JPH10179161A - Bacterial cell detection - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a bacterial cell detection technique that is increased in its detection sensitivity and can surely detect even only one cell. SOLUTION: In this bacterial cell detection, the cell is infected with a bacteriophage including a luminescent gene group and the cell is allowed to emit light and comprises the following steps: (1) the luminescent gene group is inserted into the gene area unnecessary for the lytic cycle in the bacteriophage, (2) the luminescent gene group is placed under the promoter control of the virus gene, (3) the termination codon is arranged on the upstream of the luminescent gene group, and (4) the SD sequence is placed on the 13<th> base in the translation initiation codon of the luminescent gene group.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a method for detecting bacteria with higher sensitivity using a bacterial virus into which a luminescent gene group has been inserted.

[0002]

2. Description of the Related Art Conventionally, detection and identification of bacteria have been performed by culturing unidentified samples in various specific media and examining their culture characteristics.

[0003] However, such a method requires a considerable amount of time since it must be performed after each bacterium is separated.

In order to solve this problem, Japanese Patent Publication No.
No. 4,747, proposes a method of detecting a vector having a DNA producing a protein expressing a detectable function by incorporating the vector into a microorganism and expressing the vector.

[0005] This method is excellent in that the time for detection is shortened. However, from the viewpoint of sensitivity, it is described that one microorganism can be detected. The actual detection limit is 1000, and this method cannot be used to declare the absence of specific bacteria.

[0006]

SUMMARY OF THE INVENTION It is an object of the present invention to provide a method capable of increasing the detection sensitivity and reliably detecting even a single bacterium without requiring pre-culture.

[0007]

SUMMARY OF THE INVENTION The present inventors have conducted various studies to achieve the above object, and as a result, when detecting bacteria, (1) SD
Use bacterial virus whose sequence is located upstream of the luminescent gene group, (2) inactivate the restriction / modification system possessed by the bacterium itself, (3) minimize the volume of medium for infecting the bacterium with the bacterial virus (4) Optimizing the number of viruses per bacterium (moi) at the time of infection, (5) Addition of aliphatic aldehyde which is a substrate of enzyme luciferase required for luminescence, etc., dramatically increases detection sensitivity. As a result, it was found that even a single bacterium can be detected.

In addition, since the detection sensitivity has been increased, the detection of light emission, which has conventionally been performed using a chemiluminescence reader or a scintillation counter, can be replaced by exposure to a high-sensitivity film or image analysis using a high-sensitivity video camera. Knowledge was also obtained.

[0009] The present invention is based on the above findings, and comprises the step of infecting a bacterium with a bacterial virus having a luminescent gene group,
A method for detecting said bacterium by emitting light, comprising: (1) inserting a luminescent gene group into a gene region unnecessary for a lysis cycle of a bacterial virus; and (2) promoter-controlling the luminescent gene group into a viral gene. (3) Put a termination code upstream of the luminescence gene group. (4) Put S at 13 bases upstream of the translation initiation code of the luminescence gene group.
The present invention relates to a rapid and highly sensitive method for detecting bacteria, which can be applied to, for example, medical diagnosis and monitoring of bacterial contamination in the field of food, with respect to a method for detecting bacteria characterized by placing a D sequence.

[0010] In the present invention, bacteria to be detected include Escherichia coli and Xant.
homonas, campestris pv. cit
Most bacteria such as ri and Legionella bacteria are targeted.

In the present invention, the bacterial virus having a luminescent gene group varies depending on the bacteria to be detected. For example, when the microorganism to be detected is Escherichia coli, commercially available EMBL3,4 Λ phage and the like improved for cloning can be used, and the detection target is Xanthomonas.
campestris pv. For citri, C
P1 phage, CP2 phage, CP3 phage and the like can be used.

[0012] In order to insert a luminescent gene group into these bacterial viruses, (1) if the genetic map of the bacterial virus is known, DN is added to a gene unnecessary for the lysis cycle.
(2) If the genetic map of the bacterial virus is unknown by the recombinant method A, the bacterial virus is infected with a host bacterium carrying a broad host plasmid incorporating a transposon for luminescent gene fusion, and the resulting lytic spot ( Out of the plaques) to select ones that emit light in the dark.

The above-mentioned luminescent gene group is inserted into a gene unnecessary for the lysis cycle of the bacterial virus, placed under the control of the promoter of the viral gene, and increases the transcription efficiency after infection. The luminescent gene group cassette includes a head structural gene (lux in the case of Vibrio fischeri).
An SD sequence (ribosome binding site) and a translation stop code consisting of three reading frames that stop translation of the inserted bacterial virus gene should be provided at 13 bases upstream of the translation initiation code of C). Thereby, the translation efficiency is improved.

The term "SD sequence" as used herein means a purine-rich sequence to which a ribosome binds, and examples thereof include the most common AGGA and those having the same action.

The luminescent genes used in the present invention include those obtained from microorganisms, insects, crustaceans, jellyfish and the like.
Fischeri's lux gene group is preferably used.

More specifically,

Those consisting of those shown in Table 2 or those consisting only of the luciferase producing genes (luxA, luxB) are preferred.

[0017]

[Table 2]

In the present invention, GAATTCTAAAGGAGGATAAA is provided upstream (before) of the luminescent gene group.
It is particularly preferable to arrange a base sequence consisting of TAATG.

In order to infect bacteria with a bacterial virus, generally, ordinary infection conditions may be used. However, when different isolates of the same kind of bacteria are used, they may have different restriction / modification systems. Therefore, when infected with different isolates, viral nucleic acids may be degraded.

In such a case, since the sensitivity is extremely lowered, it is necessary to inactivate the restriction / modification system. Specifically, a method of treating at 60 ° C. immediately before and during the adsorption reaction of the bacterial virus to the bacteria, a method of treating in ice, or the like is used.

Since viruses do not have motility, they adsorb to bacteria by random collision. Therefore, especially when the number of bacteria in the sample is small, that is, the number of bacteria is 1 to
In the case of 1,000 cells, the volume of the culture medium during the adsorption reaction may be minimized in order to increase the collision frequency. When detecting one bacterium, it is desirable to use a volume of 1-2 μl.

When the number of bacteria in a sample is small, that is, when the number of bacteria is 1 to 10 ^{6, the} number of viruses added per bacterium (mo
By increasing i) to 5 to 20, and more preferably to 10, it is necessary to increase the frequency of the collision and ensure the adsorption. However, if the moi exceeds 20, the addition of the virus causes lysis (Lysis Without) due to an obstacle due to simultaneous adsorption of a large number of viruses, so that the detection sensitivity decreases.

When the number of bacteria is more than 10 ⁶ ,
Is adjusted to 0.5 to 5, more preferably 1 to 2.

The luminescent gene group includes genes that produce the enzyme luciferase necessary for luminescence and its substrate aliphatic aldehyde. When measuring the amount of luminescence, this substrate is used as a booster.
The addition can increase the sensitivity.

As the aliphatic aldehyde, those having 10 to 10 carbon atoms are used.
About 20 saturated aliphatic aldehydes can be used, but tetradecanal is particularly preferred. Tetradecana
When using a solution, it is desirable to add so that the final concentration becomes 0.05 to 2%, more preferably 0.1 to 0.25%.

In order to detect the bacteria that have emitted light in this manner, the amount of photons generated by the luminescence reaction can be detected by a chemiluminescence reader or a scintillation counter. It can also be detected by image analysis used. Here, the high-sensitivity film has an ASA (ASA) sensitivity of 3000 or more. For example, Polaroid (61)
2,667), Amersham (Hyperfilm M)
P), Fuji film (X-ray film RX), etc., and detection by image analysis using a high-sensitivity video camera means detection by image analysis using a cooled CCD camera (charge-coupled device type camera). Examples of the image analysis device include Luminescence Sensor-JNR AB-2100 manufactured by Atto, and Densitograph LuminCCD AE-6905S manufactured by Atto. In particular, according to the detection by image analysis using a high-sensitivity video camera, the location of the bacteria, for example,
It is also possible to identify where in the vegetables the bacteria are located.

The present invention can be used not only for detecting specific bacteria, but also by preparing a standard curve showing the relationship between the bacterial concentration and the amount of photons, by measuring the amount of photons in the sample. Bacterial quantification is also possible.

[0028]

【Example】

1. Insertion of luminescent genes into bacterial virus by DNA recombination method Lambda phage derivative vector-EMBL4 restricted enzyme Ec
A 10 kb plasmid pHSK728 digested with the same EcoRI was connected between the DNA fragments digested with the oRI.

The plasmid pHSK728 contains a luminescent gene (lu) of the marine bacterium Vibrio fischeri.
x) immediately before the cassettes of the group, a multi-cloning site,
A termination code and SD sequence arranged in three reading frames to prevent translation of the inserted viral gene are incorporated.

The connected DNA was subjected to infectious λ by an in vitro packaging method (a method of adding DNA to a bacterial virus protein mixture to obtain infectious λ phage particles in a test tube).
After obtaining the phage, the phage was infected with E. coli strain MV1184. Among the lysed spots obtained, those which emit light in the dark were separated, and the pHSK72 was determined from the restriction enzyme cleavage pattern.
8 was confirmed.

2. Preparation of plasmid for luminescence gene fusion The luciferase gene portion (luxA, luxB) of the luminescence gene group cassette of Vibrio fischeri was incorporated into the left end insertion sequence portion of Tn5 by genetic manipulation,
This is a broad host (capable of replicating in many types of bacteria)
It was inserted into plasmid pLAFR3 to obtain a fusion plasmid pTnlux.

3. Isolation of luminescent gene group-inserted bacterial virus using fusion plasmid pTnlux was transformed into Xanthomonas campes
tris pv. citri and the logarithmic growth phase (5
1 × 10 ⁷ cells / ml)
Infected with ⁸ PFU / ml CP1 phage. After dilution, of the plaques obtained by the overlay agar method, Xan in which a luminescent gene group was inserted from a plaque that luminescent in the dark.
Thomonas campestris pv. ci
A CP1 phage for tri detection was obtained.

4. Bacterial infection E. coli MV1184 strain 0.2% maltose and 10 m
LB medium containing M MgSO ₄ (LB-Mg-Mal)
And overnight, keep on ice for 30 minutes.
This was placed in a 1 μl microcentrifuge tube, and 1 μl of MH1109 diluted with a λ phage diluent was added to moi = 10.
After maintaining at room temperature for 0 minutes, MH1109 was adsorbed on E. coli. Next, 1 ml of LB-Mg-Mal medium was added, and 2
After culturing at 8 ° C., it was used for measuring the amount of luminescence.

5. Measurement of luminescence amount 3 ml of LB medium and 500 μl of 0.
After adding a suspension of 2% tetradecanal in distilled water and mixing well, the luminescence was measured with a chemiluminescence meter.

6. Demonstration that one bacterium can be detected In order to prove that one bacterium can be detected, the above experiment was carried out using a microtiter plate.

That is, the suspension of E. coli MV1184 was diluted to about 0.5 bacteria / μl to inactivate the restriction / modification system, and then 1 μl was added to each well of two 96-well microtiter plates. Then, about 10 phage MH1109 (1 μl) was added to one plate. 20
After culturing for one minute, 100 μl was added to each well of each plate.
of LB-Mg-Mal medium, and cultured for 2 hours at 28 ° C.
1 / ml tetradecanal was mixed, and the luminescence was measured. The other plate was continuously cultured at 28 ° C., and the number of wells that did not receive any bacteria was examined. The results were subjected to Poisson distribution analysis, and it was found that one Escherichia coli could be detected by the amount of luminescence at an efficiency of 90%.

7. Determination of optimal moi E. coli MV1184 was appropriately diluted, and
^Three , 10^Four , 10^Five, 10⁶ Adjust the amount of bacteria for detection.
10 for Ils MH1109^Three Pieces (A), 10 ^Two Pieces (B)
In addition, culture at 28 ° C in 4ml LB-Mg-Mal medium
Thereafter, the amount of chemiluminescence was measured. The result is shown in FIG. Figure
As is evident from FIG. 1, in all cases, the moi is 10
At the time, it reached the highest value.

[0038]

As described above, according to the present invention, bacteria can be detected quickly and with high sensitivity in the fields of medicine, food, and agriculture.

[Brief description of the drawings]

FIG. 1 is a diagram showing the results of an example of the present invention.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁶ Identification code FI C12R 1:19) (C12Q 1/68 C12R 1:19)

Claims (10)

[Claims] 1. A method for detecting a bacterium by infecting the bacterium with a bacterium virus having a luminescent gene group and causing the bacterium to emit light, wherein (1) a gene region unnecessary for the lysis cycle of the bacterium virus; (2) Put the luminescent genes under the promoter control of the viral gene. (3) Put the termination code upstream of the luminescent genes. (4) Put S at 13 bases upstream of the translation initiation code of the luminescent genes.
A method for detecting bacteria, comprising placing a D sequence. 2. The method for detecting bacteria according to claim 1, wherein the luminescent gene group consists of ones shown in the following Table 1 or only luciferase producing genes (luxA, luxB). . [Table 1] 3. A GAATTCTAA upstream of a luminescent gene group.
2. A bacterial virus having a nucleotide sequence of AGGAGATAAATAATG is used.
The method for detecting bacteria according to any one of claims 1 to 3. 4. The method for detecting bacteria according to claim 1, wherein the restriction and modification system of the bacteria is inactivated. 5. The method for detecting bacteria according to claim 1, wherein when the number of bacteria is 1 to 1,000, the volume of the culture medium for infecting with a bacterial virus is 1 to 2 μl. 6. When the number of bacteria is 1 to 10 ⁶ , the moi is 5
The method for detecting bacteria according to any one of claims 1 to 5, wherein 7. The method for detecting bacteria according to claim 1, wherein the moi is 0.5 to ⁶ when the number of bacteria exceeds 10 ⁶ . 8. The method for detecting bacteria according to claim 1, wherein an aliphatic aldehyde is added. 9. The method for detecting bacteria according to claim 1, wherein the detection is performed by exposing a high-sensitivity film to light. 10. The method according to claim 1, wherein the bacterium is Escherichia coli.