JPH10338637A - Preventive or therapeutic agent for disease participating with lowering of nos function - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject medicine useful for prevention or treatment for hypertension or nephropathy and the like by formulating a specific compound thereto. SOLUTION: The objective medicine for preventing or treating diseases accompanied with lowering of endogenous NO production, diseases accompanied with lowering of function in Golgi type II neuron and diseases participating with decrease of NOS revelation is obtained by mixing a compound [e.g. (6R)-L- erythro-5,6,7,8-tetrahydrobiopterines] of the formula [R<1> and R<2> are each H or the like; R<3> is -CH(OH)CH(OH)CH3 or the like] or its pharmaceutically permissible salt, a usual carrier (starch, polyvinyl pyrrolidone, etc.) and an oxidation inhibitor (ascorbic acid, N-acetyl cystein, etc.). This medicine is administrated at a dose of 0.1-50 mg/kg (weight)/day once or 2-4 times a day, for example, in order to treat hypertension.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a compound of the formula (I):

Embedded image [Wherein, R ¹ and R ² each represent a hydrogen atom,
Or together represent a single bond, and when R ¹ and R ² represent a hydrogen atom, R ³ represents —CH (OH) CH (O
_{H) CH 3, -CH (OCOCH} 3) CH (OCOC
H ₃ ) represents CH ₃ , —CH ₃ , —CH ₂ OH or a phenyl group, and when R ¹ and R ² together represent a single bond, R ³ represents —COCH (OH) CH ₃ And a pharmaceutically acceptable salt thereof as an active ingredient, for preventing and / or treating a disease to which a decrease in NOS function contributes.

[0002]

BACKGROUND OF THE INVENTION It has been known that the vascular endothelium plays an important role in the formation of vascular tonus and thrombus.
In 980, the first endothelium-derived relaxing factor (endothel)
ium-derived relaxing fact
or: EDRF) was reported. Then 198
In seven years, the body of the EDRF was proven to be nitric oxide (NO). NO means that L-arginine is oxidized and N
It is produced when ^G -hydroxyl-L-arginine is converted to L-citrulline, and its reaction is based on NO synthase (NOs
ynthase (NOS). NOS is present in a wide range of vascular endothelium, nervous system, kidney, platelets, myocardium, smooth muscle, etc.
Has a versatile effect and therefore plays an important role in the regulation of circulation throughout the body. Diseases in which decreased production of NO is recognized include hypertension, hyperlipidemia, arteriosclerosis, ischemic heart disease, heart failure, cardiovascular diseases such as thrombosis, asthma, chronic obstructive pulmonary disease, pulmonary hypertension, and ARDS. Respiratory diseases, liver disorders, cirrhosis, gastrointestinal mucosal disorders, digestive disorders such as hypertrophic pyloric stenosis, pancreatitis, cerebral ischemia, cerebral infarction, cerebral circulatory insufficiency, cerebrovascular disorders such as senile dementia, renal disorders, impotence And other gynecological diseases such as renal and urinary disorders, preeclampsia, and other infectious diseases.
Many diseases, such as immunological diseases, diabetes, and burns, in which a decrease in NO production is recognized as a drug, are known. NO
For S, the gene was cloned and structural analysis was performed. As a result, calmodulin (CaM), flavin, and NADPH were used as coenzymes in the NOS gene.
In addition to the binding site of the formula (I),
(6R) -L-erythro-5, contained in the compound of
6,7,8-tetrahydrobiopterin (hereinafter referred to as “BH
4 "). Furthermore, it has been suggested that BH4 actually participates in NOS function control.

On the other hand, it has been reported that intravenous injection of NOS inhibitors into experimental animals increases blood pressure (Sak).
uma I. et al. Circ. Res. 70: 6
07-611, 1992). Furthermore, there is a report that endogenous NO production is decreased in hypertensive model animals such as DOCA-salt hypertensive rats, SHR-SP rats, Dahl-S rats, and Goldblatt hypertensive rats.

[0004] However, the cause of reduced NO production in these model systems has not been clarified. Also, there are many reports that NO production is rather enhanced in spontaneously hypertensive rats (SHR) which are frequently used as a model animal for hypertension (Dominizak AF et al., Hy).
pertension25: 1202-1211,19
95). In the case of SHR, NO is excessively released in a hypertensive state to reduce blood pressure, but the action of NO can be considered to be insufficient (Nava E).
Et al., Circulation 92: I-347, 199.
5). That is, although the relationship between NO and hypertension has been pointed out, the relationship between NOS activity and hypertension has not always been clarified. Furthermore, it is possible that the decrease in the vasorelaxant response in hypertension may be related to a decrease in the endothelium-derived hyperpolarizing factor (EDHF) response and an increase in the endothelium-derived vascular substance (EDCF), whose nature is still unknown. .

As described above, conventionally, the vasorelaxant action of NO,
In addition, knowledge of NOS function control by BH4 has been obtained to some extent. However, the cause of the decrease in NO production and the relationship between NOS activity and hypertension have not been elucidated, and, of course, the relationship between hypertension and BH4 in a living body and, of course, the antihypertensive effect of BH4 have not been known.

In many industrialized countries, cardiovascular disease is the most common cause of death. Various drugs such as antihypertensives, hyperlipidemia, diuretics, vasodilators, and antiplatelet drugs have been used clinically, but many aim to improve indicators such as blood pressure and cholesterol. From the viewpoint of prevention of onset, suppression of deterioration and progression, and long-term prognosis, there are many unsolved parts. In recent years, from the molecular level of vascular diseases related to the above diseases, a therapeutic strategy for treating blood vessels such as endothelial cells as a place of treatment has been considered. It has been proposed that regulation of production or application of substances having antioxidant activity is one of the most promising treatments (Gibbons, GH, Dzau, VJ, Science. Vol.
272, 689-693, 1996). However, no drug or treatment has yet been established to satisfy this treatment strategy.

[0007] Among these diseases, nitrates (such as nitroglycene preparations) have been conventionally effective as an exogenous NO donor for the treatment of angina pectoris and heart failure.
In long-term continuous use, there is a problem of tolerance.
In other words, a thiol group (SH group) is indispensable for producing NO from a nitrate,
This SH group is depleted. Furthermore, metabolic enzymes are required for NO generation, and other NO-related substances such as nitrosothiol are generated during the reaction.
It is conceivable to disrupt the balance of other biological substances. Also, new types of NO donors having the properties of β-blockers and K ⁺ channel openers have been developed, but these do not depart from the above-mentioned NO donors. Therefore, from the viewpoint of prevention of onset, suppression of deterioration / progression, and long-term prognosis, maintenance and activation of endogenous NO function and improvement of endothelial cell function are considered to be the most ideal treatment methods.

From this viewpoint, spontaneous NO production in a living body, that is, activation of NOS is considered to be the most excellent method, and L-arginine, a substrate of NOS, has been used until now. The effects have been studied in the following diseases. For example, hypertension (Higashi, Y. et al., Hypertensi
on 1995, 25, 898-902), angina pectoris (Egashira, K. et al., C
irculation 1996, 94, 130-134), heart failure (Rector T.
S. et al., Circulation 1996, 93, 2135-2141).

However, acetylcholine reduces endothelium-dependent vasodilator response, a model in which renal NO production is reduced by basal and endothelin receptor (ET _B ) stimulation (Hirata Y, Hayagawa H, 0).
meta M et al .: Circulation 1995:
91: 1229-1235),
It has been reported that long-term administration of L-arginine restores endothelium-dependent vasodilation and renal NO production in DOCA-salt hypertensive rats, but their effects are partial (Hayakawa H, Hirata Y, Oma).
ta M et al .: Hypertension 1994: 2.
3: 752-756). In addition, L-
Administration of arginine causes a decrease in blood pressure as in normal subjects, but increases in renal blood flow, decreases in filtration fraction, and
It was reported that renal vascular resistance was not attenuated, and blood cGMP was significantly reduced in hypertensive patients (Higas
hiY. 0hshima T, Kajiyama G
Et al .: Hypertension 1996: 25: 89.
8-902). These facts suggest that there is insufficient NO production in the renal circulation irrespective of the amount of the substrate L-arginine, and that the activity of NOS as an enzyme is not merely reduced. That is, L
-The involvement of arginine-NO system in circulatory regulation and the mechanism of decrease of endothelium-dependent vasodilation cannot be explained by impairment or lack of L-arginine as a substrate. It is a situation that requires further investigation.

[0010] The purpose of hypertension treatment is to prevent cardiovascular complications caused by hypertension, prolong the life of the patient, and lead a fulfilling life. This requires long-term, long-term control of blood pressure, and long-term drug therapy with antihypertensive drugs on the basis of general therapies such as salt reduction, correction of obesity, and exercise. .

At present, thiazide diuretics, β-blockers, Ca antagonists, angiotensin converting enzyme (ACE)
Inhibitors, alpha ₁ blockers have been used in the treatment as the main antihypertensive agents. However, these drugs do not satisfy all of the following conditions as desirable antihypertensive agents, and are considered to have advantages and disadvantages.

Desirable conditions for the antihypertensive agent are as follows: The effect is mild and the effect is stable. 2. There are few side effects at the beginning of use. 3. The effect on the circulatory dynamics and organ functions is in a desired direction. 4. Long-term use does not adversely affect, but rather improves, cardiovascular risk factors. 5. Improve patient compliance with treatment. 6. There are no complications or contraindications for accidental use. 7. A more fulfilling life can be expected by treatment.

[0013] Specifically, the antihypertensive currently used has the following problems.

[0014] The thiazide diuretic is a good indication when salt restriction is difficult to maintain or when there is a tendency to retain body fluid. However, dysglycemia, hyperuricemia, renal dysfunction, hyperlipidemia, It is said that it is better not to administer to patients with K-bloodemia.

[0015] The β-blocker is suitable for administration to young people or those who have a tendency to tachycardia. Patients with bronchial asthma or chronic obstructive pulmonary disease or patients with obstructive lesions in the peripheral arteries It is believed that it is safer to avoid using it for patients with Raynaud's symptoms. In addition, it also affects insulin secretion, and thus has a drawback that it is difficult to use it for hypertensive patients with diabetes.

As a side effect of the Ca antagonist, dihydropyridine derivatives include flushing of the face and headache due to vasodilatory action, and may cause hypotension, dizziness, tachycardia and palpitations due to reflex sympathetic tone due to strong hypotensive action.

[0017] Side effects of ACE inhibitors include orthostatic hypotension, dry cough, angioedema and hyperkemia. Since it is mainly excreted from the kidney, the dose and high K
Beware of blood. In addition, fetal disorders have been reported, some of which are contraindicated in pregnant women.

Care must be taken not to cause side effects such as orthostatic hypotension with α ₁ blockers.

As described above, there are a large number of drugs having various actions as antihypertensive drugs. However, drugs which are still fully satisfied with respect to side effects, safety for long-term continuous use, and improvement of QOL. At present, it does not exist. In addition, hypertension treatment is aimed at preventing the development of organ disorders due to hypertension, which is its primary goal, to reduce the incidence of heart failure, renal failure, stroke, and the likelihood of mortality, and certainly lowers blood pressure. Although drug therapy has been shown to improve heart failure and stroke mortality, it does not prevent an increase in patients with renal failure due to hypertension. In acute or chronic glomerulonephritis, etc., hypertension is caused by glomerular disorders. Prognosis is poor in chronic glomerulonephritis with hypertension, and the presence of hypertension has also been shown to be an independent prognostic factor in chronic glomerulonephritis. However, treatment for hypertension associated with chronic glomerulonephritis has not been established.

[0020] As described above, there is a demand for a therapeutic agent having truly desirable conditions, and in particular, development of a drug having a renal protective effect has been desired.

The compound of the formula (I), which is an active ingredient of the therapeutic agent of the present invention, is a known compound, and is known for use as a therapeutic agent for malignant hyperphenylalaninemia, depression, Parkinson's disease, and the like. I have. For example, JP-A-59-2
No. 5323, No. 59-76086, No. 61-
See 277618 and 63-267781.

[0022]

DISCLOSURE OF THE INVENTION The present invention is intended to improve the circulatory dynamics and organ functions by inhibiting endogenous NO production and controlling endothelial cell function for diseases in which NOS function is reduced. An object of the present invention is to provide a safe therapeutic agent without side effects in order to suppress the progress of the disease and enhance the quality of daily life of the patient.

[0023]

As a result of various studies, the present inventors have hypothesized that BH4 levels may be reduced in diseases to which NOS function is reduced. Thus, administration of BH4 to DOCA-salt hypertensive rats and DOCA-salt SHR was attempted. As a result, in the DOCA-salt hypertensive rat, it was confirmed that the BH4 level was actually reduced, and more surprisingly, the NOS expression level was also reduced. It has been found that an extremely natural and excellent blood pressure increase suppressing effect can be obtained. Also, D
The OCA-salt SHR also confirmed that BH4 levels actually decreased, and further histopathologically confirmed necrotizing glomeritis and necrotizing vasculitis. The present inventors have found that a remarkable improvement effect of the above-mentioned histopathological findings can be obtained by the endothelial cell function-regulating effect, and it has been found that BH4 has a NOS function activating effect, thereby completing the present invention.
That is, the present invention relates to an effective treatment of a disease to which a decrease in NOS function contributes by using a BH4 preparation.

Accordingly, the present invention provides a compound of formula (I):

Embedded image [Wherein, R ¹ and R ² each represent a hydrogen atom,
Or together represent a single bond, and when R ¹ and R ² represent a hydrogen atom, R ³ represents —CH (OH) CH (O
_{H) CH 3, -CH (OCOCH} 3) CH (OCOC
H ₃ ) represents CH ₃ , —CH ₃ , —CH ₂ OH or a phenyl group, and when R ¹ and R ² together represent a single bond, R ³ represents —COCH (OH) CH ₃ Or a pharmaceutically acceptable salt thereof as an active ingredient, for preventing or treating a disease to which NOS function is reduced.

In the present specification, NOS dysfunction refers to NOS that widely exists in the vascular endothelium, nervous system, kidney, platelets, myocardium, smooth muscle, etc., whose expression is reduced or expressed for some reason. This also means that NOS activity is not exerted due to a decrease in the function of these cells.
A typical example of reduced NOS function is a reduced level of endogenous NO. Diseases to which NOS dysfunction contributes include NO
Includes diseases that develop due to the decrease in S function, diseases in which the decrease in NOS function worsens the symptoms, and diseases in which the decrease in NOS function delays healing, such as hypertension, hyperlipidemia,
Arteriosclerosis, coronary vasospasm, ischemic heart disease, heart failure, thrombosis, pulmonary hypertension, cerebral circulatory insufficiency, cerebral vasospasm, glomerulonephritis,
If NOS function contributes to chronic renal failure, diabetes, postoperative restenosis, achalasia, portal hypertension, liver disorder, gastrointestinal mucosal disorder, hypertrophic pyloric stenosis, enteritis, impotence, chorioretinopathy, etc. Is mentioned.

BH4, when administered to patients with these diseases, stimulates NOS production in the body or restores reduced endothelial cell function by reducing NOS.
Function can be normalized to prevent or treat these diseases.

Therefore, the subject to be treated or prevented according to the present invention is a disease which can be treated by the function activating effect of NOS by BH4.

The compounds of formula (I) which are active ingredients according to the invention include the following and their pharmaceutically acceptable salts: (6R) -L-erythro-5,6,6
7,8-tetrahydrobiopterin (BH4)

Embedded image (6R, S) -5,6,7,8-tetrahydrobiopterin 1 ′, 2′-diacetyl-5,6,7,8-tetrahydrobiopterin

Embedded image Sepiapterin

Embedded image 6-methyl-5,6,7,8-tetrahydropterin

Embedded image 6-hydroxymethyl-5,6,7,8-tetrahydropterin

Embedded image 6-phenyl-5,6,7,8-tetrahydropterin

Embedded image Among the above compounds, a preferred compound is 5,6,7,8-tetrahydrobiopterin or a salt thereof, and the most preferred compound is BH4 or a salt thereof.

Formula (I) used as an active ingredient in the present invention
The compound represented by is a known compound. For example, JP-A-59-25323, JP-A-59-76086,
See JP-A-61-277618 and JP-A-63-2677781. These may be used as appropriate salts, such as pharmacologically non-toxic acids such as hydrochloric acid,
Examples thereof include salts with mineral acids such as phosphoric acid, sulfuric acid and boric acid, and organic acids such as acetic acid, formic acid, maleic acid, fumaric acid and mesylic acid.

The drug of the present invention is effective for the above-mentioned diseases. For example, in the case of hypertension, not only essential hypertension but also malignant hypertension which causes abrupt progression and causes necrosis of small artery walls such as kidneys and retina, and renal hypertension with renal impairment are targets. Specifically, it is effective for all of essential hypertension, renal hypertension, renal vascular hypertension, pregnancy hypertension, senile hypertension, and adrenal hypertension.

The therapeutic agent of the present invention is obtained by administering a compound represented by the formula (I) to a carrier used in a general pharmaceutical preparation, orally, rectally or parenterally (intravenously, into cerebrospinal fluid by a conventional method). In the form of a formulation suitable for administration.

The carrier used in these pharmaceutical preparations depends on the dosage form used, but generally includes excipients, binders, disintegrants and the like.

Representative examples of excipients include starch, lactose,
There are sucrose, glucose, mannitol, cellulose, etc.
Examples of the binder include polyvinylpyrrolidone, starch, sucrose, hydroxypropylcellulose, and gum arabic. Examples of disintegrants include starch, agar, gelatin powder, cellulose, CMC, and the like, but any other commonly used excipients, binders, and disintegrants may be used.

The therapeutic agent of the present invention preferably contains an antioxidant for stabilizing the active ingredient, in addition to the above-mentioned carrier. The antioxidant is appropriately selected from those generally used in pharmaceutical preparations, and examples include ascorbic acid, N-acetylcysteine, L-cysteine, dl-α-tocopherol, natural tocopherol and the like. The amount used may be any amount that stabilizes the active ingredient (one or more), but is generally preferably from 0.2 to 2.0 by weight based on 1 active ingredient.

The formulations of the present invention suitable for oral administration include tablets, each containing a predetermined amount of the active ingredient (s),
It may be presented as a sublingual tablet, capsule, powder, powder, granules or granules, or as a suspension in non-aqueous liquids such as syrups, emulsions or lozenges.

For example, granules are prepared by uniformly mixing an active ingredient (one or more) with one or more of the above-mentioned carriers, auxiliary ingredients such as antioxidants, granulating the mixture, and using a sieve to mesh. It is provided by aligning. Tablets
The active ingredient (s) can be prepared by compression or molding, optionally with one or more accessory ingredients. Capsules are made by filling a powder or granules of the active ingredient (one or more), optionally with one or more accessory ingredients, into a suitable capsule, using a filler or the like. Formulations for rectal administration include:
It can be provided as a suppository using a conventional carrier such as cocoa butter. Formulations for parenteral administration may be provided by sealing the active ingredient (one or more) as a dry solid in a sterile nitrogen purging container. At the time of parenteral administration, the dried solid preparation can be dispersed or dissolved in a predetermined amount of sterile water and administered to a patient.

In the preparation of these preparations, it is preferable to add the above-mentioned antioxidants in addition to the active ingredient and the usual carrier, and to further prepare a buffer, a flavoring agent, if desired.
1 selected from surfactants, thickeners, lubricants, lubricants, etc.
It may further contain one or more auxiliary components.

The dosage of the active ingredient, ie the compound of formula (I), will, of course, vary with the route of administration, the condition being treated and the patient being treated, but will ultimately result in a physician. It is left to the judgment of.

For example, a suitable dose for treating hypertension is in the range of 0.1 to 50 mg / kg (body weight) / day, with a typical preferred dose being 0.5 to 10 mg / kg (body weight). ) / Day.

The desired dosage may be such that the above-mentioned active ingredient may be administered once a day, or may be administered in 2 to 4 divided doses at appropriate intervals throughout the day.

The active ingredient may be administered alone or as it is without being mixed with other ingredients. However, for the purpose of facilitating the adjustment of the dose, other active ingredients corresponding to the disease to be applied may be used as pharmaceutical preparations. Can also be administered.

The preparation of the present invention may contain, as an active ingredient, a compound represented by the formula (I) together with a NOS substrate or a coenzyme or cofactor such as L-arginine, flavins (eg, FAD, FMN, etc.). ) And calcium may be contained as an auxiliary active ingredient. By mixing these active ingredients, a more excellent therapeutic effect can be expected as compared to the case where the compound represented by the formula (I) is used alone. The ratio of each of the above components in the preparation of the present invention is not particularly limited, and for example, at least one selected from the group consisting of L-arginine, flavins and calcium with respect to 1 of the compound represented by the formula (I) by weight. One type can be in the range of 0.1 to 10, preferably in the range of 0.5 to 2.

An appropriate dose for treating the hypertension with this mixed preparation is, for example, 0.1% as the total amount of the active ingredients.
It is in the range of 1-50 mg / kg (body weight) / day, preferably 0.5-10 mg / kg (body weight) / day.

In the treatment, the selection of a preparation containing the compound represented by formula (I) alone as an active ingredient and a preparation containing another active ingredient together with the active ingredient is appropriately selected by a doctor according to age, symptoms, and the like.

The active ingredient used in the present invention is (6R)
-L-erythro-5,6,7,8-tetrahydrobiopterin (BH4) and its salts are most preferred, but (6
(R, S) -5,6,7,8-tetrahydrobiopterin, 1 ′, 2′-diacetyl-5,6,7,8-tetrahydrobiopterin, sepiapterin, 6-methyl-5
6,7,8-tetrahydropterin, 6-hydroxymethyl-5,6,7,8-tetrahydropterin or 6
Similar compounds such as -phenyl-5,6,7,8-tetrahydropterin and salts thereof may be used. However, it goes without saying that BH4, which is a natural substance existing in the living body, is preferable. The acute toxicity of this BH4 dihydrochloride to rats is 2 g / kg (body weight) or more by oral administration, and almost no toxicity is found. In addition, (6R, S) -5,6,7,8-tetrahydrobiopterin, which is not an optically active substance, also has low toxicity, as seen in the treatment of Parkinson's disease described in JP-A-59-25323. It can be used for treatment. Compounds belonging to formula (I) other than these have almost no acute toxicity.

The present invention will be described in more detail with reference to the following Examples, but the present invention is not limited to these Examples.

[0047]

【Example】

Example 1 (granules, fine granules) 1 part (parts by weight) of polyvinylpyrrolidone (Korydone 30)
Was dissolved in sterile purified water, and 10 parts of ascorbic acid and 5 parts of L-cysteine hydrochloride were added to make a uniform solution. Then, 10 parts of BH4.2 hydrochloride was added to make the solution uniform. This solution was added to 59 parts of an excipient (mannitol or lactose) and 15 parts of a disintegrant [corn starch or hydroxypropylcellulose (LH-22)], kneaded, granulated, dried and then sieved.

Example 2 (Tablets) After 58 parts of lactose and 15 parts of microcrystalline cellulose were mixed with the homogeneous solution of the active ingredient prepared in Example 1, 1 part of magnesium stearate was further added and mixed, followed by tableting.

Example 3 (Capsule) The capsule of the dosage form prepared in Example 1 was filled.
However, 0.2% of magnesium stearate as a lubricant
What was added and formulated was used.

Example 4 (Injection) BH4.2 dihydrochloride 1.5 g Ascorbic acid 1.5 g L-cysteine hydrochloride 0.5 g mannitol 6.5 g The above components were dissolved in sterile purified water, and the mixture was disinfected to 100 ml to remove bacteria. Each 1 ml or 2 ml was placed in a vial or ampoule and freeze-dried and sealed.

Example 5 (Injection) 2.0 g of BH4.2 dihydrochloride was dissolved in sterile purified water without oxygen to make 100 ml of the solution, and the solution was sterilized and sealed in the same manner as in Example 4.

Example 6 (suppository) 150 parts of BH4.2 dihydrochloride 150 parts of ascorbic acid 50 parts of L-cysteine hydrochloride The above components were made into a uniform powder, and cocoa butter 99 was used.
Dispersed in 50 parts.

Example 7 (Granules) BH4.2 dihydrochloride 5 parts Ascorbic acid 5 parts L-cysteine hydrochloride 2 parts A uniform solution was prepared using the above components. On the other hand, 55 parts of mannitol, 1 part of polyvinylpyrrolidone, 14 parts of hydroxypropylcellulose, and 5 parts of L-arginine or calcium were uniformly mixed with the above solution, kneaded, granulated, dried, and sieved. .

Example 8 (Granules) BH4.2 dihydrochloride 5 parts Ascorbic acid 5 parts L-cysteine hydrochloride 5 parts Mannitol 52 parts Polyvinylpyrrolidone (Korydone 30) 1 part Hydroxypropyl cellulose (LH-22) 12 parts 10 parts of L-arginine or calcium Granulated and sieved in the same manner as in Example 7 using the above components.

Example 9 (Granules) BH4.2 dihydrochloride 5 parts Ascorbic acid 5 parts L-cysteine hydrochloride 2 parts A homogeneous solution was prepared using the above components. On the other hand, the solution is kneaded, granulated, and dried by uniformly mixing 10 parts of L-arginine or calcium, 50 parts of mannitol, 1 part of polyvinylpyrrolidone (colydone 30) and 9 parts of hydroxypropylcellulose (LH-22). And then sieved.

Example 10 Preparation of DOCA-salt hypertensive rats 8-week-old Sprague-Dawley rats (Cha
One nephrectomy (except for the control group) was performed at the same time. Thereafter, the following three experimental groups were compared and studied. 1) Group receiving only drinking water (control group) Number of subjects n = 3 2) One week after one-nephrectomy, deoxycorticosterone acetate (DOCA) 30
mg / kg body weight subcutaneously once a week, 1% saline was given, and a group of DOCCA-salt hypertensive rats was prepared (DOC
A group) n = 6 3) DOH-salt hypertensive rats were given BH4 (10 mg).
/ Kg body weight / day) orally (DOCA + BH4)
Group) n = 5 Each group was observed until the 5th week of the end of the experiment. At the start of the experiment, two weeks, four weeks, and five weeks (at the end of observation), urine was collected from the metabolic cage for 24 hours. At the end of the observation, blood was collected from the abdominal aorta under phenobarbital anesthesia, and then the kidney was perfused with physiological saline and extracted, and histological examination and immunohistological examination were performed.

Blood pressure measurement Blood pressure was measured by the tail-cuff method at the beginning of the experiment, two weeks later,
Measurements were taken after 5 and 5 weeks.

Measurement of NO ₂ / NO _{3 in} urine Cyman Chemical based on the Griess method
Company's Nitrate-Nitrite
The measurement was performed using an assay kit, kit No. 780001. The larger the value of in NO ₂ / NO ₃ urine NOS
Means high activity.

Urinary BP Measurement The method of Fukushima and Nixon (Anal. B
HPLC analysis based on iochem. 102; 176-188, 1980) to measure biopterin (BP), a metabolite of BH4. The effect of BH4 administration on the change in urinary BP will be discussed.

Renal tissue NOS immunostaining The resected kidney tissue was frozen, and endothelial NOS (E-NOS) and brain NOS (B-
NOS) expression, an antibody specific to each of them, anti-E-NO
S antibody and anti-B-NOS antibody (Affinity B
(obtained from ioreagents).

Measurement of NOS mRNA Expression a) Extraction of Total RNA from Kidney Tissue RNA was extracted from kidney tissue by a guanidium / cesium chloride extraction method. Specifically, first, a small amount of tissue was collected from the cortex of the resected kidney, and immediately a 4M guanidinium thiocyanate (Guanidinium thiocyanate) was dissolved.
cyanate) and crushed with a glass / Teflon homogenizer. This cell lysis solution was layered on 5.7 M cesium chloride and centrifuged at 80,000 rpm for 2 hours.
Thereafter, the precipitate was washed with 0.1% diethyl pyrocarbonate (D
Dissolved in EP) solution. 2.5 M ammonium acetate and ethanol were added thereto, and the mixture was precipitated at −20 ° C. for 1 hour, and centrifuged at 10,000 rpm at 4 ° C. for 20 minutes to obtain a precipitate. 0.1% of the precipitate to a concentration of about 1 μg / μl
It was dissolved in a DEP solution and stored at −20 ° C. until use.

B) Reverse transcriptase (RT) reaction cDNA was synthesized from total RNA using MoMLV reverse transcriptase. Specifically, a sample in which total RNA, a primer, a buffer, and H ₂ O were mixed was heated at 95 ° C. for 2 minutes, and then ice-cooled. Then, keep the temperature at 37 ° C for 30 minutes,
Annealed to NA. This was supplemented with 0.2 M dithiothreitol (DTT), 5 mM deoxyribonucleotide (d
(NTP) mixture, RNasin and MoMLV reverse transcriptase were added, and the mixture was heated at 90 ° C. for 5 minutes and then cooled with ice to stop the reaction.

C) PCR PCR was performed using the cDNA obtained by the RT method as a template. Specifically, E-NOS, which is the object of detection, and malate dehydrogenase (MD
H) each 5 ′ primer, 3 ′ primer, PCR buffer, 2.5 mM dNTP mixture,
Taq DNA polymerase was mixed and the RT reaction was added. After overlaying with mineral oil and centrifuging, the reaction was started with an automatic PCR device. One cycle was performed at 94 ° C for 30 seconds, 50
The reaction was performed at 30 ° C. for 30 seconds and at 72 ° C. for 30 seconds, and this was repeated 30 cycles to obtain a PCR product. The primers used for E-NOS detection and MDH detection were prepared by Ujiie.K. Et al., Am.
J. Physiol. 267 (Renal Fluid Electrolyte Physiol. 36):
According to F296-F302.1994. Specifically, the base sequence of the primer used for E-NOS detection was 5′-side primer:
TACGGAGCAGCAAATCCAC (SEQ ID NO: 1), 3 'primer: CAGGCTGCAGTCC
TTTGATC (SEQ ID NO: 2). The base sequence of the primer used for MDH detection was 5′-side primer: C
AAGAAGCATGGCGTATACAACCC (SEQ ID NO: 3), 3 'primer: TTTCAGCCTCA
GGGATGGCCTCG (SEQ ID NO: 4).

D) NOS mRN by polyacrylamide gel electrophoresis and Southern hybridization
Measurement of A expression The PCR product was electrophoresed on a 5% polyacrylamide gel, and the NOS mR was analyzed by Southern hybridization.
Measurement of NA expression was performed. Specifically, first, the PCR reaction solution was electrophoresed with 5% polyacrylamide, and after completion of the electrophoresis, the gel was transferred to a membrane filter. For the detection of E-NOS and MDH, hybridization was performed on a membrane filter using a probe labeled at the 5 ′ end with γ ³² P-ATP (Ujiie.
Et al., 1994, supra). The base sequence of the probe for detecting E-NOS is CTGGAACAATTTCCATCCG.
(SEQ ID NO: 5), and the nucleotide sequence of the probe for detecting MDH is TTTGTCTCTCTCCTGGTGGA
(SEQ ID NO: 6). Thereafter, autoradiography was performed at -70 ° C for several hours, and the exposed autoradiography was analyzed using a densitator. FIG. 4 shows the results. Based on the results of the autoradiography, the amount of the E-NOS PCR product was standardized by the amount of the MDHPCR product as a housekeeping gene,
Gene expression was semi-quantified.

Statistical measurements are expressed as mean ± standard error, and statistics between groups are two-
Performed by wayANOVA. Hereinafter, p <0.05 was set as the significance level. Changes in blood pressure are shown in Table 1 below and FIG. The DOCA group exhibited hypertension at 4 weeks of observation. The increase in blood pressure in the DOCA group was significant compared to the other two groups. In contrast, in the DOCA + BH4 group, the blood pressure remained normal until the end of the observation as in the control group.

At the start of blood pressure (mmHg) 2 weeks 4 weeks 5 weeks Control group 101.38 102.85 91.77 111.70 (± 7.12) (± 11.07) (± 7.88) (± 10.10) DOCA group 107.03 137.53 153.53 150.68 (± 2.04) (± 4.63) (± 7.71) (± 3.35) DOCA + BH4 group 105.72 120.54 111.91 107.78 (± 5.63) (± 6.57) (± 7.52) (± 7.93)

Table 2 and FIG. 2 show changes in urine NO ₂ / NO ₃ .
Shown in In the DOCA group, urinary NO ₂ / NO ₃ decreased with time, and became lower than the measurement sensitivity at the end of observation. On the other hand, it increased in the DOCA + BH4 group. The decrease in the DOCA group was significant compared to the other two groups, and the control group and the DOCA +
No significant difference was observed in the BH4 group.

Table 2 Urinary NO ₂ / NO ₃ (mmol / day) at the start 2 weeks 4 weeks 5 weeks Control group 2.91 ± 0.09 1.51 ± 0.79 4.54 ± 0.32 DOCA group 3.11 ± 1.09 0.34 ± 0.34 Less than measurement sensitivity DOCA + BH4 group 2.22 ± 0.70 2.00 ± 0.55 5.95 ± 1.90

The changes in urinary BP are shown in Table 3 and FIG.
In the DOCA group, BP decreased over time. In contrast,
BP increased over time in the DOCA + BH4 group. DO
The decrease in the CA group was significant compared to the other two groups, and no significant difference was observed between the control group and the DOCA + BH4 group.

Table 3 At the start of urinary BP (nmol / day) 2 weeks 4 weeks 5 weeks Control group 26.76 ± 3.01 21.71 ± 0.61 27.79 ± 2.03 34.96 ± 0.96 DOCA group 23.77 ± 0.77 19.49 ± 2.52 15.93 ± 3.46 19.25 ± 1.96 DOCA + BH4 group 21.87 ± 0.60 35.58 ± 3.74 52.60 ± 13.13 34.26 ± 4.08

As shown in Table 4, the body weight increased over time in all groups, and no significant difference was observed among the three groups.

[Table 4] Weight (g)Starting 2 weeks 4 weeks 5 weeks Control group 390.67 ± 18.49 433.33 ± 21.49 456.00 ± 21.63 458.00 ± 20.43 DOCA group 376.00 ± 3.69 399.67 ± 19.44 430.33 ± 20.08 435.67 ± 23.34DOCA + BH4 group 383.40 ± 10.83 386.40 ± 12.84 431.20 ± 13.31 446.80 ± 15.81  As a result of immunostaining, E-NO
S at Macula densa
Both B-NOS expression decreased, DOCA + BH4 group
In these cases, their expression was observed to be equal to or slightly enhanced from the control group.
Was.

(Results of Measurement of NOS mRNA Expression) As a result of the measurement, as shown in FIG.
E-NOS mRNA expression was significantly increased with respect to the OCA group. As described above, in DOCA-salt hypertensive rats, blood pressure rises, urinary NO ₂ / NO ₃ decreases, renal tissue NOS
Expression was decreased, and dysfunction of vascular endothelial cells was observed. Furthermore, it was revealed that urinary BP was reduced in the model rat. On the other hand, BH administered orally
4 suppressed the increase in blood pressure, increased urinary NO ₂ / NO ₃ and increased expression of renal tissue NOS.
By activating NOS function (control of NOS amount / NOS activity), No. 4 was shown to be useful for treating diseases associated with decreased endogenous NO production.

Example 11 Preparation of DOCA-Salt SHR One week nephrectomy (excluding the control group) was performed on an 8-week-old SHR (obtained from Charles River). afterwards,
Comparative study was conducted in the following three experimental groups. 1) Group receiving only drinking water (control group) Number of subjects n = 8 2) Deoxycorticosterone acetate (DOCA) 30 from one week after one nephrectomy
mg / kg body weight subcutaneously once a week, 1% saline was given, and DOCA-salt SHR was prepared (DOCA group).
n = 43) BH4 (10 mg / kg) was added to DOCA-salt SHR.
Weight / day) group (DOCA + BH4 group)
n = 6 Each group was observed up to 6 weeks after the end of the experiment. At the start of the experiment, two weeks, three weeks, four weeks, five weeks, and six weeks (at the end of the observation), urine was collected from the metabolic cage for 24 hours. At the end of the observation, blood was collected from the abdominal aorta under phenobarbital anesthesia, and then the kidneys were perfused with physiological saline and excised for histological examination.

Blood pressure measurement Blood pressure was measured by the tail-cuff method at the beginning of the experiment, two weeks later,
Measurements were taken at weeks, four weeks, five weeks, and six weeks.

Urinary BP Measurement HPLC analysis was carried out based on the method of Fukushima and Nixon to measure biopterin (BP), a metabolite of BH4. BH changes in urine BP
Consider the effect of 4 administration.

After 6 weeks of histopathological findings , urine collection and blood pressure measurement were completed, the abdomen was opened under anesthesia, blood was removed from the abdominal aorta, and physiological saline was injected and perfused from the abdominal aorta. The excised kidney was fixed in a 10% formaldehyde solution, embedded in paraffin, and sliced to 4 μm with a microtome to prepare a kidney tissue specimen. Hematoxylin and eosin (HE) staining and periodic
Acid-Shiff staining was performed. The pathological findings observed in rat kidney tissue specimens, that is, the frequency of occurrence of necrotizing glomerulitis and necrotizing arterioleitis were compared.

The statistical measurements are expressed as the mean ± standard error, and the statistics between groups are two-
Performed by way ANOVA. Hereinafter, p <0.05
Was taken as the significance level. Changes in blood pressure are shown in Table 5 below and FIG.
Shown in The DOCA group exhibited remarkable hypertension at the third week of observation. The increase in blood pressure in the DOCA group was significant compared to the other two groups. In contrast, the DOCA + BH4 group remained at the same level as the control group until the end of the observation.

At the start of blood pressure (mmHg) 2 weeks 3 weeks 4 weeks 5 weeks 6 weeks Control group 129.44 119.44 143.83 151.20 158.01 161.91 (± 2.20) (± 2.97) (± 0.62) (± 0.90) (± 1.63) (± 4.20) DOCA group 132.00 132.88 162.28 169.83 182.98 178.10 (± 5.18) (± 3.88) (± 1.87) (± 2.57) (± 2.04) (± 9.85) DOCA + BH4 group 130.22 133.60 143.63 150.90 159.30 162.95 (± 3.75) (± 2.05) (± 0.85) (± 0.94) (± 2.84) (± 1.52)

The changes in urinary BP are shown in Table 6 and FIG.
In the DOCA group, BP decreased over time. In contrast,
In the DOCA + BH4 group, BH4 increased over time. D
The decrease in the OCA group was significant compared to the other two groups, and no significant difference was observed between the control group and the DOCA + BH4 group.

[Table 6] At the start of urinary BP (nmol / day) 4 weeks 6 weeks Control group 22.29 ± 1.53 25.13 ± 1.23 43.07 ± 7.24 DOCA group 17.87 ± 1.65 3.18 ± 2.14 16.33 ± 5.77 DOCA + BH4 group 24.26 ± 1.58 45.21 ± 10.31 71.78 ± 32.08

Table 7 and FIG. 7 show the frequency of appearance of histopathological findings in the renal tissue specimen. In the DOCA group, the incidence of necrotizing glomerulitis and the incidence of necrotizing vasculitis were the other two.
Significantly higher than in the group.

[Table 7] Percentage of appearance of pathological findings in kidney tissue (%)Necrotic glomeritis Necrotic vasculitis Control group 0.06 ± 0.06 0.00 ± 0.00 DOCA group 10.78 ± 0.77 9.03 ± 1.65DOCA + BH4 group 2.47 ± 1.07 3.34 ± 0.94  As described above, in the DOCA-salt SHR, the blood pressure rises and breaks.
Histopathological findings such as death glomerulitis and necrotizing vasculitis
Was done. Furthermore, in the model rat, urinary BP was reduced.
It was revealed a little. On the other hand, oral administration
BH4 suppresses the increase in blood pressure, and histopathological findings
BH4 is a function of NOS due to significant improvement
Of diseases associated with decreased endothelial cell function
It has been shown to be useful for treatment.

[0077]

As described above, the present invention provides a therapeutic agent for effectively preventing and / or ameliorating a disease to which NOS function is reduced. Further, since the active ingredient of the therapeutic agent of the present invention is a substance originally present in a living body, there is no concern about side effects even if it is used for a long time.

[0078]

[Sequence list]

SEQ ID NO: 1 Sequence length: 19 base pairs Sequence type: nucleic acid Number of strands: single stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence: TACGGAGCAG CAAATCCAC 19

SEQ ID NO: 2 Sequence length: 20 base pairs Sequence type: nucleic acid Number of strands: single stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence: CAGGCTGCAG TCCTTTGATC 20

SEQ ID NO: 3 Sequence length: 24 base pairs Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids Synthetic DNA sequence: CAAGAAGCAT GGCGTATACA ACCC 24

SEQ ID NO: 4 Sequence length: 22 base pairs Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids Synthetic DNA sequence: TTTCAGCTCA GGGATGGCCT CG 22

SEQ ID NO: 5 Sequence length: 19 base pairs Sequence type: nucleic acid Number of strands: single stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence: CTGGAACAAT TTCCATCCG 19

SEQ ID NO: 6 Sequence length: 20 base pairs Sequence type: number of nucleic acid strands: single stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence: TTTGTCTTCT CCCTGGTGGA 20

[Brief description of the drawings]

FIG. 1 shows a control group (− ○ −) and a DOCA group (−
(-) And the change over time in blood pressure of DOCA-salt hypertensive rats (DOCA + BH4 group,--) to which BH4 was orally administered.

FIG. 2 shows the control group (− ○ −) and the DOCA group (−
NO- in urine of DOCA-salt hypertensive rats (DOCA + BH4 group,-□-) orally administered with B− _{4 and B−4}
/ NO ₃ shows changes with time.

FIG. 3 shows the control group (− ○ −) and the DOCA group (−
(-) And the time course of urinary BP in DOCA-salt hypertensive rats (DOCA + BH4 group,-□-) to which BH4 was orally administered.

FIG. 4 shows the results of measuring the expression of E-NOS mRNA in kidney tissue.

FIG. 5 shows the control group (− ● −) and the DOCA group (−
Δ-) and DOCA-salt SH administered orally with BH4
The time course of blood pressure of R (DOCA + BH4 group,-□-) is shown.

FIG. 6 shows the control group (− ● −) and the DOCA group (−
Δ-) and DOCA-salt SH administered orally with BH4
The time course of urinary BP of R (DOCA + BH4 group,-□-) is shown.

FIG. 7 shows the pathological findings observed in the renal tissue specimen, from the left, the control group, the DOCA group, and the DOCA +
The frequency of appearance of necrotizing glomerulitis and necrotizing vasculitis is shown for the BH4 group, respectively.

 ──────────────────────────────────────────────────続 き Continued on the front page (71) Applicant 000001904 Suntory Limited 2-4-1 Dojimahama, Kita-ku, Osaka-shi, Osaka (72) Inventor Yoshiharu Kanayama 8-2-26-Honcho, Toyonaka-shi, Osaka (72) Invention Author Mikio Okamura 5-160 Nakata, Yao City, Osaka (72) Inventor Junichi Yoshikawa 7-15-20 Nishiokamoto, Higashinada-ku, Kobe, Hyogo (72) Inventor Haruo Shintaku 1-24-17, Kitahata, Abeno-ku, Osaka, Osaka (72) Inventor Takafumi Ishihara 3-15-1-604 Miyatacho, Takatsuki-shi, Osaka

Claims (7)

[Claims] (1) Formula (I): [Wherein, R ¹ and R ² each represent a hydrogen atom,
Or together represent a single bond, and when R ¹ and R ² represent a hydrogen atom, R ³ represents —CH (OH) CH (O
_{H) CH 3, -CH (OCOCH} 3) CH (OCOC
H ₃ ) represents CH ₃ , —CH ₃ , —CH ₂ OH or a phenyl group, and when R ¹ and R ² together represent a single bond, R ³ represents —COCH (OH) CH ₃ And / or a pharmaceutically acceptable salt thereof as an active ingredient. 2. The preventive or therapeutic agent according to claim 1, wherein the disease to which a decrease in NOS function contributes is a disease accompanied by a decrease in endogenous NO production. 3. The preventive or therapeutic agent according to claim 1, wherein the disease to which NOS function reduction contributes is a disease accompanied by endothelial cell function reduction. 4. A disease to which a decrease in NOS function contributes is an N-type disease.
2. The preventive or therapeutic agent according to claim 1, wherein the agent is associated with a decrease in OS expression. (5) R ³ is L-erythro-CH (OH) CH
(OH) CH is _3, prophylactic or therapeutic agent according to claim 1, 2, 3 or 4. 6. The preventive or therapeutic agent according to claim 1, which is a preventive or therapeutic agent for hypertension. 7. The prophylactic or therapeutic agent according to claim 1, which is a prophylactic or therapeutic agent for renal disorder.