JPH10165178A - Dna encoding variable region of anti-fas antibody and anti-fas antibody - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new DNA consisting of a DNA containing specific base sequences encoding a variable region of a heavy chain of an anti- Fas antibody, and used for producing an antibody useful for the treatment and diagnosis of an autoimmune disease by inducing the apoptosis of autoantibody producing cells, etc. SOLUTION: This DNA encoding a variable region of an anti-Fas antibody is a new DNA containing base sequences expressed by formulae I to III, and used for the production of the anti-Fas monoclonal antibody useful for the treatment, diagnosis, etc., of an autoimmune disease by inducing the apoptosis of autoantibody producing cells remaining in a living body for removing these cells. The DNA is obtained by culturing a hybridoma CH-11 (FERM P-15708) producing the anti-Fas monoclonal antibody in a medium, preparing mRNA from the cells by a usual method, synthesizing a single-stranded cDNA by using the mRNA as a mold, and amplifying the cDNA by a PCR method using primers encoding the parts of the variable regions of heavy and light chains of the monoclonal antibody.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a DNA encoding the variable region of an anti-Fas antibody, and an anti-Fas antibody.

[0002]

2. Description of the Related Art In a multicellular organism, many cells are removed by cell death during the ontogeny process. It is presumed that this cell death is caused by a predetermined program, and is called apoptosis to distinguish it from passive cell death caused by an external cause such as a burn (this is called necrosis). It is believed that cell death seen during development, differentiation or tissue turnover is caused by apoptosis.

[0003] A protein present on the surface of living cells which is considered to be closely related to the control of cell death called apoptosis or programmed cell death is a transmembrane protein called Fas antigen. Mouse and human Fas
The amino acid sequence of the antigen and c encoding the amino acid sequence
The DNA sequence has already been determined (Cell, Vol. 66,
233-243, 1991, Ito Naoto et al., J. Immunol.
148, No. 4, pp. 1274-1279, 1992, Watanabe (Fukunaga) Rie et al., J. Biol. Chem., Vol. 267, No.
No. 15, 10709-10715, 1992, Aime (Alexander Oe
hm) et al., J. Exp. Med., 169, 1747-1756, 1989.
Yoneharacin et al., Proc. Natl. Acad. Sci. USA, 8th.
7, 9620-9624, 1990, Kobayashi Nobuyuki et al., Sci.
ence, 245, 301-305, 1989, Traus (Bernh
ard C. Trauth) et al., J. Immunol., Volume 149, Issue 10, 3
166-3173, 1992, Jeas Dein et al., The La
ncet. Vol. 335, pp. 497-500, 1990, Debatin (Kla
us-Michael Debatin) et al., J. Immunol., 149, 11
No., 3753-3758, 1992, Miyawaki Toshio et al., Genomi
cs, Vol. 14, pp. 179-180, 1992, Richter (Peter Li
chter) et al.).

In 1989, Yonehara et al. Prepared a monoclonal antibody against the surface antigen of human FS-7 cells, and obtained an apoptosis-inducing antibody, an anti-Fas antibody, from these (Yo).
nehara, S. et al .: J.Exp.Med., 169: 1747-1756, 198
9). Apart from this, Traus et al.
APO-1 antibody, a monoclonal antibody having properties similar to s antibody and showing cell killing activity, has been obtained (Trauth,
BC et al .: Science, 245: 301-305, 1989), and it has been revealed that the distribution and molecular weight of the antigen recognized by the antibody are very similar and the same.

As a result of structural analysis of Fas antigen, tumor necrosis factor (TNF) receptor and nerve growth factor (NGF)
It has been revealed that it has a structure very similar to that of the TNF / NGF receptor family, and is a new type of receptor that causes cell death in response to external signals. ing.

[0006] Recently, the relationship between the expression of Fas antigen and autoimmune diseases has been attracting attention because abnormalities of the Fas gene are observed in mice exhibiting autoimmune symptoms (MRL / lpr mice). Autoimmune diseases are those in which the immune system, which is the body's defense mechanism, produces autoantibodies and lymphocytes that react with its own cellular components, resulting in tissue damage and lesions. The mechanism includes antigen-related causes such as cross-reaction and antigen modification, as well as lymphocytes that have reactivity with their own cell components that would otherwise be eliminated by apoptosis during development. The theory that it is caused by surviving is becoming influential.

[0007] From this, it is conceivable that administration of an anti-Fas monoclonal antibody to a living body induces apoptosis, and the autoantibody-producing cells remaining in the living body are removed to help treat autoimmune diseases.

[0008]

In general, the use of monoclonal antibodies for the treatment of diseases has been proposed as a method for treating cancer, and several attempts have been made. When produced in humans, proteins produced by these xenogeneic animals are distinguished from human proteins and immediately eliminated from the human circulatory system, or cause allergic reactions. Therefore, it was difficult to use it continuously.

In order to avoid these problems, it is desirable to use a human monoclonal antibody. However, in the case of a human antigen, the human immune system is not recognized as a foreign antigen and has no immunogenicity. Is a less efficient IgM type, and the more effective I
It is difficult to freely produce human monoclonal antibodies by cell fusion, as it is not easy to obtain a gG-type monoclonal antibody. Therefore, recently, research into the production of chimeric monoclonal antibodies combining the variable regions (antigen recognition sites) of mouse monoclonal antibodies and the constant regions of human antibodies by genetic engineering techniques has been conducted (Japanese Patent Application Laid-Open No. 60-155132). Such).

An object of the present invention is to produce an anti-Fas antibody which can be used for the treatment and diagnosis of an autoimmune disease.
It is another object of the present invention to provide a DNA encoding a variable region of an antibody, and to provide the anti-Fas antibody.

[0011]

Means for Solving the Problems, Embodiments of the Invention and Effects of the Invention In order to solve the above problems, a first invention is directed to an anti-F
DNA encoding the variable region of the heavy chain of the as antibody, a base sequence represented by GACTACAACATGCAC, TATATTTATCC
It comprises a nucleotide sequence represented by TTACAATGGTGGTACTGGCTACAACCAGAAGTTCAAGAGC and a nucleotide sequence represented by AGTTACTATGCTATGGACTAC. Such a DNA may be, for example, the base sequence shown in SEQ ID NO: 1 or SEQ ID NO: 5 in the sequence listing (in the base sequence shown in SEQ ID NO: 1 in the sequence listing, Number 91-
105, 148 to 198, 295 to 315, and the portion corresponding to each of the above base sequences in the base sequence shown in SEQ ID NO: 5 in the sequence listing includes base numbers 148 to 162, 205 to 2
55, 352-372).

A second invention is a DNA encoding a variable region of a light chain of an anti-Fas antibody, which comprises AGATCTAGTAAGAGCCTTGT.
Base sequence represented by ACACAGTAATGGAAACACCTATTTACAT, AA
The nucleotide sequence represented by AGTTTCCAACCGATTTTCT, and TCTCAAA
It is characterized by including the nucleotide sequence represented by GTACACATGTTCCTCCGGCG. Such DNA may be, for example, the base sequences shown in SEQ ID NO: 2 and SEQ ID NO: 6 in the sequence listing (in addition,
In the nucleotide sequence shown in SEQ ID NO: 2 in the sequence listing, the portion corresponding to each of the nucleotide sequences corresponds to nucleotide numbers 70 to 117, 163
183, 280 to 306, and a portion corresponding to each of the base sequences in the base sequence shown in SEQ ID NO: 6 in the sequence listing,
Base numbers 127 to 174, 220 to 240, 337 to 3
63).

In general, an antibody (immunoglobulin) is composed of a heavy chain having a large molecular weight and a light chain having a small molecular weight. Each of the heavy and light chains has a different region of the amino acid sequence called a variable region at about 110 residues from the N-terminus. The variable region of the heavy chain is V _H , and the variable region of the light chain is V _{H.
Expressed as L.} By the variable regions V _L of the variable regions V _H and light chains of the heavy chain is relative (non-covalent) bond, the antigen binding site is formed at the tip. Among the variable regions, the region where the amino acid sequence mutation is particularly high is called a hypervariable region, and the hypervariable region of the heavy chain and the hypervariable region of the light chain create an antigen-binding site structure unique to the anti-Fas antibody. Not only the affinity and specificity of the binding site but also the antigenicity of the binding site.

In the first invention, the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 5 in the sequence listing encodes a heavy chain variable region V _H , of which the nucleotide sequence represented by GACTACAACATGCAC (the sequence of SEQ ID NO: 1) Base numbers 91 to 105 in
Base numbers 148 to 162 in the sequence of SEQ ID NO: 5),
TATATTTATCCTTACAATGGTGGTACTGGCTACAACCAGAAGTTCAAGAG
A base sequence represented by C (base numbers 148 to 198 in the sequence of SEQ ID NO: 1; base numbers 205 to 255 in the sequence of SEQ ID NO: 5); and a base sequence represented by AGTTACTATGCTATGGACTAC (base in the sequence of SEQ ID NO: 1). 295 to 315, base number 3 in the sequence of SEQ ID NO: 5
52-372) encode the hypervariable region of the heavy chain.

In the second invention, the nucleotide sequence shown in SEQ ID NO: 2 or SEQ ID NO: 6 in the sequence listing is
Code _L , of which AGATCTAGTAAGAGCCTTGTACACAG
A base sequence represented by TAATGGAAACACCTATTTACAT (base numbers 70 to 117 in the sequence of SEQ ID NO: 2, base numbers 127 to 174 in the sequence of SEQ ID NO: 6), AAAGTTTCCAAC
A base sequence represented by CGATTTTCT (base numbers 163 to 183 in the sequence of SEQ ID NO: 2, base numbers 220 to 240 in the sequence of SEQ ID NO: 6), and TCTCAAAGTACACATG
The base sequence represented by TTCCTCCGGCG (base numbers 280 to 306 in the sequence of SEQ ID NO: 2, base numbers 337 to 363 in the sequence of SEQ ID NO: 6) encodes a hypervariable region of a light chain.

The DNAs of the first and second inventions include, for example, a heavy chain variable region of an anti-human Fas mouse monoclonal antibody,
It corresponds to the variable region of the light chain. Such anti-human F
As mouse monoclonal antibodies, for example, hybridoma (Mouse-Mouse hybridoma) CBE, WB3,
VB3, JAE, AX6, ZB4, UB2 and CH11
An antibody produced from one hybridoma selected from the group consisting of:

Here, for example, hybridoma ZB4,
UB2 transfects recombinant Fas antigen obtained from mouse cells transformed with human Fas antigen cDNA with BALB /
After immunization of the c mouse, it can be obtained by fusing the spleen cells with mouse myeloma cells (NS-1). In addition, hybridoma CBE, WB3, VB3, J
AE and AX6 can be prepared in the same manner as hybridomas ZB4 and UB2. On the other hand, hybridoma CH11 can be obtained by immunizing BALB / c mice with human diploid fibroblasts FS-7 and fusing their spleen cells with mouse myeloma cells (NS-1) (Yonehara,
S., Ishii, A. & Yonehara, M.:"A cell killing mono
clonal antibody (anti-Fas) to a cell surface antige
n co-downregulated with the receptor of tumor necr
osis factor. "J. Exp. Med., 169: 1747-1756 (1989)).

The hybridomas CBE, WB3, VB
3, the accession numbers of JAE, AX6, ZB4, UB2 and CH11 are FERM P-15701, FER, respectively.
MP-15702, FERM P-15703, FER
MP-15704, FERM P-15705, FE
RM P-15706, FERM P-15707, F
ERM P-15708. Among these, monoclonal antibodies produced from hybridomas ZB4, UB2, and CH11 are commercially available from Institute for Medical Biology, and each catalog number is MD-11-
3, MD-10-3 and SY-001.

The DNAs of the first and second inventions can be used, for example, as follows. That is, a vector encoding a heavy chain variable region according to the first invention together with a DNA encoding a heavy chain constant region (for example, the constant region of a human immunoglobulin heavy chain) is incorporated into a vector to express the heavy chain. And On the other hand, the DNA encoding the variable region of the light chain according to the second invention is incorporated into a vector together with the constant region of the light chain (for example, the constant region of the light chain of human immunoglobulin) to obtain a vector that expresses the light chain. And
Cells are transformed with these expression vectors, and an anti-human Fas antibody (the anti-F
as antibody).

A third invention is an anti-Fas antibody, wherein the variable region of the heavy chain has an amino acid sequence represented by Asp Tyr Asn Met His (amino acids 31 to 31 in the sequence of SEQ ID NO: 3).
35, amino acid numbers 50 to 5 in the sequence of SEQ ID NO: 7
4), Tyr Ile Tyr Pro TyrAsn Gly Gly Thr Gly Tyr A
an amino acid sequence represented by sn Gln Lys Phe Lys Ser (amino acid numbers 50 to 66 in the sequence of SEQ ID NO: 3; amino acid numbers 69 to 85 in the sequence of SEQ ID NO: 7); and
The amino acid sequence represented by Ser Tyr Tyr Ala Met Asp Tyr (amino acids 99 to 10 in the sequence of SEQ ID NO: 3)
5, amino acid number 11 in the sequence of SEQ ID NO: 7
8-124), wherein the heavy chain constant region is a human immunoglobulin heavy chain constant region, and the light chain variable region is
Arg SerSer Lys Ser Leu Val His Ser Asn Gly Asn Thr
Amino acid sequence represented by Tyr Leu His (amino acids 24 to 39 in the sequence of SEQ ID NO: 4; amino acids 43 to 58 in the sequence of SEQ ID NO: 8); Lys Val Ser Asn
An amino acid sequence represented by Arg Phe Ser (amino acids 55 to 61 in the sequence of SEQ ID NO: 4; amino acids 74 to 80 in the sequence of SEQ ID NO: 8); Ser Gln Ser Thr
The amino acid sequence represented by His Val Pro ProAla (amino acid numbers 94 to 102 in the sequence of SEQ ID NO: 4; amino acid sequences 113 to 121 in the sequence of SEQ ID NO: 8); It is a light chain constant region.

The anti-Fas antibody of the third invention is a combination of a variable region containing a hypervariable region for determining a recognition site of a Fas antigen and a constant region of a human immunoglobulin, so that it can be administered to a human. Is also recognized as a human protein, so that it is not easily eliminated from the human circulatory system and allergic reactions are unlikely to occur. Therefore, if this anti-Fas antibody is administered to a patient whose lymphocytes which should be removed by apoptosis and which have reactivity with their own cell components are left in the living body, apoptosis may occur. Since the lymphocytes are induced and eliminated, they are expected to be effective therapeutic agents for autoimmune diseases.

Here, the anti-Fas antibody of the third invention alone has apoptosis activity alone, but those classified as IgG cannot sufficiently induce apoptosis alone. The reason is that three of the Fas antigens on the cell surface need to be cross-linked to induce apoptosis, whereas those of the IgG class alone
It is considered that the s-antigen cannot be cross-linked even if reacted.

For this reason, it is preferable to induce a higher apoptotic activity by using a secondary antibody capable of cross-linking IgG and cross-linking the reacted anti-Fas antibodies with each other, as compared with the case where the anti-Fas antibody is used alone. By appropriately combining the anti-Fas antibody of the third invention with such a secondary antibody, for example, W
The cell viability (by MTT assay) of R19L12a can be suppressed to 20% or less. Such secondary antibodies include, for example, anti-human γ heavy chain antibody, anti-human κ light chain antibody, anti-human Fc antibody, anti-human IgG (H +
L) In addition to antibodies such as antibodies, protein A and protein G
And the like.

In the anti-Fas antibody of the third invention, the variable region of the heavy chain contains the amino acid sequence shown in SEQ ID NO: 3 in the sequence listing, and the variable region of the light chain contains the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing. You may go out. Alternatively, the variable region of the heavy chain may include the amino acid sequence shown in SEQ ID NO: 7 in the sequence listing, and the variable region of the light chain may include the amino acid sequence shown in SEQ ID NO: 8 in the sequence listing. Further, the constant region of the heavy chain is the constant region of the heavy chain of human IgG, and the constant region of the light chain is the constant region of the light chain of human IgG. It is preferable because it is expected to be effective.

For example, such an anti-Fas antibody includes a chimeric monoclonal antibody in which the variable region of an anti-human Fas mouse monoclonal antibody is combined with the constant region of human IgG. Anti-human Fas mouse monoclonal antibodies include the hybridomas CBE, WB3, VB3, JAE, AX6, ZB4, U
An antibody produced from one hybridoma selected from the group consisting of B2 and CH11 can be used.

[0026]

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Preferred embodiments of the present invention will be described below with reference to the drawings. The embodiments of the present invention are not limited to the following examples at all, and it goes without saying that various embodiments can be adopted as long as they belong to the technical scope of the present invention. [Example 1] DN encoding variable region of anti-Fas antibody
Plasmid having A [1-1] anti-human Fas mouse monoclonal antibody cD
Preparation of NA Hybridoma CH-11 producing anti-Fas monoclonal antibody (IgM) (Accession number: FERM P-
15708) with 10% FCS (fetal calf serum)
After culturing in MEM, mRNA preparation kit from 1 × 10 ⁷ cells (Pharmacia), trade name “Quick Prep Mic”
roA-RNA purification Kit ")
NA was prepared. From 5 μg of this mRNA, a cDNA synthesis kit (manufactured by Pharmacia, trade name “First Strand c
-DNA Synthesis Kit ”) to synthesize single-stranded cDNA according to the operation manual of the kit.

The hybridoma CH-11 was prepared as follows. First, Balb was prepared using human diploid fibroblast FS-7 cell line expressing human Fas antigen.
/ C female mice were immunized. The sensitized mouse was laparotomized, the spleen was excised, ground in a serum-free RPMI1640 culture solution on a stainless steel mesh, and the spleen cell solution was centrifuged (at 1500 rpm for 7 minutes). The centrifugation residue was collected and suspended in a serum-free RPMI 1640 culture solution. Furthermore, the cells were washed twice with a serum-free RPMI 1640 culture solution to obtain antibody-producing mouse spleen cells. On the other hand, mouse myelo-
MA cells NS-1 (ATCC TIB18) at 37 ° C., 5% CO ₂
The cells were cultured in an ASF-104 medium (manufactured by Ajinomoto Co.) containing 10% FCS and 50 U / ml kanamycin.

Next, serum-free RPMI obtained by mixing mouse myeloma cells NS-1 cells washed with serum-free RPMI 1640 culture medium and mouse spleen cells prepared as described above.
1640 solution is centrifuged (1000 rpm for 10 minutes)
And collect the centrifugation residue, and use the Herzenberg
g, LA) et al. (Selected Methods in Cellular Immunology)
ellular Immunology), p. 351 (1980)), and a plurality of hybridoma colonies were obtained.

Then, in order to screen the hybridoma producing the anti-human Fas monoclonal antibody, the reactivity of the culture supernatant of each hybrid-macronion to human thymocytes expressing the Fas antigen was screened. Was measured by a flow cytometer, and a hybridoma CH11 (Ig) producing an anti-human Fas monoclonal antibody was measured.
M) was obtained. [1-2] Preparation of Variable Region Primers Variable regions of heavy and light chains (hereinafter referred to as V _H and V _{L) of the} monoclonal antibody produced by hybridoma CH11
) And a mixed antisense primer for cloning a gene encoding the gene coding the gene described in Kabat et al. ("Sequences of Prot.
eins of IMMUNOLOGICAL INTEREST ", Kabat et al.,
Health service National insutitute of Health (199
It was prepared using a DNA synthesizer (Perkin Elmer) with reference to 1))). Each base sequence is shown in Table 1 below, and is also shown in SEQ ID NOs: 9 to 12 in the sequence listing.

[0030]

[Table 1]

In Table 1, R is A or G;
S is G or C, M is A or C, K is G or T, W is A or T, H is A or C or T, B is C or G or T And Y is C or T. [1-3] PCR Amplification of Variable Region Gene Next, using this primer, a gene encoding the heavy chain of an anti-human Fas mouse monoclonal antibody was amplified by the polymerase chain reaction (PCR). That is, 3 μl of the cDNA solution prepared in [1-1] above
to 20 μM of the primer prepared in [1-2] above.
5 μl of solution, 1 μl of 20 mM d-NTP and TaqD
To 1 μl of NA polymerase (manufactured by Takara Shuzo Co., Ltd.), 10 μl of a 10-fold concentration PCR buffer and 75 μl of purified water were added to make a total of 100 μl, and PCR was performed using a DNA cycler (manufactured by MJ Research). PCR at 94 ° C
1 minute, 55 ° C for 2 minutes, 72 ° C for 2 minutes as one cycle, 30
The cycle was performed. The obtained PCR product was 1% agaro-
The product was electrophoresed on a gel, and a product of about 300 bp was confirmed. [1-4] Incorporation into pUC19 The _VH and _VL PCR products collected above were incorporated into the SmaI site of plasmid pUC19 by a conventional method, and were named pUC- _VH and pUC- _VL , respectively. still,
The restriction enzyme map of pUC19 is shown in FIG. 1 (in FIG. 1, the numbers represent the number from the position of the first T of 5 ′... TCCGCGGTTT. Numbers in parentheses indicate the number of cleavages of the restriction enzyme). [1-5] Analysis of DNA sequence pUC- _VH and pUC- _VL prepared in [1-4] above
About the dideoxy method (Proceedings of
National Academy of Science [Proc. Nat
l. Acad. Sci. USA] Vol. 74, p. 5463 (1977)
Year))). The nucleotide sequences of the DNAs contained in these plasmids are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. The amino acid sequence encoded by each DNA is uniquely the amino acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4. [Example 2] Plasmid having DNA encoding human immunoglobulin constant region [2-1] Synthesis of human immunoglobulin cDNA Next, in order to clone the constant region of human IgG, human peripheral blood lymphocytes were prepared. Single-stranded cDNA was synthesized. That is, 30 ml of human blood is diluted 2-fold with 0.9% NaCl, and 3 ml of lymphoprep (manufactured by Nicomed).
6 ml of diluted blood is layered on a centrifuge tube into which
And centrifuged at for 20 minutes to collect the separated lymphocyte layer.
Washed with% NaCl. From 1 × 10 ⁷ lymphocytes, a single-stranded cDNA was synthesized in the same manner as in the above [1-1]. [2-2] for a chimeric antibody with synthetic human immunoglobulin constant region primers, the heavy and light chain constant region of human immunoglobulin (hereinafter C _H
And sense and antisense primers for cloning the gene encoding the C _L and) was synthesized in the same manner as in [1-2]. The base sequence of this primer is shown in Table 2, and SEQ ID NOS: 13 to
16 is also shown.

[0032]

[Table 2]

[2-3] Incorporation into plasmid pUC19 The PCR was performed using the above primers in the same manner as in [1-3] to amplify the gene encoding the constant region of human immunoglobulin IgG2. And the above [1-4]
The product was electrophoresed in the same manner as described above, and a product of about 300 bp corresponding to the light chain and a product of about 1 Kbp corresponding to the heavy chain were recovered.
Cloning into the SmaI site of the C19 plasmid,
Sequence of DNA was confirmed to be a DNA sequence encoding the C _H and C _L (known) by the dideoxy method.

[0034] These plasmids pUC-C _L, pUC
It was designated as -C _H. Example 3 Chimeric Monoclonal Antibody Combining Variable Region of Anti-Human Fas Mouse Monoclonal Antibody and Constant Region of Human IgG (hereinafter referred to as Human Antibody) [3-1] Construction of Expression Vector Cloned _VH , V _L, the expression vector of the C _H and C _L mammals - for incorporation into a is pREP4 and pREP9 (Invitrogen), pUC-V _H, pU
_{C-V L, pUC-C} L, PCR was carried out using pUC-C respectively using primers shown in Table 3 as a template Pfu polymerase _H (manufactured by Toyobo Co., Ltd.). P
CR was performed in the same manner as in the above [1-3]. Here, V _H 5
And V _L 5 primers, ATG codon and HindI
It includes a II site, C _H 3 and C _L 3 primer contains a stop codon and BamHI site. The base sequence of each primer is also shown in SEQ ID NOs: 17 to 24 in the sequence listing.

[0035]

[Table 3]

After treating these amplified fragments with the corresponding restriction enzymes, V _H and C _H , V _L and C _L were obtained using T4 DNA ligase (Bio-Rad).
Were ligated respectively, and pREP4 and pRE4 were ligated.
The P9 vector was integrated into the HindIII-BamHI site, and these plasmids were respectively pREP4-H,
It was named pREP9-L.

The restriction maps of pREP4 and pREP9 are shown in FIGS. 2 and 3, respectively. [3-2] Introduction of expression vector into mouse myeloma cells Mouse myeloma cells Sp-2 / o-Ag14 (ATCC (American Type Culture Collection) code: CRL15) cultured in RPMI / 10% FCS
81; Immunoglonrinnon-secre
simultaneously, pREP4-H and pREP9-L were simultaneously subjected to DEAE-dextran method (McCutchan JH and Pagano JG, 1968, using a Mammalian transfection kit (manufactured by STRATAGENE)).
Transfected with J. Natl. Cancer Inst. 41, 351-356) and put the drug (neomycin 7) in a 96-well sterile plate.
(50 μg / ml, hygromycin 500 μg / ml)
After limiting dilution with RPMI / 10% FCS containing
The drug resistant strain was screened. [3-3] Purification of human antibody The human antibody was collected by centrifugation after drug-resistant cells were cultured in large amounts and centrifuged to obtain 2% Triton-100 / 2.
After dissolving in 5 mM Tris / 1 mM EDTA (pH 7.5), sonication was performed, and the supernatant was further centrifuged.
After filtration through a 22 μm filter (Millipore),
Dialysis against PBS (physiological phosphate buffer), PBS / 0.
After passing through a column packed with protein G Sepharose 4FF (manufactured by Pharmacia) equilibrated with 15 M NaCl, the column was washed with PBS, and the antibody bound to the column was eluted with 0.17 M glycine (pH 2.3). The antibody fractions were collected and dialyzed against PBS. [Example 4] Properties of chimeric antibody (human-type antibody) Transformed cell WR19L12a overexpressing human Fas antigen
(For the creation method, refer to Cell Vol. 66, No. 233-
243 (see the report on 1991)), and SDS-PAGE was performed using the cell extract as an antigen, and blotting was performed on a nylon membrane. This was reacted with 1 μg / ml of a human antibody (obtained in Example 3), incubated at room temperature for 1 hour, and then used with a peroxidase-labeled anti-human Fc antibody (manufactured by Institute of Medical Biology, Inc.). Visualization confirmed the molecular weight. As a result, as shown in FIG. 4, the molecular weight of the Fas antigen was about 45 kD.
One band was confirmed at the position of.

Next, the WR19L12a and WR19L cells (Mouselympho) as a control were used.
Ma, ATCC code; TIB-52) was used to conduct cell apoptosis experiments. Human-type antibody and mouse CH11 antibody as a control were respectively RPMI / 1
Diluted with 0% FCS to a concentration of 4 μg / ml and allowed to act,
After about 12 hours, the number of living cells was counted. In the WR19L cells, the human antibody obtained in Example 3, mouse CH11
Apoptosis was not observed with any of the antibodies, whereas W
Apoptosis was confirmed to occur in both of the R19L12a cells.

As a result, the humanized antibody obtained in Example 3
Similar to the mouse CH11 antibody, it was found to have an effect of inducing apoptosis in human Fas antigen overexpressing transformed cells WR19L12a. In addition, mouse CH
Since antibody 11 is a protein produced by a heterologous animal, when administered to humans, it may be eliminated from the human circulatory system by being distinguished from human proteins or cause an allergic reaction. Because there is no such fear, it is promising as a therapeutic agent for autoimmune diseases. [Example 5] Anti-human Fas mouse monoclonal antibody c
Preparation of DNA Plasmid pUC obtained in [1-4] of Example 1 above
-V _H, base sequence of the DNA contained in the pUC-V _L (see SEQ ID NO: 1 of the Sequence Listing), using a mix sense primer mixes antisense primer prepared in [1-2] [1- 3] obtained by performing PCR. Mixed sense primers and mixed antisense primers are used as primers by mixing some possible primers because the sequence of the primer portion cannot be specified, and a mixture of sequences slightly different from the original sequence It is. Since these primers are similar to the original sequence, those with a slightly different sequence can be used as primers for cDNA extension, but the base sequence of the resulting DNA may be slightly different from the true sequence. is there.

In this Example 5, the purpose was to investigate the true base sequence of the DNA encoding the variable region of the anti-Fas antibody, and the plasmid pUC obtained in [1-4] was used.
Over V _H, the DNA contained in the pUC-V _L as a probe, picked a DNA having a true nucleotide sequence from a cDNA library revealed that nucleotide sequence. The experimental procedure is shown below.

The aforementioned hybridoma CH11 was replaced with DMEM.
Cultivated in / 10% FCS, and from a cell number of 1 × 10 ⁷
k Prep m-RNA Purification Kit (Pharmacia)
Was used to prepare polu RNA. Its mRNA5
From μg, a first strand cDNA was synthesized using a ZAP cDNA synthesis kit (Stratadyne), then a second strand c-DNA was synthesized, and a linker (EcoRI, having an Xho-I site) was further added. After ligating, the cDNA was ligated to EcoRI / Xho of Uni-ZAP XR vector in ZAP cDNA synthesis kit.
-Incorporated into the I site. Next, ZAP cDNA Gigapack II
VC using I Gold Cloning Kit (Stratadine)
It was packaged in MG13 phage to prepare a cDNA library.

The phage was used in the kit for E. coli. coli /
XL-I blue was infected and plaques were formed on the medium. A Hybond-M + membrane (Amersham) was placed thereon, and the plaque was transferred to the membrane. Then, the membrane was treated with 1.5M NaCl / 0.5M.
2 min in NaOH, then 1.5 M NaCl / 0.5 M
Tris-HCl (pH 8.0) for 5 minutes, 0.2M T
The plate was washed with ris-HCl (pH 7.5) / 2 × SSC for 30 seconds and air-dried. Next, ECL direct nucleicacid lab
Using the elling and detection system (manufactured by Amersham), pUC-V _H obtained in “1-4] of Example 1,
After labeling with pUC- _VL as a probe and incubating with the membrane for hybridization, the membrane was washed.

Next, the membrane was subjected to Hyper-film ECL
(Amersham) and exposed for 5 minutes. Positive plaque was isolated from the medium based on the film. Thereafter, the positive phage was transformed into E. coli using the Uni-ZAP XR Vector Cloning Kit (Stratadyne). co
li / SOLR strain was infected, and phagemid was excised from Uni-ZAP XR DNA in the phage.

Next, E.I. coli / SOLR stra
The phagemid DNA was purified from in by the alkaline SDS method. This phagemid DNA was converted into pBluesc
The sequences were named "rip- _VH" and "_VL", and the sequences were confirmed by the dideoxy method. These base sequences are shown in SEQ ID NOs: 5 and 6 in the sequence listing, respectively. The amino acid sequence encoded by each DNA is uniquely the amino acid sequence of SEQ ID NO: 7 and SEQ ID NO: 8. [Example 6] Human type antibody-another example of Example 3 [6-1] Construction of expression vector The plasmid obtained above was used to convert a mammalian cell expression vector BCMGSneo (see Fig. 5, Karasuyama, H .,
Kudo, A., Melchers, F .: J. Exp.Med., 172: 969-972 (199
0) for incorporation in), and the pBluescript-V _H and pBluescript-V _L, respectively a template pUC-C _H and pUC-C _L, NV shown in Table 4
Using _H 5, NV _L 5 primers and NC _H 3, NC _L 3 primers, PCR was carried out by Pfu polymerase.
Here, NV _H 5, NV _L 5 primer contains an ATG codon (indicated by shaded in Table 4) and XhoI site (indicated by underlining in Table _{4), NC H 3, NC} L 3 primers St
Includes op codons (shaded in Table 4) and NotI sites (underlined in Table 4). The base sequence of each primer is also shown in SEQ ID NOs: 25 to 32 in the sequence listing.

[0045]

[Table 4]

[0046] In FIG. 5, CMV _P cytomegalovirus promoter, poly (A) poly (A) addition signal, Intron intron for splicing,
Neo ^R represents the neomycin resistance gene, Amp ^R represents the ampicillin resistance gene, and ori represents the origin of replication.

PCR is performed by using pBluescript of the template DNA.
Primers NV _H 5 and NV _H 3 are used for pt-V _H, using primers NV _L 5 and NV _L 3 for pBluescript-V _L, primer NC _H 5 for pUC-C _H the NC _H 3 used as, using primers NC _L 5 and NC _L 3 for pUC-C _L. After confirming and purifying each fragment by electrophoresis, these fragments were phosphorylated using T4 kinase (New England Biolabs: NEB), treated with restriction enzymes, and then treated with T4 DNA ligase (NE).
NV _L and NC _L, the NV _H and NC _H were ligated respectively with B), the BCMGSneo vector XhoI
Site and NotI site, and these plasmids were named BCMG-H and BCMG-L.

[6-2] Transfection of Chimeric Antibody Expression Vector 35 min.
After culture in DMEM / 10% FCS in a 50% confluent state in a culture dish, the cells were washed twice with DMEM and CHO-SFM medium (serum-free medium, GIBCO)
3 ml was added. Simultaneously purified BCMG-H, BCM
GL plasmid DNA (3 μg), Lipofectin (Takara Shuzo), 12 μl, and CHO-SFM medium (100 μl) were incubated at room temperature for 15 minutes to give Lipofectin-D.
An NA complex was formed. This lipofectin-DNA solution was added to CHO and cultured for about 4 hours. Thereafter, the medium was treated with DMEM containing 500 μg / ml of neomycin.
After changing to / 10% FCS and culturing for about one week, drug-resistant strains were screened.

[6-3] Detection of Chimeric Antibody (Human Antibody) To 15 μl of culture supernatant obtained by culturing a resistant strain (hereinafter referred to as “chimeric cell”), 5 μl of a three-fold concentrated sample buffer was added, and 12.5% After electrophoresis on a gel,
Blot on membrane and put the membrane on 10
μg / ml anti-human κ light chain antibody (Medical Biology Laboratories) or anti-human γ heavy chain antibody (Medical Biology Laboratories)
After reacting with a peroxidase-labeled secondary antibody (anti-goat immunoglobulin) and adding a chromogenic substrate to form a membrane, as shown in FIG.
A light chain was detected at the position of Kd and a heavy chain was detected at a position of about 50 Kd. In FIG. 6, M is a molecular weight marker, NHS is normal human serum, 1 to 7 are clones transfected with an H chain vector and an L chain vector,
L1 and L2 indicate clones transfected only with the L chain vector, and H1 and H2 indicate clones transfected only with the H chain vector.

Example 7 Properties of Chimeric Antibody (Human-type Antibody) A culture supernatant obtained by culturing chimeric cells in a CHO-SFM medium for about 5 days was concentrated to 1 in 10 with an ultrafilter, and Fas-expressing cells were obtained. Was performed using WR19L12a cell as a control and WR19L cell (Fas non-expressing cell) as a control.

1 × 10 ⁵ washed with PBS / 1% BSA
After blocking by reacting 20 μl of normal goat serum with these cells, an anti-GST antibody (culture supernatant, mouse negative control), normal rabbit serum (diluted to 1000-fold volume, hereinafter referred to as 1000-fold dilution), normal Human serum (1000-fold dilution), anti-Fas antibody (hybridoma ZB4, 10 μg / ml), chimeric antibody culture supernatant (concentrated to 1 / 10-fold volume, hereinafter referred to as 1 / 10-fold concentration), anti-human γ Heavy chain antibody (rabbit, 10 μg / ml)
Was reacted at room temperature for 30 minutes, and PBS /
Washed with 1% BSA. Chimeric antibody culture supernatant (1/10
A double-concentration and normal human serum (100-fold dilution) were reacted with an anti-human γ heavy chain antibody (rabbit, 1-fold).
(0 μg / ml) for 30 minutes and washed with PBS / 1% BSA. Next, after reacting with FITC-labeled anti-rabbit immunoglobulin antibody or FITC-labeled anti-mouse immunoglobulin antibody for 30 minutes, the plate was washed with PBS / 1% BSA,
Suspended in 200 μl of PBS / 1% BSA. Flow cytometry was performed using the cells. FIG. 7 shows the result. Table 5 summarizes the description of each graph in FIG.

[0052]

[Table 5]

As shown in FIG. 7, the chimeric antibody was anti-Fas
As with the monoclonal antibody (hybridoma ZB4), it reacts with WR19L12a, which is a Fas-expressing cell,
It did not react with WR19L which is a non-Fas expressing cell. The anti-GST antibody, normal rabbit serum and normal human serum used as negative controls were WR19L1
No reaction was observed for both 2a and WR19L. Similarly, no reaction was observed with only the anti-human γ heavy chain antibody.

In the same manner, WR19L12a and WR19
L to an anti-Fas monoclonal antibody (Hybridoma CH
11, culture supernatant), the culture supernatant of the chimeric antibody, the anti-GST antibody, and the anti-human γ heavy chain antibody were allowed to react with each other, and were observed under a fluorescence microscope. The results are shown in FIGS.
As is clear from these photographs, WR19L12a is an anti-Fas monoclonal antibody (hybridoma CH1).
1, see FIG. 8) and the chimeric antibody (see FIG. 9) were stained in the same pattern, but were not stained with the anti-GST antibody (see FIG. 10) and the anti-human γ heavy chain antibody (see FIG. 11). WR19L is an anti-Fas monoclonal antibody (hybridoma CH11) or a chimeric antibody.
No staining was observed with the ST antibody (see FIGS. 12 to 14). From these, it was confirmed that the chimeric antibody did react with the Fas antigen.

Next, the apoptotic activity of the chimeric antibody was determined using W
MTT using R19L12a and WR19L cells as materials
It was measured by the assay method. The MTT assay is a method for measuring cell proliferation ability and cell viability without using an isotope. For evaluation of cell proliferation and cytotoxicity, ³ H
-Although the incorporation of thymidine into the cell nucleus is often used, there is an inconvenience that available researchers are limited due to various restrictions on the handling of isotopes. In contrast, the MTT assay does not have such disadvantages. MTT (3- (4,5-Dimethylthiazol-2-yl) -2,5-Di-ph
Nyl tetrazolium bromide) is a pale yellow substance, and is known to be cleaved into dark blue harmazan by enzymes present in mitochondria of living cells (dead cells cannot cleave MTT). The MTT assay is an assay utilizing such properties of MTT, and by using an MTT colorimetric method instead of ³ H-thymidine,
Cell proliferation ability can be measured.

The MTT assay was carried out using a commercially available kit (Chemicon International, MTT Assay). That is, 1 × each cell was placed in a 96-well microplate.
50 μl per well at a concentration of 10 ⁵ / ml, 5
After 0 μl of the antibody was reacted and cultured overnight, MTT (5
mg / ml, Chemicon International
nal INC) was added, and after culturing for 4 hours,
100 μl of a mixed solution of isopropanol and hydrochloric acid was added, and the ratio of the absorbance at a wavelength of 570 nm to the absorbance at a wavelength of 620 nm (A570 / 620) was measured. Antibody is anti-F
as monoclonal antibody (hybridoma CH11) culture supernatant (same as used for flow cytometry), chimeric cell culture supernatant (10-fold concentrated), chimeric cell culture supernatant (10-fold concentrated) + anti-human γ heavy chain The antibody (final concentration 10 μg / ml) and DMEM / 10% FCS were reacted respectively.

The results are as shown in FIGS.
That is, as is clear from FIG. 15, when a mixture of the chimeric cell culture supernatant and the anti-human γ heavy chain antibody was reacted, WR
Apoptosis activity was observed in 19L12a as in the case of the anti-Fas monoclonal antibody (hybridoma CH11), but only a little apoptotic activity was observed in the case of the chimeric antibody alone, and only the anti-human γ heavy chain antibody was observed.
Alternatively, no apoptotic activity was observed in DMEM / 10% FCS. As is clear from FIG. 16, apoptosis could not be induced in any of WR19L.

The reason why such a result is obtained is considered as follows. That is, Fa on the cell surface
The s antigen is known to be a trimer, and it is considered that apoptosis is induced by crosslinking these three Fas antigens with an anti-Fas antibody (Fas ligand). Since the anti-Fas monoclonal antibody (hybridoma CH11) is an IgM class antibody and a pentameric antibody, it is considered that it can crosslink the Fas antigen and can induce apoptosis by itself.

On the other hand, since IgG class antibodies such as chimeric antibodies are monomers, they react with the Fas antigen but do not easily crosslink the Fas antigen, and it is considered that only low apoptotic activity was obtained by itself. . The low apoptotic activity in this case is considered to be due to spontaneous aggregation of the chimeric antibodies. On the other hand, IgG such as anti-human γ heavy chain antibody
When a substance that crosslinks the antibody coexists, it is considered that the chimeric antibody is crosslinked by the anti-human γ heavy chain antibody and acts as a multimer, resulting in markedly improved apoptotic activity (cell viability of 20% or less).

From the above, it was revealed that the present chimeric antibody is an antibody that can react with the Fas antigen expressed on cells and induce apoptosis.
As a result, the human-type antibody obtained in Example 6 was used in combination with a secondary antibody capable of cross-linking IgG to obtain mouse CH11.
Similar to the antibody, the human Fas antigen-overexpressing transformed cell WR
19L12a was found to have an effect of inducing apoptosis. Further, since the mouse CH11 antibody is a protein produced by a heterologous animal, when administered to humans, it may be discriminated from human proteins and eliminated from the human circulatory system or cause an allergic reaction.
Since human antibodies do not have such a possibility, they are promising as therapeutic agents for autoimmune diseases.

[0061]

[Sequence list]

SEQ ID NO: 1 Sequence length: 348 Sequence type: Nucleic acid Number of strands: Single stranded Topology: Linear Sequence type: cDNA sequence CAGGTCCAGC TGCAGGAGTC AGGACCTGAG CTGGTGAAAC CTGGGGCCTC AGTGAAGATA 60 TCCTGCAAGG CTTCTGGATA CACATTCACT GACTACGACA TGCACTGGGTGAGAGA ATTTATCCTT ACAATGGTGG TACTGGCTAC 180 AACCAGAAGT TCAAGAGCAA GGCCACATTG ACTGTTGACA ATTCCTCCAG CACAGCCTAC 240 ATGGAGCTCC GCAGCCTGTGAT ATCTGAGGAC TCTGCAGTCT ATTACTGTGC AAGAAGTTAC 300 Long sequence of the TATGCTATGG ACTACTGGGG CCAAGGGTCGCGTCG TG TGACT TG TGACT TG TGACT TG TGACT GG Type Sequence type: cDNA sequence GATGTTTTGA TGACCCAAAC TCCACTCTCC CTGCCTGTCA GTCTTGGAGA TCAAGCCTCC 60 ATCTCTTGCA GATCTAGTAA GAGCCTTGTA CACAGTAATG GAAACACCTA TTTACATTGG 120 TACCTGCAGA AGCCAGGC CAGTCATCGATCGATCGATCGATCGATCGATCGATCGATCTCAGTCGATCTCGATCGATCTCAGTCGATCTCAGTCGATCTCGATCGATCTCAGTCGATCTCAGTCGATCTCAGTCGATCTCAGTCGATCTCAGTCGATCTCAGTCGATCTCAGTCGATCTCAGTCGATCTCAGTCGATCTCAGTCGATCGATCCATCGATCGATCGATCGATCGATCGATCGATCGATCTCCAGGTCAG AGGA TCTGGGAGTT TATTTCTGCT CTCAAAGTAC ACATGTTCCT 300 CCGGCGTTCG GTGGAGGCAC CAAGCTGGAA ATCAAACGG 339 Sequence No .: 3 Sequence length: 116 Sequence type: Amino acid Topology: Linear Sequence type: Protein Sequence Gln Val Gln Leu Gln Glu Ser Gly Pro Glu Leu Vals Pro Gly 1 5 10 15 Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr 20 25 30 Asp Tyr Asn Met His Trp Val Lys Gln Ser His Gly Lys Ser Leu 35 40 45 Glu Trp Ile Gly Tyr Ile Tyr Pro Tyr Asn Gly Gly Thr Gly Tyr 50 55 60 Asn Gln Lys Phe Lys Ser Lys Ala Thr Leu Thr Val Asp Asn Ser 65 70 75 Ser Ser Thr Ala Tyr Met Glu Leu Arg Ser Leu Thr Ser Glu Asp 80 85 90 Ser Ala Val Tyr Tyr Cys Ala Arg Ser Tyr Tyr Ala Met Asp Tyr 95 100 105 Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 110 115 SEQ ID NO: 4 Sequence length: 113 Sequence type: Amino acid Topology: Linear Sequence type : Protein sequence Asp Val Leu Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu 1 5 10 15 Gly Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Val 20 25 30 His Ser Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro 35 40 45 Gly Gln Ser Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe 50 55 60 Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 65 70 75 Phe Thr Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Leu Gly Val 80 85 90 Tyr Phe Cys Ser Gln Ser Thr His Val Pro Pro Ala Phe Gly Gly 95 100 105 Gly Thr Lys Leu Glu Ile Lys Arg 110 SEQ ID NO: 5 Sequence length: 405 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: cDNA sequence ATGGGATGGA GCTGGATCTT TCTCTTCCTC CTGTCAGGAA CTGCAGGCGT CCACTCTGAG 60 GTCCAGCTTC AGCAGTCAGG ACCTGAGCTG GTGAAACCTG GGGCCTCAGT GAAGATATCC 120 TGCAAGGCTT CTGGATACAC ATTCACTGAC TACAACATGC ACTGGGTGAA GCAGAGCCAT 180 GGAAAGAGCC TTGAGTGGAT TGGATATATT TATCCTTACA ATGGTGGTAC TGGCTACAAC 240 CAGAAGTTCA AGAGCAAGGC CACATTGACT GTTGACAATT CCTCCAGCAC AGCCTACATG 300 GAGCTCCGCA GCCTGACATC TGAGGACTCT GCAGTCTATT ACTGTGCAAG AAGTTACTAT 360 GCTATGGACT ACTGGGGTCA AGGAACCTCA GTCACCGTCT CCTCA 405 SEQ ID NO: 6 Sequence length: 396 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: cDNA Sequence ATGAAGTTGC CTGTTAGGCT GTTGGTGCTG ATGTTCTGTG TTCCTGTCTCGTCATGAGTGTCTCGTCAGT TTGGAGATCA AGCCTCCATC 120 TCTTGCAGAT CTAGTAAGAG CCTTGTACAC AGTAATGGAA ACACCTATTT ACATTGGTAC 180 CTGCAGAAGC CAGGCCAGTC TCCAAAGCTC CTGATCTACA AAGTTTCCAA CCGATTTTCT 240 GGGGTCCCAG ACAGGTTCAG TGGCAGTGGA TCAGGGACAG ATTTCACACT CAAGATCAGC 300 AGAGTGGAGG CTGAGGATCT GGGAGTTTAT TTCTGCTCTC AAAGTACACA TGTTCCTCCG 360 GCGTTCGGTG GAGGCACCAA GCTGGAAATC AAACGG 396 SEQ ID NO: 7 length of sequence: 135 SEQ type: Amino acid Topology: linear Sequence type: protein sequence Met Gly Trp Ser Trp Ile Phe Leu Phe Leu Leu Ser Gly Thr Ala 1 5 10 15 Gly Val His Ser Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu 20 25 30 Val Lys Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly 35 40 45 Tyr Thr Phe Thr Asp Tyr Asn Met His Trp Val Lys Gln Ser His 50 55 60 Gly Lys Ser Leu Glu Trp Ile Gly Tyr Ile Tyr Pro Tyr Asn Gly 65 70 75 Gly Thr Gly Tyr Asn Gln Lys Phe Lys Ser Lys Ala Thr Leu Thr 80 85 90 Val Asp Asn Ser Ser Ser Thr Ala Tyr Met Glu Leu Arg Ser Leu 95 100 105 Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Ser Tyr Tyr 110 115 120 Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser 125 130 135 SEQ ID NO: 8 Sequence length: 132 Sequence type: Amino acid Topology: Linear Sequence type: Protein Sequence Met Lys Leu Pro Val Arg Leu Leu Val Leu Met Phe Trp Ile Pro 1 5 10 15 Ala Ser Ser Ser Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu 20 25 30 Pro Val Ser Leu Gly Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser 35 40 45 Lys Ser Leu Val His Ser Asn Gly Asn Thr Tyr Leu His Trp Tyr 50 55 60 Leu Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Lys Val 65 70 75 Ser Asn Arg Phe Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly 80 85 90 Ser Gly Thr Asp P he Thr Leu Lys Ile Ser Arg Val Glu Ala Glu 95 100 105 Asp Leu Gly Val Tyr Phe Cys Ser Gln Ser Thr His Val Pro Pro 110 115 120 Ala Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg 125 130 SEQ ID NO: 9 Sequence length: 21 Sequence type: Nucleic acid Number of strands: Single stranded Topology: Linear Sequence type: Other nucleic acid Synthetic DNA ( _VH mix sense primer) Sequence characteristics Location: 1 Other information: N = G or C Location: 6 Other information: N = G or C Location: 7 Other information: N = A or C Location: 12 Other information: N = G or T Location: 13 Other Information: N = G or C Location: 16 Other information: N = G or C Location: 21 Other information: N = A or T sequence NAGGTNNAGC TNNAGNAGTCN SEQ ID NO: 10 Sequence length: 21 Sequence type : the number of nucleic acid strands: single strand topology: linear sequence type: wherein the location of the other nucleic acid synthesis DNA (V _H mix antisense off DEG primer) sequence: 3 other Information: N = A or C Location: 10 Other information: N = G or T Location: 15 Other information: N = G or C Location: 16 Other information: N = A or C Sequence TGNGGAGATN GTGANNGTGG T SEQ ID NO: 11 Sequence length: 21 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA ( _VL mixsense primer) Sequence characteristics Location: 3 Other information: N = A or C or T Location: 4 Other information: N = A or G Location: 7 Other information: N = G or T Location: 10 Other information: N = A or C Location: 18 Other information: N = A or G Location: 19 Other information: N = A or T Sequence GANNTTNTGN TGACCCANNC T SEQ ID NO: 12 Sequence length: 21 Sequence type: Nucleic acid Number of strands: One stranded topology: linear sequence type: wherein the location of the other nucleic acid synthesis DNA (V _L mix antisense off DEG primer) sequence: 7 other information: N = C also G or T Location: 9 Other information: N = G or T Location: 10 Other information: N = C or T Sequence CCGTTTNANN TCCAGCTTGG T SEQ ID NO: 13 Sequence length: 23 Sequence type: Nucleic acid number: single strand topology: linear sequence type: other nucleic acid synthesis DNA (C _H Sensufu ° primer) sequence GCCTCCACCA AGGGCCCATC GGT SEQ ID NO: 14 length of sequence: 23 SEQ types: the number of nucleic acid strands: single chain topology: linear sequence type: other nucleic acid synthesis DNA (C _H antisense off DEG primer) sequence TTTACCCGGA GACAGGGAGA GGC SEQ ID NO: 15 SEQ length: 20 type of sequence: number of a nucleic acid strand: single strand topology: linear sequence type: other nucleic acid synthesis DNA (C _L Sensufu ° primer) sequence ACTGTGGCTG CACCATCTGT SEQ ID NO: 16 SEQ length: 20 type of sequence: number of a nucleic acid strand: single strand topology: linear sequence type: other nucleic acid synthesis DNA (C _L antisense off ° Reimer Sequence ACACTCTCCC CTGTTGAAGC SEQ ID NO: 17 Length of sequence: 30 SEQ types: the number of nucleic acid strands: single strand Topology: linear sequence type: other nucleic acid synthesis DNA (V _H 5 off DEG primer) sequence AAGCTTATGC AGGTCCAGCT GCAGGTGTCA sequence ID NO: 18 length of sequence: 21 SEQ types: the number of nucleic acid strands: single strand topology: linear sequence type: other nucleic acid synthesis DNA (V _H 3 full ° primer) sequence TGACGAGACG GTAACCGTGG T SEQ ID NO: 19 sequence length: 21 sequence types: the number of nucleic acid strands: single strand topology: linear sequence type: other nucleic acid synthesis DNA (C _H 5 off DEG primer) sequence GCCTCCACCA AGGGCCCATC G SEQ ID NO: 20 SEQ length: type 30 sequence: the number of a nucleic acid strand: single strand topology: linear sequence type: other nucleic acid synthesis DNA (C _H 3 full ° primer) sequence GGATCCCTAT TTACCCGGAG ACAGGGAGAG SEQ ID NO: 21 length of sequence: 30 type of sequence : Nucleic acid Number of strands: Single strand Topology: Chain sequence type: other nucleic acid synthesis DNA (V _L 5 off DEG primer) sequence AAGCTTATGG ATGTTTTGAT GACCCAAACT SEQ ID NO: 22 SEQ Length: 21 SEQ types: the number of the nucleic acid strand: single strand Topology: linear sequence type: other nucleic acid synthetic DNA (V _L 3 full ° primer) sequence CCGTTTGATT TCCAGCTTGG T SEQ ID NO: 23 SEQ length: 21 sequence types: the number of nucleic acid strands: single strand topology: linear sequence type: other nucleic acid synthesis DNA (C _L 5 off DEG primer) sequence ACTGTGGCTG CACCATCTGC T SEQ ID NO: 24 SEQ length: 30 sequence types: the number of nucleic acid strands: single strand topology: linear sequence type: other nucleic acid synthesis DNA ( C _L 3 full ° primer) sequence GGATCCCTAA CACTCTCCCC TGTTGAAGCT SEQ ID NO: 25 SEQ length: 30 type of sequence: number of a nucleic acid strand: single strand topology: linear sequence type: other nucleic acid synthesis DNA (NV _H 5 off DEG Reimer ) Sequence CCGCTCGAGA TGGGATGGAG CTGGATCTTT SEQ ID NO Length of 26 sequence: 19 SEQ types: the number of nucleic acid strands: single strand Topology: linear sequence type: other nucleic acid synthesis DNA (NV _H 3 full ° primer) sequence TGAGGAGACG GTGACTGAG SEQ ID NO: 27 Length of sequence : 23 SEQ types: the number of nucleic acid strands: single strand topology: linear sequence type: other nucleic acid synthesis DNA (NC _H 5 off DEG primer) sequence GCTTCCACCA AGGGCCCATC GGT SEQ ID NO: 28 sequence length of 37 sequences type: number of nucleic acid strands: single strand topology: linear sequence type: other nucleic acid synthesis DNA (NC _H 3 full ° primer) sequence ATAAGAATGC GGCCGCTATT TACCCGGAGA CAGGGAG SEQ ID NO: 29 length of sequence: 30 SEQ type: nucleic acid number of strands: single strand topology: linear sequence type: other nucleic acid synthesis DNA (NV _L 5 off DEG primer) sequence CCGCTCGAGA TGAAGTTGCC TGTTAGGCTG SEQ ID NO: 30 SEQ length: 21 sequence types: the number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other Acid synthesis DNA (NV _L 3 full ° primer) sequence CCGTTTGATT TCCAGCTTGG T SEQ ID NO: 31 SEQ Length: 20 sequence types: the number of nucleic acid strands: single strand Topology: linear sequence type: other nucleic acid synthesis DNA ( NC _L 5 primer) Sequence ACTGTGGCTG CACCATCTGT SEQ ID NO: 32 Sequence length: 38 Sequence type: Nucleic acid Number of strands: Single stranded Topology: Linear Sequence type: Other nucleic acid Synthetic DNA (NC _L 3 primer) Sequence ATAAGAATGC GGCCGCTAAC ACTCTCCCCT GTTGAAGC

[Brief description of the drawings]

FIG. 1 is a restriction map of pUC.

FIG. 2 is a restriction map of pREP4.

FIG. 3 is a restriction map of pREP9.

FIG. 4 is an explanatory diagram showing a result of SDS-PAGE.

FIG. 5 is a restriction map of a cDNA expression vector BCMGSneo.

FIG. 6 After electrophoresis of a culture supernatant of a drug-resistant strain, transfer to a membrane and react with an anti-human κ light chain antibody or an anti-human γ heavy chain antibody, and then react with a labeled secondary antibody, and add a chromogenic substrate FIG. 4 is an explanatory diagram illustrating a state of a band when the membrane is colored.

FIG. 7: Fas antigen highly expressing cells (WR19L12a)
7 is a graph when flow cytometry was performed using a non-expressing cell (WR19L).

FIG. 8: Fas antigen highly expressing cells (WR19L12a)
7 is a photograph when fluorescent staining was performed using an anti-Fas antibody.

FIG. 9: Fas antigen highly expressing cells (WR19L12a)
Fig. 4 is a photograph when fluorescent staining was performed using a chimeric antibody.

FIG. 10: Fas antigen highly expressing cells (WR19L12
5A is a photograph when fluorescent staining was performed using a) and an anti-GST antibody.

FIG. 11: Fas antigen highly expressing cells (WR19L12
5 is a photograph when fluorescent staining was performed using a) and an anti-human γ heavy chain antibody.

FIG. 12 is a photograph when fluorescent staining was performed using a Fas antigen non-expressing cell (WR19L) and an anti-Fas antibody.

FIG. 13 is a photograph showing fluorescent staining using Fas antigen non-expressing cells (WR19L) and a chimeric antibody.

FIG. 14 is a photograph showing fluorescent staining using Fas antigen non-expressing cells (WR19L) and an anti-GST antibody.

FIG. 15: Fas antigen highly expressing cells (WR19L12
It is a graph when the cell survival rate after apoptosis induction is observed using a).

FIG. 16 is a graph showing cell viability after apoptosis induction using Fas antigen non-expressing cells (WR19L).

Claims (10)

[Claims] 1. A DNA encoding a variable region of a heavy chain of an anti-Fas antibody, which comprises a base sequence represented by GACTACAACATGCAC, TATATTTATCCTTACAATGGTGGTACTGGCTACAACCAGAAGTTCA
The base sequence represented by AGAGC, and AGTTACTATGCTATGGACTAC
A DNA comprising a base sequence represented by the formula: 2. A DNA encoding a variable region of a heavy chain of an anti-Fas antibody, which is SEQ ID NO: 1 or SEQ ID NO: 5 in the sequence listing.
2. The DNA according to claim 1, wherein the DNA comprises the base sequence shown in (1). 3. A DNA encoding a light chain variable region of an anti-Fas antibody, wherein the DNA comprises AGATCTAGTAAGAGCCTTGTACACAGTAATGG.
The nucleotide sequence represented by AAACACCTATTTACAT, AAAGTTTCCAACCG
The nucleotide sequence represented by ATTTTCT, and TCTCAAAGTACACATGTTC
D comprising a base sequence represented by CTCCGGCG
NA. 4. A DNA encoding a variable region of a light chain of an anti-Fas antibody, which is represented by SEQ ID NO: 2 or SEQ ID NO: 6 in the sequence listing.
4. The DNA according to claim 3, wherein the DNA comprises the base sequence shown in (1). 5. The variable region of the heavy chain is Asp Tyr Asn Met His
The amino acid sequence represented by Tyr Ile Tyr Pro Tyr Asn Gl
amino acid sequence represented by y Gly Thr Gly Tyr Asn Gln Lys Phe Lys Ser, and Ser Tyr Tyr Ala Met Asp Tyr
Wherein the constant region of the heavy chain is the constant region of the heavy chain of human immunoglobulin, and the variable region of the light chain is Arg Ser Ser Lys Ser Leu Val His
Includes the amino acid sequence represented by Ser Asn Gly Asn ThrTyr Leu His, the amino acid sequence represented by Lys Val Ser Asn Arg Phe Ser, and the amino acid sequence represented by Ser Gln Ser Thr His Val Pro Pro Ala. An anti-Fas antibody, wherein the region is a human immunoglobulin light chain constant region. 6. The variable region of the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 3 in the sequence listing, and the variable region of the light chain comprises the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing. 6. The anti-Fas antibody according to 5. 7. The variable region of the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 7 in the sequence listing, and the variable region of the light chain comprises the amino acid sequence shown in SEQ ID NO: 8 in the sequence listing. 6. The anti-Fas antibody according to 5. 8. The constant region of a heavy chain of a human IgG, wherein the constant region of the heavy chain is a constant region of a human IgG light chain, and the constant region of the light chain is a constant region of a human IgG light chain. Or the anti-Fas antibody described in 9. The anti-Fas antibody according to any one of claims 5 to 8, which has an apoptotic activity on cells expressing the Fas antigen. 10. The method according to any one of claims 5 to 8, wherein the use of IgG together with a crosslinkable secondary antibody enhances the apoptotic activity on cells expressing Fas antigen as compared with the case of using IgG alone. Anti-Fas antibody.