JPH1084999A - Polytypic analysis - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a polytypic analysis method capable of analyzing plural kinds of specimens at the same time even by using a single fluorescent dye. SOLUTION: A mixture of two kinds of primers and a DNA specimen is amplified by PCR method, the fluorescent-labeled amplified product is introduced to a migration lane of a gel electrophoresis plate of a fluorescent sequencer and migrated in a gel electrolyte by electrophoresis, the migrated fluorescent- labeled amplified product is irradiated with excitation light, the fluorescent light generated from the product is measured to form a ladder pattern of the nucleic acid specimen to be determined and the pattern is compared with a standard ladder pattern. In the above polytypic analysis method, a non- fluorescent labeled primer is added with bases of a number not smaller than one add not larger than the number obtained by subtracting one from the number of the bases constituting the polytypic region, a PCR-amplification product is formed by using the base-added primer and the product is subjected to electrophoresis together with a PCR amplification product obtained from the original primer free from added base to enable the simultaneous analysis of two or more kinds of specimens.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method for analyzing a fragment length of a nucleic acid such as DNA, which enables multiple sample processing. More specifically, the present invention relates to a polymorphism analysis method that enables multiple analysis of the same base pair (bp) size region in DNA fragment length analysis in a fluorescent fragment analyzer.

[0002]

2. Description of the Related Art Information obtained from functional analysis of DNA is innumerable. For example, by knowing the nucleotide sequence of a characteristic gene consisting of adenine (A), guanine (G), thymine (T) and cytosine (C), it becomes possible to identify and identify species. These functional analyzes can be processed using, for example, a fluorescent sequencer.

[0003] It is known that, in both animals and plants, the base sequence has a repetition consisting of a sequence of specific bases. In addition, those in which the number of repetitions differs for each individual are called “polymorphism”. Those having a short sequence of bases (about 2 to 5 bp) are referred to as STR (Short Tandem).
This method for identifying species and identifying individuals based on the sequence of 2 to 5 bp is called an STR method.

[0004] For example, a polymorphic region consisting of a sequence of four bases of [AATG] called TH01 is used for human identification. In this case, when the region containing the polymorphic portion is fluorescently labeled, amplified by the PCR method, and detected by a fluorescent sequencer equipped with an electrophoresis means, the migration speed (mobility) of the DNA fragment depends on the number of repetitions of the polymorphic region. Differently, some patterning can be performed.

[0005] Human genes consist of one set (22 autosomes and one sex chromosome) from the father and two sets (44 autosomes and two sex chromosomes) received from the mother. For example, a father repeats a base repeating region [AATG] five times (ie, -AATGAATGAA
TGAATGAATG-) and 9 times (ie, -AAT
GAATGAATGAATGAATGAATGAATG
AATGAATG-), if the mother is 6 and 10 times, the child will have any of the 4-6, 5-10, 9-6, 9-10 repeating regions. It is only necessary to confirm such a state for paternity test or the like. Also, when identifying an individual, examining a plurality of such areas increases the likelihood of being that person.

FIG. 2 shows an example of a ladder pattern obtained by discriminating a parent and a child using an allelic ladder marker of TH01. The allelic ladder marker for TH01 is known per se, and is a gene print from Promega, USA.
(GenePrint) Generally marketed as STR Systems. The base DNA collected from parents and children
A primer labeled with a fluorescent dye, designed to sandwich the polymorphic region of H01, is amplified by the PCR method, and the fluorescently-labeled amplification product is injected into each migration lane of a gel electrophoresis plate of a fluorescence sequencer to perform electrophoresis. Then, a ladder pattern as shown in FIG. 2 is obtained. M is a reference allelic ladder marker, and the number on the left is the number of repetitions of the polymorphism. As can be seen from this ladder pattern, the father injected in lane 1 had 5 and 9 repetitions, the mother injected in lane 2 had 6 and 10 repetitions, Children injected in 3 have 9 and 6 repetitions. Therefore, from this result,
This child is confirmed to have a genetic parent-child relationship with the parents.

In the case of individual identification or the like, it is necessary to perform the same analysis not only on a single polymorphic region but also on other polymorphic regions in order to ensure the reliability of identification. For example, individual identification may be performed using the polymorphic region of F13B together with the polymorphic region of TH01. The polymorphic region of F13B has a sequence of bases consisting of [AAAT]. But,
The size of the allelic ladder having the polymorphic region of TH01 is 179 to 203 bp, the size of the allelic ladder having the polymorphic region of F13B is 169 to 189 bp, and the known repetition number of the polymorphic region of TH01 is 5, 6,
7, 8, 9, 9.3, 10, 11 and the number of known repetitions of the polymorphic region of F13B is 6, 7, 8, 9, 10, 11
It is. Therefore, when individual identification is performed using these two polymorphic regions, an overlap may occur in the obtained ladder pattern.

For this reason, in the conventional polymorphism analysis using a fluorescent sequencer, primers having each polymorphic region are labeled with different fluorescent dyes having different excitation wavelengths. Since the fluorescent dyes that label the primers are different, the wavelengths of the fluorescence generated from each primer are also different. Therefore, for example, if green and red are designated for data corresponding to each fluorescence wavelength, and the obtained data is displayed on a CRT screen in green and red or output by a color printer, even if the DNA fragment is Since the bp size is the same, even if the ladder patterns overlap, it is possible to clearly distinguish which polymorphic region each ladder pattern belongs to.

However, when such a plurality of fluorescent dyes are used, the fluorescent sequencer used in the analysis itself separates a plurality of excitation light sources or a plurality of fluorescent wavelengths corresponding to the number of fluorescent dyes used. Must have a plurality of bandpass filters. If a plurality of excitation light sources and band-pass filters are provided, the structures of the light source system and the light receiving system of the fluorescent sequencer become complicated, and not only does the entire apparatus become larger, but also the cost of the sequencer increases significantly, which is not preferable.

[0010]

SUMMARY OF THE INVENTION Accordingly, an object of the present invention is to provide a novel polymorphism analysis method capable of simultaneously analyzing a plurality of types of samples even with a single fluorescent dye.

[0011]

The object of the present invention is to label one of two types of primers designed to sandwich a specific polymorphic region in a DNA sample to be analyzed with a single fluorescent dye. A mixture of a fluorescently labeled primer, a non-fluorescently labeled primer and a DNA sample is amplified by a PCR method, and the fluorescently labeled amplification product is injected into a migration lane of a gel electrophoresis plate of a fluorescence sequencer and electrophoresed, whereby a gel electrolyte layer is obtained. Irradiating the fluorescence labeled amplification product with the excitation light, and measuring the fluorescence generated from the product to generate a ladder pattern of the analyte nucleic acid sample. Detect the number of polymorphism repetitions of the DNA sample to be analyzed by comparing with a reference ladder pattern of a reference allelic ladder size marker having a polymorphic region. In the polymorphism analysis method, the method further comprises adding one or more bases to the non-fluorescently labeled primer and not more than one less than the number of bases constituting the polymorphic region, and using the base-added primer. A PCR amplification product is generated and the P
A polymorphism analysis method characterized in that two or more types of specimens are simultaneously analyzed by electrophoresing a PCR amplification product obtained from an original primer with no base added together with a CR amplification product. You.

[0012]

BEST MODE FOR CARRYING OUT THE INVENTION When, for example, a polymorphic region of TH01 is used as a reference allelic ladder size marker, this polymorphic region is composed of 4 bases of [AATG]. For example, one, two or three bases can be added to the primer used in the PCR method. As a result, four types of primers can be used including the original primer to which no base is added,
At the same time, analysis of four samples becomes possible.

The PCR method itself for producing the PCR amplification product required for use in the polymorphism analysis method of the present invention is known to those skilled in the art. FIG. 3 is a schematic process diagram illustrating the principle of the PCR method. First, in step 1, a target DNA sample to be analyzed is prepared. Any DNA sample such as human hair, nails, skin, blood, and lymphocytes can be used. Next, in step 2, two kinds of primers (for example, oligonucleotides of about 20 mer) suitable for the double strand of the target DNA sample are selected, and these are mixed, heat-denatured and annealed to perform DNA denaturation.
Let the composition take place. The DNA synthesized by the heat denaturation / annealing treatment is made single-stranded by a Taq polymerase reaction (step 3). Thereafter, the heat denaturation, annealing, and Taq polymerase reactions proceed only by changing the temperature (step 4). This step is repeated n times. Theoretically, DNA is doubled for each step. Therefore, after n steps, the D to be analyzed
NA is amplified 2 ⁿ times to obtain an amplification product (step 5).

The primers for generating the PCR amplification products required for use in the polymorphism analysis method of the present invention are suitable for each polymorphic region, and are available from GenePrint (GenePrint) from Promega, USA. ) Commercially available as STR Systems. Therefore, in the actual analysis, if a primer synthesis kit suitable for each polymorphic region is purchased from Promega and the DNA sample to be analyzed is mixed with the synthesis kit and the PCR method is performed, the desired DNA amplification and production can be performed. Things can be obtained easily.

Adding one to three bases to a primer to change the size of the primer is a commercially available D
It can be easily implemented by using an NA synthesizer. As such a DNA synthesizer, for example, CYCLON (registered trademark) plus DNA / RNA synthesizer manufactured by Millipore of the United States can be used.
The addition of a base can be performed to either one or both of the primers 1 and 2. However, it is preferable to add a base only to the primer 1 from an economic viewpoint. This is because the primer 2 is used for adding a fluorescent label.
It is of course possible to add a base to primer 2 and add a fluorescent dye to primer 1. The base to be added is not particularly limited, but is preferably selected from the same A, T, C, and G as the DNA constituent base. In addition, it is preferable that the addition of the base does not constitute the same base sequence as the known polymorphism.

The addition of a fluorescent dye to the primer 2 can be easily carried out by using a commercially available DNA synthesizer.
As such a DNA synthesizer, the cyclone (C
YCLON) plus a DNA / RNA synthesizer can be used. For example, when synthesizing the primer 2 with a DNA synthesizer, first, an amino group is added to the end of the primer 2 (that is, the 5 ′ side or the 5 ′ end), and a fluorescent dye is chemically bonded to the site. The addition of an amino group to the 5 'end of primer 2 can also be performed with a DNA synthesizer. The fluorescent dye that can be used in the method of the present invention is not particularly limited. When laser light is used to excite the fluorescent dye, the determination can be made in consideration of a combination of the excitation wavelength of the laser light and the emission wavelength of the fluorescent dye. Examples of the fluorescent dye that can be used in the present invention include fluorescein isothiocyanate (FITC) and eosin isothiocyanate (EIT).
C), tetramethylrhodamine isothiocyanate (TM
RITC), substituted rhodamine isothiocyanate (XRI
TC), sulforhodamine 101 acid chloride (commercially available under the trade name "Texas Red") and the like. When a He-Ne laser having a wavelength of 594 nm is used as the excitation light source, it is preferable to use Texas Red having a maximum excitation wavelength of 596 nm and a maximum emission wavelength of 615 nm as the fluorescent dye. When an argon ion laser having a wavelength of 488 nm is used, the fluorescent dye preferably uses FITC. A chemiluminescent reagent or the like can also be used as long as it does not prevent hybridization between the primer and the DNA chain (PCR product) or does not prevent the extension reaction toward the 3 'end by Polymerase.

A reference allelic ladder size marker having each polymorphic region is sold as a PCR amplification product together with the primer synthesis kit. Therefore, the marker itself does not need to be subjected to amplification generation processing by the PCR method. However, when a primer to which a base is added is used, the PCR generated from the base-added primer
The allelic ladder size marker of the amplification product must be used as a reference. On the other hand, when using the original primer with no base added, the allelic ladder size marker of the PCR amplification product generated from the original primer must be used as a reference.

In the case of gel electrophoresis, substances having approximately the same molecular weight have approximately the same mobility. Therefore, a DNA fragment to be analyzed having substantially the same bp number as each fraction of the marker shows a migration pattern (ladder pattern) that is almost the same as each fraction of the marker. The base pair length (bp number) of each ladder image fraction of the allelic ladder size marker indicated by M in FIG. 2 is known, and the number of repetitions of the polymorphism (eg, [AATG]) in the fraction is also known. . Therefore, the ladder fraction of the DNA fragment to be analyzed which is present at the same position as the ladder fraction portion having the predetermined repetition number of the reference allelic ladder size marker has the same repetition number as the marker. Thus, polymorphism analysis of the DNA fragment to be analyzed is performed.

A known sequencer can be used as the fluorescent sequencer used to carry out the polymorphism analysis method of the present invention. As such a sequencer, for example, an apparatus described in JP-A-7-98276 can be suitably used. In the concave portion at the upper end of each migration lane of the gel electrolyte layer in the electrophoresis plate of this apparatus, a fluorescence-labeled PCR amplification product of a reference allelic ladder size marker and a fluorescence-labeled PCR amplification product of a DNA sample to be analyzed are placed. Inject a fixed amount, apply a voltage to the electrolyte layer to cause each of the fluorescence-labeled PCR amplification products to migrate, and at a position separated by a predetermined distance from the concave portion, irradiate a laser beam to the amplification products that have migrated, Fluorescence emitted from the product is received by the fluorescence detection means, and this light reception signal is output as a ladder pattern. Then, the ladder pattern of the fluorescence-labeled PCR amplification product of the reference allelic ladder size marker is compared with the ladder pattern of the fluorescence-labeled PCR amplification product of the DNA sample to be analyzed, and the number of repetitions of the polymorphism is analyzed. .

[0020]

EXAMPLES Hereinafter, the polymorphism analysis method of the present invention will be specifically illustrated by examples. Example 1 Purpose of the Experiment A paternity test was performed by examining the number of repeats of the TH01 polymorphic region consisting of a sequence of bases [AATG].

Step 1: Extraction of DNA Sample The following operation was performed using chromosomal DNA extracted and purified from human peripheral blood lymphocytes of three subjects.

Step 2: Amplification and extraction of target DNA region
-For amplification of the region containing the purified TH01 polymorphism, the thermostable enzyme Taq
Amplification was performed by a PCR method using a polymerase.
The following primers were used in a cyclone plus DNA / RNA synthesizer for PCR amplification. Primer 1: 5'-GTGGGGCTGAAAAGCTCCCGATT
AT-3 'primer 2: 5'-* ATTCAAAGGGTACTCGGGCTC
TGG-3 '(* in primer 2 indicates a fluorescent dye composed of Texas Red.) The concentrations of primers 1 and 2 were 7 pmol each, and chromosome D
Each amount was added so that the amount of NA was 10 to 50 ng and the amount of Taq polymerase was 2 units. Further, a buffer (buffer) at an optimum concentration was added to make a final volume of 50 μl, and
Amplification was performed. The PCR cycle was performed 30 times with a dissociation reaction: a temperature of 94 ° C. and a reaction time of 60 seconds, a pairing reaction: a temperature of 58 ° C. and a reaction time of 45 seconds, and an elongation reaction: a temperature of 72 ° C. and a reaction time of 45 seconds as one cycle reaction. The PCR product obtained by this amplification reaction has a total length of 179-20.
It was a double-stranded DNA consisting of 3 bp. Since a fluorescent dye is added to the primer 2, the amplified PCR product is labeled with the fluorescent dye.

Step 3: Separation and detection of DNA fragment SQ-commercially available from Hitachi Electronics Engineering
Using 5500 (laser light source: helium neon laser), the separation path length of the fragment is 200 mm, 5% long ranger gel, applied voltage is 1000 volts, buffer TBE buffer (0.09 mol of tris, 0.09 mol of boric acid) And a pH 8.0 mixed solution comprising 0.002 mol of EDTA), the fluorescently-labeled PCR amplification product obtained in the step 2 was used as a reference, and the fluorescently-labeled allelic ladder size marker of the TH01 polymorphic region was used as a reference. Together with gel electrophoresis analysis. This detection ladder pattern is shown in FIG.

Step 4: Addition of bases to primers Two bases of AT were added to the 5 'end of primer 1 used in step 2 using a Beckman DNA synthesizer to synthesize a primer having the following sequence. 5'-ATGTGGGCTGAAAAGCTCCCGA
TTAT-3 '

Step 5: Using base addition primer
Using the base-added primer obtained in step 4 for preparing a reference allelic ladder size marker and the primer 2 to which a fluorescent dye has been added in step 2, a fluorescence-labeled PCR amplification product to be used as a reference allelic ladder size marker Was prepared by the PCR method described in Step 2.

Step 6: Using base addition primer
Using the base addition primer obtained in step 4 for amplification, extraction and purification of the target DNA region and the primer 2 to which the fluorescent dye has been added in step 2, the fluorescence-labeled PCR amplification product of the target DNA region to be analyzed is It was prepared by the PCR method described in Step 2.

Step 7: Separation and Detection of DNA Fragment DNA fragment was separated and detected in the same manner as in Step 4. This detection ladder pattern is shown in FIG. In FIG. 1, the allelic ladder marker in step 4 is indicated by “M”, and the allelic ladder marker in step 7 is indicated by “M _A ”. As is evident from the results shown in FIG. 1, the addition of two bases to the primer used in the PCR method resulted in a clear difference between the original primer and the ladder pattern of the amplification product using the primer. Could be generated. Thus, two types of specimens could be analyzed simultaneously with a single fluorescent dye.

[0028]

As described above, according to the present invention,
By adding a base to the primer, a difference in molecular weight is caused between the product amplified by the PCR method from the original primer and the amplification product from the base-added primer, resulting in a difference in mobility in electrophoresis. As a result, a difference occurs in the ladder pattern of electrophoresis.
Different types of samples can be analyzed simultaneously with high resolution.

Also, since one type of fluorescent dye is used,
The structure of the excitation light source and the light receiving system can be simplified. Furthermore, since only one type of fluorescence is detected, there is no need to perform a fluorescence separation process using a physical filter or software. In addition, it is possible to determine the size of all loci with high accuracy by using a general-purpose monochromatic size marker.

[Brief description of the drawings]

FIG. 1 is a ladder pattern diagram showing a migration state of a PCR amplification product and a reference allelic ladder size marker by gel electrophoresis in Example 1.

FIG. 2 is a ladder pattern diagram showing an example of polymorphism analysis used for paternity testing and the like.

FIG. 3 is a schematic process diagram illustrating the principle of the PCR method.

Claims (2)

[Claims] 1. One of two kinds of primers designed to sandwich a specific polymorphic region in a DNA sample to be analyzed is labeled with a single fluorescent dye, and the fluorescent labeled primer and the non-fluorescent labeled primer A mixture of the DNA sample and the DNA sample was amplified by the PCR method, and this fluorescence-labeled amplification product was injected into the electrophoresis lane of the gel electrophoresis plate of the fluorescent sequencer, and was electrophoresed, thereby moving in the gel electrolyte layer and moving. By irradiating the fluorescence-labeled amplification product with excitation light and measuring the fluorescence generated from the product, a ladder pattern of the nucleic acid analyte to be analyzed is generated, and this ladder pattern becomes a reference having the same polymorphic region. A polymorphism analysis method comprising detecting the number of polymorphism repetitions of a DNA sample to be analyzed by comparing with a reference ladder pattern of an allelic ladder size marker. In addition, one or more bases are added to the non-fluorescent labeled primer and not more than the number obtained by subtracting 1 from the number of bases constituting the polymorphic region, and a PCR amplification product is generated using the base-added primer. Then, by simultaneously electrophoresing the PCR amplification product obtained from the original primer with no base added together with the PCR amplification product obtained from the base addition primer, two or more types of samples can be analyzed simultaneously. Characteristic polymorphism analysis method. 2. As an allelic ladder size marker, a TH01 polymorphic region consisting of a sequence of four bases of [AATG] is used, and by adding 1 to 3 bases to a primer, 4 types of markers are simultaneously obtained. The polymorphism analysis method according to claim 1, wherein the sample is analyzed.