-mentioned concentrations, and the temperature is 15 to 80 ° C.
Preferably 25-60 ° C, pH 3-11, preferably p
The reaction was carried out for 0.5 to 96 hours under the conditions of H5 to 9 and 4
(R) HYP can be manufactured. Glyoxylic acid may be added at the above-mentioned concentration during the initial or intermediate culture of the transformant to produce 4 (R) HYP.

In the production of 4 (R) HYP, the above-mentioned transformant further does not have 1) the ability to produce 4 (S) -hydroxy-2-ketoglutaric acid from glyoxylic acid and pyruvic acid. 2) has auxotrophy for lipoic acid, 3) has low or no malate synthase activity, and 4) has no phosphoenolpyruvate carboxylase activity. 5) azetidine-2-carboxylic acid or 3,4-dehydroproline And a transformant having one or more properties selected from properties having resistance to proline analogs such as thioproline and thioproline. As a microorganism of such a transformant, for example, sub-strain NHK40 of Escherichia coli K-12 strain
[Lipoic acid requirement (lip), 4KAL deficiency (ed
a)], Corynebacterium glutamicum ATCC1
3032 strain, Escherichia coli K-12 strain substrain N
HK46 strain [lip, eda, malate synthase deficiency (glc), phosphoenolpyruvate carboxylase deficiency (ppc)], NHK47 strain [lip, eda,
glc, ppc, azetidine-2-carboxylic acid resistance] and the like. Escherichia coli NHK47
Based on the Budapest Treaty, FERMBP-
Deposited as 5921.

The above-mentioned various defective strains and resistant strains can be prepared by subjecting the parent strain to a conventional mutation procedure, for example, N-methyl-N'-nitro-
Treatment with a mutagen such as N-nitrosoguanidine (NTG),
After UV irradiation, γ-ray irradiation, etc., spread on an appropriate agar plate medium to obtain a grown mutant strain, which is more resistant to analogs than the bacterial strain or parent strain whose target enzyme activity is deficient or reduced compared to the parent strain. By selecting a suitable strain. In the Escherichia coli K-12 strain, various deletion mutants can also be obtained by transferring the deletion mutation from another strain having the desired deletion or resistance mutation to a desired strain using P1 phage or the like (transduction). And resistant mutants can be obtained.

As a method for producing 4 (R) HYP, 4 (R) HYP is further converted from an amino group donor and 4 (R) KHG.
4 (R) HYP is produced in the aqueous medium by the presence of the biocatalyst II having an activity of converting the compound into an amino group donor and 4 (R) KHG in the aqueous medium. Can be obtained from the aqueous medium to produce 4 (R) HYP.

As the biocatalyst II, any of a culture, a microbial cell, and a processed microbial cell of an amino group donor and a microorganism having an activity of converting 4 (R) KHG to 4 (R) HYP can be used. .

As a microorganism having an activity of converting an amino group donor and 4 (R) KHG to 4 (R) HYP,
For example, Escherichia (Escherichia) genus, a microorganism belonging to the Corynebacterium (Corynebacterium) genus, and the like. Specifically, Escherichia coli transfected with a plasmid pKSR19 containing a mutant ProBA gene derived from Escherichia coli and having reduced feedback inhibition by proline has been introduced.
( Escherichia coli ) AT-12 strain of K-12 strain line
5 strains (ATCC 33625 / pKSR19), Corynebacterium acetoacidophilum ( Corynebacterium a
cetoacidophilum ) FERM P-4962 strain and the like. More preferably, a mutant having glutamic acid requirement can be mentioned. Such mutants may be subjected to the usual mutagenesis procedures, such as N-methyl-N '
-Nitro-N-nitrosoguanidine (NTG), etc., UV irradiation, γ-irradiation, etc., and then apply to an appropriate agar plate medium to obtain the grown mutant strain and require glutamic acid for growth By selecting the strain to be used. In the case of Escherichia coli K-12 strain, a defective mutant can also be obtained by transduction. Such a microorganism is ATCC3 of strain Escherichia coli K-12.
NHK3 / pKSR19 strain in which pKSR19 was introduced into NHK3 strain in which isocitrate dehydrogenase deficient mutation (icd) was added to 3625, NHK3 / pKSR21 strain in which pKSR21 in which Escherichia coli-derived ProC gene was linked to pKSR19, glutamate dehydrogenase and glucose NHK3 into which plasmid pKSR50 containing -6-phosphate dehydrogenase has also been introduced
/ PKSR21 + pKSR50 strain. In addition to the requirement for glutamic acid, it is more advantageous to use a host microorganism which has become resistant to proline analogs such as azetidine-2-carboxylic acid, 3,4-dehydroproline and thioproline.

Such a microorganism can be obtained by subjecting the parent strain to a mutation or transduction as described above.
It can also be obtained by introducing a plasmid containing a proline analog resistance gene. Specifically, Escherichia coli NHK23 / pKSR21 + pKSR50
Stocks. Escherichia coli NHK3 / p
KSR21 + pKSR50 strain and NHK23 / pKS
The R21 + pKSR50 strain was obtained on August 12, 1997,
The Escherichia coli NHK3 / pKSR19 strain was
FERM BP-6052, F
ERM BP-6053 and FERM BP-6076 have been deposited at the Institute of Biotechnology and Industrial Technology, based on the Budapest Treaty.

Examples of the treated bacterial cells include dried bacterial cells, freeze-dried products, surfactant or organic solvent-treated products, enzyme-treated products, ultrasonically treated products, mechanically ground products, and protein components of the cells. From the amino group donor and 4 (R) KHG to 4 (R)
Crude enzyme or purified enzyme having the activity of converting to HYP], immobilized cells and processed cells.

The concentration of the biocatalyst II is 0.1 to 200 g / l, preferably 5 to 100 g / l in terms of microbial cells. 4 (R) KHG is an isolated and purified 4 (R) KH
In addition to G, it contains 4 (S) KHG and a crudely purified sample not containing 4 (S) HG, or 4 (R) KHG produced by using a biocatalytic reaction derived from the microorganism described above. A reaction solution or the like can be used. 4 (R) K
The concentration of HG is 1 to 200 g / l, preferably 20 to 20 g / l.
0 g / l.

As the aqueous medium, the aqueous medium described in the method for producing 4 (R) KHG can be used.
In an aqueous medium, biocatalyst II, amino group donor and 4
(R) KHG is added at the above concentration, and the temperature is 15 to 80 ° C, preferably 25 to 60 ° C, pH 3 to 11, preferably pH
The reaction is carried out for 0.5 to 96 hours under the conditions of 5 to 9 and 4
(R) HYP can be manufactured.

At the beginning or during the cultivation of the microorganism used as the biocatalyst II, 4 (R) KHG is added at the above-mentioned concentration.
(R) HYP can also be manufactured. The 4 (R) HG or 4 (R) HYP produced as described above can be isolated using a commonly used amino acid purification method. For example, 4 (R) HG or 4 (R) HYP can be isolated from the reaction supernatant from which solids have been removed by centrifugation by combining operations such as an ion exchange resin and a membrane treatment method. Hereinafter, examples of the present invention will be described.

[0075]

EXAMPLES Example 1 Acquisition of 4 (R) KAL Gene Bacillus sp. OC187 strain (FE
RM BP-4646) as a loop, 10 ml of LB liquid medium [10 g of bactotripton (manufactured by Difco), 5 g of yeast extract (manufactured by Difco), and 5 g of NaCl in water 1
Liter and adjusted to pH 7.2] and cultured at 30 ° C. for 20 hours. A known method [Biochim. Biophys. Acta., 72 , 619 (196
3)] to isolate chromosomal DNA. 5 μg of the purified chromosomal DNA of Bacillus sp.
1 μg of TV29 plasmid DNA (Takara Shuzo) was added to Sa
l Dissolve in 100 µl of I buffer (Takara Shuzo K buffer) and add 20 units of restriction enzyme Sal I (Takara Shuzo)
Was added, and the digestion reaction was performed at 37 ° C. for 3 hours, followed by heating at 65 ° C. for 15 minutes to stop the reaction. The reaction stop solution was added with 10 μM of 3M sodium acetate (pH 5.6).
after addition, 300 μl of ethanol cooled to −20 ° C.
Was added and left at −80 ° C. for 30 minutes. After standing, a precipitate formed in the ethanol mixture was obtained by centrifugation (hereinafter, this operation is abbreviated as an ethanol precipitation method). The precipitate was dissolved in 5 μl of distilled water, and 40 μl of a ligation buffer A solution (Takara Shuzo) was added.
After adding and mixing 5 μl of Buffer B solution (Takara Shuzo), a DNA ligation reaction was carried out at 16 ° C. for 16 hours to obtain recombinant D
NA was obtained (hereinafter, this operation is abbreviated as a ligation reaction). Using the recombinant DNA, Escherichia coli ( Es
cherichia coli ) ATCC 33625 of strain K-12
The strain was transformed according to the method of Maniatis et al. [Molecular Cloning, 2nd Edition], and LB agar medium containing 25 μg / ml of chloramphenicol (agar 2 was added to LB medium).
% Hardened) and incubated at 37 ° C. for 24 hours. The activity of synthesizing 4-hydroxy-2-ketoglutarate from pyruvate and glyoxylate was measured for about 2,000 transformed colonies resistant to chloramphenicol.

That is, each transformant was placed at 30 ° C. in 3 ml of LB liquid medium containing 25 μg / ml of chloramphenicol.
For 20 hours, and 150 μl of 30 μl of xylene and 2 M sodium pyruvate solution, 150 μl of 2 M glyoxylic acid solution (prepared to pH 6.4 with NaOH)
μl was added and shaken at 37 ° C. for 30 minutes. The centrifugal supernatant of the shaking solution was subjected to 1 mM copper acetate (I) using SUMICHIRAL OA-5000 (inner diameter 4.6 mm, length 5 cm) manufactured by Sumitomo Chemical Co.
I), 0.1 mM ammonium acetate aqueous solution (pH 4.
5) 85: A mixed solution of isopropanol 15 was used as a mobile layer, and analyzed by an HPLC method for measuring the absorbance at UV 210 nm, and the amount of 4 (R) and 4 (S) -hydroxy-2-ketoglutar was measured.

According to the measurement, a transformant having 4 (R) KHG synthesizing activity was selected, and 4
(R) Approximately 3.5 kb Sal I responsible for KHG synthesis activity
A plasmid pKSR201 having the treated DNA fragment was obtained. FIG. 1 shows a restriction enzyme map of the SalI- treated DNA fragment. Furthermore, using various restriction enzymes, this DNA
Pst I- containing 4 (R) KAL gene region on fragment
The Sal I about 1.8kb of pSTV29 Pst I- S
pKSR222 inserted between the al I sites was prepared.

4 (R) KAL contained in pKSR222
The DNA sequence of the gene was analyzed by the dideoxy method (Proc. Natl. Sci.
USA, 74 , 5463 (1977)]. 4 (R) KA
The structural gene region of the L gene is shown in SEQ ID NO: 2, and the amino acid sequence of the 4 (R) KAL gene deduced from the DNA sequence is shown in SEQ ID NO: 1.

Example 2 Preparation of Expression Plasmid In order to highly express 4 (R) KAL activity, a plasmid (Trp promoter) derived from Escherichia coli tryptophan biosynthetic enzyme gene was ligated upstream of the 4 (R) KAL gene. Was created. At the same time, DN corresponding to the N-terminal 5 amino acids of 4 (R) KAL
The A base sequence was modified from a sequence derived from Bacillus sp. OC187 strain to a sequence corresponding to the optimal codon of Escherichia coli.

Corresponding to the N-terminus of the 4 (R) KAL gene,
The codon corresponding to the histidine residue at the second residue, the leucine residue at the fourth residue and the serine residue at the fifth residue was changed to a letter corresponding to the optimal codon of Escherichia coli, and is shown in SEQ ID NO: 4. Oligonucleotide having a base sequence and 4
(R) An oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 5 corresponding to the C-terminus of the KAL gene was synthesized according to a conventional method. Using these oligonucleotides as primers, a PCR method [RF Saiki et al., Science, 230 , 1
350 (1985)] to amplify the 4 (R) KAL gene.

That is, using pKSR222 as a template,
e AmpTM Kit (PerkinElmer Japan) and its DNA Thermal Cycle
r at 94 ° C. for 30 seconds, 52 ° C. for 30 seconds, 72 ° C.
After 30 cycles of a reaction process consisting of 1 minute at 72 ° C., the reaction was carried out at 72 ° C. for 5 minutes. After the DNA fragment of about 630 bps amplified by the reaction was extracted with chloroform, the DNA fragment was purified by an ethanol precipitation method.

The vector plasmid pTrS3 described in Reference Example 1 having 2 μg of the DNA fragment and the Trp promoter
After double digestion of 31μg each with Cla I and Bam HI, and the respective Cla I- Bam HI digested DNA fragment was purified by agarose electrophoresis. After mixing these purified fragments, ethanol precipitation was performed, and the obtained DNA precipitate was dissolved in 5 μl of distilled water, and a ligation reaction was performed to obtain a recombinant DNA.

Using the recombinant DNA, Escherichia
After transforming E. coli ATCC 33625 according to the method of Maniatis et al. [Molecular Cloning, 2nd edition], the transformant was spread on an LB agar medium containing 100 μg / ml of ampicillin, and cultured at 37 ° C. for 24 hours.

4 (R) KA in the same manner as in Example 1 (however, 100 μg / ml of ampicillin was added instead of chloramphenicol at the time of culture) for several colonies of the ampicillin-resistant transformant that had grown.
L synthesis activity was measured. High in all transformants 4
(R) had KAL synthesis activity. These transformants are cultured with shaking at 37 ° C. for 16 hours in 3 ml of an LB liquid medium containing 100 μg / ml of ampicillin, and the resulting culture is centrifuged to obtain a known method from cells obtained by molecular cloning [Molecular Cloning Second edition] to isolate the plasmid.

The isolated plasmids were cleaved with various restriction enzymes and the structure was examined. As a result, it was confirmed that all the plasmids had the same structure. The plasmid thus prepared was named pKSR303. p
FIG. 2 shows a restriction enzyme cleavage map of KSR303. Next, in order to introduce the 4 (R) KAL gene into the genus Corynebacterium, a vector plasmid pCS116 capable of autonomous propagation in the genus Corynebacterium [ Escherichia coli KY9002 / pCS116 (F.
Obtained from ERM BP-6055)] and pKSR303
Was connected.

PCS116 and pKSR303 each 1
μg was dissolved in 45 μl of H buffer (manufactured by Takara Shuzo Co., Ltd.), and 10 units of Bgl II was added to carry out digestion at 37 ° C. for 3 hours. After the DNA obtained by the reaction was extracted with phenol, the DNA fragment was obtained by an ethanol precipitation method.

The DNA was dissolved in 5 μl of distilled water, and a ligation reaction was performed to obtain a recombinant DNA. Using the recombinant DNA, Escherichia coli ATCC3
The 3625 strain was transformed according to the method of Maniatis et al. [Molecular Cloning, 2nd Edition], and the transformant was spread on an LB agar medium containing 100 μg / ml of ampicillin and 100 μg / ml of spectinomycin, and then incubated at 37 ° C.
For 24 hours.

A plasmid was isolated from the growing colonies resistant to ampicillin and spectinomycin in the same manner as described above, and the plasmid was used in a known manner (Japanese Patent Laid-Open No.
277082) Corynebacterium glutamicum ATCC13
The 032 strain was transformed.

The transformant was transformed into spectinomycin 100
BY agar medium containing pg / ml [Bouillon (Kyokutosha)
20 g of yeast extract (manufactured by Far East Co., Ltd.) in 1 liter of water, adjusted to pH 7.2, and solidified with 2% agar], and cultured at 30 ° C. for 48 hours. Plasmids were isolated from several growing colonies resistant to spectinomycin according to a known method (JP-A-57-183799).

The isolated plasmids were cleaved with various restriction enzymes and the structure was examined. As a result, it was confirmed that all the plasmids had the same structure. The plasmid thus prepared was named pKSR803. p
The restriction map of KSR803 is shown in FIG.

Example 3 4 (R) KHG by various strains
Production of Escherichia coli B strain ATCC11303 strain,
Klebsiella oxytoca (Klebsiela oxytoca) ATC
C8724 strain, Serratia marcescens (Serratia mars
ecens ) ATCC13880 strain was inoculated in 3 ml of LB medium, one loop each, and cultured at 28 ° C. for 12 hours.

After culturing, each of the cells was obtained by centrifuging the obtained culture solution. Each of these cells was suspended in 1 ml of ice-cooled 50 mM CaCl ₂ solution,
Each cell was obtained again by centrifuging these suspensions. Each of these cells was 0.2 ml of ice-cold 50 mM After suspending in a CaCl ₂ , 50% glycerol solution, the suspension was left on ice for 10 minutes.

[0093] These bacterial suspensions were added with pK prepared in Example 2.
After adding 0.2 μg of SR303 and leaving the mixture on ice for 20 minutes, the mixture was heated at 42 ° C. for 30 seconds, each containing 0.8 ml of LB.
The medium was added, and the cells were cultured with shaking at 30 ° C for 1 hour. These culture solutions were applied to an LB agar medium containing 400 μg / ml of ampicillin, and cultured at 30 ° C. for 24 hours.

By selecting the colonies that have grown, Escherichia coli B into which pKSR303 has been introduced can be obtained.
The strains ATCC11303, Klebsiella oxytoca ATCC8724 and Serratia marcescens ATCC13880 were obtained. Escherichia coli ATCC 33625, ATCC 11303, Klebsiella oxytoca ATCC 8724, Serratia marcescens ATCC 13880, pKSR303-introduced strain, Corynebacterium glutamicum ATCC 13032 in which pKSR803 was introduced, and 3 ml of ATCC 13032 in which pKSR803 was introduced. For 16 hours in LB medium.

To these cultures, 30 μl of xylene, 150 μl of a 2 M sodium pyruvate solution, and 150 μl of a 2 M glyoxylic acid solution (adjusted to pH 6.4 with NaOH) were added and shaken at 37 ° C. for 30 minutes. The centrifugal supernatants of these reaction solutions were measured for 4 (R) and 4 (S) -hydroxy-2-ketoglutaral production in the same manner as in Example 1.

The results are shown in Table 1.

[0097]

[Table 1]

Example 4 4 (R) K by Escherichia coli mutant
Production of HG Escherichia coli strain K-12 strain ppc, li
A malate synthase activity-reduced strain was derived from the NHK43 strain having a triple deletion mutation of p and eda. That is, cells of the NHK43 strain cultured in an LB medium supplemented with 2 g / l of glutamic acid and 100 μg / l of lipoic acid until the exponential growth phase were collected by centrifugation, and 0.05 M Tris-maleate buffer (pH 6.0) was collected. After washing with, the cell concentration was 10 ⁹ cells /
The suspension was suspended in the same buffer to a volume of 0.1 ml.

The suspension was added with NTG to a final concentration of 600 mg / g.
1 and kept at room temperature for 20 minutes to perform mutation treatment. The mutated cells were applied to M9 minimal agar medium [Molecular Cloning 2nd Edition] supplemented with 0.5% glucose, 0.05 g / l glutamic acid, 100 μg / l lipoic acid, and 30 mM glyoxylic acid, and then applied to the cells.
C. for 2 days.

Among the grown strains, those forming small colonies were glutamic acid 2 g / l and lipoic acid 100
The cells were inoculated on LB agar medium supplemented with μg / l and cultured.

The strain grown on the culture plate was prepared by adding 0.5% of glucose, 0.5 g / l of glutamic acid and 100 g of lipoic acid.
M9 minimal agar medium supplemented with μg / l and glucose 0.
5%, lipoic acid 100 μg / l, glyoxylic acid 30 mM
A replica was added to the M9 minimal agar medium supplemented with, and a strain that grew on the former medium but could not grow on the latter medium was selected.

The selected strain was placed in an MS medium [glucose
3g, KH_TwoPO_Four4g, (NH_Four)_TwoSO_Four10g, M
gSO_Four1 g, thiamine hydrochloride 100μg, yeast
S 1g, peptone 1g, lipoic acid 50 μg, CaCO_Three
20 g, glutamic acid 2 g in 1 liter of water,
culture medium adjusted to pH 7.2] at 37 ° C with shaking.
Was.

At the stage of culturing until the late logarithmic growth phase, the cells were collected by centrifugation, washed with 50 mM Tris-HCl buffer (pH 7.0), and crushed with an ultrasonic crusher. The cell lysate was centrifuged (15,000 rpm,
45 minutes), and the obtained supernatant was used as a cell extract. The malate synthase activity of the cell extract was previously reported [Methods
in Enzymology 5 , 633 (1962)], and the NHK46 strain in which no activity was detected was selected as the target mutant.

The NHK46 strain was transduced with P1 phage [JHMiller, Experiments in Molecular Gen.
etics, Cold Spring Harbor Lab. (1972)], the lip ⁺ gene derived from Escherichia coli W3110 was introduced to obtain a lipoic acid non-requiring NHK48 strain. NHK
PKSR222 was introduced into 43 strains, NHK46 strain and NHK48 strain according to the method of Maniatis et al. [Molecular Cloning, 2nd edition] (however, culture was performed using lipoic acid 1).
This was performed by adding 00 μg / l and glutamic acid 2 g / l), and a transformant was obtained using chloramphenicol resistance as an index.

[0105] Similarly, using ampicillin resistance as an index
Introduction of pKSR303 to NHK46 strain, Escherichia
 E. coli NHK46 / pKSR303 strain was obtained. Each form
Quality transformant with glucose 1%, calcium carbonate 2%, re
Poic acid 100 μg / l, glutamic acid Add 2 g / l
The LB medium was inoculated and cultured at 28 ° C. for 16 hours with shaking.

0.5 ml of each of these culture solutions was sterilized in 5 ml of T medium [glucose 50g, KH ₂ PO _{4 4}
g, (NH ₄ ) ₂ SO ₄ 10 g, MgSO ₄ 1 g, thiamine hydrochloride 10 μg, yeast extract 0.2g, KCl 3
g, lipoic acid 50 μg, tryptophan 250 mg, C
aCO ₃ 20g, glutamic acid 2 g in 1 liter of water and adjusted to pH 7.2] at 30 ° C.
After shaking culture for 24 hours, 0.25 ml of a 2M glyoxylic acid solution (adjusted to pH 6.4 with NaOH) was added, and shaking culture was further performed at 37 ° C. for 24 hours.

A culture supernatant obtained by centrifuging these culture solutions was subjected to the same method as in Example 1 to obtain 4 (R) KHG and 4 (R) KHG.
(S) The amount of KHG produced was measured. The results are shown in Table 2. From the comparison of the amount of 4 (R) KHG produced, the lipoic acid auxotrophic mutation and the malate synthase activity decreasing mutation were 4 (R) KHG
It became clear that it would contribute to production.

[0108]

[Table 2]

Example 5 4 in a jar fermenter
(R) KHG production Lip, ed in Escherichia coli K-12 strain
pKSR222 was introduced into the NHK40 strain having the double deletion mutation of a in the same manner as in Example 4 to obtain a transformant.

[0110] The transformant was treated with glucose. 1%, carbonated
Lucium 2%, lipoic acid LB with 100 μg / l added
The medium was inoculated and cultured with shaking at 28 ° C. for 13 hours. The culture
10 ml of the solution was sterilized by adding 200 ml of a medium of the same composition.
And shaken at 28 ° C. for 13 hours.
Cultured. The total amount of the culture solution was transferred to J1 medium [1 liter
Lactose 30 g, (NH_Four)_TwoSO_Four10g, K
Cl 3g, KH_TwoPO_Four2g, K_TwoHPO_Four2g, Mg
SO _Four1g, yeast extract 0.5g, tryptophan 2
50 mg, CaCl_Two15 mg, FeSO_Four・ 7aq 1
0 mg, MnSO_Four・ 4-6aq 10 mg, NiCl
_Two 1.5 mg, ammonium molybdate 1.5 mg, Co
Cl_Two1.5 mg, thiamine hydrochloride 100 μg, lipo
acid Medium containing 75 μg and adjusted to pH 6.8]
5l jar fermen
And maintain the pH at 6.8 with aqueous ammonia.
, Aeration 2L / min, stirring 500rpm, 33 ℃
Culture.

After 20 hours of culture, xylene was added to the culture.
20 ml and 370 ml of a 2M glyoxylic acid solution (adjusted to pH 6.4 with NaOH) were added, and the mixture was further cultured at 37 ° C. for 12 hours. The 4 (R) KHG content in the culture supernatant was measured in the same manner as in Example 1. 299.5 mM of 4 (R) KHG was produced in the culture supernatant.

Example 6 Production of 4 (R) HG Production method using P1 phage [JHMiller, Experime
nts in Molecular Genetics, Cold Spring Harbor Lab.
(1972)], the ppc ⁺ gene derived from Escherichia coli W3110 strain was introduced into the NHK43 strain to obtain a glutamate-requiring NHK45 strain.

In the same manner as in Example 4, pKSR2 was added to the strain.
22 were introduced. NHK43 possessing pKSR222
Strain, NHK46 strain, NHK48 strain, NHK45 strain and NHK46 strain having pKSR303 were cultured in the same manner as in Example 4, and 4 (R) HG, 4 (R) HG,
(S) A solution containing 10 mM sodium citrate, 10 mM anhydrous sodium sulfate (pH 2.2), 0.4% n-propanol, and 0.03% SDS using a Lichrospher (C18) column manufactured by Merck Co., Ltd. Is used as a mobile layer, and the eluate is post-column labeled with o-phthalaldehyde, and then analyzed by HPLC for measuring the fluorescence at 350 nm and 448 nm to measure the amount of 4 (R) HG and 4 (S) HG produced. did.

The results are shown in Table 3. Comparison of the amount of 4 (R) HG production revealed that the lipoic acid auxotrophic mutation, malate synthase activity reduction mutation, and phosphoenolpyruvate carboxylase deficiency mutation contributed to 4 (R) HG production. In addition, Corynebacterium glutamicum ATCC13032 carrying pKSR803 was
The medium was inoculated and cultured with shaking for 16 hours.

0.5 ml of the culture was sterilized with 5 ml of T
C medium [glucose 100g, KH_TwoPO_Four0.5g,
K_TwoHPO_Four0.5 g, (NH_Four)_TwoSO_Four20g, Mg
SO _Four0.25 g, urea 3g, biotin 100 μg,
Corn steep liquor 5g, FeSO_Four・ 7aq 10
mg, MnSO_Four・ 4-6aq 5 mg, CaCO_Three20
g in 1 liter of water and adjusted to pH 7.2.
Ground) and cultured with shaking at 30 ° C. for 24 hours.
A 2M glyoxylic acid solution (pH 6.0 with NaOH) was added to the nutrient solution.
0.25 ml) and add another 24 at 37 ° C.
The cells were cultured with shaking for hours.

4 (R) HG, 4 (S) H in the culture supernatant
The amount of G produced was similarly measured using an ODS column. The results are shown in Table 3.

[0117]

[Table 3]

Example 7 4 in a jar fermenter
(R) HG production Escherichia coli NHK4 carrying pKSR303
6 strains of glucose 1%, calcium carbonate 2%, lipoic acid
100 μg / l, glutamic acid L with 2 g / l added
The cells were inoculated into medium B and cultured with shaking at 28 ° C. for 13 hours. 10 ml of the culture was added to a sterilized 1 L Erlenmeyer flask containing 200 ml of a medium having the same composition, and cultured with shaking at 28 ° C. for 13 hours.

[0119] The whole amount of the culture solution was transferred to a J2 medium [glucose per liter. 30 g, glutamic acid 12g, (N
H ₄ ) ₂ SO ₄ 10 g, KCl 3 g, KH ₂ PO ₄ 2 g,
K ₂ HPO ₄ 2g, MgSO ₄ 1g, yeast extract 0.5
g, tryptophan 250mg, isoleucine 20m
g, methionine 10 mg, CaCl ₂ 15 mg, Fe
SO ₄ · 7aq 10mg, MnSO ₄ · 4-6aq 10
mg, NiCl ₂ 1.5 mg, ammonium molybdate
1.5 mg, CoCl ₂ 1.5 mg, thiamine hydrochloride
100 μg, lipoic acid A medium containing 75 μg and adjusted to pH 6.8], added to a sterilized 5 L jar fermenter containing 1800 ml, and adjusted to pH 6. with ammonia water.
8, aeration 2 L / min, stirring 500 rpm,
The cells were cultured at 33 ° C. After 14 hours of culture, 2 M 190 ml of glyoxylic acid solution (adjusted to pH 6.4 with NaOH) was added, and the culture was continued at 37 ° C. for 60 hours while appropriately adding glucose.

The amount of 4 (R) HG in the culture supernatant was determined in Example 6.
Was analyzed by HPLC in the same manner as described above. In the culture supernatant, 11
7.8 mM of 4 (R) HG was produced.

Example 8 Proline Synthase Gene and 4
(R) Ligation of KAL gene Plasmid pPRO-11 having Escherichia coli-derived desensitized ProBA gene [ Esch containing the plasmid
erichia coli ATCC33625 / pPRO11 (FERMBP-60
77) was digested with Pst I, and the digest was subjected to agarose gel electrophoresis followed by Prep-A-Gene DNA Purification S
An approximately 3 kb DNA fragment containing the ProBA gene was isolated and purified using ystem (manufactured by BIO-RAD).

A ligation reaction was carried out using a PstI digest of the plasmid and a plasmid pTrc99A (manufactured by Pharmacia Biotech) having the multiple cloning site, and Escherichia coli ATCC
The 33625 strain was transformed. The transformant was spread on an LB agar medium containing 100 μg / ml of ampicillin, and
After culturing at 7 ° C. for 24 hours, an ampicillin-resistant transformant was obtained.

[0123] These transformants were converted to glucose. 0.5
%, Thiamine hydrochloride 100 μg / l, 3,4-dehydroproline Replica was replicated on M9 minimal agar medium supplemented with 100 mg / l. Since the strain having the desensitized ProBA gene is resistant to 100 mg / l of 3,4-dehydroproline (JP-A-3-26695), the strain grown on the above medium was designated as a strain having the desensitized ProBA gene. Selected.

Plasmids were extracted from the selected strains according to a conventional method, restriction enzyme analysis was performed, and pTrc99A
About 3 kb of D containing ProBA gene at Pst I site
PKSR17 having a structure in which the NA fragment was inserted so that the transcription direction of ProBA was forward with respect to the tac promoter of pTrc99A was obtained. In order to bring the transcription start point of tac promoter and ProBA close, pK
The SR17 was partially digested with Eco RV, was further digested with Sma I, subjected to ligation reaction digested product was self-cyclized.

Using the cyclized product, Escherichia coli ATCC 3362 was used.
Five strains were transformed. Plasmids were extracted from several transformants and subjected to restriction enzyme analysis. As a result, it was confirmed that all the plasmids had the same structure. The plasmid was named pKSR18.

[0126] The pKSR18 was digested with Eco RI and Bgl II, DNA blunting kit (Takara Shuzo Co., Ltd.) after blunt using agarose gel electrophoresis and Prep-A-Gene DNA
Using a Purification System (manufactured by BIO-RAD), a DNA fragment of about 2.9 kb containing the ProBA gene was isolated and purified. The DNA fragment and an expression vector pPAC1 having a high temperature inducible promoter [ Escherichia coli KY8415 / pPAC1 containing the plasmid (FERM BP
-6054)) was digested with Cla I, and DNA blun
DNA fragments blunt-ended using a ting kit were ligated by a ligation reaction.

Using the ligation product, E. coli ATCC3
Strain 3625 was transformed, a plasmid was extracted from the transformant, and PPAC was downstream of the high temperature inducible promoter of pPAC1.
pKSR19 having a structure inserted so that the transfer direction of roBA was forward was obtained. On the other hand, Pr of Escherichia coli
pE inserting the Hin CII-Xho I treated DNA fragment containing oC gene between Sma I- Sal I of pTrs33
digesting the proC with Eco RI and Bgl II DNA blunting
After blunt-ending using a kit, agarose gel electrophoresis
Prep-A-Gene DNA Purification System (BIO-RA
A DNA fragment of about 2.1 kb containing the ProC gene was isolated and purified from the Trp promoter using the product of Company D).

The DNA fragment was ligated to pKSR19 which had been digested with SphI and blunt-ended after ligation. Using the ligation reaction, E. coli ATCC 3362 was used.
Five strains were transformed. The transformant was transformed into ampicillin 10
Spread on LB agar medium containing 0 μg / ml and
After culturing for 4 hours, an ampicillin-resistant transformant was obtained.

A plasmid was extracted from the ampicillin-resistant transformant, subjected to restriction enzyme analysis, and subjected to desensitization type Pro.
A plasmid having a BA gene and a ProC gene was found and named pKSR21. The pKSR21 is replaced with Bam
After HI digestion and blunt end digestion, further digestion with PstI was performed , followed by agarose gel electrophoresis and Prep-A-Gene DNA Purification Sys
About 7 kb of DNA using tem (manufactured by BIO-RAD)
The fragment was isolated and purified.

The DNA fragment and pK prepared in Example 2 were used.
SR303 the Eco RI digestion, further Ps after blunt
tI digested, agarose gel electrophoresis and Prep-A-Gene DN
An about 2.9 kb DNA fragment isolated and purified using an APurification System (manufactured by BIO-RAD) was ligated by a ligation reaction. Escherichia coli ATCC 33625 was transformed using the ligation reaction product.

The transformant was treated with 100 μg of ampicillin /
The resultant was applied to an LB agar medium containing the same, and cultured at 37 ° C. for 24 hours to obtain an ampicillin-resistant transformant. Extracting a plasmid from the ampicillin-resistant transformant;
Restriction enzyme analysis was performed, and plasmid p containing desensitized ProBA, ProC gene and 4 (R) KAL gene was analyzed.
KSR321 was obtained.

The procedure for constructing the plasmid of this example is shown in FIG.

Example 9 Production of 4 (R) HYP by Cultivation with Glyoxylic Acid A mutant strain resistant to the proline analog azetidine-2-carboxylic acid was derived from the NHK46 strain prepared in Example 4. That is, NHK46 cultured in the same manner as in Example 4.
The strain was mutated in the same manner as in Example 4 and glucose was
0.5%, glutamic acid 0.5g / l, lipoic acid 100
μg / l, azetidine-2-carboxylic acid 100 mg /
1 was added to M9 minimal agar medium and cultured at 37 ° C. for 2 days.

In this culture, the azetidine-2-carboxylic acid resistant mutant N
HK47 strain was obtained. NHK46 strain and NHK47
The pKSR321 prepared in Example 8 was introduced into the strain, and a transformant was obtained using ampicillin resistance as an index. Each transformant and the NHK46 strain carrying pKSR303 (prepared in Example 4) were cultured in the same manner as in Example 4, and the amount of 4 (R) HYP in these culture supernatants was quantified using HPLC.

The quantitative determination by HPLC was performed as follows. 1 M borate buffer (pH 9.
6) 20 μl, 6 mg / ml NBD-Cl (7-chloro-
100 μl of a methanol solution containing 4-nitrobenzo-2-oxa-1,3-diazole chloride) is added, and the mixture is reacted at 60 ° C. for 20 minutes under light shielding. After stopping the reaction by adding 50 μl of 1N HCl to the reaction solution, the reaction solution was filtered through a Millipore filter, and the filtrate was analyzed under the following conditions.

[0136] Gradient time program of mobile phase Time (min) B (Vol%) 0-10 0-8 10-20 8-80 20-21 80-100 21-23 100 23-24 0 Detection: Ex = 470 nm, Em = 530 nm Table 4 shows the results of fluorescence detection.

[0137]

[Table 4]

Example 10 4 (R) HY by Two-Step Reaction
P-producing Escherichia coli mutant EB106 strain deficient in isocitrate dehydrogenase [ E. coli Genetic Stock Center (Yal
e University, New Haven, CT, USA) to P
E. coli ATCC using the phage 1 transduction method
An isocitrate dehydrogenase deficient mutation (icd) was introduced into the 33625 strain to prepare an NHK3 strain. This mutant strain requires glutamate due to the icd mutation.

Using the pKSR19 prepared in Example 8, Escherichia coli ATCC 33625 was prepared using the pKSR19 prepared in Example 8.
Escherichia coli NHK3 using KSR19 and pKSR21
Each strain was transformed, and each transformant was obtained using ampicillin resistance as an index. Pst I and C containing the glutamate dehydrogenase gene (gdh) of E. coli
It has a 4.2 kb DNA fragment flanked by the la I site and an approximately 3 kb DNA fragment flanked by the Bam HI and the Sph I sites containing the glucose-6-phosphate dehydrogenase gene (zwf) of Escherichia coli, and contains chloramphenicol. Using a plasmid pKSR50 derived from pACYC177 having a resistance gene (restriction enzyme map is shown in FIG. 5), an E. coli NHK3 strain carrying pKSR21 (NHK3) was used.
3 / pKSR21 strain), and used as an indicator for resistance to both ampicillin and chloramphenicol drugs,
NHK3 strain carrying pKSR50 and pKSR21 (N
HK3 / pKSR50 + pKSR21).

In the E. coli K-12 strain, the mutant (i
Mutant N having (cd, sucA, putA, eda)
Similarly, pKSR50 and pKSR21 were used for the HK23 strain.
Was introduced to obtain an NHK23 / pKSR50 + pKSR21 strain. Escherichia coli ATCC 33625 strain, NHK3 constructed as described above, ATCC 33625 / pKSR
19 strains, NHK3 / pKSR19 strains, NHK3 / pKS
R50 + pKSR21 strain and NHK23 / pKSR5
0 + pKSR21 strain in T medium as in Example 4
After culturing at 24 ° C. for 24 hours, 4
A culture supernatant containing (R) KHG and sterilized by millipore filtration was added so that the final concentration of 4 (R) KHG was 40 mM, and the cells were cultured at 37 ° C. for 24 hours with shaking.

The amount of 4 (R) HYP in the culture supernatant was determined by HPL
Quantified with C. The results are shown in Table 5. Corynebacterium glutamicum KY10912 strain was cultured in LB medium for 1 hour.
The cells were cultured with shaking for 6 hours. 0.5 ml of the culture was sterilized 5
RK prepared in Example 5 which was added to the TC medium, and cultured with shaking at 30 ° C. for 24 hours, followed by sterilization by millipore filtration.
The culture supernatant containing HG was purified to a final concentration of 4 (R) KHG of 4
The solution was added to a concentration of 0 mM, and cultured with shaking at 37 ° C. for another 24 hours.

The amount of 4 (R) HYP in the culture supernatant was H
Quantified by PLC. The results are shown in Table 5.

[0143]

[Table 5]

Example 11 Production of 4 (R) HYP by Micro Jar Fermenter Escherichia coli NHK23 /
The pKSR50 + pKSR21 strain was inoculated into an LB medium supplemented with 1% glucose, 2% calcium carbonate, and 2 g / l glutamic acid, and cultured with shaking at 28 ° C. for 13 hours. 0.5 ml of the culture was added to a sterilized 300 ml Erlenmeyer flask containing 10 ml of a medium having the same composition, and the mixture was added at 28 ° C. for 1 hour.
The cells were cultured with shaking for 3 hours.

The whole amount of the culture solution was added to a sterilized 200 ml jar fermenter containing 90 ml of J2 medium excluding lipoic acid, and while maintaining the pH at 6.8 with aqueous ammonia, aeration at 200 ml / min and stirring at 800 rpm. 33
The culture was carried out at a temperature of ° C.

After 14 hours of culture, the culture temperature was raised to 40 ° C., and after another 8 hours, the culture temperature was lowered to 37 ° C.
At 22 hours of the culture, 27 ml of the culture solution was withdrawn from the jar fermenter, and the jar fermenter was used in Example 5.
27 ml of culture supernatant containing 4 (R) KHG prepared in
Was added after Millipore filtration sterilization [4 (R) KHG final concentration 80 mM].

At 37 ° C., the culture was continued for 40 hours while appropriately adding glucose to the jar fermenter. 4 (R) HYP in the culture supernatant was analyzed by HPLC. By the culture, 49.9 mM (6.5 g / l) of 4
(R) HYP was produced.

Reference Example 1 Construction of pTrS33 PTrS33 can be easily constructed according to the procedures described in JP-A-58-110600 and JP-A-2-22775. The method for constructing the plasmid is described below.

E. coli IKYP-1 (FERM P-69)
The plasmid pKYP-1 isolated from 62) Taq 1
After digestion with EcoRI , an approximately 2.6 kb DNA fragment containing the tryptophan promoter and SD sequence was purified by agarose gel electrophoresis.
I got it. After pBR322 (Takara Shuzo Co., Ltd.) was partially digested with Taq 1, it was digested with Eco RI, purified DNA fragment of about 4.33kb by agarose gel electrophoresis, were obtained.

The obtained DNA fragments of about 2.6 kb and about 4.33 kb were ligated with T4 DNA ligase. Using the ligated DNA, Escherichia coli C600SFS was transformed according to the method of Maniatis et al. [Molecular Cloning, 2nd Edition], and applied to an LB agar medium containing ampicillin and tetracycline.
Incubated at 24 ° C. for 24 hours.

From the transformants showing resistance to the grown ampicillin and tetracycline, plasmid pKY
P-5 was extracted and obtained. The pKYP-5 is called Hap II.
It was digested with Hin dIII to obtain a DNA fragment of about 340bp. The DNA fragment of about 340 bp was converted into Cla I and Hi.
and inserted into pBR322 which had been digested with n dIII pKYP-
10 were obtained.

[0152] Ban the pKYP-10 III and Nru I
After that, a DNA fragment of about 3.8 kb containing a tryptophan promoter was purified and obtained by agarose gel electrophoresis ( Ban III- Nru I fragment). In order to add an ATG start codon downstream of the tryptophan promoter, the DNA shown in SEQ ID NOs: 6 and 7
Two types of DNA linkers having sequences were synthesized by the triester method.

After phosphorylation of these synthetic DNA linkers using T4 polynucleotide kinase, T4 DNA
The ligase was used to ligate with the pKYP-10-derived Ban III- Nru I fragment obtained above. The ligated DNA
Was used to transform Escherichia coli HB101 according to the method of Maniatis et al. [Molecular Cloning, 2nd Edition], spread on LB agar medium containing ampicillin, and
For 24 hours.

[0154] Plasmid pTrS20 was extracted and obtained from transformants showing resistance to the grown ampicillin. After digesting the pTrS20 with Sac I and Pst I, a DNA of about 1.15 kb was determined by agarose gel electrophoresis.
The fragment was purified and obtained ( SacI- PstI fragment).

E. coli IKYP-26 (FERM BP-
863) was digested with Bam HI, and the agarose gel electrophoresis was performed to obtain a 1.7 kb DKYP26.
The NA fragment was purified and obtained ( Bam HI fragment). Also M1
After digesting 3mp18RF DNA (manufactured by Takara Shuzo) with Sac I and Cla I, agarose gel electrophoresis was performed to about 0.65 k.
The DNA fragment b were purified (Sac I- Cla I fragment).

Furthermore, the DN shown in SEQ ID NOS: 8 and 9
The two DNA linkers having the A sequence are
It was synthesized using a Biosystems 380A DNA synthesizer and phosphorylated using T4 polynucleotide kinase. Sac I- Ps derived from pTrS20 obtained above
t I fragment, Bam HI fragment from pKYP26, M13mp1
The 8RF DNA derived Sac I- Cla I fragment and 5 'phosphorylated the two synthetic DNA were ligated using T4 DNA ligase.

Using the ligated DNA, Escherichia coli ATCC 33625 was transformed according to the method of Maniatis et al. [Molecular cloning, 2nd edition], and LB containing ampicillin was used.
It was spread on an agar medium and incubated at 37 ° C. for 24 hours. Plasmid pTrS33 was extracted and obtained from transformants showing resistance to the growing ampicillin.

[0158]

According to the present invention, a reaction for producing only 4 (R) -hydroxy-2-ketoglutaric acid without producing 4 (S) -hydroxy-2-ketoglutaric acid from glyoxylic acid and pyruvic acid. Enzyme 4 (R) -hydroxy-2-ketoglutarate aldolase which catalyzes, DNA encoding the enzyme, recombinant DNA obtained by incorporating the DNA into a vector, and recombinant DNA obtained by introducing the recombinant DNA into host cells Transformant, and 4 using the transformant
A method for producing (R) KHG, 4 (R) HG or 4 (R) HYP can be provided.

Further, an amino group donor and 4 (R) KH
A method for producing 4 (R) HYP using a biocatalyst having an activity of producing 4 (R) HYP from G can be provided.

[0160]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 208 Sequence type: Amino acid Topology: Linear Sequence type: Protein Sequence Met His Val Leu Ser Gln Ile Lys Glu Gln Lys Val Ile Ala Ile Ile 1 5 10 15 Arg Gly Tyr Asn Pro Glu Glu Ala Val Ser Ile Ala Gly Ala Leu Lys 20 25 30 Ala Gly Gly Ile Arg Leu Val Glu Ile Thr Leu Asn Ser Pro Gln Ala 35 40 45 Ile Lys Ala Ile Glu Ala Val Ser Glu Asp Phe Gly Asp Glu Met Leu 50 55 60 Ile Gly Ala Gly Thr Val Leu Asp Pro Glu Ser Ala Arg Ala Ala Leu 65 70 75 80 Leu Ala Gly Ala Arg Phe Ile Leu Ser Pro Ile Val His Glu Glu Thr 85 90 95 Ile Lys Leu Thr Lys Arg Tyr Gly Ala Val Ser Ile Pro Gly Ala Phe 100 105 110 Thr Pro Thr Glu Ile Leu Lys Ala Tyr Glu Ser Gly Gly Asp Ile Ile 115 120 125 Lys Val Phe Pro Gly Thr Met Gly Pro Gly Tyr Ile Lys Asp Ile His 130 135 140 Gly Pro Phe Pro His Ile Pro Leu Leu Pro Thr Gly Gly Val Gly Leu 145 150 155 160 Glu Asn Leu His Glu Phe Leu Gln Ala Gly Ala Val Gly Ala Gly Ile 165 170 175 Gly Gly Ser Leu Val Arg Ala His Gln Asp Val Asn Asp Ala Phe Leu 180 185 190 Glu Val Leu Ser Lys Lys Ala Lys Gln Phe Val Glu Ala Ala Lys Gln 195 200 205

SEQ ID NO: 2 Sequence length: 624 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism name: Bacillus sp. OC187 sequence ATGCATGTAT TGTCACAAAT CAAAGAACAA AAAGTGATTG CGATCATCCG CGGATACAAT 60 CCGGAGGAGG CAGTGAGCAT TGCCGGCGCC TTAAAAGCGG GCGGCATCAG GCTTGTGGAA 120 ATTACGCTCA ATTCCCCTCA AGCGATCAAA GCGATTGAAG CGGTTTCAGA AGATTTTGGA 180 GACGAAATGC TTATCGGAGC GGGAACCGTT CTTGATCCCG AATCTGCGAG AGCGGCGCTT 240 TTAGCCGGCG CGCGGTTTAT CCTGTCGCCA ATTGTTCATG AAGAGACGAT CAAGCTGACA 300 AAGCGATATG GAGCGGTCAG CATTCCGGGC GCCTTTACCC CGACGGAAAT ATTGAAGGCG 360 TATGAAAGCG GGGGAGACAT CATCAAAGTA TTTCCCGGAA CGATGGGGCC TGGCTATATC 420 AAAGATATCC ACGGACCGTT TCCGCATATT CCGCTGCTTC CGACGGGAGG GGTCGGGTTG 480 GAAAACCTTC ACGAGTTTTT ACAGGCCGGT GCGGTCGGTG CTGGAATCGG CGGTTCACTT 540 GTCAGGGCTC ATCAAGATGT AAATGACGCG TTTTTAGAAG TGCTGTCCAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGCATGAAGCAGAAAGCAAGAGCATGAAGCAGAAGATCAAGCAGAAGATCAAGCAGAAGTCA

SEQ ID NO: 3 Sequence length: 624 Sequence type: nucleic acid Number of strands: double-stranded Topology: type of linear sequence: Genomic DNA origin Organism: Bacillus sp. OC187 sequence ATGCACGTAC TGTCTCAAAT CAAAGAACAA AAAGTGATTG CGATCATCCG CGGATACAAT 60 CCGGAGGAGG CAGTGAGCAT TGCCGGCGCC TTAAAAGCGG GCGGCATCAG GCTTGTGGAA 120 ATTACGCTCA ATTCCCCTCA AGCGATCAAA GCGATTGAAG CGGTTTCAGA AGATTTTGGA 180 GACGAAATGC TTATCGGAGC GGGAACCGTT CTTGATCCCG AATCTGCGAG AGCGGCGCTT 240 TTAGCCGGCG CGCGGTTTAT CCTGTCGCCA ATTGTTCATG AAGAGACGAT CAAGCTGACA 300 AAGCGATATG GAGCGGTCAG CATTCCGGGC GCCTTTACCC CGACGGAAAT ATTGAAGGCG 360 TATGAAAGCG GGGGAGACAT CATCAAAGTA TTTCCCGGAA CGATGGGGCC TGGCTATATC 420 AAAGATATCC ACGGACCGTT TCCGCATATT CCGCTGCTTC CGACGGGAGG GGTCGGGTTG 480 GAAAACCTTC ACGAGTTTTT ACAGGCCGGT GCGGTCGGTG CTGGAATCGG CGGTTCACTT 540 GTCAGGGCTC ATCAAGATGT AAATGACGCG TTTTTAGAAG TGCTGTCCAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGCATGAAGCAGAAAGCAAGAGCATGAAGCAGAAGATCAAGCAGAAGATCAAGCAGAAGTCA

SEQ ID NO: 4 Sequence length: 30 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid, synthetic DNA sequence GTCATCGATA TGCACGTACT GTCTCAAATC 30

SEQ ID NO: 5 Sequence length: 27 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid, synthetic DNA sequence TGCGGATCCT TACTGTTTTG CTGCTTC 27

SEQ ID NO: 6 Sequence length: 19 Sequence type: Number of nucleic acid chains: Single strand Topology: Linear Sequence type: Other nucleic acid, synthetic DNA sequence CGATAAGCTT ATGAGCTCG 19

SEQ ID NO: 7 Sequence length: 17 Sequence type: Number of nucleic acid chains: Single strand Topology: Linear Sequence type: Other nucleic acid, synthetic DNA sequence CGAGCTCATA AGCTTAT 17

SEQ ID NO: 8 Sequence length: 49 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid, synthetic DNA sequence CGATAAGCTT ATGATATCCA ACGTCGACGA CGGCGTCGAA CCATGGCCG 49

SEQ ID NO: 9 Sequence length: 51 Sequence type: number of nucleic acid strands: single strand Topology: linear Sequence type: other nucleic acid, synthetic DNA sequence GATCCGGCCA TGGTTCGACG CCGTCGTCGA CGTTGGATAT CATAAGCTTA T 51

[Brief description of the drawings]

FIG. 1. FIG. 1 is cloned on pKSR201.
It is a figure showing a restriction map of a D fragment derived from Bacillus sp. Strain OC187.

FIG. 2 is a diagram showing a restriction map of pKSR303.

FIG. 3 is a diagram showing a restriction map of pKSR803.

FIG. 4 shows pKSR19, pKSR21, pKSR
FIG. 321 is a diagram showing a creation procedure and a structure of H.321.

FIG. 5 is a diagram showing a restriction map of pKSR50.

[Explanation of symbols]

Amp: pBR322-derived ampicillin resistance gene Ptrp: tryptophan promoter 4 (R) KAL: gene encoding 4-hydroxy-2-ketoglutarate aldolase Spc: spectinomycin resistance gene laclq: overproduced lac repressor gene Ptac: tac promoter ProBAR: feedback inhibition moderating mutant proline biosynthesis gene ProBA PpL: lambda phage-derived pL promoter ProC: proline biosynthesis gene ProC ZWF: glucose-6-phosphate dehydrogenase gene GDH: glutamate dehydrogenase gene Cm: chloramphenicol resistance gene ori177: pACYC177 origin of replication

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁶ Identification symbol FI C12P 13/24 C12P 13/24 // (C12N 15/09 ZNA C12R 1:19) (C12N 15/09 ZNA C12R 1:15) (C12N 15/09 ZNA C12R 1: 425) (C12N 15/09 ZNA C12R 1: 185) (C12N 15/09 ZNA C12R 1: 185) (C12N 15/09 ZNA C12R 1:07) (C12N 1/21 C12R 1: 185) (C12N 1/21 C12R 1:19) (C12N 1/21 C12R 1:15) (C12N 1/21 C12R 1:22) (C12N 1/21 C12R 1: 425) (C12P 7/50 C12R 1: 185) (C12P 7/50 C12R 1:19) (C12P 7/50 C12R 1:15) (C12P 7/50 C12R 1:22) (C12P 7/50 C12R 1:45) (C12P 13/04 C 2R 1: 185) (C12P 13/04 C12R 1:19) (C12P 13/04 C12R 1:15) (C12P 13/04 C12R 1:22) (C12P 13/04 C12R 1: 425) (C12P 13/24 (C12R 1: 185) (C12P 13/24 C12R 1:19) (C12P 13/24 C12R 1:15) (C12P 13/24 C12R 1:22) (C12P 13/24 C12R 1: 425)

Claims (26)

[Claims] 1. A method for preparing 4 glyoxylic acid and pyruvic acid.
(S) -hydroxy-2-ketoglutaric acid is not produced,
4 (R) -hydroxy-2-ketoglutarate aldolase which catalyzes a reaction producing only 4 (R) -hydroxy-2-ketoglutarate. 2. The method according to claim 1, wherein the 4 (R) -hydroxy-2-ketoglutarate aldolase is a polypeptide having the amino acid sequence represented by SEQ ID NO: 1 or one or more amino acids different from the amino acid sequence represented by SEQ ID NO: 1. It has a substituted, deleted or added amino acid sequence and does not produce 4 (S) -hydroxy-2-ketoglutaric acid from glyoxylic acid and pyruvic acid, but only 4 (R) -hydroxy-2-ketoglutaric acid The 4 (R) -hydroxy according to claim 1, which is a polypeptide having an activity of catalyzing a reaction producing
2-ketoglutarate aldolase. 3. A DN encoding 4 (R) -hydroxy-2-ketoglutarate aldolase according to claim 1 or 2.
A. 4. The DNA according to claim 3, wherein the DNA is derived from a microorganism belonging to the genus Bacillus. 5. The microorganism belonging to the genus Bacillus, wherein the microorganism is Bacillus.
The DNA according to claim 4, which is sp. OC187 strain (FERM BP-4646). 6. The DNA according to claim 3, wherein the DNA is a DNA having the nucleotide sequence represented by SEQ ID NO: 2 or 3, or a DNA that hybridizes with the DNA under stringent conditions. 7. A recombinant DNA obtained by incorporating the DNA according to claim 3 into a vector. 8. The recombinant DNA may be pKSR222, pKSR222 or pKSR222.
The recombinant DNA according to claim 7, which is a recombinant DNA selected from SR303, pKSR321, and pKSR803. 9. A transformant obtained by introducing the recombinant DNA according to claim 7 or 8 into a host cell. 10. The transformant according to claim 9, wherein the host cell is a microorganism selected from the genus Escherichia, Corynebacterium, Klebsiella and Serratia. 11. The transformant according to claim 10, wherein the microorganism belonging to the genus Escherichia is Escherichia coli NHK46 / pKSR303. 12. The transformant according to claim 9, 10 or 11, wherein the transformant is cultured in a medium, and 4 (S) -hydroxy-2-ketoglutaric acid is not produced from glyoxylic acid and pyruvic acid. 4 (R) -hydroxy-2-catalyzing the reaction producing only R) -hydroxy-2-ketoglutaric acid
A method for producing 4 (R) -hydroxy-2-ketoglutarate aldolase, comprising producing and accumulating ketoglutarate aldolase, and collecting the 4 (R) -hydroxy-2-ketoglutarate aldolase from the culture. 13. A biocatalyst I derived from the transformant according to claim 9, 10 or 11, and having an activity of producing 4 (R) -hydroxy-2-ketoglutaric acid from glyoxylic acid and pyruvic acid. By causing pyruvic acid and glyoxylic acid to be present in the aqueous medium, 4 (R) -hydroxy-2-ketoglutaric acid is produced in the aqueous medium, and the produced 4 (R) -hydroxy-2-ketoglutaric acid is converted into the aqueous medium. Characterized by being collected from the medium 4
A method for producing (R) -hydroxy-2-ketoglutaric acid. 14. The transformant 1) has no ability to produce 4 (S) -hydroxy-2-ketoglutarate from glyoxylic acid and pyruvic acid, 2) has an auxotrophy for lipoic acid, and 3) 1 selected from properties of low or no malate synthase activity
14. The production method according to claim 13, which is a transformant having one or more properties. 15. The production method according to claim 13, wherein the biocatalyst I is a culture, a microorganism, or a processed product thereof of a microorganism. (16) the method according to the above (13), wherein the pyruvate is pyruvate converted from the compound which can be converted into the pyruvate by the transformant according to the above (13) or (14); Law. 17. The method according to claim 16, wherein the compound that can be converted to pyruvic acid is glucose, fructose, maltose, glycerol, lactic acid or ammonium lactate. (18) The presence of the transformant (9), (10) or (11), amino group donor, saccharide and glyoxylic acid in an aqueous medium,
(R) -hydroxy-2-L-glutamic acid is produced, and the produced 4 (R) -hydroxy-2-L-glutamic acid is collected from the aqueous medium.
A method for producing (R) -hydroxy-2-L-glutamic acid. 19. The transformant is 1) not capable of producing 4 (S) -hydroxy-2-ketoglutaric acid from glyoxylic acid and pyruvic acid; 2) having an auxotrophy for lipoic acid; 19. The method according to claim 18, wherein the transformant has at least one property selected from the group consisting of :) low or no malate synthase activity, and 4) no phosphoenolpyruvate carboxylase activity. . 20. The transformant according to claim 9, 10 or 11, wherein the amino group donor, saccharide, and glyoxylic acid are present in the aqueous medium so that 4
(R) -hydroxy-L-proline is produced, and the produced 4 (R) -hydroxy-L-proline is collected from the aqueous medium.
A method for producing L-proline. 21. A transformant which has 1) no ability to produce 4 (S) -hydroxy-2-ketoglutarate from glyoxylic acid and pyruvate; 2) an auxotrophy for lipoic acid; ) A transformant having one or more properties selected from among properties of low or no malate synthase activity, 4) no phosphoenolpyruvate carboxylase activity, and 5) resistance to proline analogs. 21. A body
Production method as described. 22. An amino group donor and 4 (R) -hydroxy-2-ketoglutaric acid to give 4 (R) -hydroxy-
The presence of the biocatalyst II having the activity of producing L-proline, the amino group donor and 4 (R) -hydroxy-2-ketoglutaric acid in the aqueous medium allows the 4 (R) -hydroxy- Producing L-proline,
A method for producing 4 (R) -hydroxy-L-proline, wherein the produced 4 (R) -hydroxy-L-proline is collected from the aqueous medium. 23. The method according to claim 22, wherein the biocatalyst II is a culture, a microbial cell or a processed product thereof of a microorganism. 24. The method according to claim 23, wherein the microorganism is a microorganism belonging to the genus Escherichia or Corynebacterium. 25. The microorganism according to claim 23, wherein the microorganism has one or more properties selected from 1) an auxotrophy for glutamate and 2) a resistance to a proline analog. Or the production method according to 24. 26. The method according to claim 13, wherein the 4 (R) -hydroxy-2-ketoglutaric acid is 4 (R) -hydroxy-2-ketoglutaric acid produced by the method according to any one of claims 13 to 17. 23. The production method according to 23.