JPH1067798A - Rho target protein p140mdia - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject protein participating in cell adhesion, useful for elucidating functions of infiltration, proliferation and metastasis of cancerous cell, agglutination and activation of leukocyte, comprising a protein having both active type Rho protein bonding ability and profilin bonding ability. SOLUTION: This new Rho target protein p140mDia has an active type Rho protein bonding ability, is a protein capable of adjusting the reconstruction of actin cell skeleton and has profilin bonding ability. The Rho protein closely effects function expression of cells such as cell morphology, cell movement, cell adhesion, cytokinesis, etc., including formation and metastasis of tumor. The Rho target protein participates in cell adhesion and is useful for elucidating functions of infiltration, proliferation and metastasis of cancerous cell, agglutination and activation of leukocyte. The protein is obtained by screening a mouse brain cDNA library by a probe, incorporating the prepared gene to a vector and expressing the vector in a host cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION Field of the Invention The present invention relates to a target protein of the Rho protein,
More particularly, it relates to proteins involved in the reorganization of the actin cytoskeleton.

2. Description of the Related Art In vivo, a molecular weight of 2 to 3 having no subunit structure
There are a large group of low molecular weight GTP binding proteins (G proteins). At present, more than 50 members have been found in the superfamily of low molecular weight G proteins, from yeast to mammals. The low-molecular-weight G protein has Ras, R
ho, Rab, and other four families. It has been revealed that this low-molecular-weight G protein controls various cell functions. For example, Ras protein regulates cell growth and differentiation by Rho.
Proteins are thought to control morphological changes of cells, cell adhesion, cell motility, and the like, respectively.

[0003] Among them, Rho protein is GDP / G
It exhibits TP binding capacity and endogenous GTPase activity and has been implicated in the cytoskeletal response to extracellular signals such as lysophosphatidic acid (LPA) and certain growth factors. GDP-bound Rho that is inactive
When a certain stimulus is given to a protein, Smg GD
By the action of a GDP / GTP converting protein such as S, Dbl or Ost, it is converted into an active GTP-binding Rho protein (hereinafter referred to as “active Rho protein”). It is considered that the activated Rho protein acts on the target protein to form stress fibers and adhesion spots, thereby inducing cell adhesion and cell movement (Experimental Medicine vol.12, No.8, 97-10
2 (1994), Takai, Y. et al. Trends Biochem. Sci., 2
0, 227-231 (1995)). On the other hand, the activated Rho protein is converted to a GDP-bound Rho protein by the Rho protein endogenous GTPase. This endogenous GTPa
GTPase activating protein (GAP) (Lamarche, N. & Hall, A. eta)
l., TIG, 10, 436-440 (1994)).

[0004] RhoA protein, RhoB protein, RhoC protein, Rac1 protein, Rac
The amino acid sequences of Rho family proteins, such as the two proteins, Cdc42 protein, are 50
% Or more similarity. This Rho family of proteins responds to extracellular signals such as lysophosphatidylic acid (LPA) and growth factors to respond to stress fibers (st
ress fiber and focal contact
(AJ Ridley & A. Hall, Cell, 70, 389-399 (1
992), AJ Ridley & A. Hall, EMBO J., 1353,2600-261
0 (1994)). In addition, the subfamily Rho protein is used for morphological changes of cells (HFParterson et al., J. Ce
ll Biol., 111, 1001-1007 (1990)), cell adhesion (Morii,
N. et al., J. Biol. Chem. 267, 20921-20926 (1992),
T. Tominaga et al., J. Cell Biol., 120, 1529-1537 (19
93), Nusrat, A. et al., Proc, Natl. Acad. Sci. US
A, 92, 10629-10633 (1995), Landanna, C. et al., Sc
ience 271, 981-983 (1996)), cell motility (K. Takaishi
et al., Oncogene, 9, 273-279 (1994)), cytokinesis (cy
tokinesis) (K. Kishiet al., J. Cell Biol., 120, 118
7-1195 (1993), I. Mabuchi et al., Zygote, 1,325-331
(1993)) is also considered to be related to physiological functions accompanied by cytoskeletal rearrangement. Furthermore, the Rho protein has been shown to inhibit smooth muscle contraction (K. Hirata et al., J. Biol.
em., 267, 8719-8722 (1992), M. Noda et al., FEBS Let
t., 367, 246-250 (1995), M. Gong et al., Proc. Nat.
l. Acad. Sci. USA, 93, 1340-1345 (1996) *), phosphatidylinositol 3-kinase (PI3-kinase) (J. Zhang et al., J. Biol. Chem., 268, 22251).
-22254 (1993)), phosphatidylinositol 4
-Phosphate 5-kinase (PI 4,5-kinase)
(LD Chong et al., Cell, 79, 507-513 (1994)) and c-
Expression of fos (CS Hill et al., Cell, 81, 1159-1170
(1995)).

[0005] Recently, it has been discovered that when a Rho protein partially substituted with an amino acid sequence is introduced into cells, Ras-dependent tumor formation is suppressed.
Proteins have been shown to play an important role in Ras cell transformation, ie, tumorigenesis (GC Prendergast et al., Oncogene, 1).
0,2289-2296 (1995), Khosravi-Far, R., et al., Mol. Cel
l. Biol., 15,6443-6453 (1995), R. Qiu et al., Proc. Nat.
l. Acad. Sci. USA, 92, 11781-11785 (1995), and Lebowi
tz, P. et al., Mol. Cell. Biol., 15, 6613-6622 (1995)).
Further, it has been shown that cells are transformed when the Rho protein GDP / GTP conversion protein is mutated (Collard, J., Int. J. Oncol., 8, 131-138 (199).
6)), Hart, M. et al., J. Biol Chem., 269, 62-65 (199
4), Horii, Y. et al., EMBO J., 13,4776-4786 (1994)
). Furthermore, it has been revealed that the Rho protein is involved in cancer cell invasion, that is, cancer metastasis (Yoshioka, K. et al., FEBS Lett., 372, 25-28 (1995)).
). Changes in cell adhesion of cancer cells are closely related to cancer cell invasion, but Rho protein has been shown to be involved in cell adhesion (see Morii, supra).
N. et al. (1992), Tominaga, T. et al. (1993), Nusrat,
A. et al. (1995), Landanna, C. et al. (1996)).

[0006] The involvement of phosphoinositide kinase in Rho signaling has been reported. Rho
(Chong, LD et al., Cell, 79, 507-513 (1994)) and another member of the Rho family small G protein, Rac (Hartwig, JH et al., Cell, 82,
643-653 (1995)) has been shown to stimulate the synthesis of phosphatidylinositol bisphosphate (PIP2) in different cell lines. PIP2 binding is thought to regulate the function of many actin-related proteins (Janmey, PA, Ann. Rev. Physiol., 56, 169-191).
(1994)), it is thought that focal actin reconstitution is promoted by its intracellular local biosynthesis. PI
One of the proteins regulated by P2 is profilin, which complexes with actin monomers and dissociates actin upon binding to PIP2. Profilin also promotes actin filament assembly in the presence of thymosin β4 (Pantaloni, D., & Crl
ier, MF, Cell, 75, 1007-1014 (1993)). Therefore, accumulation of profilin at the adhesion site is considered to be important in actin reconstitution (Theriot, JA & Mitchis
on, TJ, Cell, 75,835-838 (1993)).

The actin cytoskeleton plays an important role in cell motility, morphology, phagocytosis and cytokinesis. It is spatially and dynamically reconfigured,
Provides power for morphological changes and cell surface movement of most eukaryotic cells. Actin rearrangement
Is rapidly triggered by extracellular stimuli, and a series of actin-binding proteins are thought to act synergistically on actin filament polymerization, crosslinking and fixation. The low molecular weight G protein Rho is responsible for a number of actin-dependent cellular processes, such as platelet aggregation (Morii, N. et al., J. Bio.
l. Chem., 267, 20921-20926 (1992)), lymphocyte adhesion (Tominaga, T. et al., J. Cell. Biol., 120, 1529-1).
537 (1993)), enhanced cell motility (Takaishi, K. et.
al., Oncogene, 11, 39-48 (1995)), and the formation of contractile rings and cytokinesis (Kishi, K. et al., J. Cell Bi.
ol., 120, 1187-1195 (1993), and Mabuchi, I. et a
l., Zygote, 1, 325-331 (1993)). In cultured fibroblasts, Rho
By microinjecting proteins, actin stress fibers and focal adhe
sion) is rapidly induced. Conversely, inactivation of Rho by botulinum C3 extracellular enzyme (ADP-ribosyltransferase) inhibits this process (Ridley, AJ & Hall, A., Cell, 7
0, 389-399 (1992)). Treatment of C3 extracellular enzyme also involves the use of focal adhesion kinase:
FAK) and paxillin lysophosphatidic acid (LPA)-, endothelin- or GTP
Inhibits γS-induced tyrosine phosphorylation (Kumagai,
N. et al., J. Biol. Chem., 268, 24535-24538 (1993)
, Rankin, S. et al., FEBS Lett., 354, 315-319 (19
94), Ridley, AJ & Hall, A., Cell, 70, 389-399.
(1992), and Seckl, MJ et al., J. Biol. Chem.
270, 6984-6990 (1995)). From these results, Rho
Proteins have been shown to regulate signaling pathways that link extracellular stimuli with actin cytoskeleton remodeling.

[0008] There are many target molecules for the Rho protein, which are thought to regulate many of the above signal transduction pathways. Very recently, several candidate proteins have been reported in mammals. These proteins are
Protein kinase N (PKN) (Watanabe, G. et a
l., Science 271, 645-648 (1996); Amano, M. et al.,
Sceince 271, 648-650 (1996)), porphyrin (Wat
anabe, G. et al., Science 271, 645-648 (1996)),
Citron (Madaule, P. et al., FEBS Lett. 377, 243-
248 (1995)), ROKα (Leung, T. et al., J. Biol.
Chem. 270, 29051-29054 (1995)), Rho-binding kinase (Matsui, T. et al., EMBO J. 15, 1885-1893 (1996)), rotekin (Reid, T. et al., J. Biol). .Chem., 271,9816-9822
(1996)), myosin light chain phosphatase (Kimura, K.
et al., Science, 273, 245-248 (1996)). All of these proteins bind to the GTP-bound RhoA protein (except for citron alone, where GTP-bound Ra
also binds to the c1 protein).

[0009] However, as far as the present inventors know, there has been no report on Rho proteins and Rho target proteins that bind to profilin, which regulates the reorganization of actin cytoskeleton.

[0010]

SUMMARY OF THE INVENTION The present inventors have now identified a target protein for the Rho protein (p140mDia) using the yeast two-hybrid system. This is a mammalian homolog of Drosophila diaphanous required for cytokinesis,
It contains a stretch of repeat poly-proline and a formin homology (FH2) domain. p140
mDia binds selectively via its amino-terminal region of GTP-linked Rho and binds to actin-binding protein, profilin. p140mDia, profilin and Rho proteins are localized in the expanded fibroblast membrane ruffles and in the cleavage furrow of dividing cells, and the fibronectin-coated latex beads localize under the beads. Recruited to the plasma membrane. These results suggested that one of the mechanisms of induction of actin reconstitution by the Rho protein is p140mDia-mediated recruitment of the profilactin complex at specific sites in cells.
The present invention is based on such findings.

[0011] Accordingly, an object of the present invention is to provide a Rho target protein that has an active Rho protein binding ability and binds to profilin.

Further, according to the present invention, a nucleotide sequence encoding the protein, a vector containing the nucleotide sequence, a host cell transformed with the vector, a method for producing the protein, an antibody against the protein, and an active form It is an object of the present invention to provide a screening method or the like for inhibiting the binding between a Rho protein and its target protein.

The protein according to the present invention has an active Rho protein binding ability and a profilin binding ability.

[0014]

DETAILED DESCRIPTION OF THE INVENTION Definitions In the present invention, the term "amino acid" is used to include both optical isomers, that is, L-form and D-form. Therefore, in the present invention, the term “peptide” means not only a peptide composed of only L-form amino acids but also a peptide containing some or all of D-form amino acids.

In the present invention, the term "amino acid" means not only the 20 kinds of α-amino acids constituting natural proteins, but also other α-amino acids, β-,
γ- and δ-amino acids, unnatural amino acids and the like are used. Thus, amino acids that are substituted in a peptide or inserted into a peptide as described below include the 20
It is not limited only to species α-amino acids, but may be other α-amino acids and β-, γ-, δ-amino acids and unnatural amino acids. Such β
-, Γ- or δ-amino acids, β-alanine,
γ-aminobutyric acid or ornithine; and amino acids other than those constituting natural proteins or unnatural amino acids include 3,4-dihydroxyphenylalanine, phenylglycine, cyclohexylglycine, 1,2,3,4-tetraethyl Hydroisoquinoline-3
-Carboxylic acid or dipecotinic acid.

[0016] In this specification, the term "protein according to the present invention" is used to include its derivatives.

Furthermore, in the present specification, "base sequence"
Means both the DNA sequence and the RNA sequence.

Protein The protein according to the present invention is a protein having an active Rho protein binding ability and a profilin binding ability or a derivative thereof. Here, the Rho protein includes RhoA protein, RhoB protein,
RhoC protein, or RhoG protein.

In the present invention, the term "protein having the ability to bind to active Rho protein" refers to a protein that has been evaluated by those skilled in the art as having binding to active Rho protein. It means a protein which is evaluated to have been found to bind to the active Rho protein when tested under the same conditions.

The protein according to the present invention comprises, in addition to the Rho protein binding region, a poly-proline region and F
It has an H2 region (Example 2). Further, the protein according to the present invention is characterized in that it is strongly expressed in mouse lung, testis, thymus, liver and stomach.

Proteins having activated Rho-binding ability and profilin-binding ability include p140mDia
(See Example 3).

In the present invention, the term “protein having a profilin binding ability” refers to a protein which is evaluated by those skilled in the art to have binding to profilin. In this case, it means a protein that is evaluated as having been recognized to bind to profilin.

As used herein, Rho protein is R
It also includes a Rho protein that has been modified so that the binding between the ho protein and the protein according to the present invention is not substantially impaired. Such modified Rho proteins include Rho in which the 14th amino acid is substituted with valine.
A mutant (RhoA ^Val14 ).

The origin of the protein according to the present invention is not particularly limited, and it may be derived from mammals including mice, or may be derived from other sources.

The molecular weight of the protein according to the present invention, when derived from a mouse, is about 1 as measured by SDS-PAGE.
It is 60 kD.

The protein according to the present invention can be obtained, for example, by expressing the cDNA sequence of SEQ ID NO: 2 in a host (Examples 4 and 9). Acquisition of the sequence of SEQ ID NO: 2 and expression in the host will be described later.

As used herein, the term “protein derivative” refers to a part or all of the amino group at the amino terminus (N-terminus) of the protein or the amino group on the side chain of each amino acid, and / or the carboxyl terminus of the peptide ( C-terminal) carboxyl group or a part or all of the carboxyl group of the side chain of each amino acid and / or a functional group other than the amino group and carboxyl group of the side chain of each amino acid of the peptide (for example, hydrogen group, thiol group) , An amide group, etc.) are partially or entirely modified with other appropriate substituents. Modification with an appropriate other substituent is performed, for example, for the purpose of protecting a functional group present in the peptide, improving safety and tissue transferability, or enhancing activity.

Specific examples of the protein derivative include (1) the amino group at the amino terminus (N-terminus) of the protein or part or all of the hydrogen atoms in the amino group in the side chain of each amino acid are substituted or non-substituted; Substituted alkyl groups (which may be linear, branched or cyclic) (e.g., methyl, ethyl, propyl, isopropyl, isobutyl, butyl, t-butyl, cyclopropyl,
Cyclohexyl group, benzyl group), substituted or unsubstituted acyl group (for example, formyl group, acetyl group, caproyl group, cyclohexylcarbonyl group, benzoyl group, phthaloyl group, tosyl group, nicotinoyl group, piperidinecarbonyl group), urethane-type protection Group (for example, p-nitrobenzyloxycarbonyl group, p-methoxybenzyloxycarbonyl group, p-biphenylisopropyloxycarbonyl group, t-butoxycarbonyl group) or a urea-type substituent (for example, methylaminocarbonyl group, phenylcarbonyl group) , Cyclohexylaminocarbonyl group), and (2) a carboxyl group at the carboxyl terminal (C-terminal) of the protein or part or all of the carboxyl group at the side chain of each amino acid is an ester type Decorated (e.g., those whose hydrogen atoms have been replaced by methyl, ethyl, isopropyl, cyclohexyl, phenyl, benzyl, t-butyl, 4-picolyl), those which have been modified by amide type (e.g., , Unsubstituted amides, those forming C1-C6 alkylamides (eg, methylamide, ethylamide, isopropylamide), and (3) functional groups other than the amino group and carboxyl group of the side chain of each amino acid of the protein (eg, , A hydrogen group, a thiol group, an amino group, etc.) in which a part or the whole is modified with the same substituent as the above-mentioned amino group or a trityl group.

Examples of the protein according to the present invention include a protein consisting of the amino acid sequence of SEQ ID NO: 1 (hereinafter referred to as "p140mDia") and its derivatives. The amino acid sequence of SEQ ID NO: 1 was obtained from D-DNA obtained from a cDNA library derived from mouse brain and embryo.
It was determined from the NA sequence (cDNA sequence).
This cDNA library is commercially available or Kakiz
uka, A. et al. (1993), cDNA Libraty Construction
(Edited by Stein, C. and Holland, P.) Essential Deve
lopmental Biology: A Practical Approach, pp223-23
2, IRL Press, Oxford. The cDNA sequence can be obtained by using an oligonucleotide corresponding to the thick underline (clone 50) in FIG. 3 as a probe.

Examples of the protein according to the present invention include an amino acid sequence of SEQ ID NO: 1, wherein one or more amino acid sequences are added and / or inserted to the amino acid sequence of SEQ ID NO: 1, and / or A protein in which one or more amino acids of one amino acid sequence are substituted and / or deleted, which has an active Rho protein binding ability and a profilin binding ability. That is, addition, insertion, substitution, and deletion (del
The term “etion” refers to a protein consisting of the amino acid sequence of SEQ ID NO: 1 that does not impair (not damage) the ability to bind to active Rho protein and the ability to bind to profilin.

According to another aspect of the invention, 6 of SEQ ID NO: 1
A protein having an amino acid sequence of Nos. 3-260 (Rho protein binding region) and an amino acid sequence of Nos. 571-737 (Profilin binding region) is provided.

The protein according to the present invention is an active form of Rho
It has protein binding ability and profilin binding ability. In addition, Rho protein is closely involved in the expression of cell functions such as tumor formation and metastasis, cell morphology, cell motility, cell adhesion, and cytokinesis (Ta, supra).
kai, Y., et al., GCPrendergast.et al., Khosravi
-Far, R., et al. , R. Qiu et al., Lebowitz,
P., et al., And Yoshioka, K. et al.). Therefore, the protein according to the present invention is considered to be useful for elucidating the mechanism of tumor formation and metastasis.

Further, according to Examples described later, it was shown that the protein according to the present invention is involved in cell adhesion. Thus, the protein according to the invention is useful for the infiltration and metastasis of cancer cells, leukocytes (T lymphocytes, B lymphocytes, neutrophils,
It is useful for elucidating functions such as aggregation and activation of eosinophils, basophils, macrophages, and the like, and aggregation and activation of platelets.

Further, according to the examples described later, it was shown that the protein according to the present invention is involved in cell division (particularly, cell proliferation). Therefore, the protein according to the present invention is useful for elucidating functions such as cancer growth.

Nucleotide Sequence According to the present invention, a nucleotide sequence encoding the protein of the present invention is provided. A typical sequence of this nucleotide sequence is
It has part or all of the DNA sequence of SEQ ID NO: 2.

[0036] The DNA sequence of SEQ ID NO: 2 was obtained from a cDNA library derived from mouse brain as described above. The sequence of Nos. 94 to 3861 of SEQ ID NO: 2 is
It corresponds to the open reading frame of p140mDia.

Given the amino acid sequence of the protein according to the present invention, the nucleotide sequence encoding it is easily determined, and various nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO: 1 can be selected. Accordingly, the nucleotide sequence encoding the protein according to the present invention refers to a DNA sequence encoding the same amino acid in addition to a part or all of the DNA sequence shown in SEQ ID NO: 2, and a degenerate codon in the DNA sequence. As well as RNA sequences corresponding thereto.

The base sequence according to the present invention may be of natural origin or may be totally synthesized. In addition, a product synthesized using a part of a product derived from a natural product may be used. The nucleotide sequence is a chromosome library or c
It can be obtained from a DNA library by a method commonly used in the field of genetic engineering, for example, a method of screening using an appropriate DNA probe prepared based on partial amino acid sequence information. The nucleotide sequence according to the present invention can be obtained by screening a mouse-derived cDNA library. This c
A commercially available DNA library can be used. In addition, the screening was carried out by the thick underline in FIG.
It can be carried out by using the oligonucleotide corresponding to 0) as a probe.

When the nucleotide sequence is of natural origin, its origin is not particularly limited, and it may be derived from mammals including mice, or may be derived from other sources.

Examples of the nucleotide sequence encoding the protein according to the present invention include the nucleotide sequence of SEQ ID NO: 2 and a part of the DNA sequence of SEQ ID NO: 2 (for example, 94 to 386 of SEQ ID NO: 2).
No. 1 (equivalent to open reading frame), 280
873 (corresponding to the Rho protein binding region) and 1804-2304 (corresponding to the profilin binding region).

Vector and Host Cell According to the present invention, there is provided a vector comprising the above-described nucleotide sequence of the present invention in a state capable of replicating in a host cell and expressing a protein encoded by the nucleotide sequence. You. Further, according to the present invention, there is provided a host cell transformed with the vector. The host-vector system is not particularly limited, and a fusion protein expression system with another protein can be used. Examples of fusion protein expression systems include MBP (maltose binding protein), GST (glutathione S transferase), HA (hemagglutinin), polyhistidine, my
c, Fas and the like.

As the vector, a plasmid vector (for example, an expression vector in prokaryotic cells, yeast, insect cells, animal cells, etc.), a viral vector (for example, a retrovirus vector, an adenovirus vector, an adeno-associated virus vector, a herpes virus vector, Sendai virus vector, HIV vector, baculovirus vector), liposome vector (eg, cationic liposome vector) and the like.

In order to express a desired protein by actually introducing the vector into a host cell, the vector according to the present invention requires not only the above-mentioned nucleotide sequence according to the present invention but also a sequence controlling its expression and a host cell. It may contain a genetic marker or the like for selection. In addition, this vector is obtained by repeating the base sequence according to the present invention (for example, in tandem).
May be included. These may be made to exist in a vector according to a conventional method, and a method of transforming a host cell with this vector may be one commonly used in this field.

The procedure and method for constructing a vector according to the present invention may be those commonly used in the field of genetic engineering.

Examples of host cells include Escherichia coli, yeast, insect cells, and animal cells (eg, COS cells,
Lymphocytes, fibroblasts, CHO cells, blood cells, tumor cells, etc.).

The transformed host cells are cultured in an appropriate medium, and the above-mentioned protein of the present invention can be obtained from the culture. Thus, according to another aspect of the present invention, there is provided a method for producing a protein according to the present invention. The culture of the transformed host cell and its conditions are as follows:
It may be essentially the same as that for the cells used. The recovery and purification of the protein according to the present invention from the culture solution can also be performed according to a conventional method.

[0047] According to the screening method the present invention, (1) the subject to substance screening, the activated Rho protein, is present in the screening system comprising a protein according to the invention, and (2) and the activated Rho protein And a method for screening a substance that inhibits the binding between an active Rho protein and a protein according to the present invention, which comprises measuring the degree of inhibition of binding to the protein according to the present invention.

According to the present invention, (1) the substance to be screened is present in a screening system containing profilin and the protein according to the present invention; A method for screening for a substance that inhibits the binding of profilin to a protein according to the present invention, comprising measuring the degree of inhibition of binding to a protein is provided.

Here, "measuring the degree of inhibition of binding"
Examples of the method include a method of measuring using an immunoblot with an antibody against the protein according to the present invention, a two hybrid system (M. Kawaba
ta Experimental Medicine 13,2111-2120 (1995), ABVojetk et al.
Cell 74, 205-214 (1993)).
Method for measurement using an assay (Ishizaki, T. et al.,
EMBO J., 15, 1885-1893 (1996)), a method of measuring using in vitro translated protein (Shibata, H. et al.
al., FEBS Lett. 385, 221-224 (1996)), Amano, M.,
et al., Science 271, 648-650 (1996), for example, the binding measurement method in a cell-free system, and the like. For example, the binding can be determined according to the methods described in Examples 1, 5, and 6. The degree of inhibition can be measured.

As used herein, the term “measuring the degree of inhibition of binding” is used to include the measurement of the presence or absence of binding. The term “screening” is used to include an assay.

The screening system may be either a cell system or a cell-free system. Examples of the cell system include yeast cells, COS cells, Escherichia coli, insect cells, nematode cells, lymph cells, fibroblasts, and CHO cells. Cells, blood cells, and tumor cells.

The screening target is not particularly restricted but includes, for example, peptides, peptide analogs, microorganism cultures, organic compounds and the like.

Antibodies The antibodies according to the present invention can be produced by methods commonly used in the art. For example, the peptide shown by the thick line in FIG. 3 is injected into an animal body (eg, rabbit, goat, rat, mouse, sheep) together with an arbitrary carrier (eg, bovine serum albumin), and after a certain period of time, the animal It can be obtained by purifying serum.

The peptide shown by the thick line in FIG.
0 mDia. Therefore, the reaction of this polyclonal antibody (ie, the immune response) is p140mDi
It is one indicator of the presence of a. Thus, according to another aspect of the present invention there is provided a protein recognized by the above antibody, and a protein according to the present invention which is recognized by the above antibody.

According to still another aspect of the present invention, (1) a substance to be detected is present in a detection system containing the antibody according to the present invention, and (2) a substance to be detected is There is provided a method for detecting a substance recognized by an antibody according to the present invention, comprising measuring the degree of reaction with the antibody according to the present invention.

Methods for measuring the degree of reaction with the antibody according to the present invention include ELISA, radioimmunoassay, western blotting, immunoprecipitation, and fluorescent antibody (for example, manuals for monoclonal antibody experiments,
Kodansha, (1987)). For example, the degree of reaction can be measured according to the methods described in Examples 4 to 6. Further, in the present invention, "measuring the degree of reaction" includes measuring the presence or absence of a reaction.

The detection system in the detection method according to the present invention may contain, for example, latex particles in addition to the polyclonal antibody according to the present invention. Furthermore, according to the present invention, there is provided a kit for detecting a substance which specifically reacts with the antibody, comprising the antibody according to the present invention. Here, the “detection kit” is intended to include a reagent for detecting a disease associated with the protein according to the present invention, a diagnostic reagent and a diagnostic kit.

Specific examples of the detection method according to the present invention include:
(1) The antibody, which comprises causing a substance to be detected to exist in a detection system containing latex particles carrying the antibody according to the present invention, and (2) measuring the degree of agglutination of the latex particles. For detecting a substance that specifically reacts with The degree of agglutination of latex particles is
For example, it can be measured by an optical measuring method such as a turbidimetric method or a non-turbidimetric method.

The detection kit according to the present invention may contain latex particles as in the above detection system. In this case, the latex particles may carry the antibody on its surface. Further, the detection kit according to the present invention, which further contains latex particles, can be used in an embodiment as shown in the specific examples of the detection method described above. Substances to be detected include body fluids derived from animals including humans (eg, serum, blood, etc.), urine, stool, tissue sections, cells (eg, tumor cells, etc.)
And the like.

The substance which reacts with the polyclonal antibody according to the present invention includes the protein according to the present invention (SEQ ID NO: 1).
Sequence).

[0061]

EXAMPLE 1 Example 1 Using Yeast Two Hybrid System
^N 19 fused to screening LexA DNA binding protein RhoA binding peptide fragments -R
Using the hoAΔC (RhoA ^Asn19 truncated at the C-terminal Ala ¹⁸¹ ) as a byte, a novel Rho
The binding proteins were screened. The yeast two-hybrid system is described in the previously described method (Vojtek, A. et al.
et al., Cell 74, 205-214 (1993); Modaule, P. et a
l., FEBSLett., 377, 243-248 (1995); Watanabe,
G. et al., Science 271, 645-648 (1996); Reid, T.
et al., J. Biol. Chem., 271, 13556-13560 (1996))
It carried out according to.

The plasmids pBTM116 and pVP16 used in the two-hybrid system (Vojtek,
A. et al., Cell 74, 205-214 (1993))
nberg, Rolf Sternglanz, Stan Fields and Paul B
Obtained from artel. pBTM-RhoA (pBTM116 containing the cDNA encoding RhoA) is described in the previously described method (Watanabe, G. et al., Science, 271,
645-648 (1996)). V on RhoA
To generate al ¹⁴ or ^{Asn 19} mutations, R
Ba of pGEX-RhoA encoding the N-terminus of hoA
The mHI-EcoRV fragment was inserted into pBluescript (Stratagene) and the method of Kunkel (Kunkel,
T., Proc. Natl. Acad. Sci. USA, 82, 488-492 (198
Mutagenesis was performed according to 5)). Then, pGEX-Rho
A (Morii, N. et al., J. Biol. Chem., 268, 27160-2)
The corresponding wild-type fragment of 7163 (1993)) was replaced with each mutagenesis ^{fragments, pGEX-V} 14 RhoA and pGEX-
N ¹⁹ RhoA was made.

PGEX-V ¹⁴ RhoA and pGEX
It was cut out BamHI-EcoRI fragment encoding the coding region of the full-length mutant RhoA from -N ¹⁹ RhoA, and inserted into pBTM116, pBTM
It was obtained -V ¹⁴ RhoA and ^pBTM-N 19 RhoA. Was inserted deletion mutants of C- terminal at ^{Ala 181} of these mutants pBTM116 (pBTM-V
¹⁴ RhoA △ C and pBTM-N ¹⁹ RhoA △
C) is based on a previously described method (Reid, T. et al., J. B.
iol. Chem., (1996)).

The yeast L40 strain having pBTM-N ¹⁹ RhoAΔC (MATa trp1 leu2 his3LYS :: lexA-HIS3 URA)
3 :: lexA-lacZ) (Vojtek, A. et al., Cell 74, 205-21
4 (1993)) and a mouse embryo cDNA library (Kakizu
ka, A. et al. (1993), cDNA Library Construction (St.
ein, C. and Holland, P. Edited) Essential Developme
ntal Biology: A Practical Approach, pp223-232, IR
PVP16 fused with L Press, Oxford) (Vojtek, A.
et al., Cell 74, 205-214 (1993)).
The initial transformation efficiency is 2.2 × 10 ⁷ ,
7 hours during incubation for 6 hours before seeding on IS (-) plate
It means that it has split twice. Of the 1.5 × 10 ⁸ transformants, 978 clones were isolated as His + and lacZ positive, and 220 clones were isolated to eliminate the byte plasmid. Interactions with other proteins were evaluated by crossing with yeast strain AMR70 having various test bytes. Among 220 clones, 55 clones showed the lacZ activity of the positive ^N 19 -RhoA △ C,
Lamin used as a negative control showed negative. The 55 clones isolated by this technique had identical size cDNA inserts and some of them were sequenced and found to have identical nucleotide sequences.

[0065] These clones were crossed to AMR70 with LexA fused to various RhoA mutants. All of them strongly with RhoA ^Val14, RhoA ^Asn19
And weak, and it is the wild-type RhoA bound weakly enough negligible, they ^N 19 -RhoA △ C
Alternatively, it strongly bound to wild-type RhoAΔC. Similar results were confirmed by the following experiment.

To test the specificity of the interaction in a two-hybrid system, the yeast clone 50
PVP16 plasmid (pVP-cl.
50) pBTM having cDNAs of various proteins
The L40 strain was co-transformed with the 116 plasmid and the interaction was tested by the lacZ assay. PBTM-RhoA △ and pBTM-lamin (Watanabe, G. et al., Science 271, 645-648 (199
6)), pBTM-Rac and pBTM-Cdc42H
(Reid, T. et al., J. Biol. Chem., 271, 13556-1356
0 (1996)) has been described previously.

As a result, the specificity of the binding was determined by the plasmid recovered from a representative clone (clone 50) and the various LexA-mutant RhoA fusion constructs with L4.
This was confirmed by co-transformation of 0 strain (FIG. 1). That is, the plasmid recovered from clone 50) and the LexA-Rac fusion construct or LexA-C
When the L40 strain was co-transformed with the dc42H fusion construct, the peptide encoded by this clone was R
It was found that neither ac nor Cdc42H specifically bound. These results indicate that the peptide encoded by this clone binds specifically to RhoA.

Example 2 Full length cD of p140mDia
To obtain the coding sequence for the full length clone of NA, we used the 0.6 Kbp c-DNA obtained from clone 50 as a probe.
Using DNA inserts ( ³² P-labelled 0.6 kbp cDNA insert of pVP-cl.50, a 0.6 kbp cDNA insert), two mouse brain libraries (936309 library (Stratagene) made in λZAP II) and λgt-10 The ML3000a library (Clontech) prepared in the above was screened, and then a mouse embryo library (Kakizuka,
A. et al. (1993), cDNA Libraty Construction (Stei
n, C. and Holland, P. Edited) Essential Development
al Biology: A Practical Approach, pp223-232, IRLP
ress, Oxford).

With this procedure, six overlapping clones were isolated (FIG. 2). One positive clone (clone 502) and two positive clones (clone 503 and 504) were obtained from the former and latter libraries, respectively. Using the 5 'portion of 504 and the 3' portion of 503 as probes, clones E51, E52, and E73 were isolated from a mouse embryo library.

When the nucleotide sequences of these clones were determined by the dideoxy chain termination method, a 3,763 amino acid encoding a 1,255 amino acid protein having a molecular weight of 139,336 Da was calculated.
From these clones containing the 5 bp open reading frame, the complete cDNA sequence was determined (FIG. 3). The initial cDNA obtained from clone 50 contains N
Encodes a 198 amino acid sequence (amino acids 63-260) including the terminal Rho binding domain. In the middle of the molecule, between amino acids 571-737, IPPPPPLPG
There is a 14-fold repeat of (G / S / A / V), a proline-rich region characterized by homologous sequences. Comparison of the deduced amino acid sequence with other sequences on the database identified several homologous proteins, all of which share a proline-rich region (FIG. 4). These proteins belong to a family of formin-like molecules that have two homologous regions, a proline-rich FH-1 region and an FH-2 region. FH
The -2 region also corresponds to amino acids 945-10 in the deduced sequence.
It was also found between 10 The protein with the highest homology to this sequence is Drosophila diaphanous, a protein characterized by being required for cytokinesis, which is N-specific for the identified protein. It showed about 30% identity in the terminal proline-rich region and about 39% identity in the C-terminal region of that region. that is,
In addition, each putative Rho binding domain and FH-
In two regions, about 32 relative to the identified protein
% And 57% homology. Based on these results, we concluded that the protein we identified was a mammalian homolog of the Drosophila diaphanos protein, and identified this protein as p140mDia.
(Mammalian Diafanosu (m ammalian Di
a phanous)) (hereinafter referred to as “p140mD
ia ").

P140mDia was also obtained from yeast (Saccha
romyces cerevisiae) Bni1p involved in cell budding
Showed significant homology with respect to the entire region. On the other hand,
p140mDia showed homology in the C-terminal half region to formin and Drosophila capuccino. R of p140mDia
The ho-binding domain was mapped to the N-terminal part (described above), but no sequence similar to the Rho-binding domain was found in formin or capsino. From this,
These proteins (formin and capsino without the Rho binding domain) perform similar functions to the proteins identified in cells, but only p140mDia, Diaphanos and Bnilp function in a Rho-dependent manner. It was suggested.

Example 3 A set expressing p140mDia
To search for tissues expressing the search p140mDia woven were performed Northern blot analysis. Oligo-dT latex beads (Pharmacia
Biotech) using standard techniques (Sambrook, J .;
et al. (1989) Molecular Cloning: A Laboratory Man
ual, 2nd Edition, Cold Spring Harbor Laboratory Pr
ess, Cold Spring Harbor), poly (A) ⁺ RN
A was prepared. 6 μg of each poly (A) ⁺ RNA was added to 2.1
Separated on a 1.0% agarose gel containing 5% formaldehyde and transferred to Biodyne A filters (Pall BioSuport). Then filter ³²
P-labeled cl. It hybridized with 50 cDNA fragments of 0.6 Kbp. Finally, the filters were washed with 0.4 × SSC and 0.1% SDS at 65 ° C. and subjected to autoradiography.

As a result, the main 6.3 kb transcript was
Universal (ubiquitousl) in all tissues tested
y) Although detected, particularly strong expression was detected in lung, testis, thymus, liver and stomach. Also, another 5 kb transcript was found in the testis and lung (FIG. 5).

Example 4 Preparation of Anti-p140Dia Antibody In order to examine the localization of p140mDia in cells and the binding to other proteins, the cD of clone 50 was
Peptides encoded by NA (63 to SEQ ID NO: 1)
260 (including the amino acid sequence at position 260) was expressed as a His-tagged protein, and an antibody against this peptide was prepared, whereby a specific antibody against p140mDia was obtained. Specifically, the experiment was performed according to the following method.

PVP-cl. Using the BamHI and EcoRI sites close to the 50 cDNA insert, cl. Fifty cDNAs were ligated with pQE11 (QIAGEN
And pGEX-3X (Pharmacia) vector. His6 labeled cl. 50 was expressed in E. coli strain JM109 and purified on Ni-NTA resin (QIAGEN) according to the manufacturer's protocol. The purified protein was mixed with Freund's adjuvant and injected into rabbits. Reid, T. et al., J. Biol. Chem., 271, 13556-13.
560 (1992), GST-cl. Immobilized on a nitrocellulose membrane. The antibodies were affinity purified using 50 fusion proteins. Specifically, GST-cl. Inclusion body containing 50 (inclusio
n body) was isolated from E. coli, solubilized in Laemmli buffer, and SDS-
Separated by PAGE and transferred to a nitrocellulose membrane.
GST-cl. Fifty bands were cut out as strips and the antibody absorbed on the strips was
00 mM glycine-HCl buffer (pH 2.
3), 100 mM glycine-HCl (pH 2.10) containing 100 mM monoethanolamine buffer (pH 11.5), and 10% 1,4-dioxane.
It eluted continuously in 5). The eluate was immediately neutralized with 0.25 volumes of 250 mM sodium phosphate buffer (pH 8.8 for the first and third eluates and pH 7.0 for the second eluate). These eluates were combined and used as affinity-purified antibody AP50. For the control immunofluorescence test, aliquots of AP50 were serially cut into 5 pieces of GST-cl. An AP50 solution from which antibodies were removed was prepared by incubating with a 50 blot membrane.

The specificity of the polyclonal antibody AP50 obtained was confirmed by its reactivity with a protein of the expected molecular weight of 50 kDa and its degradation products found in E. coli lysate after IPTG induction. (FIG. 6, lanes 1 and 2). AP50 antibody is approximately 160 in Swiss 3T3 cell lysate.
A single kDa protein was detected, which clearly shows endogenous p140mDia (lanes 3 and 4).

Example 5 In vitro Rho tan
Detection of binding between p140mDia and protein Using the AP50 antibody, the binding between wild-type Rho family small G protein and native p140mDia was examined in vitro. Specifically, the experiment was performed according to the method described below.

GST-small G protein (GST-Rho, Rac and Cd
c42H) was prepared according to a previously described method (Reid, T. et.
al., J. Biol. Chem., 271, 13556-13560 (1992)). Confluent S of approximately 1 × 10 ⁷ cells
Wiss 3T3 cells were collected and 3.2 ml of buffer A [10 mM Mes (pH 6.5), 150 mM N
aCl, 2 mM MgCl ₂ , 0.5 mM EDTA,
0.5% Triton X-100, 5mM DTT, 1m
M PMSF, 5 μg / ml leupeptin] by sonication (5 seconds, 4 times). The sonicated homogenate was centrifuged at 10,000 g for 20 minutes and the supernatant was set aside. Methods described previously (Ishizaki, T. et al., EMBO J., 15, 1885-1893 (199
According to 6)), each nucleotide was loaded by incubating 10 μM GST-low molecular weight G protein with 1 mM nucleotides. Next, 1/10 volume of the supernatant was replaced with 400 pmol of GTPγS or G
Each GST-low G protein loaded with DP was incubated. After incubating at 30 ° C. for 30 minutes, 5 μl of glutathione-sepharose was added to the solution, and the mixture was incubated at 4 ° C. for 1 hour. The immune complexes recovered by centrifugation were washed twice with 1 ml of buffer A and boiled in Laemmli sample buffer. The solubilized extract was subjected to SDS-PAGE, and the separated proteins were transferred to a PVDF membrane. The procedure described previously (Kumagai, N. et al., J. Biol. Chem., 26
8, 4535-24538 (1993)). 50 antiserum A
Immunoblotting was performed using P50.

The results were as shown in FIG. p
140mDia was precipitated only by GTPγS-bound Rho, but its GDP-bound Rho or GTPγ
No precipitation was caused by S-linked Rac or Cdc42. These results support the results in the two-hybrid system, where p140mDia is activated Rho
And selectively bind to

Example 6 In Vitro Profiling
Detection of binding between p140mDia and p140mDia It has been shown that p140mDia has a repeating structure of a stretch of poly-proline, and that profilin binds to a poly-L-proline sequence. Thus, the present inventors examined whether profilin binds to p140mDia and whether this binding depends on Rho.
Specifically, the experiment was performed according to the method described below.

First, a method described in the past (Janmey, P .;
Human platelet profilin was purified by poly-L-proline affinity chromatography according to A., Ann. Rev. Physiol., 56, 169-191 (1994)). Specifically, 250 mg of poly-L-proline (PLP, molecular weight 12,000, Sigma) was bound to CNBr-activated Sepharose 4B (Pharmacia). Previously described methods (Ishizaki, T. et al., EMBO J., 15,
1885-1893 (1996)), washed human platelets were prepared from a buffy coat fraction of 100 units of blood. Platelets were washed with 200 ml of extraction buffer [20 mM
Tris (pH 7.4), 150 mM KCl, 0.2
mM ATP, 1 mM DTT, 1 mM PMSF] +
Disrupted by sonication in 50 mM benzamidine and 1 mg / ml aprotinin. 100,0000
After centrifugation at xg for hours, the supernatant was applied to a PLP-Sepharose column. This was washed with 4 M urea and eluted with 7 M urea to obtain a homogeneous preparation of profilin. Next, 0.96 mg of profilin was complexed with 1 ml of NHS-activated Sepharose (Pharmacia) according to the manufacturer's protocol to obtain immobilized profilin beads. As a control, bovine serum albumin was also bound to NHS-activated Sepharose.

Confluent Swiss 3T3 cells obtained from twelve 6 cm culture dishes were solubilized in 2.4 ml of buffer C, and lysate was diluted to 10,000 × g.
And the supernatant was collected. A 1/10 aliquot of the resulting supernatant was then incubated in the presence or absence of GST-low molecular weight G protein or free GTPγS or GDP. Also, 20 μl of immobilized profilin was added.
After incubating the mixture at 25 ° C. for 30 minutes, the beads were centrifuged at 1,000 × g for 2 minutes. Set aside the supernatant and replace the beads with 3 mM instead of 100 mM NaCl.
Buffer C containing 100 mM NaCl (100 μl
Washed once in l). 50 μl of Laemmli sample buffer was added to the beads, and 1/10 volume of the supernatant was mixed with 1/5 volume of 5 × Lemli buffer. Samples were boiled, subjected to SDS-PAGE and transferred to a nitrocellulose membrane. Perform immunoblotting as described above,
Detection was performed by an ECL system (Amersham).

The results were as shown in FIG. Sw
p140mDi in the iss 3T3 cell lysate
a precipitated almost quantitatively with the addition of profilin-agarose, but did not precipitate with BSA-agarose. On the other hand, this binding was not affected by the addition of exogenous RhoA or GTPγS.

Example 7 Waves of a Spreading and Moving Cell Membrane
Rho in the striking structure and dividing cleft of dividing cells
A, Colocalization of p140mDia and profilin HT1080 cultured human fibroblast sarcoma cells, Swiss 3
T3 cells, stably expressing myc-labeled RhoA
MDCK2 cells (K. Takaishi, K. et al., Oncogene, 1
1, 39-48 (1995)) or p1 in HeLa cells.
The distribution of 40mDia, profilin and endogenous Rho and their potential for co-localization in vivo were examined by fluorescence microscopy using antibodies specific for each protein.

[0086] The cells were transformed with 10% fetal calf serum (FCS).
Were grown in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with HT1080 cells are 5 × 10 ⁴ cells / 3
Seeded at a density of 5 mm dishes, cultured overnight and submitted for analysis.
For analysis of sMDCK2 cells, 1
1 × 10 ⁴ cells / in DMEM containing 0% FCS
Cells were seeded at a density of 35 mm culture dishes and incubated for 16 hours. The medium was then washed with DMEM without FCS.
And incubated for 24 hours. Serum-starved cells were transformed with 1 × 10 ⁻⁷ M phorbol ester (phorbol myristat).
e acetate: 1 in the presence or absence of PMA)
Stimulated for 5 minutes at 37 ° C. and fixed.

For indirect immunofluorescence, cells were fixed for 20 minutes at room temperature in phosphate buffered saline (PBS) containing 3.7% paraformaldehyde, then 0.2% Triton X-100. 10 with PBS containing
Minutes were processed to make it permeable. After washing several times with PBS,
Cells were buffered with 5% BSA in buffer B [20 mM
Incubated in Tris pH 7.4, 50 mM NaCl] for 30 minutes at room temperature. p140mD
For ia staining, cells were treated with AP in blocking solution.
Incubated with 50 1:10 dilutions for 1 hour at room temperature and washed three times with buffer B containing 0.1% Triton X-100. The cells were then stained with a Cy2-labeled goat anti-rabbit IgG antibody (Amersham Life Science). For actin staining, rhodamine phalloidin (Molecular Probe) with a secondary antibody:
Added at 200 dilution. For staining of Myc-epitope, 9E10 monoclonal anti-Myc antibody was
Added for primary incubation with AP50 at a concentration of 0 μg / ml. The rhodamine anti-mouse IgG antibody was then used at a 1:50 dilution for detection.

The results were as described below. Most of the fluorescence obtained by the anti-p140mDia antibody is
It was localized in the thicker part of HT1080 cells, the cytoplasmic area around the nucleus. However, significant fluorescence is also present in surrounding areas known to be highly motile, such as the leading lamella of spreading and moving cells and the membrane ruffles of membranes. (Fig. 9
A). The perinuclear cytoplasmic region and the leading edge (le
ading edge), p140mDia staining was significantly absent. No binding of p140mDia to focal adhesion and stress fibers was observed. The pattern of distribution similar to the above is the culture Swiss 3
It was also observed in T3 cells (FIG. 9E).

A monoclonal anti-profilin antibody (2H
In the double immunofluorescence microscopy observation using 11), HT1
Accumulation of profilin was detected in the perinuclear cytoplasmic area of 080 cells and in the expanding lamella an veils, which overlapped with the distribution of p140mDia (FIG. 9B). This distribution of profilin was previously determined in rat fibroblasts (Buβ, F. et a
l., Cell Mot. Cytoskeleton, 22, 51-61 (1992)). Interestingly, double immunofluorescence observations using profilin and polyclonal anti-RhoA antibodies revealed that a portion of the endogenous RhoA also accumulates with profilin in the membrane veil of motile cells. (FIGS. 9C and D). This indicates that p140mDia, profilin and RhoA
Was suggested to be co-localized in the highly motile structure of cells. In addition, the distribution of p140mDia was changed to Swiss
It was examined in s3T3 cells and compared to the distribution of F-actin. p140mDia was also localized in the expanded lamella with well-developed actin ribs in these cells (FIGS. 9E, F).

P140mDia, profilin and R
Colocalization of hoA also results in sMDCK cells that stably express myc-tagged RhoA and expand the membrane in response to phorbol esters (Takaishi, K. et al., Oncogene, 1
1, 39-48 (1995)). As shown in FIG. 10, both Myc-RhoA and p140mDia were rather homogeneous in the cytoplasm in the thicker part of the resting cells. After 2 minutes of stimulation by PMA,
Some of Myc-RhoA migrated around the corrugated structure of the membrane where p140mDia was co-localized. It was revealed that a part of the profilin also moved to the wavy structure of the membrane and co-localized with RhoA. Induction of membrane expansion of these cells by phorbol esters is known to occur in a Rho-dependent manner (Takaishi, K. et al., Oncogen
e, 11, 39-48 (1995)).
Recruitment of mDia and profilin (recr
uitment) also suggests that it is Rho-dependent.

In interphase cells,
Most of the p140mDia is in the cytoplasm, and some have migrated to the plasma membrane at the spreading edge. On the other hand, in mitotic cells, p140mDia
Subcellular localization was not observed until they underwent cytokinesis. At this time, a part of p140mDia was enriched in the plasma membrane in the division groove and appeared as a ring-like structure (FIGS. 11A and 11C). This enrichment disappeared at the end of cytokinesis and staining migrated to the area surrounding the plasma membrane. No staining was observed in the intercellular bridge connecting the daughter cells. Profilin showed a staining pattern almost overlapping p140mDia during these processes (FIG. 11D).

Example 8 RhoA and p140mDi
a: Fibronectin (FN) coated beads
In a recent study clustered around the cell, Rho activation and ligation of integrins of extracellular matrix proteins (li
gation) is required for cell spreading and adhesion to substrates (Hotchin, NA & Hall,
A., J. Cell Biol., 131, 1857-1865 (1995)), and ligation of integrins with beads coated with either fibronectin or anti-integrin antibodies recruits Rho to the plasma membrane just below the beads. (Burbelo, P. et al., J.
Biol. Chem. 270, 30919-30926 (1995)). Then p
140 mDia also add R to the plasma membrane with these beads.
We examined whether ho was recruited and whether this recruitment was dependent on Rho activation.

Beads of polystyrene latex (11.
An average diameter of 9 μm, Sigma) was coated as described for 50 μg / ml human fibronectin (Collabrative Research) or 100 μg / ml poly-L-lysine (Sigma) (Grinnel & Geig).
er, Exp. Cell Res., 162, 449-461 (1986)). Trypsinized Swiss 3T3 cells were plated on poly-lysine coated glass slips and
The slip was bound to the slip in DMEM containing 37% FCS at 37 ° C for 2 hours. The different types of beads were then placed on the cells. After incubation at 37 ° C. for 15 minutes, the cells were fixed. Staining of p140mDia was performed as described above. Rabbit anti-RhoA antibody (Santa Cruz) for immunostaining of endogenous RhoA
Was used at a 1:40 dilution. Antibodies were visualized using a Cy2-labeled goat anti-rabbit IgG antibody as described above.

The results were as described below. First, it was confirmed that endogenous Rho was accumulated not directly under beads coated with poly-lysine (FIG. 12d), but directly under beads coated with fibronectin (FN) (FIG. 12b). Under these conditions, p140
mDia was also recruited just below the FN-coated beads, and a ring-like accumulation was observed around the beads (FIG. 12a). In addition to the above results (accumulation of both Rho and p140mDia), when cells were previously treated with C3 extracellular enzymes, their accumulation was inhibited, and thus their recruitment was dependent on Rho activation. (Data omitted).

Example 9 For overexpression of p140mDia
In order to investigate the function of p140mDia, a method described previously (Ishizaki, T. et al., EMBO J., 15, 1885-1893 (19
According to 96)), the cDNA of p140mDia (amino acid sequence of Nos. 1 to 1255 of SEQ ID NO: 1) and / or the cDNA of another protein is transiently expressed in COS7 cells, and then the cells are fixed. Stained with p140mDia antibody.

When cells 40 hours after the transfection were stained with an anti-p140mDia antibody, the cells were stained well and the expression of p140mDia was confirmed. Non-transfected cells showed perinuclear staining. By comparison, the transfected cells clearly and evenly stained the cell outline, indicating that p140
When mDia was overexpressed, this molecule was shown to be localized across the plasma membrane (FIG. 13A). When stained with phalloidin, it was observed that the stress fibers disappeared and actin staining was enhanced in accordance with the plasma membrane of the cells (FIG. 13B). It was suggested to induce. More pronounced results were obtained when p140mDia was expressed together with the C3 extracellular enzyme. That is, C
When the three extracellular enzymes were transfected alone, almost all actin fibers disappeared from the cells and the cells became spherical (FIGS. 13C and D). p140mDia to C3
When transfected with the extracellular enzyme, the cells maintained their morphology and a similar staining of fibrous actin as observed in cells transfected with p140mDia alone was observed (data not shown).

Furthermore, p140mDia was co-expressed with Rho ^Val14 or wild-type Rho. When Rho ^Val14 or wild-type Rho was expressed alone, induction of stress fibers and contraction was observed. However, p140mD
When ia was co-expressed with Rho ^Val14 or wild-type Rho, the above-described p140mDia trait (loss of stress fiber and actin staining consistent with the plasma membrane of cells) was induced by Rho alone (stress Induction of stress fibers and contraction were hardly observed (data not shown). From these results, p140mDi
When a is overexpressed, it automatically translocates to the plasma membrane,
That is, it suggests that the translocation is independent of actin polymerization by the Rho protein.

[0097]

[Sequence list]

SEQ ID NO: 1 Sequence length: Sequence type: Amino acid Number of chains: Single chain Topology: Linear Sequence type: Peptide Origin: Biological name: Mouse Sequence Met Glu Pro Ser Gly Gly Gly Leu Gly Pro Gly Arg Gly Thr Arg Asp 1 5 10 15 Lys Lys Lys Gly Arg Ser Pro Asp Glu Leu Pro Ala Thr Gly Gly Asp 20 25 30 Gly Gly Lys His Lys Lys Phe Leu Glu Arg Phe Thr Ser Met Arg Ile 35 40 45 Lys Lys Glu Lys Glu Lys Pro Asn Ser Ala His Arg Asn Ser Ser Ala 50 55 60 Ser Tyr Gly Asp Asp Pro Thr Ala Gln Ser Leu Gln Asp Ile Ser Asp 65 70 75 80 Glu Gln Val Leu Val Leu Phe Glu Gln Met Leu Val Asp Met Asn Leu 85 90 95 Asn Glu Glu Lys Gln Gln Pro Leu Arg Glu Lys Asp Ile Val Ile Lys 100 105 110 Arg Glu Met Val Ser Gln Tyr Leu His Thr Ser Lys Ala Gly Met Asn 115 120 125 Gln Lys Glu Ser Ser Arg Ser Ala Met Met Tyr Ile Gln Glu Leu Arg 130 135 140 Ser Gly Leu Arg Asp Met His Leu Leu Ser Cys Leu Glu Ser Leu Arg 145 150 155 160 Val Ser Leu Asn Asn Asn Pro Val Ser Trp Val Gln Thr Phe Gly Ala 165 170 175 Glu Gly Leu Ala Ser Leu Leu Asp Ile Leu Lys Arg Leu His Asp Glu 180 185 190 Lys Glu Glu Thr Ser Gly Asn Tyr Asp Ser Arg Asn Gln His Glu Ile 195 200 205 Ile Arg Cys Leu Lys Ala Phe Met Asn Asn Lys Phe Gly Ile Lys Thr 210 215 220 Met Leu Glu Thr Glu Glu Gly Ile Leu Leu Leu Val Arg Ala Met Asp 225 230 235 240 Pro Ala Val Pro Asn Met Met Ile Asp Ala Ala Lys Leu Leu Ser Ala 245 250 255 Leu Cys Ile Leu Pro Gln Pro Glu Asp Met Asn Glu Arg Val Leu Glu 260 265 270 Ala Met Thr Glu Arg Ala Glu Met Asp Glu Val Glu Arg Phe Gln Pro 275 280 285 Leu Leu Asp Gly Leu Lys Ser Gly Thr Ser Ile Ala Leu Lys Val Gly 290 295 300 Cys Leu Gln Leu Ile Asn Ala Leu Ile Thr Pro Ala Glu Glu Leu Asp 305 310 315 320 Phe Arg Val His Ile Arg Ser Glu Leu Met Arg Leu Gly Leu His Gln 325 330 335 Val Leu Gln Glu Leu Arg Glu Ile Glu Asn Glu Asp Met Lys Val Gln 340 345 350 Leu Cys Val Phe Asp Glu Gln Gly Asp Glu Asp Phe Phe Asp Leu Lys 355 360 365 Gly Arg Leu Asp Asp Ile Arg Met Glu Met Asp Asp Phe Gly Glu Val 3 0 375
380 Phe Gln Ile Ile Leu Asn Thr Val L
ys Asp Ser Lys Ala Glu Pro His 385 390
395 400 Phe Leu Ser Ile Leu Gln His Leu L
eu Leu Val Arg Asn Asp Tyr Glu 405
410 415 Ala Arg Pro Gln Tyr Tyr Lys Leu I
le Glu Glu Cys Val Ser Gln Ile 420 4
25 430 Val Leu His Lys Asn Gly Thr Asp P
ro Asp Phe Lys Cys Arg His Leu 435 440
445 Gln Ile Asp Ile Glu Arg Leu Val A
sp Gln Met Ile Asp Lys Thr Lys 450 455
460 Val Glu Lys Ser Glu Ala Lys Ala T
hr Glu Leu Glu Lys Lys Leu Asp 465 470
475 480 Ser Glu Leu Thr Ala Arg His Glu L
eu Gln Val Glu Met Lys Lys Met 485
490 495 Glu Asn Asp Phe Glu Gln Lys Leu G
ln Asp Leu Gln Gly Glu Lys Asp 500 505 510 Ala Leu Asp Ser Glu Lys Gln Gln Ile Thr Ala Gln Lys Gln Asp Leu 515 520 525 Glu Ala Glu Val Ser Lys Leu Thr Gly Glu Val 540 Gla Leu Glu Asp Ala Lys Asn Glu Met Ala Ser Leu Ser Ala Val Val 545 550 555 560 Val Ala Pro Ser Val Ser Ser Ser Ala Ala Val Pro Pro Ala Pro Pro 565 570 575 Leu Pro Gly Asp Ser Gly Thr Val Ile Pro Pro Pro Pro Pro Pro Pro 580 585 590 Pro Leu Pro Gly Gly Val Val Pro Pro Ser Pro Pro Leu Pro Pro Gly 595 600 605 Thr Cys Ile Pro Pro Pro Pro Pro Leu Pro Gly Gly Ala Cys Ile Pro 610 615 620 620 Pro Pro Pro Gln Leu Pro Gly Ser Ala Ala Ile Pro Pro Pro Pro 625 630 635 640 Leu Pro Gly Val Ala Ser Ile Pro Pro Pro Pro Pro Leu Pro Gly Ala 645 650 655 Thr Ala Ile Pro Pro Pro Pro Pro Leu Pro Gly Ala Thr Ala Ile Pro 660 665 670 Pro Pro Pro Pro Leu Pro Gly Gly Thr Gly Ile Pro Pro Pro Pro Pro 675 680 685 Pro Leu Pro Gly Ser Val Gly Val Pro Pro Pro Pro Pro Leu Pro Gly 690 695 700 Gly Pro Gly Leu Pro Pro Pro Pro Pro Pro Phe Pro Gly Ala Pro Gly 705 710 715 720 720 Ile Pro Pro Pro Pro Pro Gly Met Gly Val Pro Pro Pro Pro Pro Phe 725 730 735 Gly Phe Gly Val Pro Ala Ala Pro Val Leu Pro Phe Gly Leu Thr Pro 740 745 750 Lys Lys Val Tyr Lys Pro Glu Val Gln Leu Arg Arg Pro Asn Trp Ser 755 760 765 Lys Phe Val Ala Glu Asp Leu Ser Gln Asp Cys Phe Trp Thr Lys Val 770 775 775 780 Lys Glu Asp Arg Phe Glu Asn Asn Glu Leu Phe Ala Lys Leu Thr Leu 785 790 795 800 Ala Phe Ser Ala Gln Thr Lys Thr Ser Lys Ala Lys Lys Asp Gln Glu 805 810 815 Gly Gly Glu Glu Lys Lys Ser Val Gln Lys Lys Lys Val Lys Glu Leu 820 825 830 Lys Val Leu Asp Ser Lys Thr Ala Gln Asn Leu Ser Ile Phe Leu Gly 835 840 845 Ser Phe Arg Met Pro Tyr Gln Glu Ile Lys Asn Val Ile Leu Glu Val 850 855 860 Asn Glu Ala Val Leu Thr Glu Ser Met Ile Gln Asn Leu Ile Lys Gln 865 870 875 880 Met Pro Glu Pro Glu Gln Leu Lys Met Leu Ser Glu Leu Lys Glu Glu 885 890 895 Tyr Asp Asp Leu Ala Glu Ser Glu Gln Phe Gly Val Val Met Gly Thr 900 905 910 Val Pro Arg Leu Arg Pro Arg Leu Asn Ala Ile Leu Phe Lys Leu Gln 915 920 925 Phe Ser Glu Gln Val Glu Asn Ile Lys Pro Glu Ile Val Ser Val Thr 930 935 940 Ala Ala Cys Glu Glu Leu Arg Lys Ser Glu Asn Phe Ser Ser Leu Leu 945 950 955 960 Glu Leu Thr Leu Leu Val Gly Asn Tyr Met Asn Ala Gly Ser Arg Asn 965 970 975 Ala Gly Ala Phe Gly Phe Asn Ile Ser Phe Leu Cys Lys Leu Arg Asp 980 985 990 Thr Lys Ser Ala Asp Gln Lys Met Thr Leu Leu His Phe Leu Ala Glu 995 1000 1005 Leu Cys Glu Asn Asp His Pro Glu Val Leu Lys Phe Pro Asp Glu Leu 1010 1015 1020 Ala His Val Glu Lys Ala Ser Arg Val Ser Ala Glu Asn Leu Gln Lys 1025 1030 1035 1040 Ser Leu Asp Gln Met Lys Lys Gln Ile Ala Asp Val Glu Arg Asp Val 1045 1050 1055 Gln Asn Phe Pro Ala Ala Thr Asp Glu Lys Asp Lys Phe Val Glu Lys 1060 1065 1070 Met Thr SerPhe Val Asp Ala G
ln Glu Gln Tyr Asn Lys Leu Arg 1075 1080
1085 Met Met His Ser Asn Met Glu Thr L
eu Tyr Lys Glu Leu Gly Asp Tyr 1090 1095
1100 Phe Val Phe Asp Pro Lys Lys Leu S
er Val Glu Glu Phe Phe Met Asp 1105 1110
1115 1120 Leu His Asn Phe Arg Asn Met Phe L
eu Gln Ala Val Lys Glu Asn Gln 1125
1130 1135 Lys Arg Arg Glu Thr Glu Glu Lys M
et Arg Arg Ala Lys Leu Ala Lys 1140 1
145 1150 Glu Lys Ala Glu Lys Glu Arg Leu G
lu Lys Gln Gln Lys Arg Glu Gln 1155 1160
1165 Leu Ile Asp Met Asn Ala Glu Gly A
sp Glu Thr Gly Val Met Asp Ser 1170 1175
1180 Leu Leu Glu Ala Leu Gln Ser Gly A
la Ala Phe Arg Arg Lys Arg Gly 1185 1190
1195 1200 Pro Arg Gln Val Asn Arg Lys Ala G
ly Cys Ala Val Thr Ser Leu Leu 1205
1210 1215 Ala Ser Glu Leu Thr Lys Asp Asp A
la Met Ala Pro Gly Pro Val Lys 12201
225 1230 Val Pro Lys Lys Ser Glu Gly Val P
ro Thr Ile Leu Glu Glu Ala Lys 1235 1240
1245 Glu Leu Val Gly Arg Ala Ser 1250 1255

SEQ ID NO: 2 Sequence length: Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: cDNA Origin: Organism name: Mouse Sequence GAAGGCTGCT GGGCGGCGGC GGTGGTTGCT GGCTCGGGGC AGCCGGGCGC GAGCGGCGTA 60 GACAAGGGGT CACTTGCCGG CGCTAATCAG GAC ATG GAG CCG TCC GGC GGG GGC 114 Met Glu Pro Ser Gly Gly Gly 15 CTG GGG CCC GGC CGC GGT ACC CGG GAC AAG AAG AAG GGT CGG AGC CCG 162 Leu Gly Pro Gly Arg Gly Thr Arg Asp Lys Lys Lys Lys Lys Lys Lys Arg Ser Pro 10 15 20 GAT GAG CTG CCT GCG ACG GGC GGC GAC GGC GGC AAA CAT AAG AAA TTT 210 Asp Glu Leu Pro Ala Thr Gly Gly Asp Gly Gly Lys His Lys Lys Phe 25 30 35 CTG GAG AGA TTT ACC AGC ATG AGG ATT AAG AAG GAG AAA GAA AAG CCC 258 Leu Glu Arg Phe Thr Ser Met Arg Ile Lys Lys Glu Lys Glu Lys Pro 40 45 50 55 AAT TCT GCT CAT AGA AAC TCC TCT GCA TCG TAC GGA GAT GAC CCC ACT 306 Asn Ser Ala His Arg Asn Ser Ser Ala Ser Tyr Gly Asp Asp Pro Thr 60 65 70 GCT CAG TCA TTG CAG GAC ATC TCA GAC GAG CAA GTT CTT GTC CTC TTT 35 4 Ala Gln Ser Leu Gln Asp Ile Ser Asp Glu Gln Val Leu Val Leu Phe 75 80 85 GAG CAG ATG CTG GTG GAT ATG AAC CTG AAT GAG GAG AAG CAG CAG CCT 402 Glu Gln Met Leu Val Asp Met Asn Leu Asn Glu Glu Lys Gln Gln Pro 90 95 100 TTG CGA GAG AAG GAC ATT GTC ATC AAG AGG GAG ATG GTG TCG CAA TAT 450 Leu Arg Glu Lys Asp Ile Val Ile Lys Arg Glu Met Val Ser Gln Tyr 105 110 115 CTG CAC ACT TCC AAG GCT GGC ATG AAC CAG AAA GAG AGC TCT AGG TCT 498 Leu His Thr Ser Lys Ala Gly Met Asn Gln Lys Glu Ser Ser Arg Ser 120 125 130 135 GCC ATG ATG TAC ATC CAG GAG CTG AGG TCG GGC TTG CGG GAT ATG CAC 546 Ala Met Met Tyr Ile Gln Glu Leu Arg Ser Gly Leu Arg Asp Met His 140 145 150 CTG CTT AGC TGC CTT GAG TCC CTT CGA GTC TCT CTC AAC AAT AAC CCT 594 Leu Leu Ser Cys Leu Glu Ser Leu Arg Val Ser Leu Asn Asn Asn Pro 155 160 165 GTC AGT TGG GTG CAG ACA TTT GGT GCT GAG GGC CTA GCC TCC TTA TTG 642 Val Ser Trp Val Gln Thr Phe Gly Ala Glu Gly Leu Ala Ser Leu Leu 170 175 180 GAC ATC CTC AAA CGA CTC CAT GAT GAG AAA GAG GAG ACT TCT GGA AAC 690 Asp Ile Leu Lys Arg Leu His Asp Glu Lys Glu Glu Thr Ser Gly Asn 185 190 195 TAC GAC AGC CGA AAC CAG CAT GAG ATT ATC CGC TGT TTG AAG GCT TTC 738 Tyr Asp Ser Arg Asn Gln His Glu Ile Ile Arg Cys Leu Lys Ala Phe 200 205 210 215 ATG AAC AAC AAG TTT GGA ATC AAA ACT ATG TTG GAG ACG GAA GAA GGA 786 Met Asn Asn Lys Phe Gly Ile Lys Thr Met Leu Glu Thr Glu Glu Gly 220 225 230 ATC CTA CTG CTG GTC AGA GCC ATG GAT CCT GCT GTT CCC AAT ATG ATG 834 Ile Leu Leu Leu Val Arg Ala Met Asp Pro Ala Val Pro Asn Met Met 235 240 245 ATT GAT GCA GCA AAG CTG CTG TCT GCC CTC TGT ATC CTG CCG CAG CCG 882 Ile Asp Ala Ala Lys Leu Leu Ser Ala Leu Cys Ile Leu Pro Gln Pro 250 255 260 GAG GAC ATG AAT GAA CGA GTT CTA GAG GCA ATG ACA GAG AGA GCT GAA 930 Glu Asp Met Asn Glu Arg Val Leu Glu Ala Met Thr Glu Arg Ala Glu 265 270 275 ATG GAT GAG GTC GAA CGC TTC CAG CCA CTT CTG GAC GGA TTA AAA AGT 978 Met Asp Glu Val Glu Arg Phe Gln Pro Leu Leu Asp Gly Leu Lys Ser 280 285 290 290 295 GGG ACC TCT ATT GCC CTC AAA GTG GGA TGC CT A CAG CTC ATC AAT GCT 1026 Gly Thr Ser Ile Ala Leu Lys Val Gly Cys Leu Gln Leu Ile Asn Ala 300 305 310 CTC ATC ACT CCA GCT GAG GAA CTG GAC TTC CGA GTT CAC ATC CGA AGT 1074 Leu Ile Thr Pro Ala Glu Glu Leu Asp Phe Arg Val His Ile Arg Ser 315 320 325 GAG CTG ATG CGC CTG GGG CTG CAT CAG GTG TTG CAG GAG CTT CGA GAG 1122 Glu Leu Met Arg Leu Gly Leu His Gln Val Leu Gln Glu Leu Arg Glu 330 335 340 ATT GAA AAT GAA GAT ATG AAA GTA CAG CTG TGC GTG TTT GAT GAA CAA 1170 Ile Glu Asn Glu Asp Met Lys Val Gln Leu Cys Val Phe Asp Glu Gln 345 350 355 GGG GAT GAA GAT TTC TTT GAT CTG AAG GGA CGG CTG GAT GAT ATC CGC 1218 Gly Asp Glu Asp Phe Phe Asp Leu Lys Gly Arg Leu Asp Asp Ile Arg 360 365 370 375 ATG GAG ATG GAT GAC TTT GGT GAA GTT TTT CAG ATT ATT TTA AAC ACA 1266 Met Glu Met Asp Asp Phe Gly Glu Val Phe Gln Ile Ile Leu Asn Thr 380 385 390 GTG AAA GAT TCA AAG GCA GAG CCA CAC TTC CTG TCT ATC TTG CAG CAT 1314 Val Lys Asp Ser Lys Ala Glu Pro His Phe Leu Ser Ile Leu Gln His 395 400 405 CTC CTG TTG GTC CGA AAT GAT TAT GAA GCC AGG CCA CAG TAC TAT AAA 1362 Leu Leu Leu Val Arg Asn Asp Tyr Glu Ala Arg Pro Gln Tyr Tyr Lys 410 415 420 CTG ATT GAA GAA TGT GTT TCT CAG ATA GTT CTA CAC AAA AAT GGA ACT 1410 Leu Ile Glu Glu Cys Val Ser Gln Ile Val Leu His Lys Asn Gly Thr 425 430 435 GAT CCT GAC TTC AAG TGC CGA CAC CTG CAG ATT GAT ATT GAG AGA TTG 1458 Asp Pro Asp Phe Lys Cys Arg His Leu Gln Ile Asp Ile Glu Arg Leu 440 445 450 455 GTT GAT CAA ATG ATT GAT AAA ACA AAG GTG GAA AAA TCT GAG GCC AAA 1506 Val Asp Gln Met Ile Asp Lys Thr Lys Val Glu Lys Ser Glu Ala Lys 460 465 470 470 GCT ACA GAG CTG GAA AAA AAG TTG GAT TCA GAA TTA ACA GCG CGG CAC 1554 Ala Thr Glu Leu Glu Lys Lys Leu Asp Ser Glu Leu Thr Ala Arg His 475 480 485 GAG TTA CAA GTA GAA ATG AAA AAG ATG GAA AAT GAC TTT GAG CAG AAA 1602 Glu Leu Gln Val Glu Met Lys Lys Met Glu Asn Asp Phe Glu Gln Lys 490 495 500 CTT CAG GAT CTT CAA GGA GAA AAG GAT GCC TTG GAT TCT GAA AAG CAG 1650 Leu Gln Asp Leu Gln Gly Glu Lys Asp Ala Leu Asp Ser Glu Lys Gln 505 510 515 CAG ATC ACT GCA CAG AAA CAA GAC CTG GAG GCA GAG GTG TCC AAG CTG 1698 Gln Ile Thr Ala Gln Lys Gln Asp Leu Glu Ala Glu Val Ser Lys Leu 520 525 530 530 535 ACA GGA GAG GTT GCC AAG CTG TCA AAA GAA CTA GAA GAT GCC AAG AAT 1746 Thr Gly Glu Val Ala Lys Leu Ser Lys Glu Leu Glu Asp Ala Lys Asn 540 545 550 GAA ATG GCT TCT CTC TCT GCT GTG GTT GTT GCA CCT TCT GTT TCT AGC 1794 Glu Met Ala Ser Leu Ser Ala Val Val Val Ala Pro Ser Val Ser Ser 555 560 565 AGT GCT GCT GTT CCC CCT GCC CCT CCT CTG CCT GGT GAC TCT GGC ACT 1842 Ser Ala Ala Val Pro Pro Ala Pro Pro Leu Pro Gly Asp Ser Gly Thr 570 575 580 580 GTT ATT CCA CCT CCC CCA CCC CCA CCT CCT CTT CCT GGA GGT GTG GTC 1890 Val Ile Pro Pro Pro Pro Pro Pro Pro Pro Leu Pro Gly Gly Val Val 585 590 595 CCA CCA TCC CCT CCT CTG CCT CCA GGT ACT TGT ATC CCT CCA CCT CCT 1938 Pro Pro Ser Pro Pro Leu Pro Pro Gly Thr Cys Ile Pro Pro Pro Pro 600 605 610 615 CCT TTA CCT GGA GGT GCT TGT ATA CCC CCT CCC CCC CAG TTG CCT GGC 1986 Pro Leu Pro Gly Gly Aly Cys Ile Pro Pro Pro Pro Gln Leu Pro Gly 620 625 630 AGT GCT GCC ATC CCT CCA CCT CCT CCT CTA CCT GGA GTT GCT TCC ATC 2034 Ser Ala Ala Ile Pro Pro Pro Pro Pro Leu Pro Gly Val Ala Ser Ile 635 640 645 CCC CCA CCT CCC CCT TTG CCT GGG GCT ACT GCC ATC CCC CCA CCT CCC 2082 Pro Pro Pro Pro Pro Leu Pro Gly Ala Thr Ala Ile Pro Pro Pro 650 655 660 CCT TTG CCT GGG GCT ACT GCC ATC CCC CCA CCT CCC CCT TTG CCT GGA 2130 Pro Leu Pro Gly Ala Thr Ala Ile Pro Pro Pro Pro Pro Leu Pro Gly 665 670 675 GGT ACA GGT ATA CCA CCA CCA CCT CCT CCT TTG CCT GGA AGT GTT GGC 2178 Gly Thr Gly Ile Pro Pro Pro Pro Pro Pro Leu Pro Gly Ser Val Gly 680 685 690 695 GTT CCC CCA CCC CCT CCC TTG CCT GGA GGA CCA GGA CTG CCT CCT CCC 2226 Val Pro Pro Pro Pro Pro Leu Pro Gly Gly Pro Gly Leu Pro Pro 700 705 710 CCC CCC CCT TTT CCT GGA GCA CCT GGC ATT CCT CCA CCT CCA CCT GGT 2274 Pro Pro Pro Phe Pro Gly Ala Pro Gly Ile Pro Pro Pro Pro Pro Gly 715 720 725 ATG GGC GTG CCT CCA CCT CCC CCC TTT GGA TTT GGG GTT CCT GCG GCC 2322 Met Gly Val Pro Pro Pro Pro Pro Phe G ly Phe Gly Val Pro Ala Ala 730 735 740 CCA GTT CTG CCA TTT GGA TTA ACC CCC AAA AAA GTT TAT AAG CCA GAG 2370 Pro Val Leu Pro Phe Gly Leu Thr Pro Lys Lys Val Tyr Lys Pro Glu 745 750 755 GTG CAG CTC CGG AGG CCA AAC TGG TCC AAG TTT GTG GCT GAG GAC CTT 2418 Val Gln Leu Arg Arg Pro Asn Trp Ser Lys Phe Val Ala Glu Asp Leu 760 765 770 775 TCC CAG GAC TGC TTC TGG ACA AAG GTG AAG GAG GAC CGC TTT GAG AAC 2466 Ser Gln Asp Cys Phe Trp Thr Lys Val Lys Glu Asp Arg Phe Glu Asn 780 785 790 AAT GAA CTT TTT GCC AAA CTT ACC CTT GCC TTC TCC GCC CAG ACC AAG 2514 Asn Glu Leu Phe Ala Lys Leu Thr Leu Ala Phe Ser Ala Gln Thr Lys 795 800 805 ACT TCT AAA GCC AAG AAG GAT CAA GAA GGT GGA GAA GAA AAG AAA TCT 2562 Thr Ser Lys Ala Lys Lys Asp Gln Glu Gly Gly Glu Glu Lys Lys Ser 810 815 820 GTT CAA AAG AAG AAA GTA AAA GAG CTG AAA GTG CTG GAT TCA AAG ACA 2610 Val Gln Lys Lys Lys Val Lys Glu Leu Lys Val Leu Asp Ser Lys Thr 825 830 835 GCG CAG AAT CTC TCA ATC TTT TTG GGT TCA TTC CGC ATG CCC TAT CAA 2658 Ala Gln Asn Leu Se r Ile Phe Leu Gly Ser Phe Arg Met Pro Tyr Gln 840 845 850 855 GAG ATA AAG AAC GTT ATC CTG GAG GTG AAT GAG GCT GTT CTC ACA GAG 2706 Glu Ile Lys Asn Val Ile Leu Glu Val Asn Glu Ala Val Leu Thr Glu 860 865 870 TCT ATG ATC CAG AAC CTC ATT AAA CAG ATG CCA GAG CCA GAG CAG CTA 2754 Ser Met Ile Gln Asn Leu Ile Lys Gln Met Pro Glu Pro Glu Gln Leu 875 880 885 885 AAG ATG CTC TCT GAA CTG AAG GAG GAG TAC GAT GAT CTG GCT GAG TCA 2802 Lys Met Leu Ser Glu Leu Lys Glu Glu Tyr Asp Asp Leu Ala Glu Ser 890 895 900 GAG CAG TTT GGT GTG GTG ATG GGC ACA GTG CCC CGC CTT CGG CCT CGC 2850 Glu Gln Phe Gly Val Val Met Gly Thr Val Pro Arg Leu Arg Pro Arg 905 910 915 CTC AAC GCC ATC CTC TTC AAG CTA CAG TTC AGT GAG CAA GTT GAG AAC 2898 Leu Asn Ala Ile Leu Phe Lys Leu Gln Phe Ser Glu Gln Val Glu Asn 920 925 930 930 935 ATC AAG CCA GAG ATC GTG TCT GTC ACC GCC GCA TGC GAA GAG CTG CGT 2946 Ile Lys Pro Glu Ile Val Ser Val Thr Ala Ala Cys Glu Glu Leu Arg 940 945 950 AAG AGT GAG AAC TTC TCC AGC CTC CTG GAG CTC ACA CTG CTG GTC GGA 2994 Lys Ser Glu Asn Phe Ser Ser Leu Leu Glu Leu Thr Leu Leu Val Gly 955 960 965 AAC TAT ATG AAT GCG GGC TCC AGG AAT GCT GGT GCT TTC GGC TTC AAT 3042 Asn Tyr Met Asn Ala Gly Ser Arg Asn Ala Gly Ala Phe Gly Phe Asn 970 975 980 ATC AGC TTC CTT TGT AAG CTT CGA GAC ACC AAG TCT GCA GAT CAG AAG 3090 Ile Ser Phe Leu Cys Lys Leu Arg Asp Thr Lys Ser Ala Asp Gln Lys 985 990 995 ATG ACT CTG TTG GCT GAG TTA TGT GAG AAT GAC CAC CCC 3138 Met Thr Leu Leu His Phe Leu Ala Glu Leu Cys Glu Asn Asp His Pro 1000 1005 1010 1015 GAA GTC CTC AAG TTT CCT GAT GAG CTT GCC CAT GTA GAG AAA GCC AGC 3186 Glu Val Leu Lys Phe Pro Asp Glu Leu Ala His Val Glu Lys Ala Ser 1020 1025 1030 AGA GTC TCT GCT GAG AAC CTG CAG AAG AGC TTA GAT CAG ATG AAG AAG 3234 Arg Val Ser Ala Glu Asn Leu Gln Lys Ser Leu Asp Gln Met Lys Lys 1035 1040 1045 CAG ATT GCG GAC GTG GAG CGC GAT GTT CAG AAT TTC CCA GCT GCC ACT 3282 Gln Ile Ala Asp Val Glu Arg Asp Val Gln Asn Phe Pro Ala Ala Thr 1050 1055 1060 GAC GAG AAG GAC AAG TTT GTT GAG AAG ATG ACC AGC TTT GTG AAG GAT 3330 Asp Glu Lys Asp Lys Phe Val Glu Lys Met Thr Ser Phe Val Lys Asp 1065 1070 1075 GCA CAG GAA CAG TAT AAC AAA CTA CGG ATG ATG CAC TCC AAC ATG GAG 3378 Ala Gln Glu Gln Tyr Asn Lys Leu Arg Met Met His Ser Asn Met Glu 1080 1085 1090 1095 ACC CTC TAT AAG GAG CTA GGT GAC TAC TTC GTC TTT GAC CCT AAG AAG 3426 Thr Leu Tyr Lys Glu Leu Gly Asp Tyr Phe Val Phe Asp Pro Lys Lys 1100 1105 1110 TTG TCT GTA GAG GAA TTC TTT ATG GAT CTG CAC AAC TTT AGG AAT ATG 3474 Leu Ser Val Glu Glu Phe Phe Met Asp Leu His Asn Phe Arg Asn Met 1115 1120 1125 TTT TTG CAA GCA GTC AAG GAA AAC CAG AAG CGC CGG GA ACA GAA GAA 3522 Phe Leu Gln Ala Val Lys Glu Asn Gln Lys Arg Arg Glu Thr Glu Glu 1130 1135 1140 AAG ATG CGG AGA GCA AAA TTA GCC AAG GAG AAG GCA GAA AAA GAG CGA 3570 Lys Met Arg Arg Ala Lys Leu Ala Lys Glu Lys Ala Glu Lys Glu Arg 1145 1150 1155 CTG GAG AAG CAG CAG AAG CGC GAG CAG CTC ATC GAC ATG AAC GCA GAG 3618 Leu Glu Lys Gln Gln Lys Arg Glu Gln Leu Ile Asp Met Asn Ala Glu 1160 1165 1170 1175 GGG GAT GAG ACA GGT GTG ATG GAC AGT CTT CTA GAA GCT CTG CAG TCA 3666 Gly Asp Glu Thr Gly Val Met Asp Ser Leu Leu Glu Ala Leu Gln Ser 1180 1185 1190 GGG GCA GCA TTC CGA CGG AAG AGA GGG CCC CGG CAG GTC AAC AGG AAG 3714 Gly Ala Ala Phe Arg Arg Lys Arg Gly Pro Arg Gln Val Asn Arg Lys 1195 1200 1205 GCT GGG TGT GCA GTC ACA TCT CTG CTA GCC TCG GAG CTG ACC AAG GAT 3762 Ala Gly Cys Ala Val Thr Ser Leu Leu Ala Ser Glu Leu Thr Lys Asp 1210 1215 1220 GAT GCC ATG GCT CCT GGT CCT GTT AAG GTA CCC AAG AAA AGT GAA GGA 3810 Asp Ala Met Ala Pro Gly Pro Val Lys Val Pro Lys Lys Ser Glu Gly 1225 1230 1235 GTC CCC ACA ATC CTG GAA GAA GCC AAG GAG CTG GTT GGC CGT GCA AGC 3858 Val Pro Thr Ile Leu Glu Glu Ala Lys Glu Leu Val Gly Arg Ala Ser 1240 1245 1250 1255 TAA GCTGGGCTTT ATGGCCATTG CTGCTCCTAG GCGAGATCCAGGCTGACTGCGTGACTGCGTCAGCGTGTCTCTGACTGCGTCAGCGTGTCTGACTGCGTCAGCGTGTGCCTGACTGCGTCAGCGTGTCTGCGAGCTC CCTGCTGCTC TCTGAACACC ACATACAGCT TCAGCTGCCT GGAGGCCAAA 4031 AGGAAGGGGC AGTGTAGGAG TGGCCTGAG C CCAGCCCAGC CAGCCCTGGC TGTTGTATTA 4091 CCAAAGCAGG GTCCGTGTTT GCTGCCTTAA CCCTGTCTCC TCTATGTTAC CCAGAGGTCC 4151 TGGTCTCAGA CAGAACCCAG CCTGCTTTCT CAGCCCCACT CTCTAGTGGG CCTTCCCTAG 4211 GTCAATCTTG CTGCATTTGT GCTTTTCTTT TGTGGTTTCT CTGGCCCTGA GAATAGCATG 4271 GGACTTGTGA ACCTTTGGGC TAGGTCTTTT CACTGCTGTC ACCTCTGCTT TTCCTCCTGG 4331 CAATTATTTA TTACTAGTGC TGTGGCATTG GGAGCTGCTT CTGCAAAGCA GGAAGCAAAT 4391 CCCACCCT 4399

[Brief description of the drawings]

FIG. 1 is a photograph showing the binding of clone 50 and Rho protein in a two-hybrid system. V
al, Asn, WT and Cdc42 are each R
Shown ^are hoA ^Val14 , RhoA ^Asn19 , wild type RhoA and Cdc42Hs. ΔAsn and ΔWT
^Shows a Rho ^Asn19 and wild-type RhoA was truncated at ^{Ala 181.} Lamin and the Lex binding domain not fused to other proteins were used as negative controls. Ala
RhoA ^Val14 truncated at ¹⁸¹ was not used in this experiment because it also bound to the VP16 activation domain not fused to other proteins and showed high LacZ activity.

FIG. 2 is a diagram schematically showing isolated p140mDia. The ORF is indicated by a dotted box. Conversion of nucleotide 87 from T to C and nucleotide 2229 to C
The conversion of nucleotides from T to T was found in 503 and E73 cDNA, respectively. Library a, b
And C are mouse brain library 93630, respectively.
9 (Stratagene), ML3000a (Clontech) and mouse embryo library. E7
Insertion of 9 amino acids was observed in 3 cDNA.

FIG. 3 shows the deduced amino acid sequence of p140mDia. The sequence of the clone obtained by the two-hybrid system is indicated by a thick underline, the repeating structure of the proline-rich region is indicated by a dotted line, and the FH-2 region is indicated by a thin underline. Arrowheads indicate insertions of 9 amino acids.

FIG. 4 shows a schematic structural comparison with p140mDia and other proteins containing the FH region. The sequence of p140mDia was converted to Drosophila diaphanous and S.cerevisiae Bn.
i1p, rat formin, and Drosophila capp
Compared to ucino. The comparison is based on the predicted Rho binding region (Rho
-binding), N-terminal to proline-rich region (poly-p
roline), FH-2 region and proline-rich region to C-terminal region. Amino acid identity is given in%. No homology was observed between the N-terminal regions of formin and cappuccino (indicated by *). All the sequences shown have a polyproline stretch in the middle and homology in the C-terminal half.

FIG. 5: RNA showing the tissue distribution of p140mDia in various mouse tissues by Northern blotting.
It is a blot (electrophoresis photograph). heart: heart, lung: lung, brain: brain, k
idney: kidney, testis: testicle, skelet
al muscle: skeletal muscle, thymus: thymus, s
pleen: spleen, liver: liver, stomac
h: stomach, small intestine: small intestine, co
lon: colon.

FIG. 6 is an electrophoretic photograph showing the specificity of the anti-p140mDia antibody. The antiserum (AP50) was directed against the peptide encoded by clone 50 obtained in the two-hybrid system, and its specificity was determined by recombining the pre-induction (lane 1) and post-induction (lane 2) recombinant proteins with IPTG. All lysates of E. coli expressing, or Swiss 3T3 cells (3T3c
lls) was examined by Western blotting on all lysates (lane 3). Lane 4 shows the whole cell lysate stained with CBB.

FIG. 7. p1 by GTPγS-linked Rho protein
It is an electrophoresis photograph which showed sedimentation of 40mDia. Sw
All lysates of the iss 3T3 cells were converted to GTPγS-bound or GDP-bound GST-Rho, GST-R
Incubated with ac, GST-Cdc42 or GST. The bound protein was precipitated with glutathione agarose beads and analyzed by immunoblotting using an anti-p140mDia antibody. Lane 9
(Cell lysates) contains p14 in all lysates of the cells.
0 mDia was detected with the antibody.

FIG. 8 is an electrophoresis photograph showing the binding of p140mDia and profilin in vitro. Swiss 3
T3 cell lysates are incubated with agarose beads conjugated (immobilized) with profilin or BSA in the presence or absence (none) of GTPγS- or GDP-bound GST-Rho protein to precipitate bound proteins. Was. Sediment (Pell
et) and the supernatant (Supernatant) are anti-p140mDi
The antibody a was analyzed by immunoblotting.

FIG. 9: RhoA at the membrane raffle of expanded fibroblasts
1 is a photograph (photograph of the form of an organism) showing the co-localization of p140mDia and profilin. (AD) HT1
080 human fibrosarcoma cells. (E and F) Swiss 3T
3 mouse fibroblasts. Cells are cultured, fixed, and anti-p14
0mDia antibody (A and E), anti-RhoA polyclonal antibody (C) or mouse anti-profiling monoclonal antibody (B and D) or rhodamine-phalloidin (F)
Cells were simultaneously stained with either and standard fluorescence micrographs were taken.

FIG. 10. Myc-labeled RhoA, p140m in membrane raffles of expanded sMDCK cells stimulated with PMA.
It is a photograph (photograph of a form of an organism) showing co-localization of Dia and profilin. Resting (A-)
C) or fix sMDCK cells (PMA stimulation) stimulated with phorbol myristate acetate (DH),
Staining was performed with anti-p140mDia antibodies (B, E and H) or monoclonal anti-myc antibodies (C, F). H was preabsorbed with excess recombinant peptide (preabs
orbed) Staining with anti-p140 antiserum is shown. A, D and G have a phase contrast microscope
Shows a micrograph of each cell taken using. A, B, and C are from the upper left of the photograph, D, E, and F are from the middle left of the photograph, and G and H are from the lower left of the photograph.

FIG. 11: p140mDi in the dividing furrow of dividing cells
It is a photograph (photograph of the form of a living thing) which showed concentration of a. A
And B: Swiss 3T3 cells, C and D: He
La cells. Exponentially growing cells stained with anti-p140 mDia antibody (anti-p140) (A and C)
And simultaneously stained with DAPI (B) or 2H11 monoclonal anti-profilin antibody (D) (anti-profilin) were photographed with a standard fluorescence microscope.

FIG. 12. RhoA and p1 appeared in a Rho-dependent manner around beads coated with fibronectin
It is a photograph showing a 40 mDia cluster. Swiss 3T3 cells cultured for 48 hours were used. Cells are seeded and fibronectin (FN-coated) (a, b) or poly-L-lysine (PLL-coated) (c and d)
And incubated for 15 minutes with latex beads coated with. After fixation, the cells were fixed with an anti-p140 mDia antibody (anti-p140) (a, c) or an anti-Rho antibody (anti-p140).
-Rho) (b, d).

FIG. 13 is a photograph showing the transient expression of p140mDia in COS-7 cells. C14 cells are p14
0 mDia expression vector alone (A and B) or C
The cells were transfected with three extracellular enzyme expression vectors alone (C and D). Transfection of C3 extracellular enzyme was performed with a C3 extracellular enzyme expression-like vector having a FLAG epitope. Fix cells, anti-p140m
The dia antibody (anti-p140) alone (A and C) or simultaneously with actin is converted to rhodamine-phalloidin (phalloid).
in) Staining (B, D).

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁶ Identification code Agency reference number FI Technical indication location C12N 5/10 C12P 21/02 C 15/09 ZNA 21/08 C12P 21/02 G01N 33/53 D 21/08 Z G01N 33/53 33/566 C12N 5/00 B 33/566 9282-4B 15/00 ZNAA // (C12N 1/19 C12R 1: 645) (C12N 1/21 C12R 1: 185) (C12N 5/10 C12R 1:91) (C12P 21/02 C12R 1: 185) (C12P 21/02 C12R 1: 645) (C12P 21/02 C12R 1:91)

Claims (27)

[Claims] 1. A protein or a derivative thereof having an active Rho protein binding ability and a profilin binding ability. 2. A protein or a derivative thereof having an active Rho protein binding ability and having a poly-proline region. 3. The protein or derivative thereof according to claim 1, which has an FH2 region. 4. The protein according to claim 1, which is derived from a mammal, or a derivative thereof. 5. The protein or its derivative according to claim 4, which is derived from a mouse. 6. The protein or derivative thereof according to claim 5, which has a molecular weight of about 160 kDa as measured by SDS-PAGE. 7. The protein or a derivative thereof according to claim 1, which comprises the amino acid sequence of SEQ ID NO: 1. 8. An amino acid sequence of SEQ ID NO: 1 wherein one or more amino acid sequences are added and / or inserted, and / or one or more amino acids of the amino acid sequence of SEQ ID NO: 1 are substituted and / or deleted. A protein according to claim 7 or a derivative thereof. 9. The protein or derivative according to claim 8, which has the amino acid sequence of positions 63 to 260 of SEQ ID NO: 1 and the amino acid sequence of positions 571 to 737 of SEQ ID NO: 1. 10. A protein comprising the amino acid sequence of SEQ ID NO: 1 or a derivative thereof. 11. A nucleotide sequence encoding the protein or a derivative thereof according to claim 1. 12. The base sequence according to claim 11, which has a part or all of the DNA sequence of SEQ ID NO: 2. 13. A part of the nucleotide sequence corresponding to 94 to 94 of SEQ ID NO: 2
The base sequence according to claim 12, which is a DNA sequence at positions 3861, 280 to 873, and 1804 to 2304. 14. A vector comprising the nucleotide sequence according to any one of claims 11 to 13. 15. The vector according to claim 14, which is selected from the group consisting of a plasmid vector, a virus vector, and a liposome vector. 16. A host cell transformed with the vector according to claim 14 or 15 (however, in the case of a human cell, it is limited to a cell isolated from a human). 17. Escherichia coli, yeast, insect cells, COS cells,
17. The host cell according to claim 16, wherein the host cell is selected from the group consisting of lymph cells, fibroblasts, CHO cells, blood cells, and tumor cells. 18. A method comprising culturing the host cell according to claim 16 or 17, and isolating the protein according to claim 1 or a derivative thereof from the culture. A method for producing the protein or a derivative thereof according to any one of claims 1 to 10. (1) A substance to be screened is present in a screening system containing an active Rho protein and the protein or a derivative thereof according to any one of (1) to (10), and 2) Active Rh
An active Rho protein, comprising measuring the degree of inhibition of binding between the o-protein and the protein or a derivative thereof according to any one of claims 1 to 10. A method for screening a substance that inhibits binding to a protein or a derivative thereof described in the above section. (20) A substance to be screened is present in a screening system containing profilin and the protein or a derivative thereof according to any one of (1) to (10), and (2) Measuring the degree of inhibition of the binding of profilin to the protein or derivative thereof according to any one of claims 1 to 10,
A method for screening a substance that inhibits binding between profilin and the protein or a derivative thereof according to any one of claims 1 to 10. 21. The screening method according to claim 19, wherein the screening system is a cell line or a cell-free system. 22. An antibody against the amino acid sequence of positions 63 to 260 of SEQ ID NO: 1. 23. The method according to claim 22, which is a polyclonal antibody.
The antibody according to 1. [24] a protein which is recognized by the antibody according to [22] or [23]; 25. The protein according to claim 1, which is recognized by the antibody according to claim 22 or 23, or a derivative thereof. 26. (1) The substance to be detected is defined by claim 2
24. A substance to be detected, which is present in a detection system containing the antibody according to 2 or 23, and (2) a substance to be detected and a substance to be detected.
Measuring the degree of reaction with the antibody according to 3.
A method for detecting a substance that reacts with the antibody. 27. A kit for detecting a substance recognized by the antibody, comprising the antibody according to claim 22 or 23.