JPH10158261A - Xanthene derivative, its production and use - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide the subject novel compound that can be effectively utilized as a low-toxicity immunomodulator, for example, rejection reaction repressor on transplanting, for treatment of allergy, rheumatism and the like. SOLUTION: This is a compound represented by the formula (R<1> is carboxyl which may be esterified or amidated; R<2> is H, hydroxyl; R<3> and R<4> are each hydroxyl; R<5> and R<6> are each H, a halogen; R<7> is H, nitro or a halogen; n is an integer of 0-2; Y is an 0 atom or two H atoms) or its salt, typically 2 (carboxymethylsulfinyl)-5,7-dichloro-(3, 8-dihydroxy-6-methyl-9-oxo-9H-xanthene-l- carboxylic methyl ester. The compound of the formula is prepared by culturing a microorganism that is capable of producing the compound and collecting the objective compound accumulated in the culture medium.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to xanthene derivatives useful as medicaments such as immunomodulators.

[0002]

2. Description of the Related Art An immune reaction distinguishes between self and non-self,
It is a cellular or humoral response to eliminate non-self.
The immune system is a self-defense reaction performed by a living body when a foreign antigen including various infectious pathogens enters the living body, and is an important system to protect itself from foreign enemies. However, the breakdown or excessive reaction of this system causes this reaction to act as an injury to oneself, causing many diseases such as autoimmune diseases and allergies. Controlling the immune response can ameliorate many diseases caused by the breakdown or excess of these immune systems. Recent advances in medical technology have made organ transplants possible. Even during this organ transplantation, the immune response of the living body is greatly hindered, and it is necessary to suppress the immune response in order for the graft to survive. In addition, immunocompetent cells are involved in the inflammatory response, and an excessive immune response directly leads to an exacerbation of the inflammatory response.
Therefore, many chronic inflammatory diseases such as rheumatism and nephritis can be ameliorated by suppressing the immune response. The starting point of an immune response begins when T cells recognize an antigen presented by an antigen presenting cell via a T cell receptor (hereinafter abbreviated as TCR). T cells that recognize the antigen are activated, and interleukin 2
(Hereinafter, abbreviated as IL-2) and cytokine production and proliferation start. In recent years, recognition of antigen peptides by TCR alone is not enough for sufficient activation of T cells, and at the same time, costimulatory
It has become apparent that transmission of a signal called a signal is necessary. If the T cells only receive antigen stimulation via the TCR and no costimulatory signal is supplied, not only will the T cells not be activated, but also in an antigen-specific unresponsive state (anagy, ie, once again via the TCR). And the costimulatory signal is not activated at all. T cells are c
Depending on the presence or absence of an ostimulatory signal, antigen stimulation leads to a completely opposite state of activation or anergy.

[0003] A B7 / CD28 ligand receptor has attracted attention as a molecule responsible for this costimulatory signal. B7 is an antigen presenting cell or activated B
CD28 is expressed on the cell surface and CD28 is expressed on the surface of T cells.
Transmitted to cells (Annual Review of Immunology) 1993, 11:19
1-212). B7 has two kinds of molecules B7-1 (CD80)
And B7-2 (CD86) are known, and since their expression timings on the surface are different, it is presumed that their roles also differ. Receptors that bind to ligand B7 include CD28, which transduces activation signals.
In addition, there is CTLA-4 which is considered to have a negative control. CTLA
-4 is expressed on activated T cells, but is thought to function to induce T cells into apoptosis by binding to B7 to terminate the immune response. It has been reported that the binding activity to B7 is one order stronger for CTLA-4 than for CD28. All of these molecules are proteins belonging to the immunoglobulin superfamily. Attempts to inhibit this costimulatory signal to acquire non-responsiveness to a specific antigen have been widely studied, and antibodies against B7 as a ligand and solubilized forms of CD28 and CTLA-4 as receptors have been tried as inhibitors. Has been shown to achieve the expected results (Annual Review of Immunology) 1993, 11: 191-21
2).

[0004]

Conventionally, low-molecular-weight compounds include antimetabolites which suppress the proliferation of activated immunocompetent cells and steroids which are considered to have an effect of suppressing the production of various cytokines. It has been widely used for suppression. All of these have strong side effects and cannot be said to specifically act on immunocompetent cells. In recent years, cyclosporin A and FK506 have been found as agents for suppressing the signal of T cell activation by antigen stimulation, and have come to be widely used for immunosuppression at the time of organ transplantation. However, these drugs have high specificity to the immune system, but also show considerable toxicity. A drug that inhibits a costimulatory signal can be expected not only to inhibit the activation of immunocompetent cells but also to inhibit an antigen-specific immune response, that is, to induce an unresponsive state to a specific antigen. In such a situation, it is possible to ameliorate only a disease caused by a hyperimmune reaction raised against a specific antigen without impairing the broad immune response of the living body. In particular, it is advantageous for immunosuppression during organ transplantation and prevention of allergic reactions.
Attempts to inhibit the signal using antibodies against molecules involved in the stimulatory signal have been made and the expected effects have been obtained. Therefore, a low-molecular compound having such an effect opens a new way of immunotherapy as an antigen-specific immunosuppressant.

[0005]

Means for Solving the Problems In view of such circumstances, the present inventors sought a drug that inhibits the binding between B7-1 and CD28 among microbial metabolites. Succeeded in isolating a new compound named 24221 from the culture broth, and the compound was identified as B7-1 and CD
It was found not only to inhibit binding of G.28 but also to block B7-1 dependent T cell activation. The present inventors have further studied based on these findings, and have completed the present invention.

That is, the present invention provides:

Embedded image

[Wherein, R ¹ represents a carboxyl group which may be esterified or amidated, R ² represents a hydrogen atom,
A hydroxyl group or an optionally substituted hydrocarbon group, R ³ and R ⁴ are the same or different and optionally substituted hydroxyl groups, and R ⁵ and R ⁶ are the same or different and represent a hydrogen atom or a halogen atom; , R ⁷ represents a hydrogen atom, a nitro group, a halogen atom, an optionally substituted hydrocarbon group, an optionally substituted heterocyclic group or an optionally substituted acyl group, and n represents an integer of 0 to 2. , Y represents an oxygen atom or two hydrogen atoms, and when n is 0, R
² is the expression

[0008]

Embedded image (The symbols in the formulas may be the same as defined above) or a salt thereof.

(2) The compound according to the above (1), wherein R ⁷ is a hydrogen atom or a halogen atom. (3) R ² is —CH ₂ (CHOH) m -R ² ′ wherein m is 0
Or 1, a group represented by R ² 'represents a hydroxymethyl group which may optionally be better carboxyl group or a substituted may be esterified or amidated], R ⁷ is a hydrogen atom, Y is an oxygen atom the compounds of paragraph (1), wherein it is, (4) R ² is (1) hydrogen atom, (2) hydroxyl group or (3)
(a) C _1-8 alkoxy-carbonylcarbonyl, (b) carboxyl which may be esterified or amidated, (c) hydroxyl which may be acylated, (d) C
_1-10 alkyl, C _1-6 alkanoyl, amino optionally having C _1-6 alkylsulfonyl or C _6-14 arylsulfonyl, (e) C _1-6 alkoxy, (f) cyano, (g) Sulfo, (h) C _1-6 alkyl, C _1-6 alkoxy, nitro,
A 5- or 6-membered heterocyclic group optionally having cyano, amino, halogen atom, hydroxyl or oxo,
(i) nitro, (j) halogen atom, (k) C _1-6 alkyl and
(l) C optionally substituted with a group selected from oxo
_1-19 hydrocarbon groups, wherein R ³ and R ⁴ are the same or different
(a) an acyl group or (b) a hydroxyl group optionally having a substituted C _1-10 alkyl group as a substituent, R ⁷ is (1) a hydrogen atom, (2) a nitro group, 3) halogen atom, (4) (a) carboxyl which may be esterified or amidated, (b) hydroxyl which may be acylated, (c) C _1-10 alkyl, C _1-6 alkanoyl, Amino optionally having C _1-6 alkylsulfonyl or C _6-14 arylsulfonyl, (d) C _1-6 alkoxy, (e) cyano, (f) sulfo, (g) C _1-6 alkyl, C _1-6 alkoxy, nitro, cyano, amino, halogen atom, 5- or 6-membered heterocyclic group optionally having hydroxyl or oxo, (h) nitro, (i) halogen atom and (j) oxo chosen optionally substituted C _1-19 optionally hydrocarbon group group, (5) (a) C 1-6 alkyl, even (b) esterification Ku is optionally amidated carboxyl, (c) acylated or unprotected hydroxyl, (d) C _1-10 alkyl, C _1-6 alkanoyl, C _1-6 alkylsulfonyl or C _6-14 aryl Amino optionally having sulfonyl, (e) C _1-6
5- or 6-membered heterocyclic group which may be substituted with a group selected from alkoxy, (f) cyano, (g) sulfo, (h) nitro, (i) halogen atom and (j) oxo, or a fused heterocyclic group thereof (6) (a) C _1-6 alkyl, (b) carboxyl which may be esterified or amidated, (c) hydroxyl which may be acylated, (d) C _1-10 Amino optionally having alkyl, C _1-6 alkanoyl, C _1-6 alkylsulfonyl or C _6-14 arylsulfonyl, (e) C _1-6
Alkoxy, (f) cyano, (g) sulfo, (h) C _{1 -6} alkyl, C _1-6 alkoxy, nitro, cyano, amino, halogen atom, hydroxyl or also may 5 or 6 membered optionally having oxo (1) The compound according to (1), which represents an acyl group which may be substituted with a heterocyclic group represented by (i) nitro, (j) a halogen atom and (k) a group selected from oxo,

(5) R ¹ is a carboxyl group which may be esterified, R ² is (1) a hydrogen atom, (2) a hydroxyl group, (3) (a) C _1-8 alkoxy-carbonylcarbonyl, (b) carboxyl, which may be esterified or amidated, (c) hydroxyl, which may be acylated, (d) C
_1-6 alkylsulfonyl or C _6-14 amino which may have arylsulfonyl, (e) C _1-6 alkoxy,
(f) a cyano, (g) a sulfo and (h) a C _1-10 alkyl group optionally substituted with a group selected from a 5- or 6-membered heterocyclic group optionally having hydroxyl or oxo, 4) C _2-8 alkenyl group optionally having carboxyl, or (5) (a) cyano, (b) carboxyl which may be esterified or amidated, (c) hydroxyl, (d) nitro , (E) a halogen atom and (f) a 5- or 6-membered nitrogen-containing heterocyclic group.
_7-19 aralkyl group, R ³ and R ⁴ are a hydroxyl group optionally substituted by C _1-7 acyl or a C _1-10 alkoxy group optionally substituted by C _1-6 alkoxy,
⁷ is (1) hydrogen atom, (2) nitro group, (3) halogen atom, (4)
A C _1-10 alkyl group, (5) (a) C _1-6 alkyl, (b) carboxyl, (c) C _1-6 alkoxy, (d) amino, (e) nitro or (f) or a halogen atom An optionally substituted C _6-14 aryl group, (6) a C _1-6 alkanoyl group or (7)
Item (1), which represents a 5- or 6-membered heterocyclic group containing 1 to 4 heteroatoms selected from nitrogen, oxygen and sulfur atoms other than carbon atoms, or a condensed heterocyclic group thereof with a benzene ring. Compound,

(6) R ¹ is a group represented by the formula —COOR ²⁸ [wherein R ²⁸
A group represented by hydrogen or C _1-6 substituted alkoxy show also good C _1-8 alkyl group], R ² is
(1) hydrogen atom, (2) hydroxyl group, (3) formula —CH ₂ (CHOR ^b ) m ¹ COOR ²⁹ [where m ¹ is 0 or 1, R ^b is a hydrogen atom or C _1-6 alkanoyl R ²⁹ is a hydrogen atom, or C _1-6 alkoxy, C _1-6
A C _1-8 alkyl group which may be substituted with alkanoyloxy or C _4-7 cycloalkoxycarbonyloxy.] (4) Formula —CH ₂ (CHOH) m ² CONR ³⁰ R ³¹ Medium, m ²
Represents 0 or 1, and R ³⁰ and R ³¹ are the same or different and represent a hydrogen atom or a C _1-8 alkyl group optionally substituted with carboxyl, C _1-6 alkoxy or C _2-5 alkoxycarbonyl. a group represented by, (5) ^{_{-CH 2 (CHOH) m 3 CONHS}} (= O) 2 R 32
[In the formula, m ³ represents 0 or 1, R ³² represents a C _1-4 alkyl group optionally substituted with 1 to 3 halogen atoms, or C _1-6 alkyl, nitro, C _1-6 alkoxy. Or a C _6-14 aryl group which may be substituted with a halogen atom], a group represented by the formula: —CH ₂ (CHOH) m ⁴ CONOROR ^{33 wherein} m ⁴
Represents 0 or 1, R ³³ represents a hydrogen atom or a C _1-4 alkyl group],

(7) Formula —CH ₂ (CHOH) m ⁵ R ³⁴ [wherein
m ⁵ is 0 or 1, R ³⁴ may contain 1 to 4 hydroxyl or oxo substituted by optionally nitrogen atoms in addition also good carbon atoms, heteroatoms selected from oxygen atom and sulfur atom 3 8-membered heterocyclic group (eg, 2-pyridyl group, 1H- or 2H-tetrazolyl group, 5-hydroxy-4H-pyran-4-one-2-yl group, etc.)
Groups represented by the _{indicating], (8) -CH 2 (CHOH} ) m 6 -CH 2 OR 35 wherein, m ⁶ is 0 or 1, R ³⁵ is a hydrogen atom, C _1-8 alkyl or C _1-6 alkanoyl group], (9) —CH ₂ (CHOH) m ⁷ —COCOOR ³⁶ [wherein, m ⁷
Represents 0 or 1, R ³⁶ represents a hydrogen atom or a C _1-8 alkyl group], (10) a C _2-8 alkyl group optionally substituted with a carboxyl group, or (11) a carboxyl group. , Cyano, halogen atom, nitro, hydroxyl, carbamoyl, _C2-5 alkoxycarbonyl or 3 to 8 member which may contain 1 to 4 heteroatoms selected from nitrogen atom, oxygen atom and sulfur atom in addition to carbon atom. A C _7-19 aralkyl group which may be substituted with a heterocyclic group (e.g., 1H- or 2H-tetrazolyl group)

R ³ is a group represented by the formula —OR ³⁷ wherein R ³⁷ represents a hydrogen atom, a C _1-8 alkyl group optionally substituted by C _1-6 alkoxy, or a C _1-6 alkanoyl group. In the formula, R ⁴ is a group represented by the formula (1) -OR ³⁸ [wherein R ³⁸ is a hydrogen atom, a C _1-8 alkyl group which may be substituted by C _1-6 alkoxy, a C _1-6 alkanoyl group; Or a C _7-11 aroyl group] or a group represented by the formula (2): -OCOOR ³⁹
Wherein R ³⁹ represents a C _1-6 alkyl group or a C _6-14 aryl group, and R ⁷ is (1) a hydrogen atom, (2)
Nitro group, (3) halogen atom, (4) C _1-8 alkyl group, (5)
A halogen atom, carboxyl, C _1-6 alkyl, C _1-6 alkoxy, C _6-14 aryl group optionally substituted by amino or nitro, (6) C _1-6 alkanoyl group or
(7) Condensation with a 3- to 8-membered heterocyclic group or a 6- to 8-membered carbocyclic or heterocyclic group containing 1 to 4 heteroatoms selected from nitrogen, oxygen, sulfur and the like in addition to carbon atoms The compound according to (1), which represents a heterocyclic group,

(7) R ² has the formula —CH ₂ COOR ⁴⁰ [wherein
R ⁴⁰ represents a hydrogen atom or a C _1-4 alkyl group which may be substituted by C _1-6 alkoxy, C _1-6 alkanoyloxy or C _4-7 cycloalkoxycarbonyloxy; R ³ and R ^{4 each} represent a hydroxyl group; R ⁵ and R ^{6 each} represent a chlorine atom; R ⁷ represents a hydrogen atom, a nitro group, a bromine atom or an iodine atom; (9) The compound according to (1), wherein Y is an oxygen atom,

(10) A compound represented by the formula

Embedded image A compound TAN-2421A1 represented by the formula:
⁵¹ and R ^{61 each} represent a chlorine atom], TAN-2421A
2 [in the above formula, R ⁵¹ represents a hydrogen atom, R ⁶¹ represents a chlorine atom], TAN-2421A3 [in the above formula, R ⁵¹ represents a chlorine atom, R ⁶¹ represents a hydrogen atom] or TAN-2421
A4 (wherein R ⁵¹ and R ^{61 each} represent a hydrogen atom).

(11) The compound represented by the formula

Embedded image A compound TAN-2421B1 represented by the formula:
⁵² and R ^{62 each} represent a chlorine atom], TAN-2421B
2 [wherein R ⁵² represents a hydrogen atom and R ⁶² represents a chlorine atom] or TAN-2421B3 [where R ⁵² represents a chlorine atom and R ⁶² represents a hydrogen atom]. ).

(12) The compound is (1) methyl 2- (carboxymethylsulfinyl) -5,7-dichloro-3,8-dihydroxy-6-methyl-9-oxo-9H-xanthene-1-carboxylate , (2) 2- (carboxymethylsulfinyl) -5,7-dichloro-3,8
-Dihydroxy-4-iodo-6-methyl-9-oxo-9H-xanthen-1-carboxylic acid methyl ester,
(3) 5,7-dichloro-3,8-dihydroxy-6-methyl-9-oxo-2- (pivaloyloxymethoxycarbonylmethylthio) -9H-xanthene-1-carboxylic acid methyl ester, (4) 5 , 7-Dichloro-3,8-
Dihydroxy-6-methyl-9-oxo-2- (pivaloyloxymethoxycarbonylmethylsulfinyl)-
9H-xanthene-1-carboxylic acid methyl ester, or (5) 5,7-dichloro-2- [1- (cyclohexyloxycarbonyloxy) ethoxycarbonylmethylthio] -3,8-dihydroxy-6-methyl-9-oxo The compound according to item (1), which is -9H-xanthene-1-carboxylic acid methyl ester, (13) a compound belonging to the genus Aspergillus, wherein compound TAN-24 is provided.
Culturing a microorganism capable of producing 21A1, A2, A3, A4, B1, B2 or / and B3 in a medium,
Compounds TAN-2421A1, A2, A3, in culture
The compound TAN-2421 according to the item (10) or / and (11), wherein A4, B1, B2 or / and B3 are produced and accumulated, and collected.
A1, A2, A3, A4, B1, B2 or / and B
(14) The compound TAN-2421A1, A2, A3, A4, B according to the above item (10) or / and (11).
A microorganism capable of producing 1, B2 or / and B3, Aspergillus terreus FL-67283
(15) a medicament comprising the compound according to (1) or a salt thereof, (16) a T cell signaling inhibitor comprising the compound according to (1) or a salt thereof, (17) the medicine according to (15), which is an immunomodulator; (18) the immunomodulator is a transplant rejection inhibitor, an allergy agent, a rheumatic agent, an autoimmune disease agent, a nephritis agent or diabetes. The medicament according to (17), which is a therapeutic agent,

(19) General formula

Embedded image [Wherein, R ¹ represents a carboxyl group which may be esterified or amidated, R ³ and R ⁴ represent a hydroxyl group which may be substituted the same or different, R ⁵ and R ⁶ represent a hydrogen atom or A halogen atom, R ⁷ is a hydrogen atom, a nitro group, a halogen atom, an optionally substituted hydrocarbon group, an optionally substituted heterocyclic group or an optionally substituted acyl group, and Y is an oxygen atom Or a compound represented by the formula (1) or a salt thereof, which is subjected to a reduction reaction and, if necessary, further subjected to a hydrocarbon group introduction reaction.

[0019]

Embedded image [Wherein R ² ′ ″ represents a hydrogen atom or a hydrocarbon group which may be substituted, and other symbols have the same meanings as described above]. Manufacturing method,

(20) (i) CHO containing CD28
The amount of binding between CD28 and B7-1-Ig when the cell or its cell membrane fraction and soluble B7-1-Ig are contacted;
(Ii) comparing the amount of binding between CD28 and B7-1-Ig when contacting CD28-containing CHO cells or a cell membrane fraction thereof, soluble B7-1-Ig and a test compound. A method for screening a compound having an activity of inhibiting or enhancing the binding between CD28 and B7-1 or a salt thereof, (21) (i) contacting B7-1-containing CHO cells or a cell membrane fraction thereof with T cells (Ii) comparing the amount of interleukin 2 produced when contacting CHO cells containing B7-1 or a cell membrane fraction thereof, T cells and a test compound with B7-1. (22) a method for screening a compound having an interleukin 2 production inhibitory activity or a salt thereof, which is obtained by using the screening method according to (20). A compound having an activity of inhibiting or enhancing the binding between CD28 and B7-1 or a salt thereof; (23) a compound having an interleukin-2 production inhibitory activity obtained by using the screening method according to (21), or (24) CHO cells designated as CD28-CHO-11 (FERM BP-5431), B7-1-CHO-
No. 22 (FERM BP-543)
0) or CHO cells designated as sB7-1-Ig-CHO-20 (FERM BP-5432).

In the above formula, as the esterified carboxyl group represented by R ¹ , for example, those which can be pharmacologically enjoyed or those which can be converted into those which can be enjoyed pharmacologically for the first time in vivo. Used. As the carboxyl group which may be esterified, a group represented by the formula -COOR ⁸ [wherein R ⁸ represents a hydrogen atom or a hydrocarbon group which may be substituted] is preferably used. . Examples of the hydrocarbon group represented by R ⁸ include C
_1-19 hydrocarbon groups are preferred, for example, (1) C _1-10 alkyl groups (eg, methyl, ethyl, propyl, isopropyl,
Butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, heptyl, octyl and the like, preferably a C _1-8 alkyl group, (2) a C _2-8 alkenyl group (eg, vinyl, allyl, isopropenyl, 1-propenyl, 2-butenyl, 3-butenyl, 2-hexenyl, 2-octenyl and the like, preferably a C _2-6 alkenyl group, (3) a C _2-8 alkynyl group (eg, ethynyl, 1-propynyl, -Propynyl, 1-butynyl, 2-butynyl, 3-butynyl, 2
-Hexynyl, 2-octynyl and the like, preferably C _2-8 alkynyl group), (4) C _3-6 cycloalkyl group (eg, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and the like), (5) C _6-14 aryl Groups (eg, phenyl, naphthyl, etc.) and (6) C _7-19 aralkyl groups (eg, benzyl, phenethyl, benzohydryl, trityl, etc.) and the like are used. Among them, a C _1-8 alkyl group, particularly a C _1-4 alkyl group (for example, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, etc.) and the like are preferable.

Among these hydrocarbon groups, the substituent for the C _1-10 alkyl group, C _2-8 alkenyl group or C _2-8 alkynyl group includes, for example, (1) (a) C _1-10 alkyl group (Eg, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, etc.), (b) C _1-6 alkanoyl group (eg, formyl, acetyl, propionyl,
Isopropionyl, butyryl, isobutyryl, valeryl, isovaleryl, pivaloyl, hexanoyl, etc.),
(c) C _7-11 aroyl group (eg, benzoyl, p-toluoyl, naphthoyl, etc.), (d) C _2-7 alkoxycarbonyl group (eg, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, butoxycarbonyl, tert-butoxy) Carbonyl), (e) C _8-14 aralkyloxycarbonyl group (eg, benzyloxycarbonyl, phenethyloxycarbonyl, etc.), (f) C _1-6 alkylsulfonyl group (eg, methylsulfonyl, ethylsulfonyl, propylsulfonyl, etc.) ) And (g) an amino group _optionally having one or two substituents selected from C _6-14 arylsulfonyl groups (eg, benzenesulfonyl, toluenesulfonyl, etc.); (2) (a) C _{1 -6} alkyl group, (b) C _7-19 aralkyl group (eg, benzyl, phenethyl, benzhydryl, etc.),
(c) a C _1-6 alkanoyl group, (d) a C _7-11 aroyl group and
(e) a hydroxyl group which may have a substituent selected from a C _4-7 cycloalkoxycarbonyl group (eg, cyclohexyloxycarbonyl and the like), (3) a carboxyl group, (4)
C _2-5 alkoxycarbonyl group (eg, methoxycarbonyl, ethoxycarbonyl, etc.), (5) C _8-14 aralkyloxycarbonyl group (eg, benzyloxycarbonyl, etc.), (6) carbamoyl group, (7) nitro group, (8) Halogen atom, (9) cyano group, (10) oxo group, (11) sulfo group and the like are used. The number of substituents is about 1 to 3. Among these substituents, for example, a hydroxyl group optionally substituted with a C _1-6 alkyl group, particularly a hydroxyl group substituted with methyl or ethyl, is preferred. Also, C _3-6
As the substituent for the cycloalkyl group, C _6-14 aryl group or C _7-19 aralkyl group, in addition to the above substituents, (a)
Halogen atom, (b) C _1-6 alkanoyl, (c) C _7-11 aroyl, (d) C _2-7 alkoxycarbonyl, (e) C _7-15 aryloxycarbonyl, (f) C _8-14 aralkyl Oxycarbonyl, (g) C _1-6 alkylsulfonyl, (h) C _6-14 arylsulfonyl, (i) hydroxyl, (j) carboxyl, (k) nitro, (l) having a substituent selected from cyano And a C _1-6 alkyl group which may be used.

As the amidated carboxyl group represented by R ¹ , for example, those which can be pharmacologically enjoyed or those which are converted into those which are pharmacologically enjoyable in the living body for the first time are used. The amidated carboxyl group preferably has the formula —CONR ⁹ R
^{10 wherein} R ⁹ and R ¹⁰ are the same or different and represent a hydrogen atom, a hydrocarbon group which may have a substituent or a heterocyclic group which may be substituted, and R ⁹ and R ¹⁰ May form a nitrogen-containing heterocyclic group which may have a substituent together with an adjacent nitrogen atom]. The optionally substituted hydrocarbon group represented by R ⁹ or R ¹⁰ has the same meaning as the aforementioned optionally substituted hydrocarbon group represented by R ⁸ . Above all,
As the hydrocarbon group, a C _1-8 alkyl group or the like is preferable. As the substituent, a hydroxyl group, a carboxyl group, a C _2-5 alkoxycarbonyl group and the like which may be substituted with an alkyl group such as a C _1-6 alkyl group are preferable.
Examples of the heterocyclic group of the heterocyclic group which may have a substituent represented by R ⁹ or R ¹⁰ include a hetero atom selected from a nitrogen atom, an oxygen atom, a sulfur atom and the like in addition to a carbon atom. A 3- to 8-membered, preferably 5- or 6-membered heterocyclic group containing 4 or a fused heterocyclic group thereof and a 6- to 8-membered carbocyclic or heterocyclic group (eg, 2- or 3-thienyl, -Or 3-furyl, 1-, 2- or 3-pyrrolyl, 3-, 4- or 5-pyrazolyl, 2-, 4- or 5-thiazolyl, 3-, 4- or 5-isothiazolyl, 2-, 4 -Or 5-oxazolyl, 3-, 4-
Or 5-isoxazolyl, 2-, 4- or 5-imidazolyl, 1,2,3- or 1,2,4-triazolyl, 1H- or 2H-tetrazolyl, 2-, 3- or 4-pyridyl, 2-, 4- or 5-pyrimidinyl,
3- or 4-pyridazinyl, quinolyl, isoquinolyl, indolyl, piperazinyl, morpholinyl, 2H-
Or 4H-pyranyl, 2-benzo [b] furanyl, etc.)
Are used.

Examples of the substituent of these heterocyclic groups include (1) (a) a nitro group, (b) a halogen atom, and (c) a C _1-6 alkoxy group (eg, methoxy, ethoxy, propoxy, isopropyl Propoxy, butoxy, isobutoxy, sec-butoxy,
tert-butoxy, etc.) and optionally having 1 to 3 substituents, a C _1-6 alkyl group, (2) (a) nitro group, (b)
A halogen atom, (c) a C _1-6 alkyl group, (d) a C _6-14 aryl group optionally having 1 to 4 substituents selected from a C _1-6 alkoxy group, (3) ( C _7- which may have 1 to 4 substituents selected from a) a nitro group, (b) a halogen atom, (c) a C _1-6 alkyl group, and (d) a C _1-6 alkoxy group A substitution selected from ₁₃ aralkyl groups, (4) (a) C _1-6 alkyl groups, (b) C _7-13 aralkyl groups, (c) C _1-6 alkanoyl groups and (d) C _7-11 aroyl groups A hydroxyl group which may have a group, (5) a carboxyl group, (6) a C _2-5 alkoxycarbonyl group, (7) a C _8-14 aralkyloxycarbonyl group, (8)
Carbamoyl group, (9) nitro group, (10) halogen atom, (1
1) (a) C _1-10 alkyl group, (b) C _7-13 aralkyl group, (c)
C _1-6 alkanoyl group, (d) C _7-11 aroyl group, (e) C _2-7
An alkoxycarbonyl group, (f) a C _8-14 aralkyloxycarbonyl group, (g) a C _1-6 alkylsulfonyl group and
(h) an amino group _optionally having 1 to 2 substituents selected from a C _6-14 arylsulfonyl group, (12) a cyano group,
(13) An oxo group, (14) a sulfo group and the like are used, and the number of substituents is about 1 to 5.

Examples of the nitrogen-containing heterocyclic group of the nitrogen-containing heterocyclic group which may have a substituent formed by R ⁹ and R ¹⁰ together with an adjacent nitrogen atom include, for example, an oxygen atom , Sulfur atom, nitrogen atom, etc.
5 to 8 members, preferably 5 or 6 which may contain 4
A membered heterocyclic group or a fused heterocyclic ring thereof is used.
Specifically, for example, (1) a 5-membered heterocyclic group which may contain 1 to 3 hetero atoms selected from an oxygen atom, a sulfur atom, a nitrogen atom and the like in addition to a nitrogen atom (eg, pyrrolidine-1-
Yl, 2-pyrrolin-1-yl, 1,3-diazacyclopentan-1-yl, 1-aza-3-oxacyclopentan-1-yl, 1-aza-3-thiacyclopentane-
1-yl, pyrazol-1-yl, pyrazolidine-1-
Yl, 3-pyrazolin-2-yl, 2-imidazolidin-1-yl, 1,2,3-triazol-1-yl, 1,
2,3-triazol-2-yl, 1,2,4-triazol-1-yl, tetrazol-1-yl, tetrazol-2-yl, etc.), (2) In addition to nitrogen, oxygen, sulfur, nitrogen 1 or 2 heteroatoms selected from atoms, etc.
6-membered heterocyclic group (eg, piperidino, thiomorpholino, morpholino, piperazinyl, 1,4-oxazin-4-yl, 1,4-thiazin-4-yl, etc.) which may be contained, (3) nitrogen atom A bicyclic or tricyclic fused heterocyclic group which may contain one or two hetero atoms selected from oxygen, sulfur, nitrogen and the like (eg, 1H-indazol-1-yl, purine- 7-yl, phenothiazin-10-yl, phenoxazin-10-yl, indol-1-yl and the like). As the heterocyclic group, among the above, a 6-membered heterocyclic group which may contain one or two hetero atoms selected from an oxygen atom, a sulfur atom, a nitrogen atom and the like in addition to the nitrogen atom (eg, piperidino, Thiomorpholino, morpholino, piperazinyl, 1,4-oxazin-4-yl, 1,4-thiazin-4-yl and the like) are preferred. As the substituent of these heterocyclic groups, R ⁹
Or the same substituent as the heterocyclic group which may have a substituent represented by R ¹⁰ is used, and the number of the substituents is 1 to
There are about five.

The hydrocarbon group represented by R ² is a group represented by R ⁸
And the like as the hydrocarbon group represented by. Of these, a C _1-19 hydrocarbon group is preferred, and specific examples thereof include a C _1-10 alkyl group, a C _2-8 alkenyl group, and a C _1-8 hydrocarbon group.
_7-19 aralkyl group is preferable, and C _1-8 alkyl group, is preferable and C _7-19 aralkyl groups, in particular, C _1-3
Alkyl groups (eg, methyl, ethyl, propyl, etc.), benzyl groups and the like are preferred. These examples of the substituent of the hydrocarbon group, for example, there can be used those similar to the substituent of the hydrocarbon group represented by R ^8, otherwise, for example, (1) C _2-5 alkoxycarbonyl group and Instead of a C _8-14 aralkyloxycarbonyl group, a compound of the formula —COOR ¹¹
Wherein R ¹¹ represents an optionally substituted hydrocarbon group; (2) instead of a carbamoyl group, a compound of the formula -CONR ¹² R ^{13 wherein} R ¹² and R ¹³ Same or different hydrogen atom, hydrocarbon group which may be substituted,
Or an optionally substituted heterocyclic group, wherein R ¹² and R
¹³ may form a nitrogen-containing heterocyclic group together with an adjacent nitrogen atom.] (3) -CONHS (= O) ₂
R ¹⁴ a group represented by wherein R ¹⁴ represents a hydrocarbon group which may be substituted], (4) -CONHOR ¹⁵ wherein
R ¹⁵ represents hydrogen or an optionally substituted hydrocarbon group], (5) an optionally substituted heterocyclic group, (6) an optionally substituted hydroxyl group A group represented by the formula -OR ¹⁶ (wherein R ¹⁶ represents a hydrogen atom, an optionally substituted hydrocarbon group or an optionally substituted acyl group), (7) -COCOOR ¹⁷
[Wherein R ¹⁷ represents a hydrogen atom or a hydrocarbon group which may be substituted].

The optionally substituted hydrocarbon group represented by R ¹¹ , R ¹² , R ¹³ , R ¹⁴ , R ¹⁵ , R ¹⁶ or R ¹⁷ is
It has the same meaning as the aforementioned optionally substituted hydrocarbon group represented by R ⁸ . The optionally substituted heterocyclic group represented by R ¹² or R ¹³ has the same meaning as the aforementioned optionally substituted heterocyclic group represented by R ⁹ or R ¹⁰ . R
^{When 12} and R ¹³ together with an adjacent nitrogen atom form a nitrogen-containing heterocyclic group, the nitrogen-containing heterocyclic group is a group represented by R ⁹ and R ¹⁰
Has the same meaning as a nitrogen-containing heterocyclic group when forming a nitrogen-containing heterocyclic group with an adjacent nitrogen atom. As the optionally substituted acyl group represented by R ¹⁶ , a C _1-16 acyl group is preferable. For example, (1) a C _1-16 alkanoyl group (eg,
Formyl, acetyl, propionyl, isopropionyl, butyryl, isobutyryl, valeryl, isovaleryl, pivaloyl, hexanoyl, myristoyl, palmitoyl, etc.), (2) C _3-6 alkenoyl group (e.g., acryloyl, methacryloyl, crotonoyl, isocrotonoyl, etc.), ( 3) C _4-7 cycloalkylcarbonyl group (eg, cyclopropylcarbonyl, cyclobutylcarbonyl, cyclopentylcarbonyl, cyclohexylcarbonyl, etc.), (4) C _7-11 aroyl group (eg, benzoyl, naphthoyl, etc.), (5) C _8-13 arylalkanoyl group (eg, phenylacetyl, phenylpropionyl, phenylbutyryl, etc.), (6) C _9-13 arylalkenoyl group (eg, cinnamoyl, atropoyl, etc.), (7) C _1-6 alkyl Sulfonyl group (eg, methanesulfonyl, eta Sulfonyl,
(8) C _6-14 arylsulfonyl group (eg, benzenesulfonyl), (9) C _1-6 alkoxy-carbonyl group (eg, methoxycarbonyl, ethoxycarbonyl, etc.), (10) C _{6 A -14} aryloxy-carbonyl group (eg, phenyloxycarbonyl, naphthyloxycarbonyl, etc.), (11) C _7-19 aralkyloxy-carbonyl group (eg, benzyloxycarbonyl, etc.) and the like are used.

[0028] Among the above acyl groups, preferably C _1-13 acyl groups, for example, (1) C _1-6 alkanoyl group (eg formyl, acetyl, propionyl, isopropionyl, butyryl, isobutyryl, valeryl, isovaleryl, pivaloyl, Hexanoyl, etc.), (2) C _3-6 alkenoyl group,
(3) C _4-7 cycloalkylcarbonyl group, (4) C _7-11 aroyl group, (5) C _8-13 arylalkanoyl group, (6) C _9-13
An arylalkenoyl group, (7) C _1-6 alkylsulfonyl group, (8) C _6-14 arylsulfonyl group and the like are used.
Particularly, a C _1-6 alkanoyl group (particularly, a C _1-3 alkanoyl such as formyl, acetyl, propionyl, and isopropionyl), and a C _1-7 acyl group such as benzoyl are preferable. As the substituent for these acyl groups, the same substituents as those in the hydrocarbon group represented by R ⁸ are used, and the number of substituents is about 1 to 3. Heterocyclic group which may be substituted used as the substituent of the optionally substituted hydrocarbon group represented by R ^2, R ⁹ or R ¹⁰
And has the same meaning as the optionally substituted heterocyclic group represented by. As a substituent of these heterocyclic groups, R ⁹ or R ¹⁰
The same substituents as those for the heterocyclic group which may have a substituent are used, and the number of substituents is about 1 to 5.

Among the substituents of the optionally substituted hydrocarbon group represented by R ² , (1) a C _1-8 alkoxy-carbonylcarbonyl group, and (2) an optionally esterified carboxyl group , (3) a carboxyl group which may be amidated (eg, (i) hydroxyl, (ii) C _1-6 alkoxy, (iii) halogenated C _1-6 alkylsulfonyl, (i
v) C _1-6 alkylsulfonyl, (v) halogen, nitro, C
C _6-14 arylsulfonyl optionally substituted with _1-6 alkyl or C _1-6 alkoxy, (vi) C optionally substituted with a carboxyl group which may be esterified
_1-6 alkyl and (vii) a carbamoyl group optionally having a group selected from C _1-6 alkoxy-C _1-8 alkyl), (4) an optionally acylated hydroxyl group,
(5) an amino group optionally having C _1-10 alkyl, C _1-6 alkanoyl, C _1-6 alkylsulfonyl or C _6-14 arylsulfonyl, (6) C _1-6 alkoxy group, (7 A) cyano group, (8) sulfo group, (9) C _1-6 alkyl, C _1-6 alkoxy, nitro, cyano, amino, halogen atom, 5- or 6-membered heterocyclic group optionally having hydroxyl or oxo. Preferred are a ring group (eg, a 5- or 6-membered heterocyclic group containing 1 to 4 hetero atoms such as a nitrogen atom, an oxygen atom and a sulfur atom), a (10) nitro group, and a (11) halogen atom.

The substituent of the optionally substituted hydrocarbon group represented by R ² includes, for example,
OR ¹¹ ′ wherein R ¹¹ ′ is a hydrogen atom or C _1-8 alkyl optionally substituted with C _1-6 alkoxy, C _1-6 alkanoyloxy or C _4-7 cycloalkyloxycarbonyloxy A group represented by formula (2)
CONR ¹² 'R ^13' [wherein, R ¹² 'and R ^13' are the same or different and each represents a hydrogen atom or a carboxyl, C _1-6 alkoxy or C _2-5 alkoxycarbonyl optionally C ₁ be substituted or the like, _-8 group represented by the alkyl group indicates a], (3) ^{_{-CONHS (= O) 2 R 14}} ' wherein, R ^14'
Is C which may be substituted by 1 to 3 halogen atoms
_1-6 alkyl group, or C _1-6 alkyl, nitro, C _1-6
A C _6-14 aryl group which may be substituted with an alkoxy, a halogen atom or the like], a group represented by the formula (4)
A group represented by ONHOR ¹⁵ ′ (wherein, R ¹⁵ ′ represents a hydrogen atom or a C _1-4 alkyl group); (5) a formula —OR ¹⁶ ′ (where R ¹⁶ ′ is a hydrogen atom, C _1- Represents an ₈ alkyl group or a C _1-6 alkanoyl group], (6) -COCO
A group represented by OR ¹⁷ ′, wherein R ¹⁷ ′ represents a hydrogen atom or a C _1-8 alkyl group, (7) C _1-6 alkyl, C _1-6
Alkoxy, nitro, cyano, amino, halogen atom,
A 3- to 8-membered heterocyclic group which may be substituted with hydroxyl or oxo and has 1 to 4 heteroatoms selected from nitrogen, oxygen and sulfur atoms in addition to carbon atoms (eg, 1H- or 2H- Tetrazolyl group or 5-
A hydroxy-4H-pyran-4-one-2-yl group), a (8) C _1-10 alkyl group,
An amino group optionally having a C _1-6 alkanoyl group, a C _1-6 alkylsulfonyl or a C _6-14 arylsulfonyl, (9) a C _8-14 aralkyloxycarbonyl group, a (10) nitro group, a (11) A) a halogen atom, (12) a cyano group, (13) an oxo group, and (14) a sulfo group.

Among the above-mentioned optionally substituted hydrocarbon groups represented by R ² , for example, those represented by the formula —CH ₂ (CHO
H) mR ² ″ wherein m is 0 or 1, R ² ″ is a carboxyl group which may be esterified or amidated,
A heterocyclic group which may be substituted or a hydroxymethyl group which may be substituted], and a group represented by the formula —CH ₂ (CHOH) mR ² ′ wherein m is 0 Or 1 and R ² ′ represents a carboxyl group which may be esterified or amidated or a hydroxymethyl group which may be substituted]]. As the optionally esterified or amidated carboxyl group represented by R ² ′ or R ² ″, the same carboxyl group that may be esterified or amidated represented by R ¹ is used. . As the optionally substituted heterocyclic group represented by R ² ″, the same as the aforementioned optionally substituted heterocyclic group represented by R ⁹ or R ¹⁰ can be used. R ² ''
In The optionally substituted hydroxymethyl group represented, for example, wherein -CH ₂ OR ^a [wherein, R ^a is a hydrogen atom, an optionally substituted hydrocarbon group or an optionally substituted acyl Which represents a group]. As the optionally substituted hydrocarbon group represented by R ^a , the same as the aforementioned optionally substituted hydrocarbon group represented by R ⁸ can be used. As the hydrocarbon group, for example, a C _1-8 alkyl group is preferable. As the optionally substituted acyl group represented by R ^a , the same as the aforementioned optionally substituted acyl group represented by R ¹⁶ can be used. Among them, a C _1-6 alkanoyl group and the like are preferable.

Among the above, the optionally substituted hydrocarbon group represented by R ² includes a group represented by the formula —CH ₂ (CHOR ^b ) m ¹ COOR ^{18 wherein} m ¹ is 0
Or 1, R ^b represents a hydrogen atom or a C _1-6 alkanoyl group, R ¹⁸ represents a hydrogen atom or an optionally substituted hydrocarbon group], a group represented by the formula —CH ₂ (CHOH) m ² CONR ¹⁹ R ²⁰ [wherein, m ²
Represents 0 or 1, R ¹⁹ and R ²⁰ are the same or different and each represents a hydrogen atom, an optionally substituted hydrocarbon group, or an optionally substituted heterocyclic group, and R ¹⁹ and R ²⁰ are adjacent groups represented by the nitrogen atom may form a nitrogen-containing heterocyclic group together with] the formula ^{_{-CH 2 (CHOH) m 3 CONHS}} (= O) 2 R
²¹ [wherein m ³ represents 0 or 1, and R ²¹ represents an optionally substituted hydrocarbon group], a group represented by the formula —CH ₂ (CHOH) m ⁴ CONHOR ²² [wherein m ⁴
Is 0 or 1, R ²² is a hydrogen atom or a substituted represented by also showing a substituted hydrocarbon group] have groups of the formula ^{_{-CH 2 (CHOH) m 5 R}} 23 [wherein, m ⁵ is 0 or 1 R ²³ represents a heterocyclic group which may be substituted.], A group represented by the formula —CH ₂ (CHOH) m ⁶ CH ₂ OR ²⁴ (where m ⁶ is 0
Or 1, and R ²⁴ represents a hydrogen atom, an optionally substituted hydrocarbon group or an optionally substituted acyl group)
A group represented by the formula: —CH ₂ (CHOH) m ⁷ COCOOR ²⁵ (wherein, m ⁷
Represents 0 or 1, and R ²⁵ represents a hydrogen atom or an optionally substituted hydrocarbon group). Further, the formula —COOR ¹⁸ ′ wherein R ¹⁸ ′ is a hydrogen atom or C
_{A 1-8} alkyl group], a C _2-8 alkyl group, a carboxyl group, a cyano group, a hydroxyl group, a carbamoyl group, a C _2-5 alkoxycarbonyl group or a substituted Optionally substituted by a heterocyclic group which may be substituted
_7-19 aralkyl groups (particularly, benzyl groups) and the like are also preferable.

The optionally substituted hydrocarbon group represented by R ¹⁸ , R ¹⁹ , R ²⁰ , R ²¹ , R ²² , R ²⁴ or R ²⁵ may be a substituted or unsubstituted hydrocarbon group represented by R ⁸ described above. The same as a good hydrocarbon group is used. As the optionally substituted heterocyclic group represented by R ¹⁹ , R ²⁰ or R ²³ , the same as the aforementioned optionally substituted heterocyclic group represented by R ⁹ or R ¹⁰ can be used. As the nitrogen-containing heterocyclic group formed by R ¹⁹ and R ²⁰ together with the adjacent nitrogen atom, those similar to the aforementioned nitrogen-containing heterocyclic group formed by R ⁹ and R ¹⁰ together with the adjacent nitrogen atom are used. _{Examples of the} optionally substituted heterocyclic group used as a substituent of the C _7-19 aralkyl group include the aforementioned R ⁹
Alternatively, those similar to the optionally substituted heterocyclic group represented by R ¹⁰ are used. As the optionally substituted acyl group represented by R ²⁴ , those similar to the acyl group represented by R ¹⁶ can be used, and among them, a C _1-6 alkanoyl group, particularly a C _1-4 alkanoyl group (eg, , Formyl, acetyl, propionyl, isopropionyl, etc.). As the substituent for these acyl groups, the same substituents as those for the hydrocarbon group represented by R ⁸ described above are used.

Examples of the optionally substituted hydroxyl group represented by R ³ or R ⁴ include, for example, a group represented by the formula —OR ²⁶ wherein R ²⁶ is a hydrogen atom, an optionally substituted hydrocarbon group or an optionally substituted hydrocarbon group. And a group represented by the formula -OCOOR ²⁷ [wherein R ²⁷ represents a hydrocarbon group which may be substituted]. As the optionally substituted hydrocarbon group for R ²⁶ or R ²⁷ , the same as the aforementioned optionally substituted hydrocarbon group for R ⁸ can be used. Examples of the hydrocarbon group include a C _1-8 alkyl group and C _6-14
Aryl groups and the like are preferred. As the substituent of the hydrocarbon group, for example, a C _1-6 alkoxy group is preferable. R
^{As the} optionally substituted acyl group represented by ²⁶ ,
The same as the aforementioned optionally substituted acyl group represented by R ¹⁶ are used. As the acyl group, for example, a C _1-6 alkanoyl group, a C _7-11 aroyl group (eg, benzoyl) and the like are preferable, and among them, a C _1-7 acyl group such as a C _1-6 alkanoyl group and a benzoyl group is preferable. It is.

Among the above, examples of the hydrocarbon group represented by R ²⁶ in —OR ²⁶ as R ³ include C 4
_{A 1-8} alkyl group, particularly a C _1-3 alkyl group, is preferred, and a substituent is, for example, preferably a C _1-6 alkoxy group (eg, methoxy and the like). As the acyl group represented by R ²⁶ in —OR ²⁶ as R ³ , for example, a C _1-6 alkanoyl group is preferable. The hydrocarbon group represented by R ²⁶ in —OR ²⁶ as R ⁴ is, for example, preferably a C _1-8 alkyl group or a C _6-14 aryl group, and particularly preferably a C _1-3 alkyl group or a phenyl group. . As the acyl group represented by R ²⁶ in —OR ²⁶ as R ⁴ , for example, a C _1-6 alkanoyl group or a C _7-11 aroyl group, particularly a C _1-4 alkanoyl group or a benzoyl group, is preferable. For example, a C _1-3 alkyl group (eg, a methyl group) is preferable. The hydrocarbon group represented by R ²⁷ in —OCOOR ²⁷ as R ³ and R ⁴ is, for example, preferably a C _1-8 alkyl group or a C _6-14 aryl group, particularly a C _1-3 alkyl group or phenyl. Groups are preferred.

[0036] The halogen atom represented by R ^5, R ⁶ or R ^7, for example, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom is used, inter alia, for R ⁵ and R ⁶ are chlorine atoms or A bromine atom is preferred, and R ⁷
Is preferably a bromine atom or an iodine atom. As the optionally substituted hydrocarbon group represented by R ⁷ , the same as the optionally substituted hydrocarbon group represented by R ⁸ can be used. As the hydrocarbon group, a C _1-19 hydrocarbon group is preferable, and among them, a C _1-10 alkyl group, a C _6-14 aryl group and the like are preferable, and a C _6-14 aryl group is particularly preferable. Preferred examples of the substituent of the hydrocarbon group include a halogen atom, a carboxyl group, a C _1-6 alkyl group, a C _1-6 alkoxy group, an amino group, and a nitro group. The heterocyclic group which may be substituted represented by R ^7, but similar to the heterocyclic group which may be substituted represented by R ⁹ or R ¹⁰ is used, for example, 2- or 3- Thienyl and 2-benzo [b] furanyl are preferred. R ⁷
The optionally substituted acyl group represented by
^{The same} as the optionally substituted acyl group represented by ¹⁶ are used. As the acyl group, for example, a C _1-6 alkanoyl group and the like are preferable.

Among the above, R ¹ is represented by the formula —CO
A group represented by OR ²⁸ [wherein R ²⁸ represents a hydrogen atom or a C _1-8 alkyl group optionally substituted with C _1-6 alkoxy], and among them, a C _1-3 alkyl group, particularly And a carboxyl group which may be esterified with a methyl group. R ² includes, for example, (1) a hydrogen atom,
(2) hydroxyl group or (3) (a) C _1-8 alkoxy-carbonylcarbonyl, (b) carboxyl which may be esterified or amidated, (c) hydroxyl which may be acylated, (d ) C _1-10 alkyl, C _1-6 alkanoyl, amino optionally having C _1-6 alkylsulfonyl or C _6-14 arylsulfonyl, (e) C _1-6 alkoxy, (f) cyano, g) sulfo, (h) C _1-6 alkyl,
C _1-6 alkoxy, nitro, cyano, amino, halogen atom, 5- or 6-membered heterocyclic group optionally having hydroxyl or oxo, (i) nitro, (j) halogen atom and (k) oxo A C _1-19 hydrocarbon group which may be substituted with a selected group is preferred. Examples of R ² include (1) a hydrogen atom, (2) a hydroxyl group, (3) (a) a C _1-8 alkoxy-carbonylcarbonyl, and (b) a carboxyl which may be esterified or amidated. (C) optionally acylated hydroxyl, (d) C
_1-6 alkylsulfonyl or C _6-14 amino which may have arylsulfonyl, (e) C _1-6 alkoxy,
(f) cyano, (g) sulfo and (h) a heterocyclic group optionally having hydroxyl or oxo (for example, a group containing 1 to 4 hetero atoms such as nitrogen, oxygen, sulfur, etc. Or a 6-membered heterocyclic group or the like), a C _1-10 alkyl group which may be substituted with a group selected from (4) a C _2-8 alkenyl group optionally having a carboxyl, or (5) ( a) cyano, (b) carboxyl, which may be esterified or amidated, (c) hydroxyl, (d) nitro, (e) a halogen atom and (f) a 5- or 6-membered nitrogen-containing heterocyclic group. C optionally substituted with a substituent
_7-19 aralkyl groups are preferred.

Further, as R ² , for example, (1) a hydrogen atom, (2) a hydroxyl group, (3) a formula —CH ₂ (CHOR ^b )
m ¹ COOR ²⁹ [wherein, m ¹ is 0 or 1, R ^b is a hydrogen atom or a C _1-6 alkanoyl group, R ²⁹ is a hydrogen atom or C _1-6 alkoxy, C _1-6 alkanoyloxy or C 1 _4-7 represents a C _1-8 alkyl group which may be substituted by cycloalkoxycarbonyloxy or the like], a group represented by the formula (4): —CH ₂ (CHOH) m ² CONR ³⁰ R ^{31 wherein 2} is 0 or 1; R ³⁰ and R ³¹ are the same or different and each represents a hydrogen atom or a C _1-8 alkyl group optionally substituted with carboxyl, C _1-6 alkoxy or C _2-5 alkoxycarbonyl; (5) Formula —CH ₂ (CHOH) m ³ CONHS (＝ O) ₂
R ³² [wherein, m ³ represents 0 or 1, and R ³² represents a C _1-4 alkyl group optionally substituted with 1 to 3 halogen atoms, or C _1-6 alkyl, nitro, C _{1- 6} alkoxy, a group represented by halogen atom represents an C _6-14 aryl group which may be substituted or the like], (6) -CH ₂ (CHOH) m ⁴ C
A group represented by ONHOR ³³ [wherein m ⁴ represents 0 or 1, and R ³³ represents a hydrogen atom or a C _1-4 alkyl group], (7)
Formula -CH ₂ (CHOH) m ⁵ R ³⁴ [wherein m ⁵ is 0 or 1
The, R ³⁴ may be substituted by hydroxyl or oxo, nitrogen atom, oxygen atom and 3-8-membered Hajime Tamaki containing 1 to 4 heteroatoms selected from a sulfur atom in addition to carbon atoms (e.g., 1H- or 2H- tetrazolyl, or 5-hydroxy -4H- pyran-4-on-2-yl group represented by group) are shown], (8) -CH ₂ (CH
OH) m ⁶ —CH ₂ OR ³⁵ [wherein m ⁶ represents 0 or 1;
³⁵ represents a hydrogen atom, a C _1-8 alkyl group or a C _1-6 alkanoyl group], (9) -CH ₂ (CHOH)
m ⁷ -COCOOR ³⁶ [wherein, m ⁷ represents 0 or 1, R ³⁶ represents a hydrogen atom or a C _1-8 alkyl group], and (10) a carboxyl group may be substituted. C
_2-8 alkyl group, (11) carboxyl, cyano, hydroxyl, carbamoyl, _C2-5 alkoxycarbonyl or 3-8 containing 1-4 heteroatoms selected from nitrogen atom, oxygen atom and sulfur atom in addition to carbon atom. And a C _7-19 aralkyl group (particularly, a benzyl group) which may be substituted with a membered heterocyclic group (eg, 1H- or 2H-tetrazolyl group).

R ³ and R ⁴ are preferably, for example, (a) an acyl group or (b) a hydroxyl group optionally having a substituted C _1-10 alkyl group as a substituent, Further, (1) a hydroxyl group optionally substituted by C _1-7 acyl or (2) a C _1-10 alkoxy group optionally substituted by C _1-6 alkoxy is preferable. In particular, (1) Formula -OR ²⁶ ′ wherein R ²⁶ ′ is a hydrogen atom, a C _1-8 alkyl group optionally substituted by C _1-4 alkoxy,
_1-6 alkanoyl group, group represented by C _7-11 show an aroyl group] or (2) -OCOOR ^27, 'wherein, R ^27'
_{Represents a} C _1-8 alkyl group or a C _6-14 aryl group]. R ³ is a group represented by the formula —OR ³⁷ [wherein R ³⁷ represents a hydrogen atom, a C _1-8 alkyl group optionally substituted with C _1-6 alkoxy, or a C _1-6 alkanoyl group] And the like are also preferred.
R ⁴ is a group represented by the formula —OR ³⁸ wherein R ³⁸ is a hydrogen atom, C
_A C _1-8 alkyl group optionally substituted with _1-6 alkoxy, a C _1-6 alkanoyl group or a C _7-11 aroyl group], a group represented by the formula —OCOOR ^{39 wherein} R ³⁹ is And a C _1-6 alkyl group or a C _6-14 aryl group]. Further, as R ³ and R ⁴ , a hydroxyl group, a methoxy group, an acetoxy group, a propionyloxy group, an isopropionyloxy group, a butyryloxy group, and the like are preferable, and a hydroxyl group is particularly preferable. As R ⁵ and R ⁶ , a hydrogen atom, a chlorine atom, and a bromine atom are preferable, and a chlorine atom and a bromine atom are particularly preferable. In particular, it is preferable that both R ⁵ and R ⁶ are chlorine atoms.

As R ⁷ , for example, (1) a hydrogen atom, (2)
Nitro group, (3) halogen atom, (4) (a) carboxyl which may be esterified or amidated, (b) hydroxyl which may be acylated, (c) C _1-10 alkyl, C _{1 -6} alkanoyl, amino optionally having C _1-6 alkylsulfonyl or C _6-14 arylsulfonyl, (d) C _1-6 alkoxy, (e) cyano, (f) sulfo, (g) C _{1 -6} alkyl, C _1-6 alkoxy, nitro, cyano, amino, halogen atom, 5- or 6-membered heterocyclic group optionally having hydroxyl or oxo, (h) nitro, (i) halogen atom and ( j) a C _1-19 hydrocarbon group which may be substituted with a group selected from oxo, (5) (a) a C _1-6 alkyl, (b) a carboxyl which may be esterified or amidated, c) acylated or unprotected hydroxyl, (d) C _1-10 alkyl, C _1-6 alkanoyl, _1-6 alkylsulfonyl or C _6-14 arylsulfonyl which may have amino, (e) C _1-6
5- or 6-membered heterocyclic group which may be substituted with a group selected from alkoxy, (f) cyano, (g) sulfo, (h) nitro, (i) halogen atom and (j) oxo, or a fused heterocyclic group thereof (6) (a) C _1-6 alkyl, (b) carboxyl which may be esterified or amidated, (c) hydroxyl which may be acylated, (d) C _1-10 Amino optionally having alkyl, C _1-6 alkanoyl, C _1-6 alkylsulfonyl or C _6-14 arylsulfonyl, (e) C _1-6
Alkoxy, (f) cyano, (g) sulfo, (h) C _1-6 alkyl, C _1-6 alkoxy, nitro, cyano, amino, halogen atom, hydroxyl or also may 5 or 6 membered optionally having oxo And an acyl group which may be substituted with a group selected from (i) nitro, (j) a halogen atom and (k) oxo.

Further, as R ⁷ , for example, (1) hydrogen atom, (2) nitro group, (3) halogen atom, (4) C _1-8 alkyl group, (5) halogen atom, carboxyl, C _{1 -6} alkyl,
A C _6-14 aryl group which may be substituted with C _1-6 alkoxy, amino or nitro, (6) a C _1-6 alkanoyl group or (7) a nitrogen atom, an oxygen atom, a sulfur atom, etc. A 3 to 8 membered heterocyclic group containing 1 to 4 selected heteroatoms, or a 6 to 8 membered carbocyclic ring (eg, benzene ring or the like) or a condensed heterocyclic group with a heterocyclic ring is also preferable. Among the above, as R ⁷ , a hydrogen atom, a nitro group, a bromine atom, an iodine atom and the like are preferable, and a nitro group, a bromine atom and an iodine atom are particularly preferable. As n
Particularly, 0 or 1 is preferable. As Y, an oxygen atom is particularly preferred.

When n is 0, R ² is given by the formula

Embedded image R ¹ , R ³ , R ⁴ ,
As R ⁵ , R ⁶ , R ⁷ and Y, those similar to the aforementioned preferable groups are preferably used. In particular, R ¹ is a carboxyl group which may be esterified with a C _1-8 alkyl group or the like, R ³ and R ⁴ are hydroxyl groups, and R ⁵ and R ⁶ are a hydrogen atom or a chlorine atom. A halogen atom, a hydrogen atom as R ⁷ and an oxygen atom as Y are preferable.

Preferred examples of the compound [I] of the present invention include all compounds obtained by combining the groups mentioned as preferred examples of each symbol. Among them, the following compounds [Ia] to [Ie] are preferable. Compound [Ia]: R ¹ represents a carboxyl group which may be esterified or amidated, R ² represents (1) a hydrogen atom,
(2) hydroxyl group or (3) (a) C _1-8 alkoxy-carbonylcarbonyl, (b) carboxyl which may be esterified or amidated, (c) hydroxyl which may be acylated, (d ) C _1-10 alkyl, C _1-6 alkanoyl, amino optionally having C _1-6 alkylsulfonyl or C _6-14 arylsulfonyl, (e) C _1-6 alkoxy, (f) cyano, g) sulfo, (h) C _1-6 alkyl,
C _1-6 alkoxy, nitro, cyano, amino, halogen atom, 5- or 6-membered heterocyclic group optionally having hydroxyl or oxo, (i) nitro, (j) halogen atom and (k) oxo R ³ and R ⁴ may be the same or different from each other, and may be selected from (C) an optionally substituted C _1-19 hydrocarbon group, and (B) an optionally substituted C _1-19 hydrocarbon group.
_A hydroxyl group which may have a _1-10 alkyl group as a substituent, R ⁵ and R ⁶ are the same or different and each have a hydrogen atom or a halogen atom,

R ⁷ is (1) a hydrogen atom, (2) a nitro group, (3) a halogen atom, (4) (a) a carboxyl which may be esterified or amidated, or (b) an acylated carboxyl. Hydroxyl, (c) C _1-10 alkyl, C _1-6 alkanoyl, amino optionally having C _1-6 alkylsulfonyl or C _6-14 arylsulfonyl, (d) C _1-6 alkoxy, (e) cyano, (f) sulfo, (g) C _1-6 alkyl, C _1-6 alkoxy, nitro, cyano, amino, halogen atom, 5- or 6-membered complex optionally having hydroxyl or oxo A ring group, (h) nitro, (i) a C _1-19 hydrocarbon group _optionally substituted with a group selected from a halogen atom and (j) oxo, (5) (a) a C _1-6 alkyl, b) carboxyl, which may be esterified or amidated, (c) hydroxyl, which may be acylated, (d) C _1- Amino optionally having ₁₀ alkyl, C _1-6 alkanoyl, C _1-6 alkylsulfonyl or C _6-14 arylsulfonyl, (e) C _1-6
5- or 6-membered heterocyclic group which may be substituted with a group selected from alkoxy, (f) cyano, (g) sulfo, (h) nitro, (i) halogen atom and (j) oxo, or a fused heterocyclic group thereof (6) (a) C _1-6 alkyl, (b) carboxyl which may be esterified or amidated, (c) hydroxyl which may be acylated, (d) C _1-10 Amino optionally having alkyl, C _1-6 alkanoyl, C _1-6 alkylsulfonyl or C _6-14 arylsulfonyl, (e) C _1-6
Alkoxy, (f) cyano, (g) sulfo, (h) C _1-6 alkyl, C _1-6 alkoxy, nitro, cyano, amino, halogen atom, hydroxyl or also may 5 or 6 membered optionally having oxo A heterocyclic group of (i) nitro, (j) an acyl group which may be substituted with a group selected from a halogen atom and (k) oxo, and when n is 0, R ² is a group represented by the formula

[0045]

Embedded image And a group represented by

Compound [Ib]: R ¹ is a carboxyl group which may be esterified, R ² is (1) hydrogen atom, (2)
Hydroxyl groups, (3) (a) C _1-8 alkoxy-carbonylcarbonyl, (b) carboxyl, which may be esterified or amidated, (c) hydroxyl, which may be acylated, (d) C
_1-6 alkylsulfonyl or C _6-14 amino which may have arylsulfonyl, (e) C _1-6 alkoxy,
(f) cyano, (g) sulfo and (h) 5- or 6-membered heterocyclic group optionally having hydroxyl or oxo (e.g., selected from nitrogen, oxygen, sulfur, etc. other than carbon atoms) 5 or 6 containing 1 to 4 heteroatoms
A heterocyclic group), a C _1-10 alkyl group which may be substituted with a group selected from (membered heterocyclic group), (4) a C _2-8 alkenyl group optionally having a carboxyl, or (5) (a) cyano A substituent selected from (b) a carboxyl which may be esterified or amidated, (c) hydroxyl, (d) nitro, (e) a halogen atom and (f) a 5- or 6-membered nitrogen-containing heterocyclic group. C optionally substituted with
_{7-19 an} aralkyl group wherein R ³ and R ⁴ are the same or different and each may be a hydroxyl group which may be substituted by C _1-6 acyl or a C _1-10 which may be substituted by C _1-6 alkoxy;
An alkoxy group, R ⁵ and R ⁶ are the same or different and each represents a hydrogen atom or a halogen atom, and R ⁷ represents (1) a hydrogen atom, (2)
Nitro group, (3) halogen atom, (4) C _1-10 alkyl group,
(5) (a) C _1-6 alkyl, (b) carboxyl, (c) C _1-6 alkoxy, (d) amino, (e) nitro or (f) may be substituted by a halogen atom C _{6 -14} aryl group, (6) C _1-6
An alkanoyl group or (7) a 5- or 6-membered heterocyclic group containing 1 to 4 heteroatoms selected from a nitrogen atom, an oxygen atom, a sulfur atom and the like in addition to a carbon atom, or a fused heterocyclic group thereof with a benzene ring. , N is 0, R ² is of the formula

[0047]

Embedded image And a group represented by

Compound [Ic]: R ¹ has the formula —COOR
²⁸ wherein, R ²⁸ represents a hydrogen atom or a C _1-6 optionally substituted alkoxy C _1-8 alkyl group] The group represented by, R ² is (1) hydrogen atom, (2 ) A hydroxyl group, (3) a formula —CH ₂ (CHOR ^b ) m ¹ COOR ^{29 wherein} m ¹ is 0 or 1, R ^b is a hydrogen atom or a C _1-6 alkanoyl group,
R ²⁹ represents a hydrogen atom or a C _1-8 alkyl group which may be substituted by C _1-6 alkoxy, C _1-6 alkanoyloxy or C _4-7 cycloalkoxycarbonyloxy; 4) Formula -CH ₂ (CHOH) m ² CO
NR ³⁰ R ^{31 wherein} m ² represents 0 or 1, and R ³⁰ and R ³¹
Are the same or different and are hydrogen or carboxyl,
A C _1-8 alkyl group which may be substituted by C _1-6 alkoxy or C _2-5 alkoxycarbonyl], a group represented by the formula (5): —CH ₂ (CHOH) m ³ CONHS (=
O) ₂ R ³² [wherein m ³ represents 0 or 1, R ³² represents a C _1-4 alkyl group optionally substituted with 1 to 3 halogen atoms, or C _1-6 alkyl, nitro, C _1-6 alkoxy or a C _6-14 aryl group optionally substituted with a halogen atom].

(6) Formula —CH ₂ (CHOH) m ⁴ CONHOR
³³ [wherein, m ⁴ represents 0 or 1, R ³³ represents a hydrogen atom or C
Groups represented by _1-4 represents an alkyl group], (7) -CH ₂
(CHOH) m ⁵ R ³⁴ [wherein, m ⁵ represents 0 or 1, and R ³⁴ is a hetero atom selected from a nitrogen atom, an oxygen atom and a sulfur atom other than a carbon atom, which may be substituted with hydroxyl or oxo. A 3- to 8-membered heterocyclic group containing 1 to 4 (eg, a 2-pyridyl group, a 1H- or 2H-tetrazolyl group, or a 5-hydroxy-4H-pyran-4-one-2-yl group). A group represented by formula (8):
CH ₂ (CHOH) m ⁶ —CH ₂ OR ^{35 wherein} m ⁶ is 0 or 1, R ³⁵ is a hydrogen atom, a C _1-8 alkyl group or a C _1-6
Represents an alkanoyl group], (9) -CH
₂ (CHOH) m ⁷ -COCOOR ³⁶ [wherein, m ⁷ represents 0 or 1, R ³⁶ represents a hydrogen atom or a C _1-8 alkyl group], and (10) a carboxyl group. A C _2-8 alkyl group which may be selected from the group _{consisting of} (11) a carboxyl, cyano, halogen atom, nitro, hydroxyl, carbamoyl, C _2-5 alkoxycarbonyl or hetero atom selected from a nitrogen atom, an oxygen atom and a sulfur atom in addition to a carbon atom; A 3- to 8-membered heterocyclic group containing 1 to 4 atoms (eg,
A C _7-19 aralkyl group which may be substituted with a 1H- or 2H-tetrazolyl group,

R ³ is a group represented by the formula —OR ³⁷ wherein R ³⁷ represents a hydrogen atom, a C _1-8 alkyl group optionally substituted by C _1-6 alkoxy, or a C _1-6 alkanoyl group. In the formula, R ⁴ is a group represented by the formula (1) -OR ³⁸ [wherein R ³⁸ is a hydrogen atom, a C _1-8 alkyl group which may be substituted by C _1-6 alkoxy, a C _1-6 alkanoyl group; Or a C _7-11 aroyl group] or a group represented by the formula (2) -OCOOR ³⁹
[Wherein, R ³⁹ represents a C _1-6 alkyl group or a C _6-14 aryl group], R ⁵ and R ⁶ are the same or different and represent a hydrogen atom or a halogen atom, and R ⁷ represents ( 1) hydrogen atom, (2) nitro group, (3) halogen atom, (4) C _1-8 alkyl group, (5) halogen atom, carboxyl, C _1-4 alkyl, C _1-4 alkoxy, amino or nitro 1 to 4 hetero atoms selected from a nitrogen atom, an oxygen atom, a sulfur atom and the like in addition to a C _6-14 aryl group, (6) C _1-6 alkanoyl group or (7) carbon atom which may be substituted Including 3-8
Membered heterocyclic group (eg, 2- or 3-thienyl or the like) or a 6- to 8-membered carbocyclic ring (eg, benzene ring) or a condensed heterocyclic group (eg, 2-benzo [b And when n is 0, R ² is a group represented by the formula

[0051]

Embedded image And a group represented by

Compound [Id]: R ¹ is a carboxyl group which may be esterified with a methyl group, and R ² is a group represented by the formula
H ₂ COOR ⁴⁰ wherein R ⁴⁰ is a hydrogen atom or a C _1-4 alkyl group optionally substituted by C _1-6 alkoxy, C _1-6 alkanoyloxy or C _4-7 cycloalkoxycarbonyloxy ( examples, groups represented by methyl group, and ethyl group)], or R ³ and R ⁴ are hydroxyl groups, R ⁵ and R ⁶ are a chlorine atom, R ⁷ is a hydrogen atom, a nitro group, a bromine atom Or an iodine atom, and when n is 0, R ² is a group represented by the formula

[0053]

Embedded image And a group represented by

Compound [Ie]: (1) 2- (carboxymethylsulfinyl) -5,7-
Dichloro-3,8-dihydroxy-6-methyl-9-oxo-9H-xanthen-1-carboxylic acid methyl ester, (2) 2- (carboxymethylsulfinyl) -5,7-
Dichloro-3,8-dihydroxy-4-iodo-6-methyl-9-oxo-9H-xanthen-1-carboxylic acid methyl ester, (3) 5,7-dichloro-3,8-dihydroxy-6-methyl- 9-oxo-2- (pivaloyloxymethoxycarbonylmethylthio) -9H-xanthen-1-carboxylic acid methyl ester, (4) 5,7-dichloro-3,8-dihydroxy-6-methyl-9-oxo- 2- (pivaloyloxymethoxycarbonylmethylsulfinyl) -9H-xanthen-1
-Carboxylic acid methyl ester, or (5) 5,7-dichloro-2- [1- (cyclohexyloxycarbonyloxy) ethoxycarbonylmethylthio] -3,8-dihydroxy-6-methyl-9-oxo-9H-xanthene- 1-carboxylic acid methyl ester.

The screening method of the present invention comprises: (1) (i) binding of CD28-containing CHO cells or a cell membrane fraction thereof and soluble B7-1-Ig to CD28 and B7-1-Ig Quantity and (ii) CD28
Cells containing CHO or a cell membrane fraction thereof, soluble B
CD28 upon contact of 7-1-Ig and test compound
(2) (i) a method for screening a compound or a salt thereof having an activity of inhibiting or enhancing the binding between CD28 and B7-1, which comprises comparing the amount of binding with B7-1-Ig. B) the amount of interleukin-2 produced when a CHO cell containing B7-1 or a cell membrane fraction thereof and a T cell (specifically, a T cell to which a first signal is given by an anti-CD3 antibody or the like) are contacted; (Ii) B7-1-containing CHO cells or cell membrane fraction thereof, T cells (specifically, T cells to which a first signal has been given by an anti-CD3 antibody or the like) and interleukin upon contact with a test compound A method for screening for a compound having an interleukin 2 production inhibitory activity or a salt thereof, comprising comparing the amount of 2 produced.

[0056]

DESCRIPTION OF THE PREFERRED EMBODIMENTS TA used in the production method of the present invention
Microorganisms producing N-2421A1, A2, A3, A4, B1, B2 and / or B3 include, for example, those belonging to the genus Aspergillus, such as TAN-242.
Any microorganism may be used as long as it produces 1A1, A2, A3, A4, B1, B2 and / or B3.
For example, an example of a strain FL-67283 newly isolated from Indian soil can be used. This strain exhibits the following properties. (I) Cultural properties (1) Malt extract agar medium The growth is moderate and the diameter of the colony after 2 weeks at 24 ° C. is 2
5 mm. The surface is flat and consists of a slightly raised velvety mycelium at the center, with a regular border on the outer edge. The development of aerial hyphae is good, but the formation of conidia is poor. It has a reddish-brown to pale reddish-brown color from the central part to the middle part, and the peripheral part has a pale yellowish white color. From the center of the back surface to the periphery, it exhibits a dark yellowish brown or light yellowish brown. No soluble dye formation is observed. (2) Potato / Glucose Agar Medium The growth is good and the diameter of the colony after 2 weeks at 24 ° C. is 46.
mm to 50 mm. The surface is flat, consisting of a velvety mycelium with a slightly raised central portion, and extends concentrically from the middle to the periphery. The outer edge is slightly irregular. Aerial hyphae develop well, but conidium formation is rather slow. The middle part to the middle part is reddish brown, and the peripheral part is pale yellowish white. The center of the back surface is dark reddish brown or reddish brown, the middle is pale reddish brown, and the periphery is pale yellowish brown. No soluble dye formation is observed. It grows at any of pH 3 to pH 12, and the growth temperature range is 11 ° C. to 44 ° C. and 24 ° C. to 30 ° C. is the optimum temperature. It grows even at 37 ° C.

(3) Czapek agar medium Growth is moderate, and the diameter of the colony after 2 weeks at 24 ° C. is 3
5 mm to 40 mm. The surface is composed of a velvety, rarely wool-like mycelium with a raised central part, and the outer edge is somewhat irregularly bordered. Aerial hyphae are moderately developed, but conidium formation is poor. It has a pale yellow-brown color from the center to the middle, and has a pale yellow-white color at the periphery. No formation of a soluble pigment exhibiting reddish-yellowish brown or pale reddish-yellowish brown from the center to the periphery of the back surface is observed. (4) Oatmeal agar medium The growth is good and the diameter of the colony after 2 weeks at 24 ° C is 60.
mm to 65 mm. The surface is flat, composed of velvety mycelia, and extends concentrically thinly from the center to the periphery. The outer edge is slightly irregular. The development of aerial mycelia and the formation of conidia are good. It exhibits a reddish brown to pale reddish brown from the center to the middle, and a pale yellowish brown at the periphery. The central portion of the back surface has a yellowish brown color, and has a pale yellowish brown to pale yellowish white color from the middle portion to the peripheral portion. No soluble dye formation is observed. (II) Morphological characteristics Conidium head: cylindrical, 100-180 × 40-60 μm. Conidiophores: formed on aerial hyphae. 60-100x
6.0 to 8.0 µm, partition walls are observed. Somewhat curved.
The surface is smooth. The tip is enlarged and has a swelling. Apex: hemispherical, 15-20 μm in diameter, with metre from upper half. Metre: cylindrical, 4.5-5.0 × 1.5-2.0 μm. Fialide: bottle type, 5-6 × 1.2-1.8 μm, surface is smooth, and 2-4 bunch of fialide are formed on metre. Conidium: spherical to subspherical, 1.6 to 2.0 x 1.3 to 1.7
μm, the surface is smooth and linked.

Based on the above properties, D. Malloch, Shunichi Udagawa's translation, "Separation, culture and identification of mold" (1983,
When compared with the identification search table described on page 51, the spores of this bacterium consist of one cell, colonies, conidia and conidiophores are colorless or light-colored, while It is clear that it belongs to the genus Aspergillus (Aspergillus), for example, by forming a bottle-shaped phialide. Furthermore, "THE GENUS Asp" by KB Raper et al.
ergillus ''(1965; THE Williams & Wilkins Company), the fungus forms metres on the apex of the fungus and forms a bottle-shaped phialide on it, It is considered to belong to the Aspergillus terreus group because it has a yellowish brown color and a conidiophore that is colorless.
Therefore, this strain is Aspergillus terreus (Aspe
rgillus terreus) FL-67283 strain. This strain was established on February 28, 1996 under the Budapest Treaty by the National Institute of Advanced Industrial Science and Technology
H) and deposited under accession number FERM BP-5433.

Compounds of the Invention TAN-2421A1, A
2, A3, A4, B1, B2, and / or B3 are not limited to this strain, and include mutants having the ability to produce the present compound derived therefrom by methods known per se, including genetic engineering techniques, It can be produced by culturing a microorganism capable of producing in a medium, accumulating and producing the present compound in the medium, and collecting the resulting compound. Compound TAN of the present invention
The medium used for culturing bacteria producing -2421A1, A2, A3, A4, B1, B2 and / or B3 may be liquid or solid as long as it contains a nutrient that can be used by the bacteria, but is treated in large quantities. Sometimes it is more appropriate to use a liquid medium. The medium is appropriately mixed with a carbon source, a nitrogen source, an inorganic substance, and a micronutrient which can be assimilated by the compound-producing bacterium.
Examples of the carbon source include glucose, lactose, sucrose, maltose, dextrin, starch, glycerin, mannitol, sorbitol, fats and oils (such as cottonseed oil, soybean oil, lard oil, and chicken oil), and n-paraffin. Are, for example, meat extract, yeast extract, dried yeast, soy flour, corn steep liquor, peptone, raw soy flour, cottonseed flour, tomato paste, peanut meal, molasses, urea, ammonium salts (ammonium sulfate, ammonium chloride , Ammonium nitrate, ammonium acetate, etc.). Further, salts including sodium, potassium, calcium, magnesium, etc., metal salts such as iron, manganese, zinc, cobalt, nickel, salts such as phosphoric acid and boric acid, and salts of organic acids such as acetic acid and propionic acid are appropriately used. Is also good. In addition, amino acids (glycine, glutamic acid, aspartic acid, alanine, lysine, methionine, proline, etc.), peptides (dipeptides, tripeptides, etc.), vitamins (B1, B2, nicotinic acid, B12, C, etc.), nucleic acids (purines) , Pyrimidine, derivatives thereof, etc.). Of course, an inorganic or organic acid or alkali, a buffer, or the like may be added for the purpose of adjusting the pH of the medium, or an appropriate amount of an oil or fat or a surfactant may be added for the purpose of defoaming.

As the culturing means, means such as static culturing, shaking culturing or aeration and stirring culturing may be used. For a large amount of treatment, it is desirable to use so-called deep aeration stirring culture. Culture conditions vary depending on the state and composition of the medium, the type of strain, and the means of culture, but it is usually preferable to select a temperature of about 12 ° C to 44 ° C and an initial pH of about 5 to 9. In particular, the temperature during the middle stage of culture is about 14 ° C to 30 ° C,
Conditions of about 6 to 8 are desirable. The cultivation time is not constant depending on the above-mentioned conditions, but it is desirable to culture until the concentrations of various physiologically active substances are maximized. The time required for this is usually about 1 to 14 days in the case of shaking culture using a liquid medium or aeration and stirring culture. Compound T of interest from culture
The method of collecting AN-2421A1, A2, A3, A4, B1, B2 and / or B3 is described below. Since the compound is acidic fat-soluble, general means utilizing this property may be employed. First, the pH of the culture solution or the culture filtrate is adjusted to acidic, and then an organic solvent immiscible with water,
For example, halogenated hydrocarbons such as dichloromethane, esters such as ethyl acetate, ketones such as methyl isobutyl ketone, or alcohols such as isobutanol are added, and TAN-2421A1, A2, A3, A4, B
1. Extract B2 and / or B3. When the obtained organic solvent layer is extracted with an alkaline aqueous solution, the target substance is transferred to the aqueous layer. After adjusting the pH of the obtained aqueous layer to acidic,
After re-extraction with the above-mentioned organic solvent, the obtained organic solvent layer was washed with water and concentrated, and then TAN-2421A1, A2,
A crude material containing A3, A4, B1, B2 and / or B3 is obtained.

The crude material was further purified to give pure TAN-2
421A1, A2, A3, A4, B1, B2 or B3
Various well-known chromatography methods are advantageously used to obtain As the carrier, those utilizing the difference in the adsorptivity of compounds such as activated carbon, silica gel, microcrystalline cellulose, and adsorptive resin, or a carrier for gel filtration are advantageously used. In order to elute the target compound from these carriers, combinations vary depending on the type and properties of the carrier, but suitable organic solvents (eg, halogenated hydrocarbons such as dichloromethane and chloroform, aromatic hydrocarbons such as toluene, etc.) , Esters such as ethyl acetate, ketones such as acetone, alcohols such as methanol, ethanol, isobutanol, nitriles such as acetonitrile), organic acids (eg, acetic acid, formic acid, etc.), Aqueous solution [eg, water, an aqueous solution containing an alkali (eg, sodium hydroxide, potassium hydroxide, sodium hydrogen carbonate, ammonia, etc.), an aqueous solution containing an acid (eg, hydrochloric acid, acetic acid, formic acid, phosphoric acid, trifluoroacetic acid, etc.); A salt-containing aqueous solution (eg, a saline solution, an acetate buffer, a phosphate buffer, etc.)) may be used alone, or may be used by mixing them at an appropriate ratio. Kill. For more information,
Activated carbon for chromatography (Takeda Pharmaceutical Co., Ltd.), Kieselgel 60 (Merck, Germany), microcrystalline cellulose (eg, Avicel (Asahi Kasei), Funacell (Funakoshi), etc.) as carriers Resin [eg, Diaion H
P-20 or SP-207 (manufactured by Mitsubishi Chemical Corporation), Amberlite XAD-I or II (manufactured by Rohm and Haas Company, USA), etc., a carrier for gel filtration [eg, Sephadex LH-20 (manufactured by Pharmacia, Inc.) Sweden)
Etc.] are advantageously used. Furthermore, in some cases, preparative high-performance liquid chromatography (HPLC) methods are also advantageously used for compound purification. When this method is applied, octadecylsilane (ODS) is used as a carrier.
Systems, polymer systems and silica gel systems are advantageously used. For example, in the case of ODS, YMC gel (manufactured by YMC) or TSK gel (manufactured by Tosoh Corporation) is used.
In the case of a polymer system, ODP (manufactured by Asahi Kasei Corporation) having an octadecyl group introduced into the polymer or NH2P (manufactured by Asahi Kasei Corporation) having a polyamine introduced into the polymer is used, and methanol or acetonitrile and water, salts or acids ( Hydrochloric acid, trifluoroacetic acid, acetic acid,
A mixed solution of an aqueous solution containing formic acid, etc.) is advantageously used.

TAN-2421A1, A2, A3, A
4. Since B1, B2 and B3 are acidic substances, they can be obtained as base addition salts such as salts with alkali metals such as sodium and potassium, and salts with alkaline earth metals such as calcium and magnesium by known methods. it can. TAN-24 obtained in Examples 2 and 3 described below
21A1 (compound 1), A2 (compound 2), A3 (compound 3), A4 (compound 4), B1 (compound 5), B2
The structural formulas of (Compound 6) and B3 (Compound 7) were determined as shown in [Table 1] and [Table 2] by detailed examination of physicochemical data and NMR spectra.

[0063]

[Table 1]

[0064]

[Table 2]

Next, a method for producing the compound [I] or a salt thereof will be described. In the reactions described below, the reaction for protecting the functional group that should not be involved in the reaction of the raw materials and the type of the protecting group, and the elimination reaction of the protecting group are appropriately selected from those known per se or means known per se. sell. Reagents commonly used in the following text are represented by the following abbreviations. DCC: dicyclohexylcarbodiimide WSC: 1-ethyl-3- (3-dimethylaminopropyl) hydrochloride carbodiimide (water-soluble carbodiimide hydrochloride) DIC: N, N'-diisopropylcarbodiimide HOBT: 1-hydroxybenzotriazole THF: tetrahydrofuran DMF: N, N-dimethylformamide TEA: triethylamine TFA: trifluoroacetic acid

In the general formula [I], the compound in which R ¹ is an esterified carboxyl group or a salt thereof is, for example, a compound in which R ¹ is a carboxyl group in the general formula [I] or a salt thereof is esterified. It can be produced by subjecting it to a reaction. The esterification reaction is performed by a method known per se, for example, the following method. 1) A starting compound is a diazoalkane (eg, diazomethane,
Phenyldiazomethane, diphenyldiazomethane, etc.). 2) reacting the starting compound with an activated alkyl halide (eg, methyl iodide, benzyl bromide, chloromethyl methyl ether, etc.); 3) The starting compound is reacted with an alcohol (eg, methanol, ethanol, benzyl alcohol) in the presence of an acid catalyst or a condensing agent.
Reaction). Examples of the acid catalyst include hydrochloric acid,
Sulfuric acid, camphorsulfonic acid, toluenesulfonic acid and the like are used, and as a condensing agent, for example, DCC, WSC, DIC and the like are used. 4) The starting compound is converted to an active ester and reacted with an alcohol (eg, methanol, ethanol, benzyl alcohol, etc.). As the active ester, for example, 1-
Esters with hydroxy-1H-2-pyridone, N-hydroxysuccinimide, N-hydroxyphthalimide, HOBT and the like are used. 5) reacting the starting compound with an acid halide (eg, ethyl chloroformate, benzyl chloroformate, etc.);
It is led to an acid anhydride and reacted with an alcohol (eg, methanol, ethanol, benzyl alcohol, etc.). 6) The starting compound is led to an acid halide (eg, acid chloride, acid bromide, etc.) and reacted with an alcohol (eg, methanol, ethanol, benzyl alcohol, etc.).

This reaction may be carried out in the presence of a base.
Examples of the base used include, for example, tertiary amines (eg,
Trimethylamine, triethylamine, tripropylamine, N-methylpiperidine, N-methylpyrrolidine, cyclohexyldimethylamine, N-methylmorpholine, etc.),
Secondary amines (eg, di-n-butylamine, diisobutylamine, dicyclohexylamine, etc.), aromatic tertiary amines (eg, pyridine, lutidine, collidine, 4-dimethylaminopyridine, etc.), hydroxides of alkali metals ( Examples: sodium hydroxide, potassium hydroxide, etc.), alkali metal carbonates (eg, sodium carbonate, potassium carbonate, etc.), alkali metal bicarbonates (eg, sodium bicarbonate, etc.), alkaline earth metal hydroxides Object (eg, calcium hydroxide, etc.)
Are used. This reaction is usually performed in a solvent that does not adversely influence the reaction. Examples of the solvent include amides (eg, formamide, DMF, N, N-dimethylacetamide, N-methylpyrrolidone, etc.), sulfoxides (eg,
Dimethyl sulfoxide, etc.), aromatic bases (eg, pyridine, etc.), halogenated hydrocarbons (eg, chloroform, dichloromethane, etc.), ethers (eg, diethyl ether, tetrahydrofuran, dioxane, etc.), nitriles (eg, acetonitrile) ), Esters (eg, ethyl acetate, ethyl formate, etc.), aliphatic or aromatic hydrocarbons (eg, hexane, benzene, toluene, etc.), ketones (eg, acetone, methyl ethyl ketone, methyl isobutyl ketone, etc.) Are used. The alcohol used as a reaction reagent may be used in excess as a solvent. These solvents may be mixed and used at an appropriate ratio. The reaction temperature is not particularly limited as long as the reaction proceeds, but is usually about -50 ° C to 150 ° C, preferably about -3 ° C.
It is performed at 0 ° C to 80 ° C. The reaction time varies depending on the starting material, base, reaction temperature and type of solvent used, but the reaction is usually carried out for several tens of minutes to several tens of hours.

In the general formula [I], a compound or a salt thereof in which R ¹ is an amidated carboxyl group can be obtained, for example, by reacting a compound or a salt thereof in the general formula [I] in which R ¹ is a carboxyl group. It can be manufactured by attaching to. In the amidation reaction, for example, a compound in which R ¹ is a carboxyl group (hereinafter abbreviated as carboxylic acid)
Alternatively, a reactive derivative thereof is reacted with a compound represented by the general formula HN- (R ⁹ ) R ¹⁰ [III], wherein R ⁹ and R ¹⁰ have the same meaning as described above, or a salt thereof. Can be performed. As the reactive derivative of the carboxylic acid, for example, an acid halide, an active ester or the like is used. Such a reactive derivative is specifically described as follows. 1) Acid halide As the acid halide, for example, acid chloride, acid bromide and the like are used. 2) Active ester Here, as the active ester, for example, methyl ester, ethyl ester, methoxymethyl ester, propargyl ester, 4-nitrophenyl ester, 2,4-dinitrophenyl ester, trichlorophenyl ester,
Other than esters such as pentachlorophenyl ester and mesylphenyl ester, 1-hydroxy-1H-2-pyridone,
Esters with N-hydroxysuccinimide, N-hydroxyphthalimide, HOBT and the like are used.

When the carboxylic acid is directly reacted with the compound [III] or a salt thereof, for example, DCC, WSC, DIC
And the like. These condensing agents include the above-mentioned active esters (eg, 1-hydroxy-1H-2-pyridone,
N-hydroxysuccinimide, N-hydroxyphthalimide, esters with HOBT, etc.). This reaction may be carried out in the presence of a base, and the same base as described above is used. In this method, the compound [III] or a salt thereof is usually used in an equivalent amount of 1 equivalent to the carboxylic acid or the reactive derivative of the carboxylic acid, but may be used in excess as long as the reaction is not hindered. When a base is used, the amount of the base used varies depending on the starting compound used, the type of the carboxylic acid, the type of the reactive derivative of the carboxylic acid, and other reaction conditions. It is an equimolar, preferably about 1 to 3 equimolar. This reaction is generally performed in a solvent that does not affect the reaction. Examples of the solvent include amides (eg, formamide, DM
F, N, N-dimethylacetamide, N-methylpyrrolidone, etc.), sulfoxides (eg, dimethylsulfoxide), aromatic amines (eg, pyridine), halogenated hydrocarbons (eg, chloroform, dichloromethane, etc.) ,
Ethers (eg, diethyl ether, tetrahydrofuran, dioxane, etc.), nitriles (eg, acetonitrile, etc.), esters (eg, ethyl acetate, ethyl formate, etc.),
Aliphatic or aromatic hydrocarbons (eg, hexane, benzene, toluene, etc.), ketones (eg, acetone, methyl ethyl ketone, methyl isobutyl ketone, etc.), water, etc.
Alternatively, these solvents may be mixed and used at an appropriate ratio. The reaction temperature is not particularly limited as long as the reaction proceeds, but is usually about -50 ° C to 150 ° C, preferably about
It is carried out at 30 ° C to 80 ° C. The reaction time varies depending on the starting materials, base, reaction temperature, and type of solvent used.
The reaction is usually performed for tens of minutes to tens of hours.

In the general formula [I], R ² is a group represented by the formula —CH
₂ (CHOH) m ¹ COOR ¹⁸ [wherein m ¹ and R ¹⁸ have the same meanings as described above] or a salt thereof, for example, in the general formula [I], when R ² is a group represented by the formula —CH ₂ (C
HOH) m ¹ COOH wherein m ¹ is as defined above.
Can be produced by subjecting the compound represented by or a salt thereof to the above-mentioned esterification reaction. In the general formula [I], R ² is a group represented by the formula —CH ₂ (CHOH) m ² CON
The compound represented by R ¹⁹ R ²⁰ [wherein m ² , R ¹⁹ and R ²⁰ have the same meaning as described above] or a salt thereof is, for example, a compound represented by the general formula [I] wherein R ² is a group represented by the formula —CH ₂ ( CHOH) m ² CO
It can be produced by subjecting a compound represented by OH (where m ² has the same meaning as described above) or a salt thereof to an amidation reaction. The amidation reaction is performed, for example, when R ² has the formula -C
A compound represented by H ₂ (CHOH) m ² COOH (wherein m ² has the same meaning as described above) or a reactive derivative thereof, and a general formula HN- (R ¹⁹ ) R ²⁰ [IV] [wherein R ¹⁹ and R ²⁰ have the same meanings as described above], or a salt thereof, by the above-mentioned method.

In the general formula [I], R ² is a group represented by the formula —CH
_A compound represented by ₂ (CHOH) m ³ CONHS (＝ O) ₂ R ²¹ [wherein m ³ and R ²¹ have the same meanings as described above] or a salt thereof is represented by, for example, a general formula [ R ² is wherein -CH ₂ (CHOH) m ³ COOH [wherein in I], m ³
Is as defined above) or a salt thereof, and subjecting the compound to the amidation reaction described above. In this reaction, R ² has the formula —CH ₂ (CHOH) m ³ C
A compound represented by OOH or a reactive derivative thereof,
The reaction can be carried out by reacting with a compound represented by the general formula H ₂ NS (＝ O) ₂ R ²¹ [V], wherein R ²¹ has the same meaning as described above, or a salt thereof. In the general formula [I], R ² is a group represented by the formula —CH ₂ (CH
OH) m ⁴ CONHOOR ²² wherein m ⁴ and R ²² have the same meanings as described above, or a salt thereof, for example, in the general formula [I], wherein R ² is a group represented by the formula —CH ₂ (CHO
H) The compound represented by m ⁴ COOH wherein m ⁴ has the same meaning as described above, or a salt thereof, can be produced by subjecting the compound to the amidation reaction described above. This reaction is a compound or its reactive derivative represented by R ² has the formula ^{_{-CH 2 (CHOH) m 4 COOH}} , the general formula H ₂ NOR ²² (VI) wherein, R ²² is as defined above Has) or a salt thereof. In the general formula [I], R ² is a group represented by the formula —CH ₂ (CHO
H) The compound represented by m ⁵ R ²³ [wherein m ⁵ and R ²³ have the same meanings as described above] or a salt thereof is, for example, a compound represented by the general formula [I] wherein R ² is a hydrogen atom and n is 0. Or a salt thereof with a compound having a leaving group in the presence of a base. This alkylation reaction can be carried out in the same manner as the reaction used in the method for producing a hydrocarbon compound or a salt thereof in which R ² may be substituted in the following general formula [I].

In the general formula [I], R ² is a group represented by the formula —CH
_The compound represented by ₂ (CHOH) m ⁶ CH ₂ OH (where m ⁶ has the same meaning as described above) or a salt thereof is, for example, a compound represented by the general formula [I] wherein R ² is a group represented by the formula —CH ₂ (CHOH) m ⁶ CO
OR ¹⁸ [wherein m ⁶ and R ¹⁸ have the same meanings as described above] or a salt thereof, which can be produced by subjecting the compound to a reduction reaction. This reduction reaction is suitably performed using a reducing agent. Examples of the reducing agent include metal hydride compounds (eg, lithium aluminum hydride, diisobutyl aluminum hydride, lithium tri-t-butoxyaluminum hydride, lithium borohydride, sodium borohydride, cyanoborohydride sodium,
Diborane, etc.), metal or metal salt (eg, zinc, etc.), thiols (eg, thiophenol, dithioerythritol,
And dithiothreitol. This reaction may be carried out in the presence of an acid. Examples of the acid used include mineral acids (eg, hydrochloric acid, sulfuric acid, etc.), organic acids (eg, acetic acid,
And propionic acid, TFA, methanesulfonic acid, toluenesulfonic acid, camphorsulfonic acid and the like, and Lewis acids (aluminum chloride, boron trifluoride, titanium tetrachloride and the like). This reaction is generally performed in a solvent that does not adversely influence the reaction. Examples of the solvent include amides (eg, formamide, DMF, N, N-dimethylacetamide, N-methylpyrrolidone, etc.), sulfoxides (eg, dimethylsulfoxide, etc.), aromatic amines (eg, pyridine, etc.) , Halogenated hydrocarbons (eg, chloroform, dichloromethane, etc.), ethers (eg, diethyl ether, THF, dioxane, etc.), nitriles (eg, acetonitrile, etc.), aliphatic or aromatic hydrocarbons (eg, hexane) Benzene, toluene and the like), water and the like or a mixture of these at an appropriate ratio. The reaction temperature is not particularly limited as long as the reaction proceeds.
70 ° C to 150 ° C, preferably about -40 ° C to 1 ° C
Performed at 00 ° C. The reaction time varies depending on the starting materials used, the reaction temperature, and the type of the solvent, but the reaction is usually carried out for several tens of minutes to several tens of hours.

In the general formula [I], R ² is a group represented by the formula —CH
₂ (CHOH) m ⁶ CH ₂ OR ²⁴ ′ [wherein, m ⁶ has the same meaning as described above, and R ²⁴ ′ represents an optionally substituted hydrocarbon group] and salts thereof, for example, In the general formula [I], R ² is a group represented by the formula —CH ₂ (CHOH) m ⁶ CH ₂
OH (wherein m ⁶ has the same meaning as described above) or a salt thereof, in the presence of a base, with the formula R ²⁴ ′ -X ′, wherein R ²⁴ ′ may be substituted X 'represents a leaving group, a hydrocarbon group;
With a compound having a leaving group). Examples of the leaving group represented by X ′ include a halogen atom and a sulfonyloxy group (eg,
Methanesulfonyloxy group, toluenesulfonyloxy group, trifluoromethanesulfonyloxy group, etc.). About the compound having a leaving group used in this reaction, a base, a solvent, a reaction temperature and a reaction time,
The same conditions as those described later for the method for producing a compound or a salt thereof, in which R ³ or R ⁴ is a hydroxyl group substituted with an optionally substituted hydrocarbon group in the general formula [I], are used. In the general formula [I], R ² is a group represented by the formula —CH ₂ (CHO
H) m ⁶ CH ₂ OR ²⁴ ″ wherein m ⁶ is as defined above,
²⁴ ″ represents an optionally substituted acyl group) and a salt thereof, for example, the compound represented by the general formula [I] wherein R ² is represented by the formula —CH ₂ (CHOH) m ⁶ CH ₂ OH , M
⁶ has the same meaning as defined above) or a salt thereof is subjected to an acylation reaction. The acylating agent, the base, the solvent, the reaction temperature and the reaction time used in this reaction are described below in general formula [I], wherein R ³ or R ⁴ is a hydroxyl group substituted by an optionally substituted acyl group. The same conditions as in the method for producing the compound or a salt thereof are used.

In the general formula [I], the compound represented by the formula (I) wherein R ² is a hydroxyl group and n is 1 or 2 or a salt thereof is, for example, a compound represented by the general formula [I] wherein R ² is a hydrogen atom or substituted. It can be produced by subjecting a compound represented by a good hydrocarbon group or a salt thereof, or a compound represented by the general formula [II] or a salt thereof to an oxidation reaction. This oxidation reaction is suitably performed using an oxidizing agent. Examples of the oxidizing agent include peracids (eg, peracetic acid,
Succinic acid, perbenzoic acid, m-chloroperbenzoic acid, etc.), peresters (eg, tert-butyl perbenzoate, tert-butyl m-chloroperbenzoate, etc.), chromic acids (eg, chromic anhydride) , Chromate sulfuric acid, chromate acetic acid, etc.), chromates (eg, potassium chromate, sodium chromate, pyridinium chromate, pyridinium chlorochromate, etc.), dichromates (eg, potassium dichromate, dichromium) Sodium, pyridinium dichromate, etc.), permanganates (eg, potassium permanganate, sodium permanganate, etc.), perhalo acids (eg, periodate, perbromate, perchlorate, etc.), Perhalates (eg, sodium periodate, tetrabutylammonium periodate, potassium perbromate, sodium perchlorate, etc.), halogens (eg, iodine, bromine, chlorine, etc.), peroxides Products (eg, hydrogen peroxide, butyl hydroperoxide, etc.), lead tetraacetate, nitric acid, nitrates (eg, sodium nitrate, potassium nitrate, etc.), oxygen, sulfuryl chloride, dimethyl sulfoxide and the like.

This reaction is usually performed in a solvent that does not adversely influence the reaction. Examples of the solvent include amides (eg, formamide, DMF, N, N-dimethylacetamide, N-methylpyrrolidone, etc.), sulfoxides (eg, dimethylsulfoxide, etc.), aromatic amines (eg, pyridine, etc.) , Halogenated hydrocarbons (eg, chloroform, dichloromethane, etc.), ethers (eg, diethyl ether, diisopropyl ether, THF, dioxane, etc.),
Nitriles (eg, acetonitrile, etc.), esters (eg, ethyl acetate, ethyl formate, etc.), ketones (eg, acetone, methyl ethyl ketone, methyl isobutyl ketone, etc.), alcohols (eg, methanol, ethanol, te
rt-butanol, etc.), aliphatic carboxylic acids (eg, formic acid,
Acetic acid, propionic acid, etc.), aliphatic or aromatic hydrocarbons (eg, hexane, benzene, toluene, xylene,
Nitrobenzene, chlorobenzene, etc.), water, etc., or a mixture of these solvents at an appropriate ratio. This reaction may be carried out in the presence of an acid. Examples of the acid used include mineral acids (eg, hydrochloric acid, sulfuric acid, phosphoric acid, etc.), organic acids (eg, formic acid, acetic acid, propionic acid, TF
A, methanesulfonic acid, toluenesulfonic acid, camphorsulfonic acid, etc.) and Lewis acids (aluminum chloride, boron trifluoride, titanium tetrachloride, etc.).

This reaction may be carried out in the presence of a base.
Examples of the base include alkali metal hydrides (eg, sodium hydride, potassium hydride, etc.), alkaline earth metal hydrides (eg, calcium hydride, etc.), and alkali metal alkoxides (eg, sodium methoxide, sodium Ethoxide, etc.), alkali metal hydroxides (eg, sodium hydroxide, potassium hydroxide, etc.), alkali metal carbonates (eg, sodium carbonate, potassium carbonate, etc.), alkali metal bicarbonates (eg, carbonic acid) Sodium hydroxide, alkaline earth metal hydroxides (eg, calcium hydroxide, etc.), alkali metal phosphates (eg, tripotassium phosphate, etc.), tertiary amines (eg, trimethylamine, triethylamine, triethylamine) Propylamine, N-methylpiperidine, N-methylpyrrolidine, cyclohexyldimethylamine, N-methylmorpholine, etc.) Grade amine (e.g., di -n- butylamine, diisobutylamine, dicyclohexylamine, etc.), aromatic tertiary amines (e.g., pyridine, lutidine,
Collidine, 4-dimethylaminopyridine, etc.). The reaction temperature is not particularly limited as long as the reaction proceeds, but it can be carried out usually at about -70 ° C to 150 ° C, preferably at about -30 ° C to 100 ° C. The reaction time varies depending on the starting materials used, the reaction temperature and the type of solvent, but the reaction is usually carried out for several tens of minutes to several tens of hours.

In the general formula [I], R ² is a hydrogen atom,
n is or a salt thereof 0, for example, in the formula [I], compound or method of a salt thereof literature R ² has the formula -CH ₂ COOH, n is represented by 1 (Journal Journal of Organic Chemistry
Organic Chemistry) 31, 835, (1966)). In this method, the general formula

Embedded image [Wherein R ¹ , R ³ , R ⁴ , R ⁵ , R ⁶ , R ⁷ and Y have the same meanings as described above] or a salt thereof may be produced.

In this case, the compound represented by the general formula [II] or a salt thereof is subjected to, for example, a reduction reaction, and if necessary, a hydrocarbon group introduction reaction.
formula

Embedded image Wherein R ² ′ ″ represents a hydrogen atom or a hydrocarbon group which may be substituted, and other symbols have the same meanings as described above. it can. As the optionally substituted hydrocarbon group represented by R ² ′ ″, the same as the aforementioned optionally substituted hydrocarbon group represented by R ² can be used. This reduction reaction can be carried out in the same manner as the above reduction reaction.

The reaction for introducing a hydrocarbon group can be carried out as follows. In the general formula [I], the compound wherein R ² is an optionally substituted hydrocarbon group and n is 0 or a salt thereof is, for example, a compound represented by the general formula [I] wherein R ² is a hydrogen atom and n is 0 The compound can also be produced by reacting the compound or a salt thereof with a compound having a leaving group in the presence of a base. The compound having a leaving group,
It is a compound having a functional group which is easily removed by substitution or the like by a chemical reaction, specifically, a compound represented by the general formula R ² -X [VII] [wherein R ² represents a hydrocarbon group which may be substituted, X
Represents a chlorine atom, a bromine atom or an iodine atom] or a salt thereof, a general formula R ² —OSO ₂ —R ⁴¹ [VIII] wherein R ² is a hydrocarbon which may be substituted A group represented by R
⁴¹ represents an optionally substituted hydrocarbon group] or a salt thereof, or a general formula (R ² -OSO ₂ ) O [IX] wherein R ² may be substituted Or a salt thereof.
Examples of the optionally substituted hydrocarbon group represented by R ⁴¹ include, for example, a methyl group, an ethyl group, a phenyl group (which may be substituted with a methyl group, a bromine atom and the like), a trifluoromethyl group and the like. It is.

In addition, epoxides can be used as the compound having a leaving group. As the epoxides, for example, propylene oxide, glycidol, ethyl 2,3-epoxypropionate and the like are preferable. This reaction may be carried out in the presence of a base. As the base, those described in the section on the oxidation reaction are used in the same manner. This reaction is generally performed in a solvent that does not adversely influence the reaction. As the solvent, those described above in the section of the oxidation reaction are similarly used. The reaction temperature is not particularly limited as long as the reaction proceeds, but is usually about -70 ° C to 150 ° C,
Preferably, it can be carried out at about -30 ° C to 80 ° C. The reaction time varies depending on the starting materials, the base, the reaction temperature and the type of the solvent to be used. The reduction reaction of these disulfide groups to thiols and the introduction of hydrocarbon groups to the generated thiol groups are:
The reaction can be performed continuously in the same reaction vessel.

In the general formula [I], a compound or a salt thereof in which R ³ or R ⁴ is a hydroxyl group substituted with an optionally substituted hydrocarbon group can be used, for example, in the general formula [I]
Wherein a compound or a salt thereof in which R ³ or R ⁴ is a hydroxyl group is reacted with a compound having a leaving group in the presence of a base, or a starting compound is diazoalkane (eg, diazomethane, phenyldiazomethane, diphenyldiazomethane, etc.) Can be produced by reacting The compound having a leaving group is a compound having a functional group which can be easily substituted by a chemical reaction, and specifically includes a halide (eg, methyl iodide, ethyl iodide, propyl iodide, Isopropyl, butyl iodide, pentyl iodide, allyl bromide, benzyl bromide, chloromethyl methyl ether, etc., sulfonic esters (eg, methyl methanesulfonate, methyl p-toluenesulfonate, ethyl p-toluenesulfonate) , Methyl benzenesulfonate, methyl trifluoromethanesulfonate, ethyl trifluoromethanesulfonate), sulfates (eg, dimethyl sulfate, diethyl sulfate, etc.). This reaction may be carried out in the presence of a base.
As the base, those described in the section on the oxidation reaction are used in the same manner. This reaction is generally performed in a solvent that does not adversely influence the reaction. As the solvent, those described above in the section of the oxidation reaction are similarly used. The reaction temperature is not particularly limited as long as the reaction proceeds.
C., preferably at about -30.degree. C. to 80.degree. The reaction time varies depending on the starting materials, the base, the reaction temperature and the type of the solvent to be used.

In the general formula [I], a compound or a salt thereof in which R ³ or R ⁴ is a hydroxyl group substituted with an optionally substituted acyl group can be used, for example, in the general formula [I]
Wherein R ³ and / or R ⁴ are hydroxyl groups, or a salt thereof, by subjecting the compound to an acylation reaction. The acylation reaction of the hydroxyl group can be carried out by reacting the starting compound with an acylating agent, for example, a carboxylic acid or a reactive derivative thereof, in a solvent. As the reactive derivative of the carboxylic acid, for example, the same acid halide, acid anhydride, mixed acid anhydride, active ester and the like as described above are used. In the general formula [I], when a compound in which R ³ and / or R ⁴ is a hydroxyl group or a salt thereof is directly reacted with an organic acid, for example, a condensing agent such as DCC, WSC or DIC is used. These condensing agents may be used for the synthesis of the above-mentioned active esters (eg, esters with 1-hydroxy-1H-2-pyridone, N-hydroxysuccinimide, N-hydroxyphthalimide, HOBT, etc.). Good. This reaction may be carried out in the presence of a base. As the base, those described in the section of the esterification reaction are used in the same manner. This reaction is generally performed in a solvent that does not adversely influence the reaction. As the solvent, those described in the section of the esterification reaction are used similarly. The reaction temperature is not particularly limited as long as the reaction proceeds, but it can be carried out usually at about -50 ° C to 150 ° C, preferably at about -30 ° C to 80 ° C. The reaction time varies depending on the starting material, base, reaction temperature and type of solvent used, but the reaction is usually carried out for several tens of minutes to several tens of hours.

In the general formula [I], a compound represented by the formula -OCOOR ²⁷ wherein R ³ and / or R ⁴ is represented by the formula -OCOOR ²⁷ , wherein R ²⁷ has the same meaning as described above, or a salt thereof is, for example, In the formula [I], a compound or a salt thereof in which R ³ and / or R ⁴ is a hydroxyl group is represented by the general formula X-COOR ²⁷ [X] wherein R ²⁷ has the same meaning as described above, and X represents a chlorine atom or Or a salt thereof, or a compound represented by the general formula (R ²⁷ OCO) ₂ O [XI] wherein R ²⁷ is as defined above, or a salt thereof. And subjecting it to a reaction with This reaction may be carried out in the presence of a base. As the base, those described in the section of the esterification reaction are used in the same manner. This reaction is generally performed in a solvent that does not adversely influence the reaction. As the solvent, those described in the section of the esterification reaction are used similarly. The reaction temperature is not particularly limited as long as the reaction proceeds, but it can be carried out usually at about -50 ° C to 150 ° C, preferably at about -30 ° C to 80 ° C. The reaction time depends on the starting materials, base,
The reaction is usually performed for several tens of minutes to several tens of hours, depending on the reaction temperature and the type of the solvent.

In the general formula [I], R ⁵ , R ⁶ and / or
Alternatively, the compound or a salt thereof in which R ⁷ is a halogen atom can be obtained, for example, by subjecting a compound in which R ⁵ , R ⁶ and / or R ⁷ in the general formula [I] is a hydrogen atom or a salt thereof to a halogenation reaction. Can be manufactured. Examples of the halogenating agent used in this reaction include, for example, chlorine, bromine, iodine, N-bromosuccinimide, N-chlorosuccinimide, N-bromoacetamide, pyridinium bromide perbromide, hypochlorous acid t -Butyl, sulfuryl chloride and the like. This reaction may be carried out in the presence of a radical initiator such as 2,2'-azobis (isobutyronitrile). This reaction may be carried out in the presence of an acid. As the acid, those similar to the above-mentioned oxidation reaction are used. This reaction is generally performed in a solvent that does not adversely influence the reaction. As the solvent, those described in the section on the oxidation reaction are used in the same manner. The reaction temperature is not particularly limited as long as the reaction proceeds, but it can be carried out usually at about -70 ° C to 150 ° C, preferably at about -30 ° C to 100 ° C.
The reaction time varies depending on the starting materials used, the reaction temperature, and the type of the solvent, but the reaction is usually carried out for several tens of minutes to several tens of hours.

In the general formula [I], a compound or a salt thereof in which R ⁷ is a nitro group is described, for example, in the literature [edited by The Chemical Society of Japan, New Experimental Chemistry Course, Vol. 14, 1261-130.
0 pages, Maruzen Co., Ltd., 1978 and the Chemical Society of Japan,
Fourth Edition, Experimental Chemistry, Vol. 20, pp. 394-405, Maruzen Co., Ltd., 1992] or the like, or a method analogous thereto. Examples of the starting compound for this reaction include a compound of the formula [I], wherein R ⁷ is a hydrogen atom or a halogen atom, or a salt thereof.
Examples of the reagent used in the reaction include nitric acid, nitrates (eg, sodium nitrate, potassium nitrate, etc.), nitrobenzene, benzoyl nitric acid, acetyl nitric acid, diacetyl ortho nitric acid, nitrous oxide, nitrous oxide, nitrous acid, nitrous acid, and the like. Nitrates (eg, sodium nitrite, potassium nitrite, etc.) and the like. This reaction may be carried out in the presence of an acid. As the acid, those similar to the above-mentioned oxidation reaction are used. This reaction is generally performed in a solvent that does not adversely influence the reaction. As the solvent, those described in the section on the oxidation reaction are used in the same manner. The reaction temperature is not particularly limited as long as the reaction proceeds, but is usually about -70 ° C to 150 ° C.
C., preferably at about -40.degree. C. to 100.degree.
The reaction time varies depending on the starting materials used, the reaction temperature, and the type of the solvent, but the reaction is usually carried out for several tens of minutes to several tens of hours.

In the general formula [I], a compound represented by an acyl group in which R ⁷ may be substituted or a salt thereof is
For example, in the literature [The Chemical Society of Japan, New Experimental Chemistry,
Vol. 751-875, Maruzen Co., Ltd., 1977 and edited by The Chemical Society of Japan, 4th edition Experimental Chemistry, Vol. 21, 39
4-405, Maruzen Co., Ltd., 1991, etc.] and the like. Examples of the starting compound for this reaction include a compound represented by the formula (I) wherein R ⁷ is a hydrogen atom or a salt thereof. Examples of the acylating agent used for the reaction include carboxylic acid, carboxylic acid halide, carboxylic anhydride and the like. This reaction may be carried out in the presence of an acid. As the acid, those similar to the above-mentioned oxidation reaction are used. This reaction is generally performed in a solvent that does not adversely influence the reaction. As the solvent, those described in the section on the oxidation reaction are used in the same manner. The reaction temperature is not particularly limited as long as the reaction proceeds.
70 ° C to 150 ° C, preferably about -40 ° C to 1 ° C
Performed at 00 ° C. The reaction time varies depending on the starting materials used, the reaction temperature, and the type of the solvent, but the reaction is usually carried out for several tens of minutes to several tens of hours.

In the general formula [I], when R ⁷ is a compound represented by a formyl group or a salt thereof, for example, a compound described in the literature [edited by The Chemical Society of Japan, New Experimental Chemistry Course, Vol.
-751, Maruzen Co., Ltd., 1977 and edited by The Chemical Society of Japan, 4th Edition, Experimental Chemistry, Vol. 21, 106-124.
Page, Maruzen Co., Ltd., 1991, etc.] or a method analogous thereto. Examples of the starting compound for this reaction include a compound represented by the formula (I) wherein R ⁷ is a hydrogen atom or a salt thereof. Examples of the formylation reaction include a Vilsmeier reaction. In this reaction, for example, a halogenating reagent such as phosphoryl chloride, phosgene, oxalyl chloride, thionyl chloride, triphenylphosphine / bromine, hexachlorotriphosphazatriene and DMF, N-methylformanilide, N-formylmorpholine, N, N -Diisopropylformamide, ethyl orthoformate, and other formyl group-donating reagents. This reaction is generally performed in a solvent that does not adversely influence the reaction. As the solvent, those similar to the oxidation reaction described above are used. The reaction temperature is not particularly limited as long as the reaction proceeds, but the reaction is usually carried out at about -70 ° C to 150 ° C, preferably at about -40 ° C to 100 ° C. The reaction time varies depending on the starting materials used, the reaction temperature, and the type of the solvent, but the reaction is usually carried out for several tens of minutes to several tens of hours.

In the general formula [I], a compound represented by the formula (I) wherein R ⁷ is a hydrocarbon group which may be substituted or a heterocyclic group which may be substituted, or a salt thereof, may be used. , R ⁷ can be produced by a coupling reaction between a compound represented by a halogen atom or a salt thereof and an organic boron compound. This reaction is described, for example, in the literature (Synthetic Communications, 11, 513 (1981), Jour
nal of American Chemical Society, 111, 314 (198
9), Tetrahedron Letters, 33, 2773 (1992), Synlett,
207 (1992), Journal of American Chemical Society,
116, 10847 (1994), etc.] or a method analogous thereto. In this reaction, a palladium reagent (eg, tetrakis (triphenylphosphine) palladium, palladium (II) acetate, palladium (II) chloride, or the like) is usually used in a catalytic amount, but may be used in an amount of 1 equivalent or more. This reaction may be carried out in the presence of a phosphorus compound. As the phosphorus compound used, for example,
Triphenylphosphine, tris (2-methylphenyl)
Phosphine and the like. This reaction may be carried out in the presence of a base. As the base, those similar to the above-mentioned oxidation reaction are used. This reaction is generally performed in a solvent that does not adversely influence the reaction. As the solvent, those similar to the oxidation reaction described above are used. The reaction temperature is not particularly limited as long as the reaction proceeds, but is usually about -70 ° C to 20 ° C.
It is carried out at 0 ° C, preferably at about -20 ° C to 150 ° C. The reaction time varies depending on the starting materials used, the reaction temperature, and the type of the solvent, but the reaction is usually carried out for several tens of minutes to several tens of hours.

[0089] In formula (I), a compound or a salt thereof wherein R ⁷ is represented by optionally substituted hydrocarbon group, for example, in the formula (I), R ⁷ may be substituted It can also be produced by subjecting a compound represented by an acyl group or a salt thereof to a reduction reaction. This reaction is carried out, for example, by reacting R ² in the above-mentioned general formula [I].
There can be carried out in the same manner as the method for producing a compound represented by the formula ^{_{-CH 2 (CHOH) m 6 CH}} 2 OH. In the general formula [I], the compound wherein n is 1 or 2 or a salt thereof can be produced, for example, by oxidizing the compound wherein n is 0 or a salt thereof in the general formula [I]. This oxidation reaction is suitably performed using an oxidizing agent. As the oxidizing agent, the same oxidizing agent as described above is used. This reaction is generally performed in a solvent that does not adversely influence the reaction. As the solvent, those similar to the oxidation reaction described above are used. The reaction temperature is not particularly limited as long as the reaction proceeds, but it can be carried out usually at about -70 ° C to 150 ° C, preferably at about -30 ° C to 100 ° C. The reaction time varies depending on the starting materials used, the reaction temperature and the type of solvent, but the reaction is usually carried out for several tens of minutes to several tens of hours.

In the general formula [I], a compound wherein Y is two hydrogen atoms or a salt thereof is, for example, a compound represented by the general formula [I]
Wherein Y is an oxygen atom or a salt thereof is subjected to a reduction reaction. This reduction reaction is suitably performed using a reducing agent. As the reducing agent, those similar to the above-described reduction reaction are used. This reaction may be carried out in the presence of an acid. As the acid, those similar to the above-mentioned reduction reaction are used. This reaction is generally performed in a solvent that does not adversely influence the reaction. As the solvent, those similar to the reduction reaction described above are used. The reaction temperature is not particularly limited as long as the reaction proceeds.
70 ° C to 150 ° C, preferably about -40 ° C to 1 ° C
It can be performed at 00 ° C. The reaction time varies depending on the starting materials used, the reaction temperature, and the type of the solvent, but the reaction is usually carried out for several tens of minutes to several tens of hours.

Examples of the compounds obtained by the above-mentioned production method are shown in [Table 3] to [Table 11].

[Table 3]

[0092]

[Table 4]

[0093]

[Table 5]

[0094]

[Table 6]

[0095]

[Table 7]

[0096]

[Table 8]

[0097]

[Table 9]

[0098]

[Table 10]

[0099]

[Table 11] The meanings of the abbreviations in the above table are as follows.

[0100]

[Table 12]

When the compound [I] of the present invention has an asymmetric carbon or an asymmetric sulfur, stereoisomers may exist, and the respective stereoisomers and a mixture thereof are also included in the present invention. Stereoisomers may also exist when the substituent has an asymmetric carbon or an asymmetric sulfur, and each of these stereoisomers and a mixture thereof is also included in the present invention.
Compound [I] obtained by the above-mentioned production method may be used as a salt, and preferably, a pharmacologically acceptable salt is used. Examples of such a salt include, when compound [I] has an acidic group, a salt with an alkali metal (eg, sodium, potassium, etc.), a salt with an alkaline earth metal (eg, calcium, magnesium, etc.), etc. Are used. When the compound [I] has a basic group, for example, a salt with an inorganic acid (eg, hydrochloric acid, sulfuric acid, phosphoric acid, etc.) or an organic acid (eg, acetic acid, propionic acid, citric acid, tartaric acid, malic acid, oxalic acid) Acid addition salts such as salts with acid, methanesulfonic acid, etc.) are used. The compound [I] or a salt thereof of the present invention can inhibit the binding between ligand B7-1 and receptor protein CD28, and has an inhibitory action on IL-2 production from T cells. I have. Therefore, the compound [I] of the present invention or a salt thereof can be used as a safe and low-toxic drug such as an immunomodulator for humans and mammals (mouse, guinea pig, rat, cat, dog, sheep, horse, cow, monkey, etc.). Can be used as Specifically, it can be used as a transplant rejection inhibitor, a drug for treating allergy, a drug for treating rheumatism, a drug for treating autoimmune diseases, a drug for treating nephritis, a drug for treating diabetes, and the like. When the compound [I] of the present invention or a salt thereof is administered, for example, to humans, the compound [I] or a suitable pharmacologically acceptable carrier, excipient, or diluent is mixed with the compound orally as a pharmaceutical composition. It can be safely administered parenterally or parenterally. As the pharmaceutical composition, as an oral preparation, for example,
As parenteral preparations such as powders, granules, capsules, tablets, etc.
For example, injections, drops, external preparations (eg, nasal administration preparations,
Transdermal preparations), suppositories (eg, rectal suppositories, vaginal suppositories, etc.) and the like.

These preparations can be produced by a method known per se which is generally used in the preparation process. Oral preparations include compound [I] or a salt thereof, for example, excipients (eg, lactose, sucrose, starch, mannitol, etc.), disintegrants (eg, calcium carbonate, calcium carboxymethylcellulose, etc.), binders (eg, A pregelatinized starch, gum arabic, carboxymethylcellulose, polyvinylpyrrolidone, hydroxypropylcellulose, etc.) or a lubricant (eg, talc, magnesium stearate, polyethylene glycol 6000, etc.) is added and compression-molded. It is prepared by coating in a manner known per se for the purpose of taste masking, enteric coating or long-lasting. As the coating agent, for example, ethylcellulose, hydroxymethylcellulose, polyoxyethylene glycol, cellulose acetate phthalate, hydroxypropylmethylcellulose phthalate, and Eudragit (manufactured by Rohm, Germany, methacrylic acid / acrylic acid copolymer) are used. For injection, compound [I] or a salt thereof is a dispersant (eg, Tween 80 (manufactured by Atlas Powder Co., USA), HCO60 (manufactured by Nikko Chemicals), polyethylene glycol, carboxymethyl cellulose, sodium alginate, etc.), and preserved Agents (eg, methylparaben, propylparaben, benzyl alcohol, chlorobutanol, etc.), tonicity agents (eg, sodium chloride, glycerin, sorbitol, glucose, etc.) as aqueous injections, or olive oil, sesame oil, cottonseed oil, corn oil The compound can be produced by dissolving, suspending or emulsifying in a vegetable oil such as propylene glycol or the like and shaping it as an oily injection.

The external preparation is produced by converting the compound [I] or a salt thereof into a solid, semi-solid or liquid composition. For example, the solid composition may contain the compound of the present invention as it is or as excipients (eg, lactose, mannitol, starch, microcrystalline cellulose, sucrose, etc.), thickeners (eg, natural gums, cellulose derivatives, Acrylic acid polymer) is added and mixed to make a powder. The liquid composition is produced by preparing an oily or aqueous suspension in almost the same manner as in the case of injection. The semi-solid composition is preferably an aqueous or oily gel or an ointment. In addition, these compositions each include a pH adjuster (eg, carbonic acid, phosphoric acid, citric acid, hydrochloric acid, sodium hydroxide, etc.), a preservative (eg, paraoxybenzoates, chlorobutanol, benzalkonium chloride) Etc.) may be included. Suppositories are produced by converting compound [I] or a salt thereof into an oily or aqueous solid, semi-solid or liquid composition. As the oily base used in the composition, for example,
Glycerides of higher fatty acids (eg, cocoa butter, witepsols (manufactured by Dynamite Nobel), etc.), intermediate fatty acids (eg, miglyols (manufactured by Dynamite Nobel), etc.), or vegetable oils (eg, sesame oil, soybean oil, cottonseed oil, etc.) Are used. Examples of the aqueous base include polyethylene glycols and propylene glycol. As the aqueous gel base, for example, natural gums, cellulose derivatives, vinyl polymers, acrylic acid polymers and the like are used. When the compound [I] of the present invention or a salt thereof is used in humans, the dose may vary depending on the type and severity of the target disease, the age of the patient, and the like. Adults a day (weight 5
0 kg) about 1 mg to 1 g per person, especially about 4
mg to 200 mg, preferably once a day or 2 to 2 mg
It can be administered in three divided doses. When administered parenterally subcutaneously, intravenously or intramuscularly as an injection, the dosage is about 0.5 mg to 200 mg per adult per day.
mg, preferably about 1 mg to 50 mg.

The present invention further relates to (1) CHO cells containing CD28 or a cell membrane fraction thereof and soluble B7
The amount of binding between CD28 and B7-1-Ig upon contact with -1-Ig, and (2) CHO cells containing CD28 or a cell membrane fraction thereof, soluble B7-1-Ig and a test compound. The present invention relates to a method for screening a compound having an activity of inhibiting or enhancing the binding between CD28 and B7-1 or a salt thereof, which comprises comparing the amount of binding between CD28 and B7-1-Ig at the time of exposure. In the method of the present invention for screening for a compound or a salt thereof having an activity of inhibiting or enhancing the binding between CD28 which is a receptor protein and B7-1 which is a ligand, CHO cells containing CD28 contain a CD28 gene. It can be produced by introducing an expression vector into CHO cells and culturing it under conditions that allow expression of the CD28 gene. As the gene of CD28, for example, cDNA or genomic DNA encoding CD28 is used, but it is not necessarily limited as long as it has a nucleotide sequence encoding CD28. Specifically, CD28 having the base sequence represented by SEQ ID NO: 1
[FIG. 2]. These D
NA can also be produced using a genetic engineering technique known per se. As an expression vector, for example, p
AKKO-1.11H, pXT1, pRC / CMV, pR
C / RSV, pcDNA I Neo and the like are used, and among them, pAKKO-1.11H is preferable. Any promoter can be used as long as it efficiently functions in a host cell, and is preferably an SV40 promoter, a CMV promoter, an HSV-TK promoter, an SRα promoter, an RSV promoter, or the like, and particularly preferably an SRα promoter. It is preferable to use an expression vector containing an enhancer, a splicing signal, a polyA addition signal, a selection marker and the like in addition to the above. As a selectable marker, a dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene,
Ampicillin resistant gene (hereinafter sometimes abbreviated as Ap ^r), such as neomycin resistance gene (G418 resistance). Among them, the dhfr gene is preferable.

The expression vector carrying the CD28 gene of the present invention includes, specifically, the above-mentioned promoter (particularly, SRα promoter, C
MV promoter, RSV promoter, etc.), a polyA addition signal is inserted downstream of the CD28 gene, a selection marker such as a dhfr gene or a neomycin resistance gene is inserted downstream thereof, and an ampicillin resistance gene is inserted downstream thereof. An inserted one is preferred.
More specifically, for example, an expression vector that can be prepared by the method shown in FIG. 1, wherein an SRα promoter is inserted upstream of the CD28 gene and a polyA addition signal is inserted downstream of the CD28 gene An expression vector designated by pAKKO-CD28 (FIG. 1, Reference Example 1) having a dhfr gene inserted downstream thereof and an ampicillin resistance gene inserted further downstream thereof is suitable. By introducing the thus prepared expression vector carrying the gene for CD28 into CHO cells, CHO cells that overexpress CD28 can be produced. CHO cells [Journal of Experimental Medicine. 108: 945 (19
95)], particularly, CHO lacking the dhfr gene.
Cells [Proceedings of the National Academy of Science of the U.S.A.
s of the United State of America) 77: 4216-4220 (1
980), below, CHO (dhfr ^-) there is a case to be referred to as cell], CHO K-1 cells [professional sheathing's of the National Academy of Saienshiizu-of-the-Yusesue (Proceedings of the Nat
ional Academyof Sciences of the United State of Am
erica) 60: 1275 (1968)]. In particular, when the dhfr gene is inserted into an expression vector as a selection marker, CHO (dhfr ⁻ ) cells are preferable.
In this case, a transformant can be selected very easily by culturing in a medium containing no nucleic acid. CHO cells can express not only the CD28 gene at a high level but also extremely stably.

As the combination of the expression vector and the host cell, a preferable combination can be appropriately selected. For example, pAK
Expression vector indicated by KO-CD28 (Reference Example 1)
And CHO (dhfr ⁻ ) cells are suitable. As a method for introducing an expression vector into a host cell, a known method, for example, a calcium phosphate method [Virology (Vi
rology) 52: 456-467 (1973)], electroporation [EMBO Journal. 1: 841-845 (1982)]
Are used. CHO cells that overexpress CD28
First, CHO cells into which the above-described expression vector has been introduced can be obtained by selecting a transformant using a selection marker as an index, and then selecting a clone. dhf
When the r gene is used, resistant cells are selected by gradually increasing the concentration of methotrexate (MTX) and continuing the culture, whereby the transgene is amplified intracellularly to obtain a cell line with higher expression. You can also. Examples of the CHO cells capable of highly expressing CD28 include, for example, the aforementioned pAKK
An expression vector designated by O-CD28
CHO cells designated as 28-CHO-11 (FERM
BP-5431). CD2 of the present invention
By culturing CHO cells containing an expression vector containing the gene No. 8 under conditions that allow expression of the CD28 gene, CHO cells containing CD28 can be produced. When culturing CHO cells containing an expression vector containing the CD28 gene, the medium used is about 0.5.
EMEM, DMEM, RPMI 164 with ~ 20% fetal calf serum
0, MEM-α and the like. In particular, when an expression vector containing the dhfr gene is used as a selection marker, it is preferable to use a DMEM medium containing dialyzed fetal bovine serum containing no nucleic acid or an α-MEM medium containing dialyzed fetal bovine serum containing no nucleic acid. Preferably, the pH is between about 6-8. The cultivation is usually performed at about 30 to 40 ° C. for about 15 to 200 hours, and the medium is replaced, aerated, agitated, etc. as necessary.

The cell membrane fraction of CD28-containing CHO cells refers to a cell membrane-rich fraction obtained by crushing the above-mentioned CD28-containing CHO cells by a method known per se. As a method for disrupting cells, for example, Potter-Elv
Methods of crushing cells with an ehjem-type homogenizer, crushing with a Waring blender or Polytron (Kinematica), crushing with ultrasonic waves, crushing by ejecting cells from a thin nozzle while applying pressure with a French press, freeze-thaw, etc. Can be In order to fractionate cell membranes, methods such as differential centrifugation and density gradient centrifugation are mainly used. For example, the cell lysate is slowed (50
0-3000 rpm) for a short time (usually about 1-10 minutes), and the supernatant is further centrifuged (15000-30000 rpm)
m), usually centrifuged for about 30 minutes to 2 hours, and the resulting precipitate is used as a membrane fraction. The membrane fraction is rich in expressed CD28 and membrane components such as cell-derived phospholipids and membrane proteins. The amount of CD28 in the CHO cells containing the CD28 of the present invention and the cell membrane fraction thereof is 10 ³ to 1 per cell.
Is preferably from 0 ⁷ molecule, it is preferred that a 10 ⁴ to 10 ⁶ molecules. When CHO cells containing CD28 are used in the screening method of the present invention, the CHO cells can be used as living cells. Also,
After fixing the CHO cells with glutaraldehyde, paraformaldehyde, etc. according to a method known per se,
It can also be used.

The soluble B7-1-Ig used in the screening method of the present invention is a protein in which B7-1 and the Fc region of IgG are linked. B7-1 is a cell surface protein and has a secretion signal and a membrane binding site.
Soluble B7-1-Ig acts as an extracellular secretory protein by deleting the membrane binding site of B7-1 and binding to the Fc region of immunoglobulin. Soluble B7-1-Ig
Can be produced according to a method known per se or a method analogous thereto. For example, the Journal of Experimantal Medicin
cine) 1991, 173: 721-730. Similarly to the above-mentioned method for producing CD28, for example, the B7-1 gene having the nucleotide sequence represented by SEQ ID NO: 2 [FIG. 4] and the Fc region of IgG having the nucleotide sequence represented by SEQ ID NO: 3 6 and FIG. 7 were constructed (FIG. 5), and the expression vector was introduced into CHO cells, and then, under conditions capable of expressing the B7-1-Ig gene. By culturing, CHO cells containing soluble B7-1-Ig and secreting extracellularly can be produced. As the expression vector, specifically, for example, an expression vector which can be prepared by the method shown in FIG.
Inserting the SRα promoter upstream of the gene for 7-1-Ig, inserting a polyA addition signal downstream of the gene for soluble B7-1-Ig, and inserting the dhfr gene downstream thereof;
Furthermore, p into which an ampicillin resistance gene has been inserted downstream thereof
The expression vector represented by B7-1-Ig (FIG. 5, Reference Example 2) is suitable. B7- produced in this way
By introducing an expression vector carrying the gene of 1-Ig into CHO cells, C
HO cells can be produced. As CHO cells, CHO (dhfr ⁻ ) cells, CHO K-1 cells, and the like are particularly preferable. In particular, when the dhfr gene is inserted into an expression vector as a selection marker, CHO (dhf
r ^-) cells being preferred. In this case, a transformant can be selected very easily by culturing in a medium containing no nucleic acid.

As the combination of the expression vector and the host cell, a preferable combination can be appropriately selected. For example, pB7
-Expression vector (Reference Example 2) and CH
A combination of O (dhfr ⁻ ) cells and the like are preferred. As a method for introducing an expression vector into a host cell, a known method, for example, a calcium phosphate method (Virolo
gy) 52: 456-467 (1973)), electroporation (EMBO Journal 1: 841-845 (1982)) and the like. CHO cells that highly express B7-1-Ig can be obtained by first selecting a transformant using the CHO cells into which the above-mentioned expression vector has been introduced as a marker, and then selecting clones. When the dhfr gene is used, resistant cells are selected by gradually increasing the concentration of methotrexate (MTX) and continuing the culture,
Thereby, the transgene can be amplified in the cell to obtain a cell line with higher expression. Examples of the CHO cells capable of highly expressing soluble B7-1-Ig include the aforementioned pB7
SB7- containing the expression vector designated as -1-Ig
CHO cells labeled with 1-Ig-CHO-20 (FE
RM BP-5432). B of the present invention
CH containing expression vector containing 7-1-Ig gene
Soluble B7-1-Ig can be produced by culturing O cells under conditions that allow expression of the B7-1-Ig gene. When culturing CHO cells containing the expression vector containing the B7-1-Ig gene, the medium may be EMEM, DMEM, RPMI containing about 0.5 to 20% fetal bovine serum.
1640, MEM-α and the like. In particular, when using an expression vector containing the dhfr gene as a selection marker,
It is preferable to use a DMEM medium containing dialyzed fetal bovine serum containing no nucleic acid or an α-MEM medium containing dialyzed fetal bovine serum containing no nucleic acid. Preferably, the pH is between about 6-8. The culture is usually performed at about 30 to 40 ° C. for about 24 to 200 hours,
The reaction is preferably performed for about 48 to 96 hours, and if necessary, replacement of the medium, aeration, stirring and the like are added.

The soluble B7-1-Ig is
It can be obtained and purified from cells or culture supernatant of Ig-producing CHO cells, preferably from culture supernatant. Purification can be performed by utilizing the immunoglobulin Fc region of B7-1-Ig according to a method known per se used for immunoglobulin purification. When obtaining and purifying soluble B7-1-Ig from the culture supernatant, B7-1
When the 1-Ig-producing CHO cells adhere to the culture equipment and become almost monolayer, the medium is replaced with a medium having a low serum concentration, preferably a medium containing 0 to 1% serum. Purification can prevent contamination of the soluble B7-1-Ig standard with immunoglobulin in serum.
Methods for purification from the culture medium include ultrafiltration, ammonium sulfate fractionation,
Ion exchange chromatography, affinity chromatography, gel filtration and the like are used, but affinity chromatography is particularly convenient and preferred. Particularly, a column using protein A or protein G as a carrier is preferable. Immunoglobulins in contaminating serum can be removed by gel filtration or the like.

The test compounds used in this screening method include, for example, peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products of microorganisms, marine organism extracts, plant extracts, cell extracts, and animal tissue extracts. Are used. These test compounds may be novel compounds or known compounds. In this screening method, (1) CHO cells containing CD28 or a cell membrane fraction thereof and soluble B7
CD28 and soluble B7-1-I when contacted with -1-Ig
g) and (2) CD28-containing CHO cells or their cell membrane fraction, soluble B7-1-Ig, and CD28 and soluble B7-1-Ig when contacted with a test compound
Is compared with the binding amount. Compared to (1),
When the amount of binding in the case of (2) is small, the compound is CD2
A compound that inhibits the binding between B8 and B7, and vice versa, a compound that enhances the binding between CD28 and B7. The measurement of the amount of binding between CD28 and B7 was performed using B7-1-Ig
Immunoassay (RIA) or radioimmunoassay using a labeled secondary antibody that binds to the Ig portion of B7-1-Ig (Sequence Chemistry Laboratory Course, 5th edition 1986, p62-65, Tokyo Kagaku Dojin) and the like. For example, in the EIA method, soluble B7- was expressed on CHO cells expressing CD28 grown on a microplate.
After adding 1-Ig and the test compound and incubating,
Wash well, for example, horseradish peroxidase (HR
P) labeled with an anti-human immunoglobulin antibody or protein A, and the like.
Soluble B7-1-I bound to CHO cells expressing 28
g can be measured. Specifically, it can be measured according to Test Example 1 described later.

Furthermore, the present invention relates to (1) the amount of interleukin-2 produced when a CHO cell containing B7-1 or a cell membrane fraction thereof and T cells are contacted, and
A compound having interleukin 2 production inhibitory activity or a salt thereof, characterized by comparing the amount of interleukin 2 production when a CHO cell containing -1 or a cell membrane fraction thereof, a T cell and a test compound are brought into contact with each other. A screening method. In the method for screening a compound having an IL-2 production inhibitory activity or a salt thereof according to the present invention, the CHO cells containing B7-1 may contain the above-mentioned CD.
28 or a cell membrane fraction thereof. For example, an expression vector carrying the B7-1 gene (FIG. 4) having the nucleotide sequence represented by SEQ ID NO: 2 (FIG. 4) is constructed (FIG. 3), and after introducing the expression vector into CHO cells, the B7-1 By culturing under conditions that allow gene expression, B7
-1 containing CHO cells can be produced. As the expression vector, specifically, for example, an expression vector which can be prepared by the method shown in FIG.
The SRα promoter was inserted upstream of the gene, and B7-1 was inserted.
PM with ampicillin resistance gene inserted downstream of the gene
The expression vector represented by E-B7-1 (FIG. 3, Reference Example 1) is suitable. CHO capable of highly expressing B7-1
The cells include, for example, the expression vector represented by pME-B7-1, and B7-1-CHO-22.
CHO cells (FERM BP-5430)
Are used.

[0113] Human T cells produced from a healthy person can be used as human T cells for producing IL-2 by giving a costimulatory signal. Further, a human T cell line having an IL-2 producing ability can also be used. In order to separate T cells from healthy humans, for example, the collected peripheral blood is layered on a lymphocyte separation medium (Organon Teknika co.) And centrifuged to obtain a mononuclear cell fraction. Methods for separating T cells from the mononuclear cell fraction include a method using a known nylon wool column, a method using an antibody, a method using flow cytometry, and the like. A method using a nylon wool column is simple and preferable. It is. T cells can be enriched by applying the mononuclear cell fraction to a nylon wool column and collecting non-adsorbed cells. By repeating this operation, the purity of T cells can be increased. Stimulation that mimics antigen stimulation for T cells, for example,
Stimulation with anti-CD3 antibody was given, and B7-1 to T
Stimulation of a costimulatory signal to CD28 on the cells activates T cells, resulting in strong production of IL-2. As a human T cell line having an IL-2 producing ability, for example, Jurkat cells and the like can be used. Jurk
In the case of at cells, not only the anti-CD3 antibody but also PHA
Etc. can also be used.

As the test compound, the same compounds as described above can be used. In this screening method,
(1) Production of IL-2 upon contact of CHO cells containing B7-1 or a cell membrane fraction thereof and T cells (specifically, T cells to which a first signal has been given by an anti-CD3 antibody or the like) (2) CHO cells containing B7-1 or a cell membrane fraction thereof, T cells (specifically, anti-CD
(3 cells giving the first signal with the antibody 3) and the amount of IL-2 produced when the test compound is brought into contact. Compared to the case of (1), the IL- in the case of (2)
2 When the production amount is small, the compound can be said to be a compound having an IL-2 production inhibitory activity. As the measurement of the amount of IL-2 production, an EIA method using an anti-IL-2 antibody, a bioassay method for examining the proliferation of IL-2-dependent cells, and the like are known. When various test compounds are mixed, quantification by the EIA method is preferable because they may act on cells. For the quantification of IL-2 by the EIA method, a known method described in "Immunological Experiment Procedure II, p. 819, Nankodo" can be used, or IL-I can be obtained using a commercially available EIA method.
A two-measurement kit can also be used. Specifically, it can be measured according to Test Example 2 described later.

The compound obtained by using the screening method of the present invention or a salt thereof can be used as a test compound (for example, peptide, protein, non-peptidic compound, synthetic compound, fermentation product of microorganism, marine biological extract) by using the screening method. , A plant extract, a cell extract, an animal tissue extract, etc. These test compounds may be novel compounds or known compounds.) Or a salt thereof, and a compound in which a part of the structural formula of the compound obtained by using the screening method of the present invention is converted by addition, deletion, substitution or the like can also be obtained by using the screening method of the present invention. Or a salt thereof. The compound obtained by using the screening method of the present invention or a salt thereof,
A compound that inhibits or enhances the binding between CD28 and B7,
Alternatively, a compound having IL-2 production inhibitory activity,
It can be used as a safe and low toxic drug such as an immunomodulator. Specifically, transplant rejection inhibitors, allergies, rheumatism, autoimmune diseases,
It is useful as a therapeutic agent for nephritis, a therapeutic agent for diabetes, and the like. When a compound or a salt thereof obtained by using the screening method of the present invention is used as a medicine, it can be used as a suitable pharmaceutical composition, similarly to the aforementioned compound [I] of the present invention or a salt thereof. Specifically, drugs such as safe and low-toxicity immunomodulators, as well as transplant rejection inhibitors, allergies, rheumatism, autoimmune diseases, nephritis, diabetes, etc. It can be used as a medicine.

In the present specification and drawings, when bases and amino acids are indicated by abbreviations, the IUPAC-IUB Commission
Abbreviations on Biochemistry Nomenclature or conventional abbreviations in the field, examples of which are shown below. In addition, when an amino acid can have an optical isomer, the L-form is indicated unless otherwise specified. DNA: deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine G: glycine A: alanine V: valine L: leucine I: isoleucine S: serine T: threonine C: cysteine M: methionine

E: Glutamic acid D: Aspartic acid K: Lysine R: Arginine H: Histidine F: Phenylalanine Y: Tyrosine W: Tryptophan P: Proline N: Asparagine Q: Glutamine BSA: Bovine serum albumin FBS SDS: fetal bovine serum Sodium sulfate CHO: Chinese hamster ovary cells DMEM: Dulbecco's modified Eagle's medium PBS: phosphate buffered saline

[0118] Each sequence number in the sequence listing in the present specification is described below. [SEQ ID NO: 1] This shows the nucleotide sequence of the CD28 gene obtained in Reference Example 1. [SEQ ID NO: 2] This shows the base sequence of B7-1 gene obtained in Reference Example 1. [SEQ ID NO: 3] Soluble B7-1-I obtained in Reference Example 2
g shows the nucleotide sequence of the gene. [SEQ ID NO: 4] This shows the base sequence of synthetic primer 77 used for cloning of B7-1 gene. [SEQ ID NO: 5] This shows the base sequence of synthetic primer 78 used for cloning of B7-1 gene. [SEQ ID NO: 6] This shows the base sequence of synthetic primer 28-A used for cloning gene of CD28. [SEQ ID NO: 7] This shows the base sequence of synthetic primer 28-B used for cloning gene of CD28. [SEQ ID NO: 8] This shows the base sequence of synthetic primer IG-3 used for cloning of soluble B7-1-Ig gene. [SEQ ID NO: 9] This shows the base sequence of synthetic primer IG-4 used for cloning soluble B7-1-Ig gene. [SEQ ID NO: 10] This shows the base sequence of synthetic primer IG-1 used for cloning of soluble B7-1-Ig gene. [SEQ ID NO: 11] This shows the base sequence of synthetic primer IG-2 used for cloning soluble B7-1-Ig gene.

B7-1-CHO obtained in Example 125
-22, on February 28, 1996, under the Budapest Treaty,
It has been deposited with the National Institute of Advanced Industrial Science and Technology (NIBH) under the accession number FERM BP-5430. CD28-CHO-11 obtained in Example 125
Was deposited under the Budapest Treaty on February 28, 1996 with the Ministry of International Trade and Industry, National Institute of Advanced Industrial Science and Technology (NIBH) under the accession number FERM BP-5431. SB7-1-Ig-CHO-20 obtained in Example 125 is
On February 28, 1996, under the Budapest Treaty, the accession number FE was granted to the NIBH, the Ministry of International Trade and Industry, Ministry of Industry and Technology.
Deposited as RM BP-5432.

[0120]

EXAMPLES Hereinafter, the present invention will be described in more detail with reference to Reference Examples, Examples, Test Examples, and Formulation Examples, but the present invention is not limited thereto. The compound of the present invention has a xanthene skeleton, and the skeleton and numbering are as follows:

[0121]

Embedded image

Compound 1 according to this nomenclature (Example 2)
Is 2- (carboxymethylthio) -5,7-dichloro-3,8-dihydroxy-6-methyl-9-oxo-9
It becomes H-xanthene-1-carboxylic acid methyl ester. Percentages (%) are weight / weight unless otherwise noted.
Indicates volume percent. Further, the mixing ratio of the solvent indicates a volume ratio unless otherwise specified. NMR spectra, Bruker DPX-300 type spectrometer ⁽¹ H NMR; 300
MHz, ¹³ C NMR; 75 MHz). All δ values are shown in ppm using tetramethylsilane as an internal standard. The symbols herein have the following meanings: s, singlet; d, doublet; t, triplet; q, quartet; dd, double doublet; dt, double triplet; m, multiplet; br, Broad peak; J, coupling constant (Hz); Q, quaternary carbon, CH, methine; CH
_2, methylene; CH _3, methyl.

[0123]

[Reference Example 1] Cloning of costimulatory molecule and construction of various expression vectors a) Cloning of B7-1 gene A report on the DNA base sequence of B7-1 by Freeman et al. [Journal of Immunology
143) 2714 (1989)], two types of cloning primers 7 for the N-terminal side and the C-terminal side of B7-1.
7 and 78 were produced. The sequence of the primer 77 is 5′-TGG
ATCCATGGGCCACACACGGAGGCAGGGAAC-3 '(SEQ ID NO: 4)
There is a Bam HI site 5 ', followed by the N-terminal start codon of B7-1. The sequence of primer 78 is
5′-TGGATCCTTATACAGGGCGTACACTTTCCCTTCTC-3 ′ (SEQ ID NO: 5), Bam HI site on 5 ′ side, B7-1
Followed by a stop codon at the C-terminus. Human Lymphocyte
B-cell cDNA library (Clontech Laboratories Inc.,
(Palo Alto, CA, USA) using primers 77 and 78 to amplify the DNA region encoding B7-1 by PCR and clone it into the BamHI site of plasmid vector pUC118 to give pUC118-B7-1. (FIG. 3).
Then, the entire nucleotide sequence of the translation region was determined (FIG. 4).

B) Construction of plasmid for cell expression of B7-1 pUC118-B7-1 was digested with PstI and EcoRI to obtain B7-1.
By introducing the region DNA fragment into the PstI-EcoRI site of pME18S, the plasmid pME for expression of B7-1 animal cells is obtained.
B7-1 was obtained (FIG. 3). c) Cloning of CD28 gene Aruffo et al. report on the DNA sequence of CD28 [Proceedings of National Acad.
emy of Sciences of United States of America), 84,
8573 (1987)] and two types of cloning primers 28-A and 28-B for the N-terminal side and the C-terminal side of CD28.
Was prepared. The sequence of primer 28-A was 5′-TCTCGAGG
TCGACATGCTCAGGCTGCTCTTGGCTC-3 '(SEQ ID NO: 6), with Xho I site and Sal I site on the 5' side, CD2
Eight N-terminal start codons follow. Primer 28
The sequence of -B is 5'-AACTAGTTCAGGAGCGATAGGCTGCGAAG-3 '
(SEQ ID NO: 7), there is a Spe I site on the 5 ′ side,
A stop codon at the C-terminus of CD28 follows. Human Ly
mphoma (Raji) Quick-Clone cDNA library (Clontech
Laboratories Inc., Palo Alto, CA, USA)
A and 28-B were used to amplify the DNA region encoding CD28 by the PCR method to obtain plasmid vector pME18S.
Cloned between Xho I site and Sal I site
E-CD28 was obtained (FIG. 1). Then, the entire nucleotide sequence of the translation region was determined (FIG. 2). d) Construction of a CHO cell expression vector for CD28 Between the Sal I site and the Spe I site of pAKKO1.11H, pME was inserted.
The DNA fragment obtained by digesting -CD28 with SalI and SpeI was introduced to obtain pAKKO-CD28 (FIG. 1).

[0125]

[Reference Example 2] Construction of a plasmid encoding a solubilized form of B7-1 A plasmid encoding a solubilized form of B7-1 in which the Fc region of human IgG was linked to the C-terminal side of the extracellular region of B7-1. Construction was done. Primers IG-3 and IG-4 were prepared in order to amplify the portion following the Eco RV site in the DNA encoding the extracellular region of B7-1 by PCR. The sequence of primer IG-3 is 5'-CTTTGATATCACTA
ATAACCTC-3 '(SEQ ID NO: 8), with an Eco RV site on the 5' side. The sequence of primer IG-4 was 5'-GGTGATCA
GGAAAATGCTCTTGCTTGGTTG-3 ′ (SEQ ID NO: 9),
There is a Bcl I site on the 5 'side. To introduce a human IgG Fc region at the C-terminal side of the lysate, Tada et al. [Journal of Biotechno
33, 157 (1994)].
Plasmid pTB1455 encoding the region was used. Human I
In order to amplify the Fc region of gG by the PCR method, primers IG-1 and IG-2 were prepared. At this time, the method of Linsley et al. [Journal of Experimental Medicine, 173, 721,
(1991)], primers were designed to convert three cysteines in the hinge region of IgG to serine.

The sequence of the primer IG-1 was 5'-GGTGATCA
GGAGCCCAAATCTTCTGACAAAACTCACACGTCTCCACCGTCCCCGGC G
CCTGAACTCCTG-3 '(SEQ ID NO: 10), and Bc
l I have a site. The sequence of IG-2 is 5'-CCCTGCAGTCTAG
ATCATTTACCCGGGGACAGGGAG-3 ′ (SEQ ID NO: 11), which has a Pst I site and an Xba I site on the 5 ′ side. (1) The plasmid pAKKO-B7-1 containing both the B7-1 gene and the dhfr gene was digested with Eco RV and Nhe I, and
A treated DNA fragment. (2) Using pAKKO-B7-1 as a template and IG-3 and IG-4, the DNA portion encoding the extracellular region of B7-1 was amplified by PCR and digested with Eco RV and Bcl I. DNA fragment obtained by the above method. (3) Using IG-1 and IG-2 with pTB1455 as a template, PCR was performed on the DNA portion encoding the Fc region of IgG.
DNA fragment obtained by amplification according to the method and digesting with Xba I and Bcl I. The three types of DNA fragments obtained in the above (1), (2) and (3) are ligated and the desired plasmid pB7-1-Ig is ligated.
Was constructed (FIG. 5). During the construction of pB7-1-Ig, the sequence of the portion amplified by the PCR method was examined, and the entire base sequence was determined (FIG. 6).

[0127]

Reference Example 3 Production of N-Boc-2-bromoethylamine 2-Bromoethylammonium bromide (Wako Pure Chemical Industries, Ltd.) (500 mg) was added to THF-water (10: 1, 11.0).
ml) and triethylamine (711 μl) under ice-cooling.
l) and di-t-butyl dicarbonate (manufactured by Wako Pure Chemical Industries, Ltd.) (6)
17 μl) and stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure, and the obtained residue was dissolved in ethyl acetate (30 ml), and water (2 × 10 ml) and saturated saline (5 ml) were used.
Washed in l). Next, the organic layer was dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue obtained was purified by silica gel column chromatography (n-hexane / ethyl acetate, eluted with 90:10 to 85:15) to give N. -Boc-2-bromoethylamine (350 mg) was obtained as a colorless oil. _{^{1 H NMR, CDCl 3, δ}} ppm; 4.94 (1H,
brs), 3.59-3.41 (4H, m),
1.45 (9H, s)

[0128]

Reference Example 4 Production of 2-bromoethylamine-N-benzenesulfonamide 2-bromoethylammonium bromide (501 mg)
Was dissolved in dichloromethane (10.0 ml) and benzenesulfonyl chloride (manufactured by Wako Pure Chemical Industries, Ltd.) (350 μm) was added under ice cooling.
l) and triethylamine (710 μl) were added, and the mixture was stirred at room temperature for 2 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was dissolved in ethyl acetate (40 ml), and the mixture was dissolved in water (3 × 1).
0 ml) and saturated saline (5 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue obtained was purified by silica gel column chromatography (eluted with n-hexane / ethyl acetate, 80:20) to give 2-bromoethylamine-. N-benzenesulfonamide (640 mg) was obtained as colorless crystals. ¹ H NMR, CDCl ₃ , δ ppm; 7.92-7.85 (2
H, m), 7.65-7.50 (3H, m), 5.00 (1H, br s), 3.43-3.3
7 (4H, m)

[0129]

Reference Example 5 Production of 2-bromoethylamine-N-methanesulfonamide 2-bromoethylammonium bromide (500 mg)
Was dissolved in dichloromethane (10.0 ml), and methanesulfonyl chloride (manufactured by Wako Pure Chemical Industries, Ltd.) (210 μl) and triethylamine (710 μl) were added under ice-cooling.
Stirred for hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was dissolved in ethyl acetate (40 ml).
1) and saturated saline (3 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure, and the residue obtained was subjected to silica gel column chromatography (n-hexane / ethyl acetate, 70:30 to 60: 4).
0 elution) to give 2-bromoethylamine-
N-methanesulfonamide (320 mg) was obtained as a colorless oil. ¹ H NMR, CDCl ₃ , δ ppm; 4.81 (1H, br s), 3.61-3.48
(4H, m), 3.02 (3H.s)

[0130]

Reference Example 6 Production of α-chloro-α-deoxykojic acid Kojic acid (150 mg, Sigma) was dissolved in chloroform (5.0 ml), and thionyl chloride (308 μl,
(Wako Pure Chemical Industries, Ltd.) and refluxed for 5 hours. Chloroform (50 ml) was added to the reaction mixture and washed with water (2 × 10 m
After l), the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was subjected to silica gel column chromatography, and eluted with chloroform. The eluted fraction was concentrated under reduced pressure to obtain α-chloro-α-deoxykojic acid (64 mg) as a brown powder.

[0131]

Reference Example 7 Production of 5- (2-bromomethyl) phenyltetrazole o-Tolunitrile (500 mg, Wako Pure Chemical Industries, Ltd.) was added to DMF
(10 ml) and sodium azide (555 m
g, manufactured by Wako Pure Chemical Industries, Ltd.) and ammonium chloride (453 m
g) was added and the mixture was stirred at 127 ° C. for 14 hours. Ethyl acetate (50 ml) was added to the reaction mixture, and 0.01M hydrochloric acid (2 ml) was added.
x30ml), and the organic layer was extracted with 2% aqueous sodium hydrogen carbonate (2x20ml). After the pH of the obtained aqueous layer was corrected to 2.0, it was extracted with ethyl acetate (40 ml). The organic layer was washed with water (3 × 20 ml), dried over anhydrous sodium sulfate and concentrated under reduced pressure to give 5- (2-
Methyl) phenyltetrazole (111 mg) was obtained as a white powder. This powder (60 mg) was dissolved in carbon tetrachloride (10 ml) and N-bromosuccinimide (6
7 mg, manufactured by Wako Pure Chemical Industries, Ltd.) and 2,2′-azobisisobutyronitrile (1.0 mg, manufactured by Wako Pure Chemical Industries, Ltd.),
Stirred at 90 ° C. for 2 hours. After concentrating the reaction mixture, the residue was subjected to silica gel column chromatography, washed with chloroform, and then chloroform / methanol (80:20).
And eluted fractions. The eluted fraction was concentrated under reduced pressure to give 5- (2
-Bromomethyl) phenyltetrazole (25 mg) was obtained as a brown oil.

[0132]

Reference Example 8 Preparation of methoxymethyl 3- (bromomethyl) benzoate M-toluic acid (500 mg, manufactured by Wako Pure Chemical Industries, Ltd.) was dissolved in dichloromethane (10 ml), and chloromethylmethyl ether (360 μl) and triethylamine were dissolved. (665
μl) and stirred at room temperature for 2 hours. Ethyl acetate (50 ml) was added to the reaction mixture, and the mixture was washed with 0.01 M hydrochloric acid, 2% aqueous sodium hydrogen carbonate and water (2 × 30 ml). The obtained organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain a brown oil (588 mg). This oil (300 mg) was dissolved in carbon tetrachloride (20 ml), and N-bromosuccinimide (296 mg) and 2,2′-azobisisobutyronitrile (3.0 mg) were dissolved.
Was added and stirred at 90 ° C. for 4 hours. The reaction mixture was filtered, concentrated after removing succinimide. Hexane was added to the oily residue and the mixture was stirred. The resulting supernatant was concentrated under reduced pressure to give 3-
(Bromomethyl) benzoic acid methoxymethyl ester (3
74 mg) was obtained as a colorless oil.

[0133]

Reference Example 9 Preparation of methoxymethyl 2- (bromomethyl) benzoate O-toluic acid (500 mg, manufactured by Wako Pure Chemical Industries) was dissolved in dichloromethane (10 ml), and chloromethylmethyl ether (360 μl) and triethylamine were dissolved. (665
μl) and stirred at room temperature for 2 hours. Ethyl acetate (50 ml) was added to the reaction mixture, and the mixture was washed with 0.01 M hydrochloric acid, 2% aqueous sodium hydrogen carbonate and water (2 × 30 ml). The obtained organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain a colorless oily substance (600 mg). This oil (200 mg) was dissolved in carbon tetrachloride (10 ml), and N-bromosuccinimide (198 mg) and 2,2′-azobisisobutyronitrile (1.8 mg) were dissolved.
Was added and stirred at 90 ° C. for 3 hours. The reaction mixture was filtered, concentrated after removing succinimide. The obtained residue was subjected to silica gel column chromatography, washed with hexane and hexane / ethyl acetate (50: 1), and then fractionated by elution with hexane / ethyl acetate (20: 1). The eluted fraction was concentrated under reduced pressure to obtain 2- (bromomethyl) benzoic acid methoxymethyl ester (65 mg) as a colorless oily substance. ¹ H NMR, CDCl ₃ , δ ppm; 8.03 (1H, d, J = 7.8 Hz),
7.50 (2H, m), 7.40 (1H, m), 5.52 (2H, s), 4.98 (2
H, s), 3.59 (3H, s)

[0134]

Reference Example 10 Production of trimethylene glycol 2-thiophene borate 2-thiophene boric acid (manufactured by Aldrich) (200 m
g) was suspended in toluene (2.0 ml), 1,3-propanediol (manufactured by Wako Pure Chemical Industries, Ltd.) (230 μl) was added, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was dried over anhydrous sodium sulfate and concentrated under reduced pressure, and the residue obtained was subjected to silica gel chromatography (n-hexane / ethyl acetate,
90:10 to 70:30).
Trimethylene glycol thiophene borate (2
21 mg) as a white powder. ¹ H NMR, CDCl ₃ , δ ppm; 7.59-7.52 (2H, m), 7.15 (1
H, dd, J = 4.3, 3.8 Hz), 4.16 (4H, t, J = 5.5 Hz),
2.06 (2H, m)

[0135]

Reference Example 11 Production of trimethylene glycol 3-thiophene borate 3-thiophene boric acid (manufactured by Aldrich) (200 m
g) was suspended in toluene (2.0 ml), 1,3-propanediol (230 μl) was added, and the mixture was stirred at room temperature for 1 hour. After drying the reaction mixture over anhydrous sodium sulfate,
The residue obtained by concentration under reduced pressure was subjected to silica gel chromatography (n-hexane / ethyl acetate, 90:10 to 80:
20 elution) to obtain 3-thiophene boric acid trimethylene glycol ester (238 mg) as a white powder. ¹ H NMR, CDCl ₃ , δ ppm; 7.80 (1H, m), 7.34 (1H, m),
7.29 (1H, m), 4.13 (4H, t, J = 5.5 Hz), 2.04 (2H,
m)

[0136]

Embodiment 1 TAN-2421A1, A2, A3, A
4, Production of B1, B2 and B3 Potato dextrose broth (Difco, USA)
24 g, 28 g on a slope medium consisting of 20 g of agar and 1 L of water
C., a strain of the genus Aspergillus cultured for 7 days, FL-
67283 strain, 2% glucose, 3% maltose, 1.5%
40 ml of a seed medium (pH 6.0) containing raw soy flour, 1% corn steep liquor, 0.5% polypeptone, 0.3% yeast extract and 0.3% sodium chloride was inoculated into a 200 ml Erlenmeyer flask. Culturing was performed at 48 ° C. for 48 hours to obtain a seed culture solution. 1 L of the resulting seed culture was added to 3%
Dextrin, 0.5% glucose, 1% SBF, 0.3
% Malt extract, 0.05% ammonium tartrate, 0.1%
A 120 L main medium containing 0.05% monopotassium phosphate, 0.015% magnesium sulfate, 0.007% calcium chloride, 0.05% actol, and 0.02% silicon (p
H6.5) into a 200 L culture tank containing
The cells were cultured for 5 days at 8 ° C. and 120 rpm.

[0137]

Example 2 Isolation of TAN-2421A1 The culture solution (120 L) cultured under the same conditions as the culture solution (120 L) obtained in Example 1 was combined (total of 240 L).
L), pH was adjusted to 3.0, and ethyl acetate (200 L) was added, followed by stirring and mixing at room temperature for 30 minutes. This mixture was filtered using a filter aid (Radiolite 600, manufactured by Showa Chemical Industry Co., Ltd.), and the cells were washed with ethyl acetate (60 L). The obtained organic layer (215 L) was a 2% aqueous sodium bicarbonate solution (140 L).
L). After adjusting the pH of the aqueous layer to 3.0, it was extracted with ethyl acetate (100 L). The organic layer was washed with water (40
After washing in L), the mixture was concentrated under reduced pressure to 200 ml.
This concentrated solution is applied to silica gel (Kieselgel 60, 500
g) by column chromatography, washing with hexane / ethyl acetate (4: 1, 4 L, 2: 1, 4 L), followed by hexane / ethyl acetate (1: 1, 4 L) and ethyl acetate (4 L). Eluted. The eluate was concentrated under reduced pressure to 500 ml, and the obtained concentrate was concentrated in 2% aqueous sodium hydrogen carbonate (500 m
The mixture was extracted twice in l), the aqueous layers were combined, and concentrated under reduced pressure to 500 ml. After adjusting the pH of the obtained solution to 7.5, the solution was applied to Diaion HP-20 (200 ml), and water (1 L) and methanol water (20%, 1 L, 50%, 1%) were added.
L, 80%, 1L) and then 80% methanol /
Elution was performed with 0.02N aqueous ammonia (1 L).

The eluate was concentrated to 100 ml, added with water (100 ml), adjusted to pH 3.0, and extracted twice with ethyl acetate (400 ml). The organic layers were combined (800 ml), washed with water (300 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give a crude powder (2.
36 g) were obtained. The resulting coarse powder was subjected to column chromatography on Sephadex LH-20 (3.0 L), eluted with methanol, and fractionated (300 m each).
l). Fractions 14 to 17 were collected and concentrated to dryness to give a powder (635 mg). This powder was dissolved in dimethyl sulfoxide-methanol (1: 1, 4.0 ml), and the solution was separated into two 2 ml portions and separated by high performance liquid chromatography [column: YMC-Pack ODS SH-363-15 (manufactured by YMC). , Mobile phase; 55% (V / V) acetonitrile / 0.
02 M phosphate buffer (pH 3.0), flow rate; 15 ml / min], and fractionated 20 ml at a time. The fractions 14 of each time were combined, and acetonitrile was distilled off under reduced pressure, followed by extraction with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain a powder (34 mg) containing TAN-2421A4. . Fractions 15 and 16 of each round were combined, and TAN-242 was treated in the same manner.
A powder (54 mg) containing 1B2 and B3 was obtained.
Fractions 18 and 19 from each round were combined and the same treatment yielded a powder (38 mg) containing TAN-2421A2 and A3. Fractions 22 to 24 of each time were combined, and TAN-242 was treated in the same manner.
A powder containing 1B1 (30 mg) was obtained. Fractions 26 to 31 of each time are combined, and by the same processing,
TAN-2421A1 (182 mg) was obtained as a pale yellow powder.

[TAN-2421A1] 1) Appearance: pale yellow powder 2) Molecular formula: C ₁₈ H ₁₂ Cl ₂ O ₈ S 3) Elemental analysis: (%) Calculated: C, 47.08; H, 2.63; Cl, 15.44; S, 6.98 Found; C, 47.10; H, 2.84 ; Cl, 15.43; S, 7.11 4) high resolution FAB-MS _{spectrum: m / z 458.9753 (C 18} H 12 Cl 2 O 8 S + H) + M / z 458.9709 5) UV spectrum: maximum value in methanol nm (E _{1 cm} 1%); 243 (765), 267 (shoulder, 630), 275
(645), 315 (290), 368 (200) 6) IR spectrum: shows the main absorption in KBr tablet (wave number, cm ^-1 ) 3700-2300 (br), 1725, 1645, 1585, 1480, 1435 , 137
0, 1330, 1290,1250, 1190, 1170, 1015 7) 13 C NMR spectrum: 75 MHz, in DMSO-d _6, 27 ℃,
δ ppm 178.1 (Q), 170.1 (Q), 166.2 (Q), 165.7 (Q), 157.1
(Q), 154.5 (Q), 148.7 (Q), 142.8 (Q), 139.3 (Q), 11
7.0 (Q), 114.6 (Q), 110.6 (Q), 108.6 (Q), 106.8
(Q), 102.9 (CH), 52.4 (CH ₃ ), 35.8 (CH ₂ ), 18.4 (C
H ₃ )

[0140]

Embodiment 3 TAN-2421A2, A3, A4, B
1, Isolation of B2 and B3 The powder (36 mg) containing TAN-2421A2 and A3 obtained in Example 2 was separated by high performance liquid chromatography [column: YMC-Pack ODS SH-343-5 (manufactured by YMC). , Mobile phase; 30% (V / V) acetonitrile / 0.01 M phosphate buffer (pH 7.0), flow rate: 10 ml / min], and fractionated 10 ml each. Fraction 1 each time
8 to 20 were combined, and acetonitrile was distilled off under reduced pressure. After adjusting the pH to 2.5, the mixture was extracted with ethyl acetate.
The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain TAN-2421A3 (12 mg) as a pale yellow powder. Fractions 22 to 25 of each time were combined, and TAN-2421A2 (6 m
g) was obtained as a pale yellow powder. The powder (32 mg) containing TAN-2421A4 obtained in Example 2 was subjected to preparative high performance liquid chromatography [column: YMC-Pack ODS SH-
343-5, mobile phase; 32% (V / V) acetonitrile / 0.01 M phosphate buffer (pH 6.3), flow rate;
Each fraction was fractionated by ml. Fractions 15 to 17 were combined, and acetonitrile was distilled off under reduced pressure.
And extracted with ethyl acetate. The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain TAN-24.
21A4 (15 mg) was obtained as a pale yellow powder. The powder containing TAN-2421B1 obtained in Example 2 (2
8 mg) by preparative high performance liquid chromatography [column;
YMC-Pack ODS SH-343-5, mobile phase; 32% (V / V) acetonitrile / 0.01 M phosphate buffer (pH 6.3), flow rate: 10 ml /
Min.] And fractionated 10 ml at a time. Fraction 18
And 24 were combined, acetonitrile was distilled off under reduced pressure, the pH was adjusted to 2.5, and the mixture was extracted with ethyl acetate.
The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain TAN-2421B1 (14 mg) as a pale yellow powder.

TAN-2421B2 obtained in Example 2
Preparative high performance liquid chromatography [column: YMC-Pack ODS SH-343-5, mobile phase; 27% (V / V) acetonitrile / 0.01 M phosphate buffer (pH 7.0)] , Flow rate; 10 ml / min] in two portions,
Each 10 ml was fractionated. Fractions 16-2 each time
0, and acetonitrile was distilled off under reduced pressure.
Was adjusted to 2.5, and extracted with ethyl acetate. After the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure, TA
N-2421B2 (8 mg) was obtained as a pale yellow powder. Fractions 12 and 13 of the first fractionation and fractionation 2
The fractions 11 and 12 of the second round were combined, and by the same treatment, a powder containing TAN-2421B3 (17 mg)
was gotten. This powder was separated by preparative high performance liquid chromatography [column: YMC-Pack ODS SH-343-5, mobile phase: 50% (V /
V) Acetonitrile water (containing 0.05% TFA), flow rate: 10 ml
/ Min] and fractionated 10 ml at a time. Fraction 1
After 7 to 18 were combined and acetonitrile was distilled off under reduced pressure, the pH was adjusted to 2.5 and extracted with ethyl acetate.
The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain TAN-2421B3 (13 mg) as a pale yellow powder.

[TAN-2421A2] 1) Appearance: pale yellow powder 2) Molecular formula: C ₁₈ H ₁₃ ClO ₈ S 3) High resolution FAB-MS spectrum: m / z 425.0114 (C ₁₈ H ₁₃ ClO ₈ S + H) Calculated value when ⁺ : m / z 425.0098 4) UV spectrum: maximum value in methanol nm (E _{1 cm} 1%); 244 (760), 270 (690), 315 (32
0), 361 (195) 5) IR spectrum: shows the main absorption in the KBr tablet (wave number, cm ^-1 ) 3700-2300 (br), 1720, 1700, 1650, 1590, 1570, 148
0, 1435, 1410,1370, 1310, 1265, 1200, 1015 6) 13 C NMR spectrum: 75 MHz, in DMSO-d _6, 27 ℃,
δ ppm 178.4 (Q), 170.1 (Q), 166.4 (Q), 165.3 (Q), 157.4
(Q), 155.7 (Q), 152.9 (Q), 145.7 (Q), 139.4 (Q), 11
6.2 (Q), 113.9 (Q), 108.9 (Q), 108.6 (CH), 106.4
(Q), 102.8 (CH), 52.3 (CH ₃ ), 35.8 (CH ₂ ), 20.7 (CH ₃ )

[TAN-2421A3] 1) Appearance: pale yellow powder 2) Molecular formula: C ₁₈ H ₁₃ ClO ₈ S 3) High resolution FAB-MS spectrum: m / z 425.0108 (C ₁₈ H ₁₃ ClO ₈ S + H) Calculated value when ⁺ : m / z 425.0098 4) UV spectrum: maximum value in methanol nm (E _{1 cm} 1%); 242 (740), 266 (shoulder, 610), 274
(625), 305 (290), 365 (205) 5) IR spectrum: Main absorption in KBr tablet (wave number, cm ^-1 ) 3700-2800 (br), 1730, 1650, 1590, 1485, 1435 , 136
5, 1255, 1180,1160, 1010 6 ) 13 C NMR spectrum: 75 MHz, in DMSO-d _6, 27 ℃,
δ ppm 178.4 (Q), 170.1 (Q), 166.3 (Q), 165.3 (Q), 158.6
(Q), 157.1 (Q), 150.2 (Q), 145.8 (Q), 139.3 (Q), 11
6.5 (Q), 112.4 (CH), 109.7 (Q), 109.0 (Q), 106.8
(Q), 102.9 (CH), 52.3 (CH ₃ ), 35.8 (CH ₂ ), 20.5 (C
H ₃ )

[TAN-2421A4] 1) Appearance: pale yellow powder 2) Molecular formula: C ₁₈ H ₁₄ O ₈ S 3) High resolution FAB-MS spectrum; m / z 391.0472 (C ₁₈ H ₁₄ O ₈ S + H) ⁺ a calculated value when the; m / z 391.0488 4) UV spectrum: methanol - le in maxima _{nm (E 1cm 1%);} 242 (855), 263 ( shoulder, 75
0), 269 (765), 307 (365),
358 (240) 5) IR spectrum: shows the main absorption in a KBr tablet (wave number, cm ^-1 ) 3700-2200 (br), 1725, 1650, 1615, 1590, 1575, 148
0, 1435, 1370,1255, 1210, 1015 6) 13 C NMR spectrum: 75 MHz, in DMSO-d _6, 27 ℃,
δ ppm 178.6 (Q), 170.1 (Q), 166.5 (Q), 164.8 (Q), 160.5
(Q), 157.3 (Q), 155.0 (Q), 148.8 (Q), 139.5 (Q), 11
5.7 (Q), 111.2 (CH), 109.4 (Q), 107.3 (CH), 105.5
(Q), 102.8 (CH), 52.3 (CH ₃ ), 35.8 (CH ₂ ), 21.9 (CH3)

[TAN-2421B1] 1) Appearance: pale yellow powder 2) Molecular formula: C ₁₉ H ₁₄ Cl ₂ O ₉ S 3) High resolution FAB-MS spectrum: m / z 488.9808 (C ₁₉ H ₁₄ Cl ₂ O ₉₎ S + H) ⁺ calculated: m / z 488.9814 4) UV spectrum: maximum value in methanol nm (E _{1 cm} 1%); 245 (555), 270 (460), 275
(Shoulder, 460), 308 (200), 370 (165) 5) IR spectrum: shows major absorption in KBr tablet (wave number, cm ^-1 ) 3700-2300 (br), 1740, 1700, 1645, 1590 , 1485, 144
0, 1370, 1335,1290, 1240, 1185, 1170, 1105, 1010 6) 13 C NMR spectrum: 75 MHz, in DMSO-d _6, 60 ℃,
δ ppm 178.3 (Q), 173.5 (br, Q), 166.3 (br, Q), 165.6
(Q), 157.2 (Q), 154.7 (Q), 148.9 (Q), 142.9 (Q), 13
9.8 (br, Q), 118.4 (Q), 114.8 (Q), 110.8 (Q), 109.0
(Q), 107.1 (Q), 103.1 (CH), 69.8 (CH), 52.4 (CH ₃ ),
38.8 (br, CH ₂ ), 18.4 (CH ₃ ) 7) Specific rotation [α] ²⁴ _D -22.9 ° (c 0.49, DMF)

[TAN-2421B2] 1) Appearance: pale yellow powder 2) Molecular formula: C ₁₉ H ₁₅ ClO ₉ S 3) High resolution FAB-MS spectrum: m / z 455.0197 (C ₁₉ H ₁₅ ClO ₉ S + H) Calculated value when ⁺ : m / z 455.0204 4) UV spectrum: maximum value in methanol nm (E _{1 cm} 1%); 245 (560), 266 (510), 314 (22
0), 362 (155) 5) IR spectrum: shows the main absorption in the KBr tablet (wave number, cm ^-1 ) 3700-2300 (br), 1715, 1650, 1590, 1570, 1480, 143
5, 1410, 1370,1335, 1255, 1200, 1100, 1070, 1010 6) 13 C NMR spectrum: 75 MHz, in DMSO-d _6, 60 ℃,
δ ppm 178.6 (Q), 173.3-173.5 (br, Q), 166.5 (br, Q), 16
5.1 (Q), 157.5 (Q), 156.0 (Q), 153.1 (Q), 145.8
(Q), 139.9 (br Q), 117.7 (Q), 114.1 (Q), 109.3 (br,
Q), 108.6 (CH), 106.6 (Q), 103.1 (CH), 69.8 (CH),
52.3 (CH ₃ ), 38.8-39.0 (br, CH ₂ ), 20.7 (CH ₃ )

[TAN-2421B3] 1) Appearance: pale yellow powder 2) Molecular formula: C ₁₉ H ₁₅ ClO ₉ S 3) High resolution FAB-MS spectrum: m / z 455.0200 (C ₁₉ H ₁₅ ClO ₉ S + H) Calculated value with ⁺ : m / z 455.0204 4) UV spectrum: maximum value in methanol nm (E _{1 cm} 1%); 240 (665), 266 (shoulder, 570), 272
(585), 303 (265), 364 (195) 5) IR spectrum: Main absorption in KBr tablet (wave number, cm ^-1 ) 3700-2300 (br), 1725, 1650, 1590, 1485, 1435 , 136
5, 1330, 1305,1255, 1180, 1160, 1100, 1010 6) 13 C NMR spectrum: 75 MHz, in DMSO-d _6, 60 ℃,
δ ppm 178.5 (Q), 173.3 (br, Q), 166.5 (br, Q), 165.2
(Q), 158.8 (Q), 157.2 (Q), 150.4 (Q), 145.8 (Q), 13
9.8 (br, Q), 117.9 (Q), 112.4 (CH), 109.8 (Q), 109.
3 (Q), 107.0 (Q), 103.1 (CH), 69.8 (CH), 52.3 (C
H ₃ ), 38.8-38.9 (br, CH ₂ ), 20.5 (CH ₃ )

The retention times of the components obtained in Examples 2 and 3 in high performance liquid chromatography, the Rf values in silica gel thin layer chromatography, and the results of the color reaction were as follows. 1) Retention time in high performance liquid chromatography Conditions Column: YMC-Pack A312, ODS, 6.0 x 150 mm (YMC) Flow rate: 2.0 ml / min Detection: UV 214 nm Mobile phase 1: 55% (V / V) Acetonitrile water (containing 0.05% TFA) Mobile phase 2: 35% (V / V) Acetonitrile / 0.01 M phosphate buffer (pH 6.3) Retention time (min) Mobile phase 1 Mobile phase 2 TAN-2421A1 7.7 16.8 TAN-2421A2 5.0 10.2 TAN-2421A3 5.0 9.6 TAN-2421A4 3.6 6.1 TAN-2421B1 5.8 4.8 TAN-2421B2 3.8 3.3 TAN-2421B3 3.8 3.0

2) Rf value in silica gel thin layer chromatography Conditions Carrier: Kieselgel 60F254 0.25 mm thick (Merck, Germany) Developing solvent: chloroform / methanol / formic acid (9: 1: 0.5) 3) Color reaction result (common to all components) Positive; Barton's reagent, iodine, potassium permanganate,
Phosphomolybdic acid negative; ninhydrin, Sakaguchi reagent

[0150]

Example 4 Compound 1 (40 mg) was treated with ethyl acetate (9.
4 ml), methanol (40 μl) and a 2.0 M hexane solution (manufactured by Tokyo Chemical Industry) of (trimethylsilyl) diazomethane (500 μl) were added, and the mixture was added at room temperature.
Stir for 5 minutes. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (eluted with chloroform), and then purified again by silica gel column chromatography (eluted with ethyl acetate / hexane and chloroform / methanol) to obtain a compound. 8 (3
2 mg) as a pale yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.90 (1H, s), 7.05 (1H,
s), 4.10 (3H, s), 4.05 (3H, s), 3.67 (3H, s), 3.56
(1H, d, J = 13.7 Hz), 3.49 (1H, d, J = 13.7Hz), 2
65 (3H, s) FAB-MS spectrum (M + H) ⁺ : m / z 487

[0151]

Example 5 Compound 8 (11 mg) was suspended in methanol / acetonitrile / water (3: 2: 1, 6 ml), and 1
M sodium hydroxide aqueous solution (100 μl) was added, and the mixture was stirred at room temperature for 2 hours and at 60 ° C. for 2 hours. After water was added to the reaction mixture, the mixture was neutralized with dilute hydrochloric acid and then concentrated. The obtained residue was acidified by adding a 10% aqueous citric acid solution, and extracted with chloroform (3 × 10 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was subjected to silica gel column chromatography, and chloroform / methanol / formic acid (90: 10: 0) was used.
And 80: 20: 1). After the eluate was concentrated under reduced pressure, chloroform (9 ml) was added, and the mixture was washed with a 10% aqueous citric acid solution (2 × 3 ml) and saturated saline (3 ml). The obtained organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain Compound 9 (2.7 mg) as a pale yellow powder. ¹ H NMR, CDCl ₃ -CD ₃ OD, δ ppm; 7.07 (1H, s), 4.09 (3
H, s), 4.06 (3H, s), 3.51 (2H, s), 2.65 (3H, s) FAB-MS spectrum (M + H) ⁺ : m / z 473

[0152]

Example 6 Compound 1 (50 mg) was suspended in 10% hydrochloric acid-methanol (manufactured by Tokyo Kasei) (10 ml) and stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (eluted with chloroform) to give Compound 10 (46 m
g) was obtained as a pale yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.87 (1H, s), 9.12 (1H, br
s), 7.18 (1H, s), 4.07 (3H, s), 3.77 (3H, s), 3.74
(1H, d, J = 17.5 Hz), 3.60 (1H, d, J = 17.5 Hz),
2.64 (3H, s)

[0153]

Example 7 Compound 1 (40 mg) was added to DMF (1.0 m
l) and dissolved in sodium hydrogencarbonate (36 mg) and chloromethyl methyl ether (manufactured by Tokyo Chemical Industry Co., Ltd.) (33 μl).
l) was added and the mixture was stirred at room temperature for 2 hours. Ethyl acetate (20 ml) was added to the reaction mixture, and 0.1 M hydrochloric acid (10 m
1) and water (3 × 10 ml). Then
The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure.
The resulting residue was purified by silica gel column chromatography (eluted with chloroform) to give Compound 11.
(40 mg) was obtained as a pale yellow powder. _{^{1 H NMR, CDCl 3, δ}} ppm; 12.87 (1H,
s), 7.36 (1H, s), 5.45
(2H, s), 5.24 (1H, d, J =
5.9 Hz), 5.18 (1H, d, J =
5.9 Hz), 4.05 (3H, s),
3.58 (3H, s), 3.42 (3H,
s), 2.65 (3H, s)

[0154]

Example 8 Compound 11 (20 mg) was added to DMF (1.0
ml), potassium carbonate (10 mg) and methyl iodide (Wako Pure Chemical Industries, Ltd.) (11.4 μl) were added, and the mixture was stirred at room temperature for 16 hours. Ethyl acetate (3
0 ml) and washed with water (3 × 15 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain a pale yellow powder (20 mg). This powder was dissolved in THF (0.8 ml), and 1M hydrochloric acid (0.2 m
l) was added and the mixture was stirred at 60 ° C for 24 hours. After the reaction mixture was concentrated under reduced pressure to remove THF, the residue was suspended in ethyl acetate (10 ml) and washed with water (2 × 5 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure, and the obtained residue was subjected to preparative high performance liquid chromatography [column; % TFA), flow rate; 10 ml / min], and fractionated 10 ml at a time. Fractions 19 and 20 were combined and concentrated under reduced pressure to remove acetonitrile.
Extracted with ethyl acetate (10 ml). Next, the organic layer was washed with water (3 × 5 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give Compound 12 as a white powder (11
mg). ¹ H NMR, DMSO-d ₆ , δ ppm; 12.34 (1H, br), 7.00 (1H,
s), 3.89 (3H, s), 3.82 (3H, s), 3.54 (2H, s), 2.6
0 (3H, s)

[0155]

Example 9 Compound 10 (15 mg) was dissolved in 7.2 M ammonia / methanol (3.0 ml), and dissolved at room temperature.
Stir for 1 hour. After the reaction mixture was concentrated under reduced pressure, the residue was suspended in 0.1 M hydrochloric acid (5 ml), and ethyl acetate (30 ml) was added.
ml). The organic layer was washed with water (2 × 15 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure.
The obtained residue was suspended in methanol (3 ml), and the insoluble matter was collected by centrifugation to obtain Compound 13 (13 mg) as a pale yellow powder. _{^{1 H NMR, DMSO-d 6}} , δ ppm; 13.00 (1
H, s), 12.52 (1H, br), 7.
55 (1H, brs), 7.32 (1H, b
rs), 7.08 (1H, s), 3.93
(3H, s), 3.55 (2H, s), 2.5
8 (3H, s)

[0156]

Example 10 Compound 10 (13 mg) was dissolved in dichloromethane (0.5 ml), 2-methoxyethylamine (Aldrich, USA) (0.1 ml) was added, and the mixture was stirred at room temperature for 19 hours. Ethyl acetate (2
0 ml) and 1M hydrochloric acid (10 ml) and water (2 ×
The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (chloroform / methanol, eluted with 10: 1) to give compound 14 (1).
4 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.08 (1
H, s), 8.17 (1H, brt, J = 5.3 Hz), 7.02 (1H, s),
3.91 (3H, s), 3.54 (2H, s), 3.33 (4H, m), 3.22 (3H,
s), 2.57 (3H, s)

[0157]

Example 11 Compound 1 (25 mg) was added to DMF (0.5 m
l) and dissolved in WSC (Dojindo Laboratories) (14m
g), HOBT (manufactured by Dojindo Laboratories) (9.5 mg),
Glycine hydrochloride ethyl ester (manufactured by Wako Pure Chemical Industries, Ltd.) (9.8
mg) and triethylamine (15 μl), and the mixture was stirred at room temperature for 2 hours. Ethyl acetate (30
ml), 0.1 M hydrochloric acid (10 ml), 2% aqueous sodium hydrogen carbonate (10 ml) and water (2 × 10 ml)
, And dried over anhydrous sodium sulfate and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (eluted with chloroform / methanol, 10: 1) to obtain Compound 15 (24 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.24 (1H, s), 8.66 (1H,
br), 6.91 (1H, s), 4.07 (2H, q, J = 7.1 Hz), 3.89
(3H, s), 3.82 (2H, m), 3.57 (2H, s), 2.57 (3H, s),
1.17 (3H, t, J = 7.1 Hz)

[0158]

Example 12 Compound 15 (14 mg) was suspended in methanol (1.4 ml), 1M aqueous sodium hydroxide solution (100 μl) was added, and the mixture was stirred at room temperature for 20 hours.
The reaction mixture was concentrated under reduced pressure, and the residue was treated with ethyl acetate (15 m
l), 0.1 M hydrochloric acid (5 ml) and water (2
x5 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is subjected to preparative high performance liquid chromatography [column: YMC-Pack ODS
SH-343-5, mobile phase; 50% (V / V) acetonitrile water (0.0
5% TFA), flow rate: 10 ml / min], and fractionated 10 ml at a time. Fractions 19 to 25 were combined and concentrated under reduced pressure to remove acetonitrile.
Extracted in l). The organic layer was washed with water (2 × 10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure.
Compound 16 (12 mg) was obtained as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.02 (1H, s), 12.50 (1H,
br), 8.34 (1H, br t, J = 5.7 Hz), 7.08 (1H, s),
3.91 (3H, s), 3.75 (2H, m), 3.60 (2H, s), 2.59 (3
H, s)

[0159]

Example 13 Compound 1 (15 mg) was suspended in chloroform (3 ml), m-chloroperbenzoic acid (purity 70%, manufactured by Wako Pure Chemical Industries, Ltd.) (8.1 mg) was added, and the mixture was allowed to stand at room temperature for 1 hour. Stirred. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by silica gel column chromatography (chloroform / methanol / formic acid, eluted with 20: 1: 0.5) to give Compound 17 (13 mg) as a pale yellow powder. Was done. ¹ H NMR, CD ₃ OD, δ ppm; 7.04 (1H, s), 4.30 (1H, d,
J = 14.7 Hz), 4.15 (1H, d, J = 14.7 Hz), 3.98 (3H,
s), 2.61 (3H, s)

[0160]

Example 14 Compound 1 (10 mg) was converted to pyridine (0.1%).
Acetic anhydride (0.1 ml), and the mixture was stirred at room temperature for 1.5 hours. After the reaction mixture was concentrated under reduced pressure to dryness, the residue was dissolved in 70% (V / V) acetonitrile water (10 ml) and stirred at room temperature for 18 hours. The reaction mixture is concentrated, and the obtained residue is subjected to preparative high performance liquid chromatography [column; YMC-Pack ODS SH-343-
5. Mobile phase: 60% (V / V) acetonitrile water (0.05% TFA
Contained), flow rate: 10 ml / min], and fractionated 10 ml at a time. Fractions 12 and 13 were combined and concentrated under reduced pressure to give compound 18 (9.1 mg) as a white powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 12.45 (1H, br), 7.02 (1H,
s), 3.86 (3H, s), 3.54 (2H, m), 2.64 (3H, s), 2.4
1 (3H, s)

[0161]

Example 15 Compound 1 (30 mg) was converted to pyridine (2.
4 ml), acetic anhydride (0.6 ml) was added, and the mixture was stirred at room temperature for 2 hours. After the reaction mixture was concentrated under reduced pressure to dryness, the residue was dissolved in anhydrous THF (2.5 ml), and a 1.0 MTHF solution of borane-THF complex salt (Aldrich) (1.0 ml) was added at room temperature. The mixture was stirred at room temperature under an argon atmosphere for 3 hours. After the reaction mixture was concentrated under reduced pressure to dryness, the residue was treated with ethyl acetate (30 ml).
And washed with 0.1 M hydrochloric acid (5 ml) and saturated saline (2 × 5 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure, and the residue obtained was subjected to silica gel column chromatography (chloroform /
Purification with methanol (eluted at 98: 2 to 97: 3) gave compound 20 (26 mg) as a white powder. ¹ H NMR, CDCl ₃ , δ ppm; 8.13 (1H, br), 7.16 (1H,
s), 4.05 (3H, s), 3.69 (2H, t, J = 5.0 Hz), 2.92 (2
H, m), 2.67 (3H, s), 2.47 (3H, s)

[0162]

Example 16 Compound 20 (13 mg) was dissolved in methanol (4.4 ml), 0.1 M aqueous potassium carbonate (1.4 ml) was added under ice cooling, and the mixture was stirred at room temperature for 5 hours.
0.1 M hydrochloric acid (2.7 ml) was added to the reaction mixture, and the mixture was concentrated under reduced pressure. The residue was suspended in ethyl acetate (25 ml),
0.1M hydrochloric acid (5ml) and saturated saline (2x5m
Washed in l). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is separated by preparative high performance liquid chromatography [column: YMC-Pack ODS SH-34
3-5, mobile phase; 60% (V / V) acetonitrile water (0.05% TFA
Contained), flow rate: 10 ml / min], and fractionated 10 ml at a time. Fractions 31 to 35 were combined and concentrated under reduced pressure to obtain Compound 21 (10 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.11 (1H, s), 7.04 (1H,
s), 3.91 (3H, s), 3.44 (2H, t, J = 7.0 Hz), 2.88
(2H, t, J = 7.0 Hz), 2.58 (3H, s)

[0163]

Example 17 Compound 1 (10 mg) was converted to pyridine (0.1%).
Acetic anhydride (0.1 ml), and the mixture was stirred at room temperature for 1.5 hours. After the reaction mixture was concentrated under reduced pressure to dryness, the residue was dissolved in methanol (10 ml) and stirred at room temperature for 18 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was separated by preparative high performance liquid chromatography [column: YMC-Pack ODS SH-343-5, mobile phase; 60% (V / V)
Acetonitrile water (containing 0.05% TFA), flow rate: 10 ml /
Min.] And fractionated 10 ml at a time. Fraction 18
And 19 were combined and concentrated under reduced pressure to give Compound 26
(8.2 mg) was obtained as a white powder. ¹ H NMR, CDCl ₃ , δ ppm; 8.96 (1H, br), 7.15 (1H,
s), 4.04 (3H, s), 3.76 (3H, s), 3.67 (2H, m), 2.67
(3H, s), 2.47 (3H, s)

[0164]

Example 18 Compound 1 (15 mg) was converted to pyridine (1.
5 ml), and propionic anhydride (12.7 μl,
(Wako Pure Chemical Industries, Ltd.) and stirred at room temperature for 2 hours. After the reaction mixture was concentrated under reduced pressure to dryness, the residue was reduced to 70%
(V / V) suspended in acetonitrile water (15 ml),
Stir at room temperature for 18 hours. The reaction mixture was concentrated under reduced pressure,
The obtained residue is subjected to preparative high performance liquid chromatography [column; YMC-Pack ODS SH-343-5, mobile phase; 60% (V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10 ml / min]
And fractionated 10 ml at a time. Fractions 19 and 20 were combined and concentrated under reduced pressure to give compound 27 (15 m
g) was obtained as a white powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 12.40 (1
H, br), 7.03 (1H, s), 3.8
5 (3H, s), 3.54 (2H, m),
2.74 (2H, q, J = 7.5 Hz),
2.64 (3H, s), 1.23 (3H,
t, J = 7.5 Hz)

[0165]

Example 19 Compound 1 (15 mg) was converted to pyridine (1.
5 ml) and isobutyryl chloride (10.4 μl,
(Wako Pure Chemical Industries, Ltd.) and stirred at room temperature for 2 hours. After the reaction mixture was concentrated under reduced pressure to dryness, the residue was reduced to 70%
(V / V) Dissolved in acetonitrile water (15 ml) and stirred at room temperature for 18 hours and at 60 ° C. for 2 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was separated by preparative high performance liquid chromatography [column: YMC-Pack ODS SH-343-5, mobile phase: 60% (V / V) acetonitrile water (containing 0.05% TFA),
Flow rate; 10 ml / min] and fractionated 10 ml at a time. Fractions 27 to 29 were combined and concentrated under reduced pressure to obtain Compound 28 (16 mg) as a white powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 12.24 (1H, br), 7.04 (1H,
s), 3.83 (3H, s), 3.54 (2H, m), 2.97 (1H, m), 2.6
3 (3H, s), 1.33 (6H, d, J = 6.9 Hz)

[0166]

Example 20 Compound 1 (12 mg) was added to DMF (1.2 m
1), added with WSC (15 mg) and stirred at room temperature for 30 minutes. Benzoic acid (6.4 mg, manufactured by Wako Pure Chemical Industries) and 4-dimethylaminopyridine (3.2 m) were added to the reaction mixture.
g, manufactured by Wako Pure Chemical Industries, Ltd.) and stirred at room temperature for 3 hours.
The reaction mixture was treated with 70% (v / v) aqueous acetonitrile (3.
5 ml) and stirred at room temperature for 18 hours. The reaction mixture was concentrated under reduced pressure, and the concentrate (2.5 ml) was diluted with ethyl acetate (15 ml). The diluent was washed with 0.1 M hydrochloric acid (10 ml) and water (3 × 10 ml).
Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is subjected to preparative high performance liquid chromatography [column; YMC-Pack ODS SH-343-5, mobile phase; 65%
(V / V) Acetonitrile water (containing 0.05% TFA), flow rate: 10
ml / min] and fractionated 10 ml at a time. Fractions 22 and 23 were combined and concentrated under reduced pressure to give compound 2
9 (11 mg) was obtained as a white powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 12.22 (1H, br), 8.15 (2H,
br d, J = 7.5 Hz), 7.80 (1H, br t, J = 7.5 Hz), 7.
66 (2H, t, J = 7.5 Hz), 7.06 (1H, s), 3.68-3.50 (5
H, m), 2.67 (3H, s)

[0167]

Example 21 Compound 10 (40 mg) was added to anhydrous THF.
(4.0 ml), a 1.0 MTHF solution of borane-THF complex salt (1.0 ml) was added thereto under ice cooling, and the mixture was stirred at 0 ° C. for 2 hours in an argon atmosphere. To the reaction mixture was added a saturated aqueous ammonium chloride solution (2.0 ml) under ice-cooling, and the mixture was concentrated under reduced pressure. The residue was suspended in ethyl acetate (30 ml), 0.1 M hydrochloric acid (5 ml) and saturated saline (2 ml).
x5 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is subjected to preparative high performance liquid chromatography [column: YMC-Pack ODS
SH-343-5, mobile phase; 60% (V / V) acetonitrile water (0.0
5% TFA), flow rate: 10 ml / min], and fractionated 10 ml at a time. Fractions 34 to 38 were combined and concentrated under reduced pressure to obtain Compound 30 (19 mg) as a yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 8.05 (1H, br), 6.86 (1H,
s), 5.74 (1H, br), 4.00 (3H, s), 3.82 (2H, s), 3.7
5 (3H, s), 3.56 (2H, s), 2.46 (3H, s)

[0168]

Example 22 Compound 1 (15 mg) was added to anhydrous THF
(2.5 ml), a 1.0 MTHF solution of borane-THF complex salt (0.5 ml) was added at room temperature, and the mixture was stirred at room temperature for 3 hours under an argon atmosphere. The residue obtained by concentrating the reaction mixture under reduced pressure was suspended in ethyl acetate (30 ml), 0.1 M hydrochloric acid (5 ml) and saturated saline (2 × 5).
ml). Next, the organic layer was dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting residue was separated by preparative high performance liquid chromatography [column: YMC-Pack ODS SH-343-
5. Mobile phase: 60% (V / V) acetonitrile water (0.05% TFA
Contained), flow rate: 10 ml / min], and fractionated 10 ml at a time. Fractions 22 to 25 were combined and concentrated under reduced pressure to obtain Compound 31 (12 mg) as a light brown powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 10.40 (1
H, s), 9.78 (1H, s), 6.69
(1H, s), 3.90 (3H, s),
3.68 (2H, s), 3.43 (2H, s)
t, J = 7.2 Hz), 2.80 (2H,
t, J = 7.2 Hz), 2.41 (3H,
s)

[0169]

Example 23 Compound 11 (19 mg) was added to anhydrous THF.
(3.0 ml), a 1.0 MTHF solution of borane-THF complex salt (0.5 ml) was added thereto under ice cooling, and the mixture was stirred at 0 ° C. for 3 hours in an argon atmosphere. To the reaction mixture was added a saturated aqueous ammonium chloride solution (2.0 ml) under ice-cooling, and the mixture was concentrated under reduced pressure. The obtained residue was washed with ethyl acetate (30 m
l) and washed with 0.1 M hydrochloric acid (5 ml) and saturated saline (2 x 5 ml). Next, the organic layer was dried over anhydrous sodium sulfate, and concentrated under reduced pressure.
Left for 0 minutes. The residue obtained by concentrating the reaction mixture under reduced pressure was subjected to preparative high performance liquid chromatography [column: YMC
-Pack ODS SH-343-5, mobile phase; 55%
(V / V) Acetonitrile water (containing 0.05% TFA), flow rate: 10
ml / min] and fractionated 10 ml at a time. Fractions 28 and 29 were combined and concentrated under reduced pressure to give compound 32
(7.8 mg) was obtained as a brown powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 10.56 (1H, br s), 9.77 (1
H, br s), 6.69 (1H, s), 3.88 (3H, s), 3.68 (2H, s),
3.50 (2H, s), 2.40 (3H, s)

[0170]

Example 24 Compound 1 (15 mg) was dissolved in a 25% solution of hydrogen bromide in acetic acid (3.0 ml, manufactured by Wako Pure Chemical Industries, Ltd.).
Stirred at ° C for 15 hours. After the reaction mixture was concentrated under reduced pressure to dryness, the obtained residue was separated by preparative high performance liquid chromatography [column; YMC-Pack ODS SH-343-5, mobile phase;
5% (V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10 ml / min], and fractionated 10 ml at a time. Fractions 10 to 12 were combined and concentrated under reduced pressure to obtain Compound 33 (12 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.20 (1H, s), 7.00 (1H,
s), 3.58 (2H, s), 2.58 (3H, s)

[0171]

Example 25 Compound 1 (50 mg) was added to DMF (5.0 m
1), potassium carbonate (150 mg) and chloromethylmethyl ether (83 μl) were added, and the mixture was stirred at room temperature for 30 minutes. Ethyl acetate (30 m
1) was added, and the mixture was washed with 10% aqueous citric acid, 2% aqueous sodium hydrogen carbonate and water (2 × 10 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was subjected to silica gel column chromatography (5.0 ml), and hexane / ethyl acetate (9
0:10) and (80:20).
The fractions eluted with ethyl acetate (70:30) and (65:35) were collected and concentrated to dryness to give compound 34 (55 m
g) was obtained as a pale yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 7.32 (1H, s), 5.45 (2H, s),
5.22 (4H, m), 4.05 (3H, s), 3.69 (3H, s), 3.58 (2
H, m), 3.57 (3H, s), 3.41 (3H, s), 2.67 (3H, s)

[0172]

Example 26 Compound 1 (50 mg) was suspended in dichloromethane (5.0 ml), and TEA (15 μl, manufactured by Wako Pure Chemical Industries) and chloromethyl methyl ether (13 μl) were added, followed by stirring at room temperature for 2 hours. did. Ethyl acetate (30 ml) was added to the reaction mixture, and the mixture was washed with 10% aqueous citric acid, 2% aqueous sodium hydrogen carbonate and water (2 × 10 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was subjected to silica gel column chromatography (5.0 ml), and hexane / acetone (70:30), (60:40) and (50: 5
The fraction eluted in 0) is collected and concentrated to dryness to give compound 35.
(33 mg) was obtained as a yellow powder. _{^{1 H NMR, CDCl 3, δ}} ppm; 12.86 (1H, s), 7.18 (1H, s),
5.32 (1H, d, J = 5.8 Hz), 5.26 (1H, d, J = 5.8 H
z), 4.08 (3H, s), 3.79 (1H, d, J = 17.7 Hz), 3.65
(1H, d, J = 17.7 Hz), 3.46 (3H, s), 2.64 (3H, s)

[0173]

Example 27 Compound 35 (25 mg) was dissolved in pyridine (1.0 ml), acetic anhydride (1.0 ml) was added, and the mixture was allowed to stand at room temperature for 1 hour. After concentrating the reaction mixture, ethyl acetate (30 ml) was added, and 0.01M hydrochloric acid (5 × 2) was added.
0 ml) and water (2 × 20 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated to dryness to obtain Compound 36 (30 mg) as a pale yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 7.49 (1H, s), 5.22 (2H, d, J
= 10.7 Hz), 4.03 (3H, s), 3.56 (2H, s), 3.41 (3H,
s), 2.68 (3H, s), 2.47 (3H, s), 2.42 (3H, s)

[0174]

Example 28 Compound 36 (20 mg) was dissolved in a 5% TFA solution in dichloromethane (2.0 ml), and the solution was allowed to stand at room temperature for 1 hour. Ethyl acetate (30 ml) was added to the reaction mixture, which was washed with water (5 × 20 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was subjected to preparative high performance liquid chromatography [column;
YMC-Pack ODS SH-343-5, mobile phase; 70% (V / V) acetonitrile-10 mM phosphate buffer (pH 3.0), flow rate: 10 ml /
The fractions having an elution volume of 60-80 ml were collected, concentrated under reduced pressure to remove acetonitrile, adjusted to pH 3.0, and extracted with ethyl acetate (30 ml). The organic layer was washed with water (2 × 10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain Compound 37 (18 mg) as a white powder. ¹ H NMR, CDCl ₃ , δ ppm; 7.90 (1H, s), 3.92 (3H, s),
3.49 (2H, m), 2.67 (3H, s), 2.43 (3H, s), 2.39 (3
H, s)

[0175]

Example 29 Compound 36 (5.5 mg) was added to TFA (10
0 μl) and left at room temperature for 30 minutes. Ethyl acetate (30 ml) was added to the reaction mixture, and water (3 × 10 m
Washed in l). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is separated by preparative high performance liquid chromatography [column: YMC-Pack ODS AM-32
4. Mobile phase: 70% (V / V) acetonitrile water (0.05% TFA
Contained), a flow rate of 3.0 ml / min], and an elution volume of 42-4.
Eight ml fractions were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (20 ml). The organic layer was washed with water (3 × 10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain Compound 38 (3.1 mg) as a yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 12.62 (1H, s), 7.95 (1H,
s), 3.95 (3H, s), 3.51 (2H, m), 2.62 (3H, s), 2.40
(3H, s)

[0176]

Example 30 Compound 1 (15 mg) was added to DMF (1.0 m
l) and dissolved in N-bromosuccinimide (5.8) under ice-cooling.
mg, manufactured by Wako Pure Chemical Industries, Ltd.) and stirred at 0 ° C. for 20 minutes. The reaction mixture was diluted with ethyl acetate (20 ml),
Washed with 0.1 M hydrochloric acid (10 ml) and water (3 × 10 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is separated by preparative high performance liquid chromatography [column: YMC-Pack ODS SH-343-5,
Mobile phase: 65% (V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10 ml / min], and fractionated in 10 ml portions. Fractions 33 to 37 were combined and concentrated under reduced pressure to obtain Compound 39 (14 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 12.99 (1H, s), 3.91 (3H,
s), 3.56 (2H, br s), 2.59 (3H, s)

[0177]

Example 31 Compound 1 (12 mg) was added to DMF (1.5 m
l), iodine (7.3 mg, Wako Pure Chemical Industries, Ltd.) was added, and the mixture was stirred at room temperature for 2 hours.
g) was added, and the mixture was further stirred at room temperature for 1 hour. The reaction mixture was diluted with ethyl acetate (15 ml) and washed with a 2% aqueous solution of sodium thiosulfate (10 ml), water (2 × 10 ml) and saturated saline (10 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure.
The obtained residue is subjected to preparative high performance liquid chromatography [column: YMC-Pack ODS SH-343-5, mobile phase: 75% (V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10 ml / min]
And fractionated 10 ml at a time. Fractions 21 and 22 were combined and concentrated under reduced pressure to give compound 40 (11 m
g) was obtained as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.10 (1H, br s), 3.90 (3
H, s), 3.52 (2H, brs), 2.60 (3H, s)

[0178]

Example 32 Compound 1 (12 mg) was added to formic acid (2.9 m).
l), 30% aqueous hydrogen peroxide (0.15 ml, manufactured by Wako Pure Chemical Industries, Ltd.) was added, and the mixture was stirred at 60 ° C for 2 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was subjected to preparative high performance liquid chromatography [column; YMC-Pack ODS SH-343-5, mobile phase; 50% (V / V) acetonitrile water (containing 0.05% TFA), Flow rate; 10 ml / min] and fractionated 10 ml at a time. Fractions 17 to 19 were combined and concentrated under reduced pressure to obtain Compound 41 (11 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.05 (1H, s), 6.99 (1H,
s), 4.55 (2H, s), 3.85 (3H, s), 2.58 (3H, s)

[0179]

Example 33 Compound 33 (27 mg) was dissolved in dichloromethane (2.7 ml), and triethylamine (17 μm) was dissolved.
l) and chloromethyl methyl ether (15 μl) were added, and the mixture was stirred at room temperature for 1.5 hours. Add 0. 0 to the reaction mixture.
1 M phosphate buffer (pH 3.0) (10 ml) was added,
The mixture was extracted with ethyl acetate (30 ml), and the organic layer was extracted with water (2 ×
10 ml) and saturated saline (5 ml).
Next, the organic layer was dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting residue was subjected to preparative high-performance liquid chromatography [column;
V) Acetonitrile-0.01M phosphate buffer (pH 3.0), flow rate: 10 ml / min], and fractionated in 10 ml portions. Fractions 27 to 32 were combined, concentrated under reduced pressure to remove acetonitrile, and then extracted with ethyl acetate (30 ml). The organic layer was washed with water (10 ml) and saturated saline (5 m).
After washing in l) and drying over anhydrous sodium sulfate,
After concentration under reduced pressure, compound 42 (22 mg) was obtained as a pale yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.87 (1H, s), 9.06 (1H, b
r), 7.19 (1H, s), 5.72 (1H, d, J = 5.8 Hz), 5.56
(1H, d, J = 5.8 Hz), 5.32 (1H, d, J = 5.8 Hz), 5.2
7 (1H, d, J = 5.8 Hz), 3.80 (1H, d, J = 17.8 Hz),
3.67 (1H, d, J = 17.8 Hz), 3.63 (3H, s), 3.46 (3H,
s), 2.65 (3H, s)

[0180]

Example 34 Compound 42 (16 mg) was added to THF (1.
5M), 1.0 M aqueous sodium hydroxide (89 μl) was added thereto under ice-cooling, and the mixture was stirred at 0 ° C for 30 minutes. The reaction mixture was added to a 0.1 M phosphate buffer (pH 3.0) (10
ml), extracted with ethyl acetate (30 ml), and the organic layer was washed with water (10 ml) and saturated saline (5 ml). Next, the organic layer was dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting residue was subjected to preparative high-performance liquid chromatography [column; ) Acetonitrile-0.02M phosphate buffer (pH
3.0), flow rate: 10 ml / min] and fractionated 10 ml at a time. Fractions 15 to 18 were combined, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml). The organic layer was washed with water (10 ml) and saturated saline (5 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain Compound 43 (13 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.07 (1H, s), 7.03 (1H,
s), 5.55 (1H, d, J = 5.8 Hz), 5.44 (1H, d, J = 5.8
Hz), 3.59 (2H, s), 3.51 (3H, s), 2.57 (3H, s)

[0181]

Example 35 Compound 33 (15 mg) was dissolved in 10% hydrochloric acid.
It was dissolved in methanol (3.0 ml) and stirred at room temperature for 1 hour. The residue obtained by concentrating the reaction mixture under reduced pressure was subjected to preparative high performance liquid chromatography [column: YMC-Pack ODS SH-
343-5, mobile phase; 55% (V / V) acetonitrile water (0.05% T
FA containing), flow rate: 10 ml / min], and fractionated 10 ml at a time. Fractions 22 to 24 were combined, concentrated under reduced pressure to remove acetonitrile, and then ethyl acetate (30 ml)
Extracted. The organic layer was washed with water (2 × 10 ml) and saturated saline (5 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain Compound 44 (13 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.17 (1H, s), 7.00 (1H,
s), 3.60 (2H, s), 3.55 (3H, s), 2.57 (3H, s)

[0182]

Example 36 Compound 33 (15 mg) was suspended in ethanol (1.0 ml), 10% (V / V) concentrated sulfuric acid-ethanol (10 μl) was added, and the mixture was refluxed for 1 hour. The reaction mixture was concentrated under reduced pressure, dissolved in ethyl acetate (15 ml), and washed with saturated saline (2 × 5 ml). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue obtained was separated by preparative high performance liquid chromatography [column: YMC-Pack O
DS SH-343-5, mobile phase; 60% (V / V) acetonitrile water (0.
05% TFA), flow rate: 10 ml / min] and 10 ml
Fractionated. Fractions 21 to 23 were combined and concentrated under reduced pressure to remove acetonitrile.
ml). The organic layer was washed with water (2 × 10 ml) and saturated saline (5 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give compound 45 (14 m
g) was obtained as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.18 (1H, s), 7.01 (1H,
s), 3.99 (2H, q, J = 7.1 Hz), 3.59 (2H, s), 2.58 (3
H, s), 1.08 (3H, t, J = 7.1 Hz)

[0183]

Example 37 Compound 33 (40 mg) was added to DMF (2.
0 ml), triethylamine (25 μl) and ethyl iodide (145 μl, manufactured by Wako Pure Chemical Industries) were added, and the mixture was stirred at room temperature for 13 hours. The reaction mixture was dissolved in ethyl acetate (30 ml), and 10% aqueous citric acid (2 × 5 ml) was added.
1), water (3 × 5 ml) and saturated saline (5 ml). After drying the organic layer over anhydrous sodium sulfate,
The residue obtained by concentration under reduced pressure was subjected to preparative high performance liquid chromatography [column: YMC-Pack ODS SH-343-5, mobile phase; 65%
(V / V) Acetonitrile water (containing 0.05% TFA), flow rate: 1
0 ml / min] and fractionated 10 ml at a time. Fractions 26 to 29 were combined, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml). The organic layer was washed with water (2 × 10 ml) and saturated saline (5 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain Compound 47 (10 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.09 (1H, s), 7.
02 (1H, s), 4.40 (2H, m), 3.60 (1H, d, J = 14.5 H
z), 3.53 (1H, d, J = 14.5 Hz), 2.57 (3H, s), 1.35
(3H, t, J = 7.1 Hz) Further, the fractions 55 to 65 were combined and concentrated under reduced pressure to remove acetonitrile, followed by extraction with ethyl acetate (30 ml). 5ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain Compound 46 (13 mg) as a pale yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.94 (1H, s), 9.23 (1H, br
s), 7.17 (1H, s), 4.58 (2H, m), 4.22 (2H, q, J =
7.2 Hz), 3.72 (1H, d, J = 17.6 Hz), 3.59 (1H, d, J
= 17.6 Hz), 2.64 (3H, s), 1.45 (3H, t, J = 7.2 H
z), 1.27 (3H, t, J = 7.2 Hz)

[0184]

Example 38 Compound 1 (50 mg) was added to DMF (5.0 m).
l), potassium carbonate (15 mg) and benzyl bromide (17 µl, manufactured by Wako Pure Chemical Industries) were added, and the mixture was stirred at room temperature for 11 hours. Ethyl acetate (30 m
1) was added, and the mixture was washed with 10% aqueous citric acid, 2% aqueous sodium hydrogen carbonate and water (2 × 10 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is separated by preparative high performance liquid chromatography.
[Column: YMC-Pack ODS SH-343, mobile phase; 75% (V / V)
Acetonitrile water (containing 0.05% TFA), flow rate: 10 ml /
The fractions having an elution volume of 250-320 ml were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml). Wash the organic layer with water (3x10m
1), dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain Compound 48 (22 mg) as a yellow powder. _{^{1 H NMR, CDCl 3, δ}} ppm; 12.87 (1H,
s), 9.05 (1H, br s), 7.3
2 (5H, m), 7.15 (1H, s),
5.20 (1H, d, J = 12.1 H
z), 5.14 (1H, d, J = 12.1)
Hz), 4.06 (3H, s), 3.77
(1H, d, J = 17.4 Hz), 3.6
2 (1H, d, J = 17.4 Hz),
2.65 (3H, s)

[0185]

Example 39 Compound 48 (15 mg) was added to DMF (2.
0 ml), potassium carbonate (11 mg) and chloromethyl methyl ether (6.2 μl) were added, and the mixture was stirred at room temperature for 4 hours. Ethyl acetate (30 m
1) was added, and the mixture was washed with 10% aqueous citric acid, 2% aqueous sodium hydrogen carbonate and water (2 × 10 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated to dryness to obtain Compound 49 (17 mg) as a pale yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 7.17 (5H, m), 7.16 (1H, s),
5.34 (2H, s), 5.19 (2H, d, J = 14.4 Hz), 5.02 (2H, s)
s), 4.02 (3H, s), 3.69 (3H, s), 3.52 (5H, s), 2.6
9 (3H, s)

[0186]

Example 40 Compound 49 (15 mg) was dissolved in methanol (20 ml), and 10% palladium activated carbon (5.0 mg, Wako Pure Chemical Industries, Ltd.) was added. Stirred for hours. After filtering off the catalyst from the reaction mixture, the filtrate was concentrated. The residue was again dissolved in methanol (20
ml) and 10% palladium on activated carbon (5.0 m
g) was added and the mixture was stirred at room temperature under a hydrogen atmosphere of 1 atm for 2 hours. After filtering off the catalyst from the reaction mixture, the filtrate was concentrated under reduced pressure. The obtained residue is separated by preparative high performance liquid chromatography.
[Column: D-ODS-5 YMC, mobile phase; 73% (V / V) acetonitrile-20 mM phosphate buffer (pH 3.0), flow rate: 10 ml / min]
And elution volumes of 115-145 ml and 145-1
70 ml fractions were collected and concentrated under reduced pressure to remove acetonitrile. These were extracted with ethyl acetate (30 ml). After washing each organic layer with water (2 × 10 ml),
After drying over anhydrous sodium sulfate and concentration under reduced pressure, compound 50 (4.4 mg) and compound 51 (2.6 mg) were obtained.
Were each obtained as a yellow powder. 50: ¹ H NMR, CDCl ₃ , δ ppm; 7.31 (1H, s), 5.42 (2H,
s), 5.20 (2H, br s), 4.04 (3H, s), 3.69 (3H, s),
3.59 (2H, s), 3.55 (3H, s), 2.67 (3H, s) 51: ¹ H NMR, CDCl ₃ , δ ppm; 12.84 (1H, br s), 7.36
(1H, s), 5.44 (2H, s), 4.06 (3H, s), 3.59 (2H, s),
3.56 (3H, s), 2.65 (3H, s)

[0187]

Example 41 Compound 1 (15 mg) was converted to pyridine (0.
5 ml), acetic anhydride (0.1 ml) was added, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure, the residue was dissolved in chloroform (1.5 ml), m-chloroperbenzoic acid (8.1 mg) was added, and the mixture was stirred at room temperature for 1 hour. After the reaction mixture was concentrated under reduced pressure to dryness, the residue was suspended in 70% (V / V) acetonitrile water (15 ml) and stirred at room temperature for 15 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was separated by preparative high performance liquid chromatography [column; YMC-Pack ODS SH-343-5, mobile phase; 50% (V /
V) Acetonitrile water (containing 0.05% TFA), flow rate: 10 ml
/ Min] and fractionated 10 ml at a time. Fraction 1
Compounds 4 to 16 were collected and concentrated under reduced pressure to give Compound 52 (13
mg) as a white powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 12.67 (1H, br), 7.04 (1H,
s), 4.10 (2H, s), 3.81 (3H, s), 2.64 (3H, s), 2.4
1 (3H, s)

[0188]

Example 42 Compound 27 (19 mg) was treated with acetic acid (3.6).
1%) and 30% hydrogen peroxide solution (0.19m
l) was added and the mixture was stirred at 60 ° C for 45 minutes. The reaction mixture was concentrated under reduced pressure, and the obtained residue was separated by preparative high performance liquid chromatography [column; YMC-Pack ODSSH-343-5, mobile phase;
% (V / V) acetonitrile water (containing 0.05% TFA), flow rate;
10 ml / min] and fractionated 10 ml at a time. Fractions 22 and 23 were combined and concentrated under reduced pressure to give Compound 5.
3 (10 mg) was obtained as a brown powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 6.99 (1H, s), 4.09 (2H,
s), 3.79 (3H, s), 2.74 (2H, m), 2.64 (3H, s), 1.23
(3H, t, J = 7.3 Hz)

[0189]

Example 43 Compound 40 (15 mg) was treated with acetic acid (2.8).
5%) and 30% aqueous hydrogen peroxide (0.15 m
l) was added and the mixture was stirred at 60 ° C for 1 hour. The reaction mixture was concentrated under reduced pressure, and the obtained residue was subjected to preparative high performance liquid chromatography [column; YMC-Pack ODSSH-343-5, mobile phase; 75%
(V / V) Acetonitrile water (containing 0.05% TFA), flow rate: 10
ml / min] and fractionated 10 ml at a time. Fractions 20 to 23 were combined and concentrated under reduced pressure to give compound 54.
(13 mg) was obtained as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.38 (1H, s), 4.12 (1H,
d, J = 14.4 Hz), 3.96 (1H, d, J = 14.4 Hz), 3.80
(3H, s), 2.58 (3H, s)

[0190]

Example 44 Compound 40 (40 mg) was dissolved in pyridine (4.0 ml), and propionic anhydride (26 μl) was dissolved.
l) was added and the mixture was stirred at room temperature for 1 hour. After the reaction mixture was concentrated under reduced pressure to dryness, the residue was dissolved in 80% (V / V) acetonitrile water (40 ml) and stirred at room temperature for 15 hours. The reaction mixture is concentrated, and the obtained residue is separated by preparative high performance liquid chromatography [column; YMC-Pack ODS S
H-343-5, mobile phase; 75% (V / V) acetonitrile water (0.05%
TFA), flow rate: 10 ml / min], and fractionated 10 ml at a time. Fractions 25 to 27 were combined and concentrated under reduced pressure to obtain Compound 55 (33 mg) as a white powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 3.87 (3H, s), 3.55 (2H,
s), 2.74 (2H, q, J = 7.5 Hz), 2.65 (3H, s), 1.23 (3
(H, t, J = 7.5 Hz)

[0191]

Example 45 Compound 55 (16 mg) was treated with acetic acid (3.0).
4%) and 30% hydrogen peroxide solution (0.16 m
l) was added and the mixture was stirred at 50 ° C for 2 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was subjected to preparative high performance liquid chromatography [column; YMC-Pack ODS SH-343-5, mobile phase; 75%
(V / V) Acetonitrile water (containing 0.05% TFA), flow rate: 1
0 ml / min] and fractionated 10 ml at a time. Fractions 20 to 24 were combined and concentrated under reduced pressure to give Compound 56.
(15 mg) was obtained as a white powder. _{^{1 H NMR, DMSO-d 6}} , δ ppm; 4.11 (2H,
s), 3.79 (3H, s), 2.74
(2H, m), 2.65 (3H, s), 1.
23 (3H, t, J = 7.3 Hz)

[0192]

Example 46 Compound 11 (15 mg) was dissolved in dichloromethane (1.5 ml), and triethylamine (7.7) was dissolved.
μl) and phenyl chlorocarbonate (4.1 μl, manufactured by Wako Pure Chemical Industries) were added, and the mixture was stirred at room temperature for 30 minutes. The reaction mixture was diluted with ethyl acetate (10 ml) and washed with 0.1 M hydrochloric acid (3 ml) and water (2 × 3 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was dissolved in TFA (1.5 ml), allowed to stand at room temperature for 20 minutes, and then concentrated under reduced pressure. The obtained residue is subjected to preparative high performance liquid chromatography [column: YMC-Pa
ck ODS SH-343-5, mobile phase; 65% (V / V)
Acetonitrile water (containing 0.05% TFA), flow rate: 10 ml /
Min.] And fractionated 10 ml at a time. Fraction 21
To 24 were combined and concentrated under reduced pressure, and the resulting suspension (10
ml) was extracted with ethyl acetate (10 ml). The organic layer was washed with water (2 × 5 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain Compound 57 (16 mg) as a white powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 7.52 (2H, t, J = 7.9 Hz),
7.39 (3H, m), 7.01 (1H, s), 3.91 (3H, s), 3.54 (2
H, s), 2.67 (3H, s)

[0193]

Example 47 Compound 11 (15 mg) was dissolved in dichloromethane (1.5 ml), and triethylamine (7.7) was dissolved.
μl) and methyl chlorocarbonate (4.2 μl, manufactured by Wako Pure Chemical Industries) were added, and the mixture was stirred at room temperature for 30 minutes. The reaction mixture was diluted with ethyl acetate (10 ml), and 0.1 M hydrochloric acid (3
ml) and water (2 × 3 ml). Then
The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was dissolved in TFA (1.5 ml) and
After allowing to stand for 0 minutes, the mixture was concentrated under reduced pressure. The obtained residue is subjected to preparative high performance liquid chromatography [column; YMC-Pack ODS S
H-343-5, mobile phase; 60% (V / V) acetonitrile water (0.05%
TFA), flow rate: 10 ml / min], and fractionated 10 ml at a time. Fractions 14 to 16 were combined and concentrated under reduced pressure. The resulting suspension (10 ml) was diluted with ethyl acetate (10 ml).
ml). The organic layer was washed with water (2 × 5 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain Compound 58 (13 mg) as a white powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 7.02 (1H, s), 3.89 (3H,
s), 3.86 (3H, s), 3.53 (2H, m), 2.65 (3H, s)

[0194]

Example 48 Compound 17 (265 mg) was suspended in dioxane (50 ml), and 1M sulfuric acid (50 ml) was added.
The mixture was stirred at 00 ° C for 8 hours. After concentrating the reaction solution and distilling off dioxane, ethyl acetate (100 ml) was added and water (4 × 50) was added.
ml). The organic layer was concentrated under reduced pressure, the obtained residue was subjected to silica gel column chromatography (25 ml), washed with chloroform / TEA (100: 2, 80 ml), and then chloroform / methanol / TEA (100: 2).
2: 2, 10 × 10 ml, fraction 1-10),
(100: 5: 2, 10 × 10 ml, fraction 11
-20), (50: 50: 5, 5 × 20 ml, fraction 21-25). Fraction 2-8
And 22-24 were collected and concentrated. The fraction 2-8 was concentrated to dryness, dissolved in pyridine (30 ml), and left for 12 hours. The solution was then concentrated and combined with the concentrated residue of fractions 22-24 and dissolved in ethyl acetate (80 ml). The obtained ethyl acetate solution was washed with 0.02 M hydrochloric acid and water (2 × 40 ml), respectively.
After drying over anhydrous sodium sulfate and concentration to dryness, compound 59 (175 mg) was obtained as a pale yellow powder. ¹ H NMR, Pyridine-d ₅ , δ ppm; 7.31 (2H, s), 4.06 (6
H, s), 2.46 (6H, s)

[0195]

Example 49 Compound 59 (10 mg) was added to DMF (2.0
ml) and sodium borohydride (10 mg,
(Wako Pure Chemical Industries, Ltd.) and stirred at room temperature for 30 minutes. Ethyl acetate (30 ml) was added to the reaction mixture, washed with 0.02 M hydrochloric acid and water (2 × 10 ml), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was subjected to preparative high performance liquid chromatography [column;
D-ODS-5 YMC, mobile phase; 70% (V / V) acetonitrile water (0.
05% TFA), flow rate; 10 ml / min], fractions having an elution volume of 170-250 ml were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml). The organic layer was washed with water (3 × 10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain Compound 60.
(6.9 mg) was obtained as a yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.84 (1H, s), 7.18 (1H,
s), 4.09 (3H, s), 2.64 (3H, s)

[0196]

Example 50 Compound 59 (10 mg) was suspended in pyridine (2.0 ml), sodium borohydride (5.0 mg) was added, and the mixture was stirred at room temperature for 30 minutes. Α-Bromo-p-toluic acid (8.1 mg, manufactured by Aldrich) was added to the reaction mixture, and the mixture was stirred at room temperature for 2 hours. After concentration of the reaction mixture, ethyl acetate (30 ml) was added,
Hydrochloric acid (3 × 10 ml) and saturated saline (2 × 10 m
After washing in 1), the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was subjected to preparative high performance liquid chromatography [column; YMC-Pack ODS SH-343-5,
Mobile phase: 65% (V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10 ml / min], and elution volume 210-2.
55 ml fractions were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml). The organic layer was washed with water (3 × 10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give compound 61 (6.5 mg).
Was obtained as a yellow powder. ¹ H NMR, Pyridine-d ₅ , δ ppm; 8.37 (2H, d, J = 8.1
Hz), 7.59 (2H, d, J = 8.1 Hz), 7.25 (1H, s), 4.58
(1H, d, J = 12.5 Hz), 4.42 (1H, d, J = 12.5 Hz),
4.13 (3H, s), 2.47 (3H, s)

[0197]

Example 51 Compound 59 (10 mg) was suspended in pyridine (2.0 ml), and sodium borohydride (1 mg) was added.
0 mg) and stirred at room temperature for 30 minutes. 8-Bromooctanoic acid (11 mg, manufactured by Aldrich) was added to the reaction mixture.
Was added and stirred at room temperature for 1 hour. After concentrating the reaction mixture, ethyl acetate (30 ml) was added, and 0.02 M hydrochloric acid (3 × 10
ml) and saturated saline (2 × 10 ml), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is separated by preparative high performance liquid chromatography.
[Column: YMC-Pack ODS SH-343-5, mobile phase: 70% (V /
V) Acetonitrile water (containing 0.05% TFA), flow rate: 10 ml
/ Min], fractions having an elution volume of 280-330 ml were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml). Wash the organic layer with water (3x10m
1), dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain Compound 62 (7.0 mg) as a yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.89 (1H, s), 7.20 (1H,
s), 4.07 (3H, s), 2.77 (2H, t, J = 7.5 Hz), 2.64 (3
H, s), 2.34 (2H, t, J = 7.4 Hz), 1.60 (4H, m), 1.33
(6H, m)

[0198]

Example 52 Compound 59 (10 mg) was suspended in pyridine (2.0 ml), and sodium borohydride (1 mg) was added.
0 mg) and stirred at room temperature for 30 minutes. 2-Bromooctanoic acid (8.7 μl, manufactured by Wako Pure Chemical Industries, Ltd.) was added to the reaction mixture, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure,
Ethyl acetate (30 ml) was added and 0.02 M hydrochloric acid (3 ×
10 ml) and saturated saline (2 × 10 ml). The obtained organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure, and the residue was separated by preparative high performance liquid chromatography [column: YMC-Pack ODS SH-343-5, mobile phase;
80% (V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10 ml / min]. Elution capacity 220-250m
The l fractions were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml). The organic layer was washed with water (3 × 10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain Compound 63 (7.5 mg) as a yellow powder. ¹ H NMR, Pyridine-d ₅ , δ ppm; 7.25
(0.5H, s), 7.24 (0.5H,
s), 4.57 (1H, m), 4.22 (1.
5H, s), 4.19 (1.5H, s),
2.47 (3H, s), 2.32 (1H,
m), 2.19 (1H, m), 1.72 (2
H, m), 1.33 (2H, m), 1.20
(4H, m), 0.77 (3H, t, J
= 6.6 Hz)

[0199]

Example 53 Compound 59 (15 mg) was suspended in pyridine (3.0 ml), sodium borohydride (15 mg) was added, and the mixture was stirred at room temperature for 30 minutes. N-Boc-2-bromoethylamine (21 mg) obtained in Reference Example 3 was added thereto, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure, and the resulting residue was treated with ethyl acetate (30 m
l) and suspended in 0.1 M phosphate buffer (pH 3.0)
(2 × 10 ml), water (2 × 10 ml) and saturated saline (5 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is subjected to preparative high performance liquid chromatography [column: YMC-Pack O
DS SH-343-5, mobile phase; 82% (V / V) acetonitrile-0.02
M phosphate buffer (pH 3.0), flow rate: 10 ml / min].
Fractionation was performed for each 0 ml. Fractions 17 to 22 were combined and concentrated under reduced pressure to remove acetonitrile, followed by extraction with ethyl acetate (15 ml). The organic layer is water (2x5ml)
After washing with saturated saline (3 ml), the extract was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue obtained is 4
N hydrochloric acid-ethyl acetate solution (manufactured by Kokusan Chemical Co., Ltd.) (3.0 m
1) and stirred at room temperature for 30 minutes. The reaction mixture was concentrated under reduced pressure to obtain Compound 64 (13 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 12.99 (1H, s), 7.90 (3H,
br s), 7.25 (1H, s), 3.95 (3H, s), 3.02 (2H, m), 2.
85 (2H, m), 2.58 (3H, s)

[0200]

Example 54 Compound 59 (10 mg) was suspended in pyridine (2.0 ml), sodium borohydride (10 mg) was added, and the mixture was stirred at room temperature for 30 minutes. There, 3-bromopropionic acid (manufactured by Wako Pure Chemical Industries) (10 m
g) was added and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure, and the obtained residue was suspended in ethyl acetate (30 ml). 0.02 M hydrochloric acid (2 × 10 ml) and water (2 × 10
ml) and saturated saline (5 ml). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The resulting residue was separated by preparative high performance liquid chromatography [column;
YMC-Pack ODS SH-343-5, mobile phase; 60% (V / V) acetonitrile water (containing 0.05% TFA), flow rate; Fractions 26 to 29
Were combined and concentrated under reduced pressure to remove acetonitrile, followed by extraction with ethyl acetate (15 ml). The organic layer was washed with water (2x5
ml) and saturated saline (5 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give compound 6.
5 (7.6 mg) was obtained as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.03 (1H, s), 7.07 (1H,
s), 3.90 (3H, s), 2.99 (2H, m), 2.57 (3H, s), 2.41
(2H, m)

[0201]

Example 55 Compound 59 (10 mg) was suspended in pyridine (2.0 ml), sodium borohydride (10 mg) was added, and the mixture was stirred at room temperature for 30 minutes. Ethyl iodide (5 μl) was added thereto, and the mixture was stirred at room temperature for 45 minutes. The reaction mixture was concentrated under reduced pressure, and the obtained residue was suspended in ethyl acetate (30 ml).
10 ml), water (2 x 10 ml) and saturated saline (5
ml). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The resulting residue was subjected to preparative high performance liquid chromatography [column; YMC-Pack ODS SH-343-5, mobile phase; Water (containing 0.05% TFA), flow rate: 10 ml / min], and fractionated 10 ml at a time. Fractions 26 to 29 were combined, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (15 ml). The organic layer was washed with water (3 × 5 ml) and saturated saline (5 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain Compound 66 (8.1 mg) as a pale yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.90 (1H, s), 7.80 (1H, b
r), 7.21 (1H, s), 4.08 (3H, s), 2.83 (2H, m), 2.64
(3H, s), 1.24 (3H, t, J = 7.4 Hz)

[0202]

Example 56 Compound 59 (10 mg) was suspended in pyridine (2.0 ml), sodium borohydride (10 mg) was added, and the mixture was stirred at room temperature for 30 minutes. 1-Bromopropane (Wako Pure Chemical Industries, Ltd.) (12 μl) was added thereto, and the mixture was stirred at room temperature for 6 hours. The reaction mixture was concentrated under reduced pressure, the obtained residue was suspended in ethyl acetate (30 ml), and 0.02 M hydrochloric acid (2 × 10 ml) and water (2 × 10 m
l) and saturated saline (5 ml). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The resulting residue was separated by preparative high performance liquid chromatography [column: YM
C-Pack ODS SH-343-5, mobile phase; 85% (V / V) acetonitrile water (containing 0.05% TFA), flow rate; Fractions 19 and 2
After adding 0 and concentrating under reduced pressure to remove acetonitrile, the mixture was extracted with ethyl acetate (15 ml). The organic layer was washed with water (3x
5 ml) and saturated saline (5 ml).
After drying over anhydrous sodium sulfate and concentration under reduced pressure, compound 67 (5.7 mg) was obtained as a pale yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.90 (1H, s), 7.79 (1H, b
r), 7.20 (1H, s), 4.08 (3H, s), 2.77 (2H, m), 2.64
(3H, s), 1.61 (2H, m), 1.00 (3H, t, J = 7.3 Hz)

[0203]

Example 57 Compound 59 (20 mg) was suspended in pyridine (4.0 ml), and sodium borohydride (2 mg) was added.
0 mg) and stirred at room temperature for 30 minutes. Bromoacetonitrile (3.5 μl, manufactured by Tokyo Chemical Industry Co., Ltd.) was added to the reaction mixture, and the mixture was stirred at room temperature for 1 hour. After concentrating the reaction mixture, ethyl acetate (30 ml) was added, and 0.02 M hydrochloric acid (3 × 10 m
1) and saturated saline (2 × 10 ml), the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is separated by preparative high performance liquid chromatography.
[Column: YMC-Pack ODS SH-343-5, mobile phase: 65% (V /
V) Acetonitrile water (containing 0.05% TFA), flow rate: 10 ml
/ Min], fractions having an elution volume of 170 to 230 ml were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml). Wash the organic layer with water (3x10m
After l), drying over anhydrous sodium sulfate and concentration under reduced pressure gave Compound 68 (13 mg) as a yellow powder. _{^{1 H NMR, Pyridine-d 5}} , δ ppm; 7.21 (1
H, s), 4.45 (1H, d, J = 1)
6.8 Hz), 4.32 (1H, d, J =
16.8 Hz), 4.20 (3H, s),
2.48 (3H, s)

[0204]

Example 58 Compound 59 (10 mg) was suspended in pyridine (2.0 ml), and sodium borohydride (1 mg) was added.
0 mg) and stirred at room temperature for 30 minutes. To the reaction mixture was added sodium 2-bromoethanesulfonate (11 mg, manufactured by Wako Pure Chemical Industries), and the mixture was stirred at room temperature for 2 hours. After concentrating the reaction mixture and distilling off pyridine, 0.02 M hydrochloric acid (30 m
1) and extracted with ethyl acetate (3 × 30 ml). The organic layer is concentrated under reduced pressure, and the obtained residue is subjected to preparative high performance liquid chromatography [column; YMC-Pack ODS S
H-343-5, mobile phase; 45% (V / V) acetonitrile water (containing 0.05% TFA), flow rate; After removing acetonitrile with ethyl acetate (3 × 30 ml)
Extracted. The organic layer was washed with 2% aqueous sodium hydrogen carbonate (3%
× 20 ml), and the resulting aqueous layer was concentrated.
Corrected to H8.0. This aqueous layer is used for the Diaion HP-2
0 (3.0 ml) column chromatography.
After washing with water (9.0 ml), 80% methanol water (9.
0 ml). The eluate was concentrated and freeze-dried to obtain Compound 69 (7.8 mg) as a yellow powder. ¹ H NMR, D ₂ O, δ ppm; 6.52 (1H, s), 4.07 (3H, s),
3.10 (4H, br s), 2.22 (3H, s)

[0205]

Example 59 Compound 59 (10 mg) was suspended in pyridine (2.0 ml), and sodium borohydride (1 mg) was added.
0 mg) and stirred at room temperature for 30 minutes. Α-Bromophenylacetic acid (11 mg, manufactured by Aldrich) was added to the reaction mixture, and the mixture was stirred at room temperature for 1 hour. After concentrating the reaction mixture, ethyl acetate (30 ml) was added, and 0.02 M hydrochloric acid (3 ×
After washing with 10 ml) and saturated saline (2 × 10 ml), the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was subjected to preparative high performance liquid chromatography [column; YMC-Pack ODS SH-343-5, mobile phase; 67%
(V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10
ml / min], fractions having an elution volume of 190-230 ml were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml). Wash the organic layer with water (2 × 10
After drying over anhydrous sodium sulfate and concentrating under reduced pressure, Compound 70 (7.1 mg) was obtained as a yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.88 (0.7H, s), 12.84 (0.3
H, s), 7.40 (5H, m), 7.14 (0.7H, s), 7.04 (0.3H,
s), 5.20 (0.7H, s), 4.99 (0.3H, s), 4.06 (0.9H,
s), 4.02 (2.1H, s), 2.65 (3H, s)

[0206]

Example 60 Compound 59 (10 mg) was suspended in pyridine (2.0 ml), sodium borohydride (10 mg) was added, and the mixture was stirred at room temperature for 30 minutes. There 2-bromopropionic acid (Wako Pure Chemical Industries, Ltd.) (6 μl)
Was added and stirred at room temperature for 30 minutes. The reaction mixture was concentrated under reduced pressure, the obtained residue was suspended in ethyl acetate (30 ml), and 0.02 M hydrochloric acid (2 × 10 ml) and water (2 × 10
ml) and saturated saline (5 ml). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The resulting residue was separated by preparative high performance liquid chromatography [column;
YMC-Pack ODS SH-343-5, mobile phase; 65% (V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10 ml / min], and fractionated in 10 ml portions. Fractions 21 and 2
The two were combined and concentrated under reduced pressure to remove acetonitrile, followed by extraction with ethyl acetate (15 ml). The organic layer is washed with water (2x
5 ml) and saturated saline (3 ml).
After drying over anhydrous sodium sulfate and concentration under reduced pressure, compound 71 (3.9 mg) was obtained as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.06 (0.5H, s), 13.05
(0.5H, s), 7.05 (0.5H, s), 7.03 (0.5H, s), 4.02-3.8
5 (4H, m), 2.58 (3H, s), 1.34-1.22 (3H, m)

[0207]

Example 61 Compound 68 (13 mg) was added to DMF (2.0
ml), sodium azide (3.8 mg, Wako Pure Chemical Industries) and ammonium chloride (3.1 mg) were added, and the mixture was stirred at 127 ° C for 13 hours. Ethyl acetate (30 ml) was added to the reaction mixture, and the mixture was washed with 0.01 M hydrochloric acid and saturated saline (2 × 10 ml). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is subjected to preparative high performance liquid chromatography [column; D-ODS-5
YMC (YMC), mobile phase: 52% (V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10 ml / min], fractions having an elution volume of 220 to 320 ml were collected, and the After concentration to remove acetonitrile, ethyl acetate (30 m
Extracted in l). The organic layer was washed with water (2 × 10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure.
Compound 72 (10 mg) was obtained as a yellow powder. ¹ H NMR, Pyridine-d ₅ , δ ppm; 7.12 (1H, s), 4.93 (1
H, d, J = 14.9 Hz), 4.79 (1H, d, J = 14.9 Hz), 4.0
7 (3H, s), 2.47 (3H, s)

[0208]

Example 62 Compound 59 (20 mg) was suspended in pyridine (1.0 ml), and sodium borohydride (2 mg) was added.
0 mg) and stirred at room temperature for 30 minutes. Α-Bromo-o-tolunitrile (20 mg, manufactured by Aldrich) was added to the reaction mixture, followed by stirring at room temperature for 1 hour. After concentrating the reaction mixture, ethyl acetate (30 ml) was added, and the mixture was washed with 0.02 M hydrochloric acid (3 × 10 ml) and saturated saline (2 × 10 ml). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was subjected to preparative high performance liquid chromatography [column; D-ODS-5 YMC, mobile phase; 72% (V /
V) Acetonitrile water (containing 0.05% TFA), flow rate: 10 ml
/ Min], fractions having an elution volume of 180-260 ml were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml). Wash the organic layer with water (3x10m
1), dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain Compound 73 (20 mg) as a yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.87 (1H, s), 7.70 (1H, d
d, J = 8.8, 2.1 Hz), 7.40 (2H, m), 7.14 (1H, dd, J
= 8.6, 1.7 Hz), 7.06 (1H, s), 4.19 (2H, m), 4.09
(3H, s), 2.65 (3H, s)

[0209]

Example 63 Compound 59 (20 mg) was suspended in pyridine (2.0 ml), and sodium borohydride (2 mg) was added.
0 mg) and stirred at room temperature for 30 minutes. To the reaction mixture was added 3- (bromomethyl) benzoic acid methyl ester (23 m
g, manufactured by Lancaster Corp.) and stirred at room temperature for 1 hour.
After concentrating the reaction mixture, ethyl acetate (30 ml) was added.
0.02 M hydrochloric acid (3 × 10 ml) and saturated saline (2
× 10 ml), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was subjected to preparative high performance liquid chromatography [column: D-ODS-5 YMC, mobile phase: 72% (V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10 ml / min]. , Elution volume 290-3
A 70 ml fraction was collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (50 ml). The organic layer was washed with water (3 × 20 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain Compound 74 (19 mg) as a yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.90 (1H, s), 7.94 (1H, d
t, J = 7.5, 1.5 Hz), 7.84 (1H, br t, J = 1.5 Hz),
7.28 (2H, m), 7.01 (1H, s), 4.11 (3H, s), 4.05 (1
H, d, J = 12.5 Hz), 3.99 (1H, d, J = 12.5 Hz), 3.8
8 (3H, s), 2.66 (3H, s)

[0210]

Example 64 Compound 59 (10 mg) was suspended in pyridine (2.0 ml), and sodium borohydride (1 mg) was added.
0 mg) and stirred at room temperature for 30 minutes. (±) -Bromosuccinic acid (9.8 mg, manufactured by Aldrich) was added to the reaction mixture, and the mixture was stirred at room temperature for 16 hours. After further adding sodium borohydride (10 mg) to the reaction solution and stirring at room temperature for 20 minutes, (±) -bromosuccinic acid (5.0 mg) was added and the mixture was stirred at room temperature for 2 hours. After concentrating the reaction mixture, ethyl acetate (30 ml) was added, and 0.02 M hydrochloric acid (3 × 10 m
1) and saturated saline (2 × 10 ml), the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is separated by preparative high performance liquid chromatography.
[Column: D-ODS-5 YMC, mobile phase: 52% (V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10 ml / min], and fractions having an elution volume of 220 to 240 ml were collected. After concentration under reduced pressure to remove acetonitrile, ethyl acetate (30 m
Extracted in l). The organic layer was washed with water (2 × 10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure.
Compound 75 (2.3 mg) was obtained as a yellow powder. ¹ H NMR, Pyridine-d ₅ , δ ppm; 7.23 (1H, s), 5.10 (1
H, m), 4.20 (1.5H, s), 4.15 (1.5H, s), 3.72 (1H,
m), 3.48 (1H, m), 2.48 (3H, s)

[0211]

Example 65 Compound 59 (10 mg) was suspended in pyridine (2.0 ml), sodium borohydride (10 mg) was added, and the mixture was stirred at room temperature for 30 minutes. Thereto was added 2-bromoethylamine-N-benzenesulfonamide (17 mg) obtained in Reference Example 4, and the mixture was stirred at room temperature for 1 hour. The residue obtained by concentrating the reaction mixture under reduced pressure was suspended in ethyl acetate (30 ml), and washed with 0.02 M hydrochloric acid (2 × 10 ml), water (2 × 10 ml), and saturated saline (5 ml). The organic layer was dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting residue was subjected to preparative high performance liquid chromatography [column;
3-5, mobile phase; 75% (V / V) acetonitrile water (0.05% TFA
Contained), flow rate: 10 ml / min], and fractionated 10 ml at a time. Fractions 20 and 21 were combined and concentrated under reduced pressure to remove acetonitrile, followed by ethyl acetate (15 ml)
Extracted. The organic layer was washed with water (3 × 5 ml) and saturated saline (3 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain Compound 76 (13 mg) as a pale yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.80 (1H, s), 7.88-7.81 (2
H, m), 7.57-7.43 (3H, m), 7.17 (1H, s), 5.53 (1H,
m), 4.08 (3H, s), 3.24-2.83 (4H, m), 2.64 (3H, s)

[0212]

Example 66 Compound 59 (10 mg) was suspended in pyridine (2.0 ml), sodium borohydride (10 mg) was added, and the mixture was stirred at room temperature for 30 minutes. Thereto, 2-bromoethylamine-N-methanesulfonamide (14 mg) obtained in Reference Example 5 was added, and the mixture was added at room temperature for 30 minutes.
Stirred for minutes. The residue obtained by concentrating the reaction mixture under reduced pressure was suspended in ethyl acetate (30 ml), and washed with 0.02 M hydrochloric acid (2 × 10 ml), water (2 × 10 ml), and saturated saline (5 ml). The organic layer was dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting residue was subjected to preparative high performance liquid chromatography [column: YMC-Pack ODS SH-343-
5, mobile phase: 55% (V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10 ml / min], and fractionated in 10 ml portions. Fractions 43 to 49 were combined and concentrated under reduced pressure to remove acetonitrile, followed by extraction with ethyl acetate (15 ml). The organic layer was washed with water (3 × 5 ml) and saturated saline (3 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain Compound 77 (10 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.00 (1H, s), 7.08 (1H,
s), 7.05 (1H, m), 3.93 (3H, s), 3.08-2.90 (4H, m),
2.86 (3H, s), 2.57 (3H, s)

[0213]

Example 67 Compound 59 (10 mg) was added to DMF (1.0
ml) and sodium borohydride (4.0 m
g) was added and the mixture was stirred at room temperature for 15 minutes. 2- in the reaction mixture
Hydroxy-5-nitrobenzyl bromide (4.6 m
g, manufactured by Tokyo Chemical Industry Co., Ltd.) and stirred at room temperature for 30 minutes. The reaction mixture was further added with sodium borohydride (2.0 mg) and stirred at room temperature for 30 minutes.
Add nitrobenzyl bromide (46 mg) and add 30
Stirred for minutes. After adding ethyl acetate (30 ml) to the reaction mixture and washing with 0.02 M hydrochloric acid (3 × 10 ml), the organic layer was washed with 2% aqueous sodium hydrogen carbonate (2 × 15 ml).
Extracted in l). After adjusting the pH of the obtained aqueous layer to 2.0, it was extracted again with ethyl acetate (30 ml), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is subjected to preparative high performance liquid chromatography [column; D-OD
S-5 YMC, mobile phase; 62% (V / V) acetonitrile water (0.05%
TFA containing), flow rate: 10 ml / min] and an elution volume of 29
The 5-325 ml fraction was collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml).
The organic layer was washed with water (2 × 10 ml), dried over anhydrous sodium sulfate and concentrated under reduced pressure to give compound 78 (3.0).
mg) as a yellow powder. _{^{1 H NMR, Pyridine-d 5}} , δ ppm; 8.36 (1
H, d, J = 2.8 Hz), 8.12
(1H, dd, J = 8.9, 2.8 Hz),
7.26 (1H, s), 7.07 (1H,
d, J = 8.9 Hz), 4.69 (1H,
d, J = 12.7 Hz), 4.56 (1
H, d, J = 12.7 Hz), 4.11
(3H, s), 2.46 (3H, s)

[0214]

Example 68 Compound 59 (10 mg) was added to DMF (2.
0 ml) and sodium borohydride (10 m
g) was added and the mixture was stirred at room temperature for 15 minutes. Α,
3,5-tribromo-2-hydroxytoluene (20 m
g, manufactured by Tokyo Chemical Industry Co., Ltd.) and stirred at room temperature for 30 minutes. Α, 3,5-Tribromo-2-hydroxytoluene (100 mg) was further added to the reaction solution, and the mixture was stirred at room temperature for 15 minutes. Ethyl acetate (30 ml) was added to the reaction mixture.
02M hydrochloric acid (3 × 10 ml) and saturated saline (2 × 1
0 ml), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was subjected to preparative high performance liquid chromatography [column: D-ODS-5 YMC, mobile phase: 77% (V / V) acetonitrile water (containing 0.05% TFA),
Flow rate; 10 ml / min] and an elution volume of 250-290 m
1 fractions were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (20 ml). The organic layer was washed with water (3 × 10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain compound 79 (3.7 mg) as a yellow powder. ¹ H NMR, Pyridine-d ₅ , δ ppm; 7.70 (1H, d, J = 2.4
Hz), 7.40 (1H, d, J = 2.4 Hz), 7.20 (1H, s), 4.62
(1H, d, J = 12.6 Hz), 4.46 (1H, d, J = 12.6 Hz),
4.13 (3H, s), 2.47 (3H, s)

[0215]

Example 69 Compound 59 (10 mg) was suspended in pyridine (2.0 ml), and sodium borohydride (1 mg) was added.
0 mg) and stirred at room temperature for 15 minutes. To the reaction mixture was added α-chloro-α-deoxykojic acid (12 mg) obtained in Reference Example 6, and the mixture was stirred at room temperature for 1.5 hours. The reaction mixture was concentrated and ethyl acetate (30 ml) was added.
M hydrochloric acid (3 × 10 ml) and saturated saline (2 × 10 m
After washing in 1), the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was subjected to preparative high performance liquid chromatography [column; D-ODS-5 YMC, mobile phase; 52%
(V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10
ml / min], fractions having an elution volume of 250-300 ml were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml). Wash the organic layer with water (3x1
After drying over anhydrous sodium sulfate and concentrating under reduced pressure, compound 80 (6.0 mg) was obtained as a yellow powder. ¹ H NMR, Pyridine-d ₅ , δ ppm; 8.20 (1H, s), 7.20 (1
H, s), 6.53 (1H, s), 4.35 (1H, d, J = 14.0 Hz), 4.1
4 (1H, d, J = 14.0 Hz), 4.13 (3H, s), 2.48 (3H, s)

[0216]

Example 70 Compound 73 (5.0 mg) was suspended in 75% sulfuric acid (2.5 ml) and stirred at 110 ° C. for 1 hour.
Ethyl acetate (30 ml) was added to the reaction solution, and the mixture was washed with water (3 × 1).
After that, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain Compound 81 (5.0 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.22 (1H, s), 7.66 (1H,
br s), 7.44 (1H, brs), 7.41 (1H, m), 7.28 (3H, m),
7.00 (1H, s), 4.28 (2H, s), 2.59 (3H, s)

[0219]

Example 71 Compound 81 (2.0 mg) was suspended in ethyl acetate (2.5 ml), and methanol (200 μl) was added.
And a 2.0 M hexane solution of (trimethylsilyl) diazomethane (manufactured by Tokyo Chemical Industry Co., Ltd.) (300 μl) were added, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure, and the resulting residue was subjected to silica gel column chromatography (4.
After washing with chloroform, the fraction eluted with chloroform / methanol (100: 1) was collected and concentrated to dryness to obtain Compound 82 (2.0 mg) as a pale yellow powder. ¹ H NMR, Pyridine-d ₅ + D ₂ O, δ ppm; 7.72
(1H, d, J = 7.7 Hz), 7.43
(1H, d, J = 7.7 Hz), 7.36
(1H, t, J = 7.7 Hz), 7.2
9 (1H, s), 7.22 (1H, t, J
= 7.7 Hz), 4.97 (1H, d, J
= 12.9 Hz), 4.67 (1H, d,
J = 12.9 Hz), 4.11 (3H,
s), 4.07 (3H, s), 2.57 (3
H, s)

[0218]

Example 72 Compound 59 (15 mg) was suspended in pyridine (2.0 ml), and sodium borohydride (1 mg) was added.
5 mg) and stirred at room temperature for 30 minutes. To the reaction mixture was added 5- (2-bromomethyl) phenyltetrazole (20 mg) obtained in Reference Example 7, and the mixture was stirred at room temperature for 1 hour. After concentration of the reaction mixture, the resulting residue was added to ethyl acetate (3.
0 ml) and washed with 0.02 M hydrochloric acid (2 × 10 ml), and the organic layer was washed with 2% aqueous sodium hydrogen carbonate (2 × 10 ml).
15 ml). After adjusting the pH of the obtained aqueous layer to 2.0, it was extracted again with ethyl acetate (30 ml), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was subjected to preparative high performance liquid chromatography [column;
D-ODS-5 YMC, mobile phase; 67% (V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10 ml / min], fractions having an elution volume of 220 to 270 ml were collected, and concentrated under reduced pressure. After removing acetonitrile, ethyl acetate (30 m
Extracted in l). The organic layer was washed with water (3 × 10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure.
Compound 83 (3.0 mg) was obtained as a yellow powder. ¹ H NMR, Pyridine-d ₅ + D ₂ O, δ ppm; 8.26 (1H, d, J =
7.2 Hz), 7.59 (1H, d, J = 7.2 Hz), 7.41 (2H, m),
7.26 (1H, s), 5.12 (1H, d, J = 12.0 Hz), 4.84 (1H,
d, J = 12.0 Hz), 4.01 (3H, s), 2.48 (3H, s)

[0219]

Example 73 Compound 59 (10 mg) was suspended in pyridine (2.0 ml), and sodium borohydride (1 mg) was added.
0 mg) and stirred at room temperature for 15 minutes. To the reaction mixture was added 3- (bromomethyl) benzoic acid methoxymethyl ester (13 mg) obtained in Reference Example 8, and the mixture was stirred at room temperature for 1 hour. After concentrating the reaction mixture, ethyl acetate (30 ml) was added, washed with 0.02 M hydrochloric acid (2 × 10 ml), and the organic layer was washed with 2% aqueous sodium hydrogen carbonate (2 × 10 m
Extracted in l). After correcting the pH of the obtained aqueous layer to 2.0, it was extracted again with ethyl acetate (20 ml), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is subjected to preparative high performance liquid chromatography [column; D-OD
S-5 YMC, mobile phase; 65% (V / V) acetonitrile water (0.05%
TFA containing), flow rate: 10 ml / min], and an elution volume of 190
A -240 ml fraction was collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml). The organic layer was washed with water (2 × 10 ml), dried over anhydrous sodium sulfate and concentrated under reduced pressure to give Compound 84 (2.3 m
g) was obtained as a yellow powder. ¹ H NMR, Pyridine-d ₅ , δ ppm; 8.51 (1H, s), 8.28 (1
H, d, J = 7.6 Hz), 7.67 (1H, d, J = 7.6 Hz), 7.43
(1H, t, J = 7.6 Hz), 7.24 (1H, s), 4.62 (1H, d, J
= 12.5 Hz), 4.43 (1H, d, J = 12.5 Hz), 4.16 (3H,
s), 2.46 (3H, s)

[0220]

Example 74 Compound 59 (15 mg) was suspended in pyridine (2.0 ml), and sodium borohydride (1 mg) was added.
5 mg) and stirred at room temperature for 15 minutes. To the reaction mixture, 2- (bromomethyl) benzoic acid methoxymethyl ester (19 mg) obtained in Reference Example 9 was added, and the mixture was stirred at room temperature for 2 hours. Ethyl acetate (30 ml) was added to the reaction mixture,
0.02 M hydrochloric acid (2 × 10 ml) and saturated saline (2
× 10 ml), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue was subjected to preparative high performance liquid chromatography [column: D-ODS-5 YMC, mobile phase: 70% (V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10 ml / min]. , Elution volume 150-2
10 ml fractions were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml). The organic layer was washed with water (2 × 10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain Compound 85 (12 mg) as a yellow powder. ¹ H NMR, Pyridine-d ₅ + D ₂ O, δ ppm; 8.31 (1H, dd, J
= 7.0, 2.0 Hz), 7.42 (1H, dd, J = 7.0, 2.0 Hz), 7.3
7 (1H, dt, J = 2.0, 7.0 Hz), 7.35 (1H, s), 7.32 (1
H, dt, J = 2.0, 7.0 Hz), 5.19 (1H, d, J = 12.5 H
z), 5.09 (1H, d, J = 12.5 Hz), 4.00 (3H, s), 2.50
(3H, s)

[0221]

Example 75 Compound 59 (10 mg) was dissolved in pyridine (1.0 ml), sodium borohydride (4.7 mg) was added, and the mixture was stirred at room temperature for 30 minutes.
2-Picolyl chloride hydrochloride (10.2 mg, manufactured by Tokyo Chemical Industry Co., Ltd.) was added, and the mixture was stirred for 30 minutes. After the reaction mixture was concentrated under reduced pressure, the residue was suspended in ethyl acetate (20 ml), 0.1 M hydrochloric acid (10 ml) and water (3 × 10 m
Washed in l). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is separated by preparative high performance liquid chromatography [column: YMC-Pack ODS SH-34
3-5, mobile phase; 55% (V / V) acetonitrile water (0.05% TFA
Contained), flow rate: 10 ml / min], and fractionated 10 ml at a time. Fractions 16 and 17 were combined and concentrated under reduced pressure, and the resulting suspension (8 ml) was diluted with ethyl acetate (20 ml).
Extracted in l). The organic layer was washed with water (2 × 10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain Compound 86 (6.5 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.00 (1H, s), 8.46 (1H,
br d, J = 4.4 Hz), 7.77 (1H, dt, J = 1.6, 7.6 Hz),
7.29 (2H, m), 7.07 (1H, s), 4.23 (1H, d, J = 13.3 H
z), 4.17 (1H, d, J = 13.3 Hz), 3.76 (3H, s), 2.58
(3H, s)

[0222]

Example 76 Compound 1 (20 mg) was suspended in dichloromethane (2.0 ml), and WSC (17 mg) and 4-
Dimethylaminopyridine (12 mg) and benzenesulfonamide (Wako Pure Chemical Industries, Ltd.) (16 mg) were added, and the mixture was stirred at room temperature for 15 hours. The residue obtained by concentrating the reaction mixture under reduced pressure was suspended in ethyl acetate (30 ml).
It was washed with 02M hydrochloric acid (10 ml), water (2 × 10 ml) and saturated saline (5 ml). The organic layer was dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The resulting residue was subjected to preparative high performance liquid chromatography [column: YMC-Pack ODS S
H-343-5, mobile phase; 70% (V / V) acetonitrile water (0.05%
TFA), flow rate: 10 ml / min], and fractionated 10 ml at a time. Fractions 22 to 25 were combined and concentrated under reduced pressure to remove acetonitrile.
Extracted in l). The organic layer was washed with water (3 × 5 ml) and saturated saline (5 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give compound 87 (15 mg).
Was obtained as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 12.99 (1H, s), 12.30 (1H,
br), 7.88 (2H, m), 7.70-7.52 (3H, m), 7.03 (1H,
s), 3.86 (3H, s), 3.68-3.51 (2H, m), 2.58 (3H, s)

[0223]

Example 77 Compound 1 (20 mg) was suspended in dichloromethane (2.0 ml), and WSC (18 mg), 4-
Dimethylaminopyridine (13 mg) and methanesulfonamide (manufactured by Wako Pure Chemical Industries) (43 mg) were added, and the mixture was refluxed for 2 hours. The reaction mixture was dissolved in ethyl acetate (30 ml), and 0.02 M hydrochloric acid (10 ml), water (2 × 10 m
l) and saturated saline (5 ml). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The resulting residue was separated by preparative high performance liquid chromatography [column: YM
C-Pack ODS SH-343-5, mobile phase; 70% (V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10 ml / min],
Each 10 ml was fractionated. Fraction 16 was concentrated under reduced pressure to remove acetonitrile, and then extracted with ethyl acetate (15 ml). The organic layer was washed with water (3 × 5 ml) and saturated brine (5 ml), dried over anhydrous sodium sulfate, ¹ H NMR, which reduced pressure to concentrate the compound 88 (6.6 mg) as a pale yellow powder, DMSO-d ₆ , δ ppm; 12.99 (1H, s), 7.07 (1H,
s), 3.92 (3H, s), 3.64 (1H, d, J = 14.4 Hz), 3.58
(1H, d, J = 14.4 Hz), 3.19 (3H, s), 2.58 (3H, s)

[0224]

Example 78 Compound 1 (15 mg) was suspended in dichloromethane (2.0 ml), and WSC (9.2 mg), 4-dimethylaminopyridine (6.0 mg) and p-toluenesulfonamide (8.2 mg, total (Manufactured by Kojun Pharmaceutical Co., Ltd.), and the mixture was stirred at room temperature for 2.5 hours, and then stirred at 40 ° C. for 2 hours. Further, p-toluenesulfonamide (4.1 mg)
Was added and stirred at 40 ° C. for 2 hours. Ethyl acetate (30 ml) was added to the reaction mixture, and the mixture was washed with 0.01 M hydrochloric acid and water (2 × 10 ml), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is subjected to preparative high performance liquid chromatography [column; D-ODS-5 YM
C, mobile phase: 72% (V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10 ml / min], elution volume 150-2.
Fractions of 00 ml were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml). The organic layer was washed with water (3 × 10 ml), dried over anhydrous sodium sulfate and concentrated under reduced pressure to give compound 89 (5.8 mg).
Was obtained as a yellow powder. ¹ H NMR, Pyridine-d ₅ , δ ppm; 8.30 (2H, d, J = 8.2
Hz), 7.13 (2H, d, J = 8.2 Hz), 7.11 (1H, s), 4.20
(1H, d, J = 14.6 Hz), 4.13 (3H, s), 4.03 (1H, d, J
= 14.6 Hz), 2.48 (3H, s), 2.10 (3H, s)

[0225]

Example 79 Compound 1 (15 mg) was suspended in dichloromethane (3.0 ml), and WSC (14 mg), 4-dimethylaminopyridine (9.2 mg) and naphthalene-
2-Sulfonamide (17 mg, manufactured by Lancaster) was added, and the mixture was stirred at 40 ° C for 15 hours. Ethyl acetate (30 ml) was added to the reaction mixture, and the mixture was washed with 0.01 M hydrochloric acid and saturated saline (2 × 10 ml), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is subjected to preparative high performance liquid chromatography [column; D-OD
S-5 YMC, mobile phase; 70% (V / V) acetonitrile water (0.05%
TFA containing), flow rate: 10 ml / min] and an elution volume of 23
Fractions of 0-300 ml were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml).
The organic layer was washed with water (3 × 10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give compound 90 (16 m
g) was obtained as a yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.72 (1H, s), 8.54 (1H,
s), 7.92 (1H, dd, J = 7.0, 2.1 Hz), 7.80 (3H, m),
7.55 (2H, m), 6.59 (1H, s), 4.05 (3H, s), 3.75 (1
H, d, J = 15.8 Hz), 3.57 (1H, d, J = 15.8 Hz), 2.6
4 (3H, s)

[0226]

Example 80 Compound 1 (15 mg) was suspended in dichloromethane (3.0 ml), and WSC (14 mg), 4-dimethylaminopyridine (9.2 mg) and 4-chlorobenzenesulfonamide (16 mg, manufactured by Aldrich)
Was added and stirred at 40 ° C. for 15 hours. Ethyl acetate (30 ml) was added to the reaction mixture, and the mixture was washed with 0.01 M hydrochloric acid and saturated saline (2 × 10 ml), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is subjected to preparative high performance liquid chromatography [column; D-OD
S-5 YMC, mobile phase; 70% (V / V) acetonitrile water (0.05%
TFA containing), flow rate: 10 ml / min] and an elution volume of 23
Fractions of 0-300 ml were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml).
The organic layer was washed with water (3 × 10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give Compound 91 (15 m
g) was obtained as a yellow powder. ¹ H NMR, Pyridine-d ₅ , δ ppm; 8.35 (2H, d, J = 8.6
Hz), 7.38 (2H, d, J = 8.6 Hz), 7.13 (1H, s), 4.21
(1H, d, J = 14.9 Hz), 4.11 (3H, s), 4.07 (1H, d, J
= 14.9 Hz), 2.48 (3H, s)

[0227]

Example 81 Compound 1 (15 mg) was suspended in dichloromethane (3.0 ml), and WSC (14 mg), 4-dimethylaminopyridine (9.2 mg) and 4-nitrobenzenesulfonamide (17 mg, manufactured by Aldrich)
Was added and stirred at room temperature for 4 hours. Ethyl acetate (30 ml) was added to the reaction mixture, and the mixture was washed with 0.02 M hydrochloric acid and saturated saline (2 × 10 ml), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is subjected to preparative high performance liquid chromatography [column; D-ODS-5
YMC, mobile phase; 65% (V / V) acetonitrile water (0.05% TFA
Contained), a flow rate of 10 ml / min], and an elution volume of 230-
290 ml fractions were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml). The organic layer was washed with water (3 × 10 ml), dried over anhydrous sodium sulfate and concentrated under reduced pressure to give compound 92 (17 mg).
Was obtained as a yellow powder. _{^{1 H NMR, Pyridine-d 5}} , δ ppm; 8.59 (2
H, d, J = 8.8 Hz), 8.20
(2H, d, J = 8.8 Hz), 7.16
(1H, s), 4.15 (1H, d, J =
15.7 Hz), 4.09 (3H, s),
4.07 (1H, d, J = 15.7 H
z), 2.48 (3H, s)

[0228]

Example 82 Compound 1 (15 mg) was suspended in dichloromethane (3.0 ml), and WSC (14 mg), 4-dimethylaminopyridine (9.2 mg) and trifluoromethanesulfonamide (13 mg, manufactured by Tokyo Chemical Industry Co., Ltd.) were added. The mixture was stirred at room temperature for 30 minutes. Ethyl acetate (30 ml) was added to the reaction mixture, and the mixture was washed with 0.01 M hydrochloric acid and saturated saline (2 × 10 ml), and the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is subjected to preparative high performance liquid chromatography [column; D-ODS-5
YMC, mobile phase; 70% (V / V) acetonitrile water (0.05% TFA
Contained), a flow rate of 10 ml / min] and an elution volume of 100-
180 ml fractions were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (30 ml). The organic layer was washed with water (3 × 10 ml), dried over anhydrous sodium sulfate and concentrated under reduced pressure to give Compound 93 (8.9 m
g) was obtained as a yellow powder. ¹ H NMR, Pyridine-d ₅ , δ ppm; 7.16 (1H, s), 4.26 (1
H, d, J = 14.5 Hz), 4.03 (1H, d, J = 14.5 Hz), 4.01
(3H, s), 2.48 (3H, s)

[0229]

Example 83 Compound 1 (15 mg) was added to DMF (1.5 m
1), added with WSC (9.4 mg), stirred at room temperature for 1 hour, and then hydroxylammonium sulfate (4.
0 mg, manufactured by Wako Pure Chemical Industries, Ltd.) and stirred at room temperature for 16 hours. The reaction mixture was diluted with ethyl acetate (10 ml) and washed with 0.1 M hydrochloric acid (5 ml) and water (2 × 5 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is separated by preparative high performance liquid chromatography [column: YMC-Pack ODS SH-343-5,
Mobile phase: 60% (V / V) acetonitrile water (containing 0.05% TFA), flow rate: 10 ml / min], and fractionated in 10 ml portions. Fractions 20 to 24 were combined and concentrated under reduced pressure to obtain Compound 94 (12 mg) as a pale yellow powder. _{^{1 H NMR, DMSO-d 6}} , δ ppm; 13.01 (1
H, s), 12.49 (1H, br), 1
0.65 (1H, s), 9.00 (1H, b
r), 7.09 (1H, s), 3.91 (3
H, s), 3.44 (2H, s), 2.59
(3H, s)

[0230]

Example 84 Compound 1 (15 mg) was added to DMF (1.5 mg).
ml) and added with WSC (9.4 mg).
After stirring for an hour, O-methylhydroxylammonium chloride (4.1 mg, Wako Pure Chemical Industries, Ltd.) was added, and the mixture was stirred at room temperature for 16 hours. The reaction mixture was treated with ethyl acetate (10
ml) and washed with 0.1 M hydrochloric acid (5 ml) and water (2 × 5 ml). Next, the organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The obtained residue is subjected to preparative high performance liquid chromatography [column; YMC-Pack
ODS SH-343-5, mobile phase; 65% (V / V) acetonitrile water (containing 0.05% TFA), flow rate;
Each fraction was fractionated by ml. Fractions 22 to 25 were combined and concentrated under reduced pressure to obtain Compound 95 (14 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.03 (1H, s), 12.40 (1H,
br), 11.16 (1H, br), 7.06 (1H, s), 3.90 (3H, s),
3.55 (3H, s), 3.37 (2H, s), 2.58 (3H, s)

[0231]

Example 85 Compound 5 (50 mg) was treated with acetic acid (9.5 m).
l), 30% aqueous hydrogen peroxide (0.5 ml) was added, and the mixture was stirred at 50 ° C for 45 minutes. The reaction mixture was concentrated, and the obtained residue was purified by preparative high performance liquid chromatography to obtain Compound 96 (52 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , 60 ° C, δ ppm; 12.96 (1H, br s),
7.01 (1H, s), 4.47-4.36 (1H, m), 3.85 (3H, s), 3.7
0-3.07 (2H, m), 2.58 (3H, s) SI-MS spectrum (M + N
a) ⁺ : m / z 527

[0232]

Example 86 Compound 5 (50 mg) was treated with formic acid (4.75).
ml) and 30% aqueous hydrogen peroxide (0.25 m
l) was added and the mixture was stirred at 60 ° C for 2 hours. The reaction mixture was concentrated, and the obtained residue was purified by preparative high performance liquid chromatography to obtain Compound 97 (44 mg) as a pale yellow powder. _{^{1 H NMR, DMSO-d 6}} , 60 ℃, δ ppm; 12.91 (1H, br s),
7.09 (1H, s), 4.48-4.41 (1H, m), 3.89 (3H, s), 3.8
8-3.68 (2H, m), 2.58 (3H, s) SI-MS spectrum (M + N
a) ⁺ : m / z 543

[0233]

Example 87 Compound 5 (100 mg) was added to DMF (10
ml), potassium carbonate (564 mg) and methyl iodide (254 μl) were added, and the mixture was stirred at room temperature for 7 hours. The reaction mixture was purified in the same manner as in Example 38 to obtain Compound 98 (88 mg) as a white powder. ¹ H NMR, CDCl ₃ , 50 ° C, δ ppm; 6.99 (1H, s), 4.30 (1
H, br), 4.09 (3H, s), 4.07 (3H, s), 3.95 (3H, s),
3.76 (1H, br), 3.71 (3H, s), 3.30 (1H, dd, J = 14.
0, 3.5 Hz), 3.12 (1H, br), 2.65 (3H, s) SI-MS spectrum (M + H) ⁺ : m / z 531

[0234]

Example 88 Compound 98 (17 mg) was added to formic acid (1.5%).
dissolved in 30% hydrogen peroxide solution (0.075m
l) was added and the mixture was stirred at room temperature for 3 hours. The reaction mixture was concentrated, and the obtained residue was purified by silica gel chromatography to obtain Compound 99 (17 mg) as a white powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 7.54 (1H, s), 5.90 (1H,
m), 4.46 (1H, m), 4.13 (3H, s), 3.88 (3H, s), 3.83
(3H, s), 3.77 (2H, m), 3.63 (3H, s), 2.62 (3H, s) SI-MS spectrum (M + H) ⁺ : m / z 563

[0235]

Example 89 Compound 5 (100 mg) was dissolved in ethanol (10 ml), concentrated sulfuric acid (40 μl) was added, and the mixture was stirred at room temperature for 5 hours. After concentration of the reaction mixture, the resulting residue was dissolved in ethyl acetate (30 ml) and washed with water (2 × 2
0 ml). The organic layer was concentrated and purified by preparative high performance liquid chromatography to obtain Compound 100 (98 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.03 (1H, s), 7.05 (1H,
s), 4.20-4.03 (3H, m), 3.91 (3H, s), 3.19-2.93 (2
H, m), 2.56 (3H, s), 1.18 (3H, m) SI-MS spectrum (M + H) ⁺ : m / z 517

[0236]

Example 90 Compound 98 (20 mg) was dissolved in pyridine (1.0 ml), acetic anhydride (0.1 ml) was added and the mixture was stirred at room temperature for 2 hours. After concentrating the reaction mixture, the obtained residue was purified by preparative high performance liquid chromatography to obtain Compound 101 (16 mg) as a white powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 7.37 (1H, s), 4.87 (1H,
m), 4.08 (3H, s), 3.88 (3H, s), 3.83 (3H, s), 3.64
(3H, br s), 3.30-3.10 (2H, m), 2.62 (3H, s), 1.96
(1.5H, br s), 1.94 (1.5H, br s) SI-MS spectrum (M + H) ⁺ : m / z 573

[0237]

Example 91 Compound 100 (20 mg) was added to DMF
(2.0 ml) and sodium hydrogen carbonate (33 m
g) and chloromethyl methyl ether (8.8 μl)
Was added and stirred at room temperature for 30 minutes. Ethyl acetate (20 ml) was added to the reaction mixture, and after washing with 0.1 M hydrochloric acid and water, the organic layer was concentrated. The obtained residue was purified by preparative high performance liquid chromatography to obtain Compound 102 (19 m
g) was obtained as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 12.88 (1H, s), 7.43 (1H,
s), 5.78 (1H, m), 5.59 (2H, s), 4.22-4.02 (3H, m),
3.92 (3H, s), 3.50 (3H, s), 3.22-2.95 (2H, m), 2.
60 (3H, s), 1.16 (3H, t, J = 7.2 Hz) SI-MS spectrum (M + H) ⁺ : m / z 561

[0238]

Example 92 Compound 5 (30 mg) was added to DMF (3.0).
ml), sodium hydrogen carbonate (52 mg) and chloromethyl methyl ether (14 μl) were added, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was purified in the same manner as in Example 91 to obtain Compound 103 (30 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 12.89 (1H, s), 7.44 (1H,
s), 5.88 (1H, m), 5.59 (2H, s), 5.27-5.15 (2H, m),
4.28-4.18 (1H, m), 3.93 (3H, s), 3.50 (3H, s), 3.
35 (3H, s), 3.25-2.98 (2H, m), 2.60 (3H, s) SI-MS spectrum (M + H) ⁺ : m / z 577

[0239]

Example 93 Compound 1 (50 mg) was treated with acetic acid (5.0 m).
l) and sodium nitrate (Wako Pure Chemical Industries, Ltd.) (1
1 mg) and stirred at 90 ° C. for 2 hours. The residue obtained by concentrating the reaction mixture under reduced pressure was treated with ethyl acetate (50 m
1) and washed with saturated saline (3 × 20 ml). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure. % TFA) at a flow rate of 10 ml / min] to obtain a yellow powder. The powder was further purified by silica gel chromatography (eluted with chloroform / methanol / formic acid) to give Compound 104 (6.3 mg).
Was obtained as a yellow powder. ¹ H NMR, CD ₃ OD, δ ppm; 3.99 (3H, s), 2.63 (3H, s) FAB-MS spectrum (MH) ^- : m / z 492

[0240]

Example 94 Compound 103 (15 mg) was dissolved in pyridine (1.0 ml), acetic anhydride (0.2 ml) was added, and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure to obtain a diacetate compound (16 mg) as a white powder. This powder was dissolved in TFA (1.0 ml) and allowed to stand at room temperature for 30 minutes. The reaction mixture was concentrated under reduced pressure, and the residue was purified by preparative high performance liquid chromatography to obtain Compound 105 (14 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.05 (1H, s), 12.85 (1H,
br), 7.06 (0.5H.s), 7.05 (0.5H, s), 4.75 (1H,
m), 3.88 (1.5H, s), 3.87 (1.5H, s), 3.40-3.10 (2H,
m), 2.58 (3H, s), 1.95 (1.5H, s), 1.91 (1.5H, s) SI-MS spectrum (M + H) ⁺ : m / z 531

[0241]

Example 95 The same operation as in Example 55 was carried out using compound 59 (100 mg), pyridine (10 ml), sodium borohydride (47 mg) and methyl iodide (39 μl) to give compound 106 (93 mg). Was obtained as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.04 (1H, s), 12.29 (1H,
br), 7.06 (1H, s), 3.92 (3H, s), 2.57 (3H, s), 2.3
2 (3H, s) SI-MS spectrum (M + H) ⁺ : m / z 415

[0242]

Example 96 Compound 106 (12 mg) was treated with acetic acid (1.
2%) and 30% hydrogen peroxide solution (0.06m
l) was added and the mixture was stirred at room temperature for 4 hours. The reaction mixture was concentrated under reduced pressure to obtain Compound 107 (12 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.01 (1H, s), 7.02 (1H,
s), 3.85 (3H, s), 2.94 (3H, s), 2.58 (3H, s) SI-MS spectrum (M + H) ⁺ : m / z 431

[0243]

Example 97 Compound 106 (20 mg) was treated with formic acid (2.
0%) and 30% aqueous hydrogen peroxide (0.1 ml)
Was added and stirred at 60 ° C. for 3 hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by preparative high performance liquid chromatography to obtain Compound 108 (19 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 12.99 (1H, s), 7.07 (1H,
s), 3.87 (3H, s), 3.33 (3H, s), 2.58 (3H, s) SI-MS spectrum (M + H) ⁺ : m / z 447

[0244]

Example 98 Compound 106 (20 mg) was added to DMF
(2.0 ml), potassium carbonate (67 mg) and methyl iodide (30 μl) were added, and the mixture was stirred at room temperature for 8 hours. Ethyl acetate (20 ml) was added to the reaction mixture, washed with water, and the organic layer was concentrated under reduced pressure. Next, the obtained residue was suspended in formic acid (2.0 ml), a 30% aqueous hydrogen peroxide solution (0.1 ml) was added, and the mixture was stirred at room temperature for 2 hours. The reaction mixture was concentrated under reduced pressure, and the residue was purified by preparative high performance liquid chromatography to obtain Compound 109 (21 mg) as a white powder. ¹ H NMR, CDCl ₃ , δ ppm; 7.14 (1H, s), 4.15 (3H, s),
4.09 (3H, s), 3.94 (3H, s), 3.27 (3H, s), 2.66 (3
H, s) SI-MS spectrum (M + H) ⁺ : m / z 475

[0245]

Example 99 Compound 1 (70 mg) was suspended in ethanol (7.0 ml), concentrated sulfuric acid (70 μl) was added, and the mixture was stirred at 80 ° C. for 4 hours. After concentrating the reaction mixture,
The obtained residue was dissolved in chloroform (20 ml) and washed with water (2 × 10 ml). The organic layer was concentrated and purified by preparative high performance liquid chromatography to obtain compound 110 (5
6 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.01 (1H, s), 7.06 (1H,
s), 3.98 (2H, q, J = 7.1 Hz), 3.90 (3H, s), 3.63 (1
H, d, J = 13.8 Hz), 3.56 (1H, d, J = 13.8Hz), 2.58
(3H, s), 1.06 (3H, t, J = 7.1 Hz) SI-MS spectrum (M + H) ⁺ : m / z 487

[0246]

Example 100 Compound 1 (100 mg) was added to DMF (1
0 ml), potassium carbonate (300 mg) and chloromethyl pivalate (313 μl, manufactured by Wako Pure Chemical Industries, Ltd.)
Was added and stirred at room temperature for 3 hours. The reaction mixture was treated in the same manner as in Example 91 to give compound 111 (78 m
g) was obtained as a pale yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.85 (1H, s), 8.72 (1H, b
r), 7.18 (1H, s), 5.79 (1H, d, J = 5.4 Hz), 5.76
(1H, d, J = 5.4 Hz), 4.07 (3H, s), 3.76 (1H, d, J =
17.4 Hz), 3.62 (1H, d, J = 17.4 Hz), 2.64 (3H,
s), 1.19 (9H, s) SI-MS spectrum (M + H) ⁺ : m / z 573

[0247]

Example 101 Compound 59 (100 mg) was suspended in chloroform (10 ml), and dithioerythritol (39 mg, manufactured by Wako Pure Chemical Industries) and triethylamine (35 μl) were added, followed by stirring at room temperature for 30 minutes. Ethyl bromopyruvate (125 μl, manufactured by Wako Pure Chemical Industries) was added to the reaction mixture, and the mixture was further stirred at room temperature for 30 minutes. After the reaction mixture was washed with 0.1 M hydrochloric acid and water, the obtained organic layer was concentrated and purified by preparative high performance liquid chromatography to obtain Compound 112 (111 mg) as a pale yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.84 (0.7H, s), 12.83 (0.3
H, s), 8.50 (0.3H, br s), 7.18 (1H, s), 4.82 (0.7
H, br s), 4.41 (1.4H, q, J = 7.2 Hz), 4.34 (0.6H,
q, J = 7.2 Hz), 4.27 (0.3H, d, J = 18.0 Hz), 4.17
(0.3H, d, J = 18.0 Hz), 4.08 (0.9H, s), 4.07 (2.1
H, s), 3.44 (0.7H, d, J = 13.5 Hz), 3.13 (0.7H, d,
J = 13.5 Hz), 2.64 (3H, s), 1.40 (2.1H, t, J = 7.
2 Hz), 1.36 (0.9H, t, J = 7.2 Hz) SI-MS spectrum (M + H) ⁺ : m / z 515

[0248]

Example 102 Compound 112 (30 mg) was suspended in methanol (5.0 ml) and ammonium acetate (45 mg) was added.
0 mg) and acetic acid (300 μl).
After stirring for an hour, sodium cyanoborohydride (5.5 mg, manufactured by Aldrich) was added, and the mixture was further stirred for 2 hours.
Stirred for hours. The reaction mixture was concentrated under reduced pressure, the residue was suspended in ethyl acetate (30 ml) and washed with water (3 × 20 ml). The organic layer was concentrated under reduced pressure, and the obtained residue was purified by preparative high performance liquid chromatography to obtain Compound 113 (2
3 mg) as a pale yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 13.00 (1H, br), 7.03 (1H,
s), 4.22 (2H, q, J = 7.1 Hz), 4.08 (1.2H, s), 4.07
(1.8H, s), 3.58 (1H, m), 3.34 (1H, m), 2.90 (1H,
m), 2.63 (3H, s), 1.29 (1.2H, t, J = 7.1 Hz), 1.28
(1.8H, t, J = 7.1 Hz) SI-MS spectrum (M + H) ⁺ : m / z 516

[0249]

Example 103 Compound 113 (15 mg) was suspended in ethanol (3.0 ml), 0.2 M aqueous sodium hydroxide (0.87 ml) was added, and the mixture was stirred at room temperature for 3 hours. 1.0 M hydrochloric acid (117 μl) was added to the reaction mixture,
After concentration under reduced pressure, the residue was subjected to preparative high performance liquid chromatography. The eluted fraction was concentrated under reduced pressure to remove acetonitrile, the pH was adjusted to 5.0, and Diaion HP
After desalting by column chromatography of -20 (10 ml), compound 114 (12 mg) was obtained as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.94 (1H, br), 6.34 (0.5
H, s), 6.30 (0.5H, s), 3.87 (1.5H, s), 3.86 (1.5H,
s), 2.94 (2H, br s), 2.54 (3H, s) SI-MS spectrum (M + H) ⁺ : m / z 488

[0250]

Example 104 Compound 1 (30 mg) was suspended in dichloromethane (4.0 ml), and WSC (28 mg) was added.
-Dimethylaminopyridine (18 mg) and 4-methoxybenzenesulfonamide (manufactured by Lancaster) (1
6 mg) and stirred at room temperature for 13 hours. The reaction mixture was purified in the same manner as in Example 76 to obtain Compound 11
5 (26 mg) was obtained as a yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.74 (1H, s), 7.89 (2H, d,
J = 8.9 Hz), 6.95 (1H, s), 6.90 (2H, d, J = 8.9 H
z), 4.06 (3H, s), 3.84 (3H, s), 3.72 (1H, d, J = 1
6.4 Hz), 3.56 (1H, d, J = 16.4 Hz), 2.61 (3H, s) SI-MS spectrum (M + H) ⁺ : m / z 628

[0251]

Example 105 Palladium (II) acetate (manufactured by Wako Pure Chemical Industries, Ltd.) (6.4 mg) and tris (2-methylphenyl) phosphine (manufactured by Tokyo Chemical Industry Co., Ltd.) (17.2 mg) were treated with 1,2-dimethoxyethane ( (Wako Pure Chemical Industries, Ltd.) (1.0 ml). 0.1 ml of this solution was added to Compound 40 (30
mg) in 1,2-dimethoxyethane (2.7 ml) and stirred at room temperature under an argon atmosphere for 15 minutes.
A 1.0 M aqueous sodium hydroxide solution (0.26 m
l) and phenylboric acid (Aldrich) (10
mg), and the mixture was refluxed for 3 hours under an argon atmosphere. The reaction mixture was concentrated under reduced pressure, and the obtained residue was treated with ethyl acetate (3.
0 ml) and washed with 0.05 M hydrochloric acid (10 ml), water (2 × 10 ml) and saturated saline (5 ml). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure, and the obtained residue was purified by preparative high performance liquid chromatography to obtain Compound 116 (13 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 12.92 (1H, s), 7.56-7.40
(5H, m), 3.95 (3H, s), 3.61 (2H, s), 2.49 (3H, s) SI-MS spectrum (M + H) ⁺ : m / z 535

[0252]

Examples 106 to 111 Compounds 117 to 121 and 124 were prepared in the same manner as in Example 105.
And a phenylborate derivative.

[Table 13]

¹ H NMR, DMSO-d ₆ , δ ppm; [Compound 117] 12.93 (1H, s), 7.42 (2H, d, J = 8
1 Hz), 7.31 (2H, d, J = 8.1 Hz), 3.95 (3H, s), 3.6
1 (2H, s), 2.50 (3H, s), 2.41 (3H, s) (Compound 118) 12.89 (1H, s), 8.07 (2H, d, J = 8.
3 Hz), 7.66 (2H, d, J = 8.3 Hz), 3.96 (3H, s), 3.6
1 (2H, s), 2.49 (3H, s) (Compound 119) 12.93 (1H, s), 8.12 (1H, br s), 8.
03 (1H, d, J = 8.5 Hz), 7.98 (2H, m), 7.66 (1H, d
d, J = 8.5, 1.6 Hz), 7.58 (2H, m), 3.96 (3H, s),
3.64 (2H, s), 2.46 (3H, s) (Compound 120) 12.90 (1H, s), 7.57 (4H, m), 3.95
(3H, s), 3.60 (2H, s), 2.50 (3H, s) (Compound 121) 12.92 (1H, s), 7.46 (2H, d, J = 8.
5 Hz), 7.06 (2H, d, J = 8.5 Hz), 3.94 (3H, s), 3.8
4 (3H, s), 3.61 (2H, s), 2.50 (3H, s) (Compound 124) 13.20 (1H, br), 7.28 (1H, m), 6.95
(2H, m), 6.87 (1H, m), 3.92 (3H, s), 3.52 (2H,
s), 2.50 (3H, s)

[0254]

Example 112 Compound 96 (102 mg) was suspended in 1,4-dioxane (Wako Pure Chemical Industries, Ltd.) (10 ml), and tetrabutylammonium periodate (Aldrich) (96 mg) was added. Refluxed for hours. A 10% aqueous solution of sodium thiosulfate (2 ml) was added to the reaction mixture, and the mixture was concentrated and extracted with ethyl acetate (100 ml). The organic layer was washed with water (3 × 25 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The obtained residue is subjected to preparative high performance liquid chromatography [column; YMC-Pack ODS SH-
343-5, mobile phase; 55% (V / V) acetonitrile water (0.05% T
FA containing), flow rate: 10 ml / min], and fractionated 10 ml at a time. Fractions 19 to 24 were collected, concentrated under reduced pressure to remove acetonitrile, and extracted with ethyl acetate (50 ml). The organic layer was washed with water (2 × 20 ml) and saturated saline (10 ml), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. Dichloromethane (50 ml) was added to the obtained residue, and the mixture was extracted with a 1.0 to 0.4% aqueous solution of sodium iodide (Wako Pure Chemical Industries, Ltd.) (3 × 50 ml). The aqueous layer was washed with dichloromethane (3x50ml) and ethyl acetate (50ml). After concentrating the obtained aqueous layer and correcting it to pH 5, Diaion HP-20 was used.
(100-200 mesh, 20 ml) was subjected to column chromatography, washed with water (80 ml) and 50% aqueous methanol (80 ml), and eluted with 50% aqueous methanol (20 ml) and 80% aqueous methanol (40 ml). . The eluate was concentrated and lyophilized to give compound 122
(18 mg) was obtained as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.12 (1H, s), 12.19 (1H,
br s), 7.13 (1H, s), 3.81 (3H, s), 2.57 (3H, s) SI-MS spectrum (M + Na) ⁺ : m / z 493

[0255]

Example 113 Compound 59 (30 mg) was added to DMF.
(3.0 ml), sodium borohydride (manufactured by Wako Pure Chemical Industries, Ltd.) (9 mg) was added, and the mixture was stirred at room temperature for 30 minutes. To this, 3-bromo-2- (bromomethyl) propionic acid (manufactured by Aldrich) (39 mg) was added, and the mixture was stirred at room temperature for 1 hour. Ethyl acetate (50 m
l) was added, and 0.05M hydrochloric acid (15 ml), water (2 × 1
5 ml) and saturated saline (10 ml).
The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure, and the obtained residue was purified by preparative high performance liquid chromatography to obtain Compound 123 (27 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.01 (1H, s), 7.06 (1H,
s), 5.87 (1H, s), 5.26 (1H, s), 3.83 (3H, s), 3.73
(1H, d, J = 13.2 Hz), 3.64 (1H, d, J = 13.2 Hz),
2.55 (3H, s) SI-MS spectrum (M + H) ⁺ : m / z 485

[0256]

Example 114 Compound 111 (12 mg) was suspended in acetic acid (2.4 ml), and 30% aqueous hydrogen peroxide (0.1%) was added.
12 ml) and stirred at 50 ° C. for 40 minutes. The residue obtained by concentrating the reaction mixture under reduced pressure was purified by preparative high performance liquid chromatography to obtain compound 133 (12 mg).
Was obtained as a pale yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.64 (1H, s), 11.53 (1H, b
r), 7.13 (1H, s), 5.88 (1H, d, J = 5.5 Hz), 5.84
(1H, d, J = 5.5 Hz), 4.30 (1H, d, J = 14.2Hz), 4.1
9 (1H, d, J = 14.2 Hz), 4.04 (3H, s), 2.66 (3H,
s), 1.22 (9H, s) SI-MS spectrum (M + H) ⁺ : m / z 589

[0257]

Example 115 Compound 40 (40 mg) was treated with acetic acid (5.
0 ml), sodium nitrite (manufactured by Wako Pure Chemical Industries, Ltd.) (9.4 mg) was added, and the mixture was stirred at 40 ° C for 1.5 hours. The residue obtained by concentrating the reaction mixture under reduced pressure was dissolved in ethyl acetate (30 ml), and saturated saline (2 × 10 m
Washed in l). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure, and the obtained residue was purified by preparative high performance liquid chromatography to obtain a yellow powder. The powder was further purified by silica gel chromatography (eluted with chloroform / methanol / formic acid) to give Compound 132.
(21 mg) was obtained as a yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.59 (1H, s), 3.85 (3H,
s), 3.59 (1H, d, J = 14.7 Hz), 3.51 (1H, d, J = 14.
7 Hz), 2.54 (3H, s) SI-MS spectrum (M + H) ⁺ : m / z 504

[0258]

Example 116 Compound 1 (30 mg) and literature [Th
e Journal of Antibiotics, 40, 87 (1987
Year)] cyclohexyl carbonate 1-
Iodoethyl (200 mg) was added to dichloromethane (3.0).
ml) and triethylamine (20 μl) under ice-cooling.
1) was added and refluxed for 1 hour. The reaction mixture was concentrated under reduced pressure, the resulting residue was dissolved in ethyl acetate (30 ml), 0.05 M hydrochloric acid (10 ml), 5% aqueous sodium thiosulfate (10 ml), water (2 × 10 ml) and saturated saline (5 ml). Was washed. The residue obtained by drying the organic layer over anhydrous sodium sulfate and concentrating under reduced pressure was purified by preparative high performance liquid chromatography to obtain compound 134.
(27 mg) was obtained as a pale yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.86 (1H, s), 8.79 (1H, b
r), 7.17 (1H, s), 6.74 (1H, q, J = 5.4 Hz), 4.62
(1H, m), 4.07 (3H, m), 3.72 (1H, m), 3.58 (1H, m),
2.64 (3H, s), 2.01-1.16 (10H, m), 1.51 (3H, m) SI-MS spectrum (M + H) ⁺ : m / z 629

[0259]

Example 117 Compound 132 (10 mg) was suspended in acetic acid (1.9 ml), and 30% aqueous hydrogen peroxide (0.1%) was added.
1 ml) and stirred at 50 ° C. for 2 hours. The reaction mixture was concentrated, and the obtained residue was purified by silica gel chromatography (eluted with chloroform / methanol / formic acid) to give Compound 135 (7.6 mg) as a yellow powder. ¹ H NMR, CD ₃ OD, 50 ° C, δ ppm; 4.25 (1H, d, J = 14.6
Hz), 4.11 (1H, d, J = 14.6 Hz), 3.92 (3H, br s),
2.60 (3H, s) SI-MS spectrum (M + H) ⁺ : m / z 520

[0260]

Example 118 Compound 72 (75 mg) was prepared in Example 11
Oxidation was performed in the same manner as in Example 4 to obtain Compound 136 (35 mg) as a yellow powder. ¹ H NMR, DMSO-d ₆ , 50 ° C, δ ppm; 12.99 (1H, s), 6.97
(1H, s), 4.89 (1H, d, J = 13.7 Hz), 4.79 (1H, d, J
= 13.7 Hz), 3.73 (3H, s), 2.59 (3H, s) SI-MS spectrum (M + H) ⁺ : m / z 499

[0261]

Example 119 Compound 88 (75 mg) was prepared in Example 11
Oxidation was performed in the same manner as in Example 4 to obtain Compound 137 (54 mg) as a yellow powder. ¹ H NMR, DMSO-d ₆ , 50 ° C, δ ppm; 12.95 (1H, s), 7.03
(1H, s), 4.28 (1H, d, J = 14.2 Hz), 4.17 (1H, d, J
= 14.2 Hz), 3.86 (3H, s), 3.25 (3H, s), 2.59 (3H,
s) SI-MS spectrum (M + H) ⁺ : m / z 552

[0262]

Example 120 Compound 134 (70 mg) was prepared in Example 1.
Oxidation was carried out in the same manner as for 14 to give compound 138 (71 mg)
Was obtained as a pale yellow powder. ¹ H NMR, CDCl ₃ , δ ppm; 12.64 (1H, s), 7.11 (1H,
m), 6.85 (1H, q, J = 5.4 Hz), 4.65 (1H, m), 4.30
(1H, m), 4.15 (1H, m), 4.04 (3H, m), 2.65 (3H, s),
2.02-1.16 (10H, m), 1.58 (3H, m) SI-MS spectrum (M + H) ⁺ : m / z 645

[0263]

Example 121 Compound 40 (30 mg) was added to DMF
(3.0 ml) and palladium (II) acetate
(0.6 mg) and tris (2-methylphenyl) phosphine (1.9 mg) were added to the solution at room temperature under an argon atmosphere.
Stir for 5 minutes. Tripotassium phosphate n-hydrate (manufactured by Wako Pure Chemical Industries, Ltd.) (57 mg) and 2-thiophene boric acid trimethylene glycol ester (18 mg) obtained in Reference Example 10 were added thereto, and the mixture was added at 100 ° C. under an argon atmosphere at 100 ° C.
Stirred for hours. The reaction mixture was suspended in ethyl acetate (30 ml), 0.1 M hydrochloric acid (2 × 10 ml), water (3 × 1
0 ml) and saturated saline (5 ml). The organic layer was dried over anhydrous sodium sulfate and concentrated under reduced pressure, and the residue obtained was purified by preparative high performance liquid chromatography to obtain Compound 126 (9.6 mg) as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.00 (1H, s), 7.76 (1H,
d, J = 5.1 Hz), 7.73 (1H, d, J = 3.7 Hz), 7.24 (1H,
dd, J = 5.1, 3.7 Hz), 3.94 (3H, s), 3.60 (2H, s),
2.53 (3H, s) FAB-MS spectrum (M + H) ⁺ : m / z 541

[0264]

Example 122 Palladium (II) acetate (20 mg) and tris (2-methylphenyl) phosphine (53 mg) were added to D
Dissolved in MF (2.0 ml). 0.1 of this solution.
2 ml of compound 40 (50 mg) in DMF (5.0 m
l) The solution was added, and the mixture was stirred at room temperature for 15 minutes under an argon atmosphere. Tripotassium phosphate n-hydrate (109m
g) and trimethylene glycol 3-thiophene borate (30 mg) obtained in Reference Example 11 were added,
The mixture was stirred at 100 ° C. for 2 hours under an argon atmosphere. Ethyl acetate (50 ml) was added to the reaction mixture, and the mixture was washed with 0.1 M hydrochloric acid (2 × 15 ml), water (2 × 15 ml), and saturated saline (10 ml). The residue obtained by drying the organic layer over anhydrous sodium sulfate and concentrating under reduced pressure was purified by preparative high performance liquid chromatography to obtain compound 127.
(18 mg) was obtained as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 12.94 (1H, s), 7.86 (1H,
m), 7.66 (1H, dd, J = 4.9, 3.0 Hz), 7.44 (1H, m),
3.94 (3H, s), 3.61 (2H, s), 2.54 (3H, s) SI-MS spectrum (M + H) ⁺ : m / z 541

[0265]

Example 123 Palladium (II) acetate (9.7 mg)
Tris (2-methylphenyl) phosphine (26.4m
g) was dissolved in 1,2-dimethoxyethane (2.0 ml). 0.2 ml of this solution was added to Compound 40 (50
mg) in 1,2-dimethoxyethane (5.0 ml) and stirred at room temperature for 15 minutes under an argon atmosphere.
To this, a 1.0 M aqueous sodium hydroxide solution (0.51 m
l) and benzo [b] furan-2-boric acid (manufactured by Lancaster) (28 mg) were added, and the mixture was refluxed for 1 hour under an argon atmosphere. The reaction mixture was concentrated under reduced pressure, the obtained residue was suspended in ethyl acetate (30 ml), and 0.1M hydrochloric acid (10 ml) was added.
ml), water (2 × 10 ml) and saturated saline (5 m
Washed in l). The residue obtained by drying the organic layer over anhydrous sodium sulfate and concentrating under reduced pressure was purified by preparative high performance liquid chromatography to obtain compound 128 (32 mg).
Was obtained as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 12.92 (1H, s), 7.77 (1H,
d, J = 7.4 Hz), 7.64 (1H, d, J = 8.0 Hz), 7.41 (1H,
s), 7.38 (1H, m), 7.31 (1H, m), 3.95 (3H, s), 3.6
2 (2H, s), 2.52 (3H, s) SI-MS spectrum (M + H) ⁺ : m / z 575

[0266]

Example 124 Compound 132 (5.0 mg) was treated in the same manner as in Example 86 to give Compound 139 (5.1 mg).
Was obtained as a pale yellow powder. ¹ H NMR, DMSO-d ₆ , δ ppm; 13.49 (1H, s), 4.57 (1H,
d, J = 14.1 Hz), 4.52 (1H, d, J = 14.1 Hz), 3.79
(3H, s), 2.54 (3H, s) SI-MS spectrum (M + H) ⁺ : m / z 536

[0267]

Example 125 Establishment of CHO cells expressing costimulatory molecule a) Expression of B7-1 in CHO cells Chinese hamster overly (CHO) cells 1 × 1
0 ⁵ cells using a laboratory dish having a diameter of 10 cm, and cultured for 24 hours in αMEM medium containing 10% fetal bovine serum, to the cells, B7-1cDNA expression plasmid pME-B7-1 obtained in Reference Example 1 (10 [mu] g) And the neomycin resistance expression plasmid pME-neo (1 μg) was introduced by the calcium phosphate method. 48 hours after introduction, GENETICIN (G418 sulfat
e, GIBCO) was added to a final concentration of 0.5 mg / ml to select cells that had acquired the neomycin resistance trait.
Furthermore, the expression of B7-1 was examined for these selected cells by flow cytometry (EPICS ELITE, COULTER), and cells that highly expressed B7-1 were obtained. The cells were cloned by limiting dilution to obtain B7.
A cell line B7-1-CHO-22 which stably expresses -1 was obtained. Expression dihydrofolate reductase deficiency in b) CD28 CHO cells (dhfr ^-) CHO cells 1x
10 ⁵ cells were grown in a 10 cm diameter petri dish at 10%
The cells were cultured in an αMEM medium containing fetal bovine serum for 24 hours, and the CD28 cDNA expression plasmid pAKKO-CD28 (10 μg) obtained in Reference Example 1 was introduced into the cells by the calcium phosphate method. Forty-eight hours after the introduction, the medium was changed to an αMEM medium (containing no nucleic acid) containing 10% dialyzed fetal bovine serum, and cells having the plasmid integrated into the chromosome were selected. Furthermore, for these selected cells, flow cytometry (EPICS ELIT
E, COULTER) to examine the expression of CD28
Cells that highly expressed 28 were obtained. By cloning the cells by limiting dilution, a cell line CD28-CHO-11 stably expressing CD28 at a high level was obtained.

C) CHO producing soluble B7-1-Ig
Cells producing dihydrofolate reductase deficient (dhfr ^-) CHO cells 1
X10 ⁵ cells were cultured in a 10 cm Petri dish for 10 times.
The cells were cultured for 24 hours in an αMEM medium containing fetal calf serum, and 10 μg of the expression plasmid encoding the soluble B7-1-Ig obtained in Reference Example 2 was introduced into the cells by the calcium phosphate method. Forty-eight hours after the introduction, the medium was changed to an αMEM medium (containing no nucleic acid) containing 10% dialyzed fetal bovine serum, and cells having the plasmid integrated into the chromosome were selected. Furthermore, for these selected cells, the soluble B7 produced in the culture supernatant
The amount of -1-Ig was measured by EIA, and cells with high production were obtained. A cell line that stably produces soluble B7-1-Ig by cloning these cells by limiting dilution
B7-1-Ig-CHO-20 was obtained. d) Production of soluble B7-1-Ig CH producing soluble B7-1-Ig obtained in c) above
O cells (sB7-1-Ig-CHO-20) with a diameter of 15 cm
Using a Petri dish, αME containing 10% dialyzed fetal bovine serum
The cells were cultured in M medium (containing no nucleic acid) to obtain 5 L of a culture supernatant.
This culture supernatant is applied to a protein G column (Chromatop Super Protein G 20cm IDx 10cm, NGK).
And purified by gel filtration chromatography (TSKgel G3000SW 21.5 cm IDx 600 cm, Tosoh) to obtain 20 mg of a purified sample.

[0269]

Test Example 1 Binding Inhibition Test Using Soluble B7-1-Ig The CHO cells expressing CD28 obtained in Example 125 were
Suspended in an αMEM medium (containing no nucleic acid) containing 0% dialyzed fetal bovine serum, seeded in a 96-well microplate (flat bottom) at 3 × 10 ⁴ cells / well, and 37 ° C. in 5% carbon dioxide gas
For 48 hours. The culture medium was aspirated off from the plate to which the cells were adhered, and the cells were fixed by adding phosphate buffered saline (PBS) containing 0.5% paraformaldehyde. The plate was washed twice with PBS containing 10% Block Ace (Snow Brand Milk Products), and 10 μg was added to each well.
/ Ml of soluble B7-1-Ig and the measurement sample were added. The binding reaction was allowed to stand at room temperature for 30 minutes. After the reaction, the plate was washed with PBS containing 10% Block Ace (Snow Brand Milk Products).
Washed twice with peroxidase-labeled anti-human IgG
(Cappel) was added and reacted for 2 hours. 10% plate
After washing twice more with PBS containing Block Ace (Snow Brand Milk Products), 0.1 M citrate buffer containing 6.5 mg / ml orthophenylenediamine dihydrochloride (Wako Pure Chemical Industries) and 0.06% hydrogen peroxide. 100 μl of the liquid was added to each well. After 20 minutes, the color reaction was stopped with 2N sulfuric acid and 49
Measure the absorbance at 2 nm with a plate reader (BIO-RAD Model45
0) was measured. IC ₅₀ value of some compounds (50%
Are shown in [Table 14].

[0270]

[Table 14]

[0271]

[Test Example 2] Interleukin 2 of human peripheral blood T cells
(IL-2) Production Inhibition Test Blood of a healthy person was collected, layered on a lymphocyte separation medium (LSM, Organon Teknika Co.), and centrifuged at 2,000 rpm for 20 minutes at room temperature. Peripheral blood mononuclear cells were obtained. The mononuclear cells were applied to a nylon wool column (Wako Pure Chemical Industries, Ltd.) and incubated at 37 ° C. for 40 minutes, after which non-adsorbed cells were collected and T cells were concentrated. Anti-CD3 antibody (OKT3, Ortho Diagnostic System
s) coated on a 96-well microplate (flat bottom)
The T cells were seeded at a concentration of 5x10 ⁴ cells / well, further addition of CHO cells expressing B7-1 obtained in Example 125 such that 1x10 ⁴ cells / well, 10%
In RPMI-1640 medium containing fetal bovine serum under 5% carbon dioxide,
The cells were cultured at 37 ° C. for 48 hours. I produced in the culture supernatant
L-2 for HUMAN INTERLEUKIN-2 EIA KIT (Cayman Chemic
al Co.). As a result, TAN-2421
The IC ₅₀ values of A1 (concentration giving 50% inhibition of binding) of 1
It was 0 μg / ml.

[0272]

[Formulation Example 1] Using TAN-2421A1, all the components of the following formulation are mixed, and the mixture is filled into a gelatin capsule.
30mg of TAN-2421A1 per capsule
Was produced. TAN-2421A1 30mg Lactose 100mg Corn starch 40mg Magnesium stearate 10mg Total 180mg

[0273]

Formulation Example 2 TAN-2421A1 and magnesium stearate were granulated with an aqueous solution of soluble starch, dried, and then mixed with lactose and corn starch. The mixture was compression-molded to produce tablets having the following formulation. TAN-2421A1 30mg Lactose 65mg Corn starch 30mg Soluble starch 35mg Magnesium stearate 20mg Total 180mg

[0274]

Formulation Example 3 TAN-2421A1 is dissolved in a physiological saline solution containing 30% (w / v) polyethylene glycol 400 to prepare a 0.05% solution of TAN-2421A1, sterilized and filtered, and 30 ml each is added to a vial. Dispensed. An intravenous solution was prepared containing 15 mg of TAN-2421A1 per vial.

[0275]

Formulation Example 4 TAN-2421A1 (40 mg) and mannitol (50 g) were mixed with polyethylene glycol 40.
0 was dissolved in distilled water for injection (1 liter) containing 30% (w / v), filtered by sterilization, and dispensed into ampoules by 1 ml. A 0.05% solution of TAN-2421A1 was prepared by dissolving in 40 μg of a physiological saline solution containing one ampoule, filtered by sterilization, and dispensed into vials in 30 ml portions.
15mg of TAN-2421A1 per vial
Was prepared.

[0276]

[Toxicity test] TAN-2421A1 was administered to mice at 400 mg / k.
g No deaths were observed even after intraperitoneal administration.

[0277]

The compound [I] of the present invention or a salt thereof is
Inhibits the binding of B7-1 to the CD28 receptor and prevents B7-1-dependent activation of T cells. Also, I cells from T cells
Inhibits L-2 production. Accordingly, the compound [I] of the present invention or a salt thereof is used as a low-toxicity immunomodulator, as a transplant rejection inhibitor, an allergy agent, a rheumatic agent, an autoimmune disease agent, a nephritis agent, a diabetes agent. It is useful as such.

[0278]

[Sequence list]

[SEQ ID NO: 1] Sequence length: 663 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence ATGCTCAGGC TGCTCTTGGC TCTCAACTTA TTCCCTTCAA TTCAAGTAAC AGGAAACAAG 60 ATTTTGGTGA AGCAGTCGCC CATGCTTGTA GCGTACGACATAGCTCGTC 120 ACAATCTCTT CTCAAGGGAG TTCCGGGCAT CCCTTCACAA AGGACTGGAT 180 AGTGCTGTGG AAGTCTGTGT TGTATATGGG AATTACTCCC AGCAGCTTCA GGTTTACTCA 240 AAAACGGGGT TCAACTGTGA TGGGAAATTG GGCAATGAAT CAGTGACATT CTACCTCCAG 300 AATTTGTATG TTAACCAAAC AGATATTTAC TTCTGCAAAA TTGAAGTTAT GTATCCTCCT 360 CCTTACCTAG ACAATGAGAA GAGCAATGGA ACCATTATCC ATGTGAAAGG GAAACACCTT 420 TGTCCAAGTC CCCTATTTCC CGGACCTTCT AAGCCCTTTT GGGTGCTGGT GGTGGTTGGT 480 GGAGTCCTGG CTTGCTATAG CTTGCTAGTA ACAGTGGCCT TTATTATTTT CTGGGTGAGG 540 AGTAAGAGGA GCAGGCTCCT GCACAGTGAC TACATGAACA TGACTCCCCG CCGCCCCGGG 600 CCCACCCGCA AGCATTACCA GCCCTATGCC CCACCACGCG ACTTCGCAGC CTATCGCTCC 660 TGA 663

[0279]

[SEQ ID NO: 2] Sequence length: 867 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence ATGGGCCACA CACGGAGGCA GGGAACATCA CCA
TCCAAGT GTCCATACCT CAATTTCTTT 60 CAGCTCTTGG TGCTGGCTGG TCTTTCTCAC TTC
TGTTCAG GTGTTATCCA CGTGACCAAG 120 GAAGTCAAAG AAGTGGCACAC GCTGTCCTGT GGT
CACAATG TTTCTGTTTGA AGAGCTGGCA 180 CAAACTCGCA TCTACTGGCA AAAGGGAGAAG AAA
ATGGTGC TGACTATGAT GTCTGGGGAC 240 ATGAATATAT GGCCCGAGTA CAAGAACCGG ACC
ATCTTTTG ATATCACTAA TAACCCTCTCC 300 ATGTTGATCC TGGCTCTGCCG CCCATCTGAC GAG
GGCACAT ACGAGTGTGT TGTTCTGAAG 360 TATGAAAAAG ACGCTTTCAA GCCGGAACAC CTG
GCTGAAG TGACGTTATC AGTCAAAGCT 420 GACTTCCCTA CACCTAGTAT ATCTGACTTT GAA
ATTCCAA CTTCTAATAT TAGAAGGATA 480 ATTTCTCAACCTCTGGAGG TTTTCCAGAG CCT
CACCTCT CCTGGTTGGA AAATGGAGAA 540 GAATTAATG CCATCAACAC AACAGTTTCCA CAA
GATCTGAAAACTGAGCT CTATGCTGTT 600 AGCAGCAAAC TGGATTTCAA TATGACAACC AAC
CACAGCT TCATGTGTCT CATCAAGTAT 660 GGACATTTAA GAGTGAATCA GACCTTCAAC TGG
AATACAA CCAAGCAAGA GCATTTTCCT 720 GATAACCTGC TCCCATCCTG GGCCATTACC TTA
ATCTCAG TAAATGGAAT TTTTGTGATA 780 TGCTGCCTGA CCTACTGCTT TGCCCCAAGA TGC
AGAGAGA GAAGGAGGAA TGAGAGATTG 840 AGAAGGGAAAA GTGTACGCCC TGTATAAA
867

[0280]

[SEQ ID NO: 3] Sequence length: 1428 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA sequence ATGGGCCACA CACGGAGGCA GGGAACATCA CCA
TCCAAGT GTCCATACCT CAATTTCTTT 60 CAGCTCTTGG TGCTGGCTGG TCTTTCTCAC TTC
TGTTCAG GTGTTATCCA CGTGACCAAG 120 GAAGTCAAAG AAGTGGCACAC GCTGTCCTGT GGT
CACAATG TTTCTGTTTGA AGAGCTGGCA 180 CAAACTCGCA TCTACTGGCA AAAGGGAGAAG AAA
ATGGTGC TGACTATGAT GTCTGGGGAC 240 ATGAATATAT GGCCCGAGTA CAAGAACCGG ACC
ATCTTTTG ATATCACTAA TAACCCTCTCC 300 ATGTTGATCC TGGCTCTGCCG CCCATCTGAC GAG
GGCACAT ACGAGTGTGT TGTTCTGAAG 360 TATGAAAAAG ACGCTTTCAA GCCGGAACAC CTG
GCTGAAG TGACGTTATC AGTCAAAGCT 420 GACTTCCCTA CACCTAGTAT ATCTGACTTT GAA
ATTCCAA CTTCTAATAT TAGAAGGATA 480 ATTTCTCAACCTCTGGAGG TTTTCCAGAG CCT
CACCTCT CCTGGTTGGA AAATGGAGAA 540 GAATTAATG CCATCAACAC AACAGTTTCCA CAA
GATCTGAAAACTGAGCT CTATGCTGTT 600 AGCAGCAAAC TGGATTTCAA TATGACAACC AAC
CACAGCT TCATGTGTCT CATCAAGTAT 660 GGACATTTAA GAGTGAATCA GACCTTCAAC TGG
AATACAAA CCAAGCAAGA GCATTTTCCT 720 GATCATCAGG AGCCCAAATC TTCTGACAAA ACT
CACACGT CTCCACCGTC CCCGGCGCCT 780 GAACTCCTGG GGGGACCGTC AGTCTTCCTCTCTCC
CCCCCAA AACCCAAGGA CACCCTCATG 840 ATCTCCCGGA CCCCTGAGGT CACATGCCGTG GTG
GTGGGACG TGAGCCACGA AGACCCTGAG 900 GTCAAGTTCA ACTGGTACGT GGACGGCGTGTG GAG
GTGCATA ATGCCAAGAC AAAGCGCGCGG 960 GAGGAGCAGT ACAACAGCAC GTACCGTGGTG GTC
AGCGTCC TCACCGTCCT GCACCAGGAC 1020 TGGCTGAATG GCAAGGAGTTA CAAGTGCAAG GTC
TCCAACA AAGCCCTCCC AGCCCCATC 1080 GAGAAAACCA TCTCCAAAGC CAAAGGGCAG CCC
CGAGAAC CACAGGTGTA CACCCTGCCC 1140 CCATCCCGGG AGGAGATGAC CAAGAACCAG GTC
AGCCTGA CCTGCCTGGT CAAAGGCTTC 1200 TATCCCAGGCG ACATCGCCGT GGAGTGGGGAG AGC
AATGGGC AGCCGGAGAA CAACTACAAG 1260 ACCACGCTCCC CCGTGCTGGA CTCCGACGGC TCC
TTCTTCC TCTATAGCAA GCTCACCGTG 1320 GACAAGAGCA GGTGGCAGCA GGGGGAACGTC TTC
TCATGCT CCGTGATGCA TGAGGCTCTG 1380 CACAACCACT AACGCAGAA GAGCCTCTCC CTG
TCCCCGG GTAAATGA 1428

[0281]

[SEQ ID NO: 4] Sequence length: Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: synthetic DNA sequence TGGATCCATG GGCCACACAC GGAGGCAGGG AAC 33

[0282]

[SEQ ID NO: 5] Sequence length: Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: synthetic DNA sequence TGGATCCTTA TACAGGGCGT ACACTTTCCC TTCTC 34

[0283]

[SEQ ID NO: 6] Sequence length: Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA sequence TCTCGAGGTC GACATGCTCA GGCTGCTCTT GGCTC 35

[0284]

[SEQ ID NO: 7] Sequence length: sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: synthetic DNA sequence AACTAGTTCA GGAGCGATAG GCTGCGAAG 29

[0285]

[SEQ ID NO: 8] Sequence length: Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: synthetic DNA sequence CTTTGATATC ACTAATAACC TC 22

[0286]

[SEQ ID NO: 9] Sequence length: Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA sequence GGTGATCAGG AAAATGTCCTCTGC
TTGGTTG 30

[0287]

[SEQ ID NO: 10] Sequence length: Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA sequence GGTGATCAGG AGCCCAAATC TTCTGCACAAA ACT
CACACGT CTCCACCGTC CCCGGCGCCT 60 GAACTCCTG
69

[0288]

[SEQ ID NO: 11] Sequence length: Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: synthetic DNA sequence CCCTGCAGTC TAGATCATTT ACCCGGGGAC AGGGAG 36

[0289]

[Brief description of the drawings]

FIG. 1. CD28 gene expression plasmid (pAKKO)
-CD28) is shown. CD28 is the CD28 gene, dhfr is the dihydrofolate reductase gene, Ap
^r is ampicillin resistance gene, SRα promoter is SR
The α promoter and poly A indicate a poly A addition signal.

FIG. 2 shows the nucleotide sequence of the cloned CD28 gene,
The amino acid sequence deduced from the nucleotide sequence is shown.

FIG. 3 shows an expression plasmid for the B7-1 gene (pME-B7
The construction diagram of -1) is shown. B7-1 is the B7-1 gene, A
p ^r is the ampicillin resistance gene, SRα promoter is S
The Rα promoter and poly A indicate a poly A addition signal.

FIG. 4 shows the nucleotide sequence of the cloned B7-1 gene,
The amino acid sequence deduced from the nucleotide sequence is shown.

FIG. 5 shows a construction diagram of an expression plasmid (pB7-1-IG) for a gene encoding soluble B7-1-Ig. sB7
-1-Ig indicates a soluble B7-1-Ig gene, dhfr indicates a dihydrofolate reductase gene, Ap ^r indicates an ampicillin resistance gene, SRα promoter indicates an SRα promoter, and poly A indicates a polyA addition signal.

FIG. 6 shows the nucleotide sequence of the soluble B7-1-Ig gene and the amino acid sequence deduced from the nucleotide sequence.

FIG. 7 shows the nucleotide sequence of the gene of the solubilized form of B7-1 and the amino acid sequence deduced from the nucleotide sequence. It is a continuation of FIG.

FIG. 8 shows an IR spectrum (KB) of TAN-2421A1.
r tablet).

FIG. 9 shows a ¹³ C NMR spectrum of TAN-2421A1 (7
5 MHz, in DMSO-d ₆ , at 27 ° C).

FIG. 10 shows an IR spectrum of TAN-2421B1 (K
Br tablet).

[11] ¹³ C NMR spectrum of TAN-2421B1 (75 MHz, in DMSO-d _6, 60 ℃) shows a.

──────────────────────────────────────────────────の Continuation of the front page (51) Int.Cl. ⁶ Identification code FI A61K 31/35 ACV A61K 31/35 ACV ADP ADP C07D 311/82 C07D 311/82 (72) Inventor Tsutomu Kurokawa Water in Kawanishi-shi, Hyogo 50, 1-1-1, Meijidai

Claims (24)

[Claims] 1. A compound of the general formula Wherein R ¹ is a carboxyl group which may be esterified or amidated, R ² is a hydrogen atom, a hydroxyl group or a hydrocarbon group which may be substituted, and R ³ and R ⁴ are the same or different An optionally substituted hydroxyl group, R ⁵ and R ⁶ are the same or different and are a hydrogen atom or a halogen atom, R ⁷ is a hydrogen atom, a nitro group, a halogen atom, an optionally substituted hydrocarbon group,
An optionally substituted heterocyclic group or an optionally substituted acyl group, n represents an integer of 0 to 2, Y represents an oxygen atom or two hydrogen atoms, and when n is 0, R ^{2 represents} Is the formula (The symbols in the formulas may be the same as defined above.) Or a salt thereof. 2. The compound according to claim 1, wherein R ⁷ is a hydrogen atom or a halogen atom. (3) R ² is —CH ₂ (CHOH) m-R ² ′ (wherein m is 0 or 1, and R ² ′ is a carboxyl group which may be esterified or amidated or substituted. Wherein R ⁷ is a hydrogen atom and Y is an oxygen atom. (4) R ² is (1) a hydrogen atom, (2) a hydroxyl group,
Or (3) (a) C _1-8 alkoxy-carbonylcarbonyl, (b) carboxyl which may be esterified or amidated, (c) hydroxyl which may be acylated, (d) C
_1-10 alkyl, C _1-6 alkanoyl, amino optionally having C _1-6 alkylsulfonyl or C _6-14 arylsulfonyl, (e) C _1-6 alkoxy, (f) cyano, (g) Sulfo, (h) C _1-6 alkyl, C _1-6 alkoxy, nitro,
A 5- or 6-membered heterocyclic group optionally having cyano, amino, halogen atom, hydroxyl or oxo,
(i) a nitro group, (j) a C _1-19 hydrocarbon group which may be substituted with a group selected from a halogen atom and (k) oxo,
R ³ and R ⁴ are the same or different and each have (a) an acyl group or (b) a hydroxyl group which may have a substituted C _1-10 alkyl group as a substituent, and R ⁷ represents (1) ) Hydrogen atom, (2) nitro group, (3) halogen atom, (4) (a) carboxyl which may be esterified or amidated, (b) hydroxyl which may be acylated, (c) C Amino optionally having _1-10 alkyl, C _1-6 alkanoyl, C _1-6 alkylsulfonyl or C _6-14 arylsulfonyl, (d) C _1-6 alkoxy, (e) cyano, (f) Sulfo, (g) C _1-6 alkyl, C _1-6 alkoxy, nitro, cyano, amino, halogen atom, 5- or 6-membered heterocyclic group optionally having hydroxyl or oxo, (h) nitro, (i) a halogen atom and (j) group optionally substituted C _1-19 hydrocarbon group selected from oxo (5) (a) C _1-6 alkyl, (b) esterified or amidated or unprotected carboxyl, (c) acylated or unprotected hydroxyl, (d) C _1-10 alkyl, C _{1 -6} alkanoyl, C _1-6 alkylsulfonyl or amino optionally having C _6-14 arylsulfonyl, (e) C _1-6
5- or 6-membered heterocyclic group which may be substituted with a group selected from alkoxy, (f) cyano, (g) sulfo, (h) nitro, (i) halogen atom and (j) oxo, or a fused heterocyclic group thereof (6) (a) C _1-6 alkyl, (b) carboxyl which may be esterified or amidated, (c) hydroxyl which may be acylated, (d) C _1-10 Amino optionally having alkyl, C _1-6 alkanoyl, C _1-6 alkylsulfonyl or C _6-14 arylsulfonyl, (e) C _1-6
Alkoxy, (f) cyano, (g) sulfo, (h) C _1-6 alkyl, C _1-6 alkoxy, nitro, cyano, amino, halogen atom, hydroxyl or also may 5 or 6 membered optionally having oxo 2. The compound according to claim 1, which represents an acyl group which may be substituted by a heterocyclic group represented by the formula: (i) nitro, (j) a halogen atom and (k) oxo. 5. R ¹ is a carboxyl group which may be esterified, R ² is (1) a hydrogen atom, (2) a hydroxyl group, (3) (a) C _1-8 alkoxy-carbonylcarbonyl, b) carboxyl, which may be esterified or amidated, (c) hydroxyl, which may be acylated, (d) C
_1-6 alkylsulfonyl or C _6-14 amino which may have arylsulfonyl, (e) C _1-6 alkoxy,
(f) a cyano, (g) a sulfo and (h) a C _1-10 alkyl group optionally substituted with a group selected from a 5- or 6-membered heterocyclic group optionally having hydroxyl or oxo, 4) C _2-8 alkenyl group optionally having carboxyl, or (5) (a) cyano, (b) carboxyl which may be esterified or amidated, (c) hydroxyl, (d) nitro , (E) a halogen atom and (f) a 5- or 6-membered nitrogen-containing heterocyclic group.
_7-19 aralkyl group, R ³ and R ⁴ are a hydroxyl group optionally substituted by C _1-7 acyl or a C _1-10 alkoxy group optionally substituted by C _1-6 alkoxy,
⁷ is (1) hydrogen atom, (2) nitro group, (3) halogen atom, (4)
Substituted with a C _1-10 alkyl group, (5) (a) C _1-6 alkyl, (b) carboxyl, (c) C _1-6 alkoxy, (d) amino, (e) nitro or (f) halogen atom A C _6-14 aryl group, (6) a C _1-6 alkanoyl group or (7) a carbon atom, which contains 1 to 4 hetero atoms selected from nitrogen, oxygen and sulfur atoms, or 5 or The compound according to claim 1, which represents a 6-membered heterocyclic group or a heterocyclic group condensed with a benzene ring. 6. R ¹ is a group represented by the formula —COOR ²⁸ wherein R ²⁸ is a hydrogen atom or C _1-6 alkoxy which may be substituted by C _1-6 alkoxy.
A group represented by _1-8 represents an alkyl group], R ² is (1) hydrogen atom, (2) hydroxyl group, (3) -CH ₂ (CHOR ^b)
m ¹ COOR ^{29 wherein} m ¹ is 0 or 1, R ^b is a hydrogen atom or a C _1-6 alkanoyl group, R ²⁹ is a hydrogen atom, or a C _1-6 alkoxy, C _1-6 alkanoyloxy or A C _1-8 alkyl group which may be substituted with C _4-7 cycloalkoxycarbonyloxy], a group represented by the formula (4): —CH ₂ (CHOH) m ² CONR ³⁰ R ^{31 wherein 2} represents 0 or 1, R ³⁰ and R ³¹ are the same or different and each represents a hydrogen atom or a C _1-8 alkyl group optionally substituted by carboxyl, C _1-6 alkoxy or C _2-5 alkoxycarbonyl. A group represented by formula (5)
Formula —CH ₂ (CHOH) m ³ CONHS (＝ O) ₂ R ³² [wherein m ³ represents 0 or 1, and R ³² represents C _1-4 optionally substituted with 1 to 3 halogen atoms. Alkyl group, or C _{1-6
Represents a} C _6-14 aryl group optionally substituted with an alkyl, nitro, C _1-6 alkoxy or halogen atom]
A group represented by, (6) -CH ₂ (CHOH) m ⁴ CONH
A group represented by OR ^{33 wherein} m ⁴ represents 0 or 1, and R ³³ represents a hydrogen atom or a C _1-4 alkyl group;
H ₂ (CHOH) m ⁵ R ³⁴ [wherein m ⁵ represents 0 or 1;
³⁴ is a 3- to 8-membered heterocyclic group which may be substituted with hydroxyl or oxo and has 1 to 4 heteroatoms selected from nitrogen, oxygen and sulfur atoms in addition to carbon atoms] Group, (8) -CH ₂ (CHOH)
a group represented by m ⁶ —CH ₂ OR ³⁵ [wherein m ⁶ represents 0 or 1, and R ³⁵ represents a hydrogen atom, a C _1-8 alkyl group or a C _1-6 alkanoyl group], (9) — CH ₂ (CHOH) m ⁷ -C
A group represented by OCOOR ³⁶ [wherein m ⁷ represents 0 or 1, and R ³⁶ represents a hydrogen atom or a C _1-8 alkyl group],
0) a C _2-8 alkyl group optionally substituted with a carboxyl group, or (11) a carboxyl, cyano, halogen atom, nitro, hydroxyl, carbamoyl, C _2-5 alkoxycarbonyl or carbon atom other than a nitrogen atom, oxygen C _{7-19 optionally} substituted by a 3- to 8-membered heterocyclic group containing 1 to 4 heteroatoms selected from atoms and sulfur atoms
An aralkyl group, R ³ is a group of the formula —OR ³⁷ [wherein, R ³⁷ represents a hydrogen atom, a C _1-8 alkyl group optionally substituted with a C _1-6 alkoxy, or a C _1-6 alkanoyl group] In the formula, R ⁴ is a group represented by the formula (1) —OR ³⁸ wherein R ³⁸ is a hydrogen atom, a C _1-8 alkyl group which may be substituted with a C _1-6 alkoxy, a C _1-6 alkanoyl Or a C _7-11 aroyl group) or a group represented by the formula (2): -OCOOR ³⁹
Wherein R ³⁹ represents a C _1-6 alkyl group or a C _6-14 aryl group, and R ⁷ is (1) a hydrogen atom, (2)
Nitro group, (3) halogen atom, (4) C _1-8 alkyl group, (5)
A halogen atom, carboxyl, C _1-6 alkyl, C _1-6 alkoxy, C _6-14 aryl group optionally substituted by amino or nitro, (6) C _1-6 alkanoyl group or
(7) a 3- to 8-membered heterocyclic group containing 1 to 4 heteroatoms selected from a nitrogen atom, an oxygen atom and a sulfur atom other than a carbon atom, or a condensed heterocycle with a 6- to 8-membered carbocyclic or heterocyclic group The compound according to claim 1, which represents a cyclic group. 7. R ² is of the formula —CH ₂ COOR ⁴⁰ wherein R ⁴⁰ is hydrogen or substituted by C _1-6 alkoxy, C _1-6 alkanoyloxy or C _4-7 cycloalkoxycarbonyloxy. R ³ and R ⁴ represent a hydroxyl group; R ³ represents a C _1-4 alkyl group;
⁵ and R ⁶ are a chlorine atom, R ⁷ is a hydrogen atom, a nitro group,
The compound according to claim 1, which represents a bromine atom or an iodine atom. 8. The compound according to claim 1, wherein n is 0 or 1. 9. The compound according to claim 1, wherein Y is an oxygen atom. (10) a compound represented by the formula: A compound TAN-2421A1 represented by the formula:
⁵¹ and R ^{61 each} represent a chlorine atom], TAN-2421A
2 [in the above formula, R ⁵¹ represents a hydrogen atom, R ⁶¹ represents a chlorine atom], TAN-2421A3 [in the above formula, R ⁵¹ represents a chlorine atom, R ⁶¹ represents a hydrogen atom] or TAN-2421
The compound according to claim 1, which is A4 wherein R ⁵¹ and R ^{61 each} represent a hydrogen atom. (11) a compound represented by the formula: A compound TAN-2421B1 represented by the formula:
⁵² and R ^{62 each} represent a chlorine atom], TAN-2421B
2 wherein R ⁵² represents a hydrogen atom and R ⁶² represents a chlorine atom; or TAN-2421B3 [wherein R ⁵² represents a chlorine atom and R ⁶² represents a hydrogen atom]. A compound as described. (12) The compound is (1) 2- (carboxymethylsulfinyl) -5,7-dichloro-3,8-dihydroxy-6-methyl-9-oxo-9H-xanthene-1.
-Carboxylic acid methyl ester, (2) 2- (carboxymethylsulfinyl) -5,7-dichloro-3,8-dihydroxy-4-iodo-6-methyl-9-oxo-9H
-Xanthene-1-carboxylic acid methyl ester, (3)
5,7-dichloro-3,8-dihydroxy-6-methyl-9-oxo-2- (pivaloyloxymethoxycarbonylmethylthio) -9H-xanthen-1-carboxylic acid methyl ester, (4) 5,7- Dichloro-3,8-dihydroxy-6-methyl-9-oxo-2- (pivaloyloxymethoxycarbonylmethylsulfinyl) -9H
-Xanthene-1-carboxylic acid methyl ester, or
(5) 5,7-dichloro-2- [1- (cyclohexyloxycarbonyloxy) ethoxycarbonylmethylthio] -3,8-dihydroxy-6-methyl-9-oxo-9H-xanthene-1-carboxylic acid methyl ester A compound according to claim 1. 13. The compound TAN belonging to the genus Aspergillus
A microorganism having the ability to produce -2421A1, A2, A3, A4, B1, B2 or / and B3 is cultured in a medium, and the compound TAN-2421A1, A2,
The compound TAN-2421 according to claim 10 or / and / or 11, wherein A3, A4, B1, B2 or / and B3 are produced and accumulated, and collected.
A1, A2, A3, A4, B1, B2 or / and B
3, or a method for producing a salt thereof. 14. The compound TAN-2421A1, A2, A3, A4 according to claim 10 or / and / or 11,
A microorganism having the ability to produce B1, B2 or / and B3, Aspergillus terreus FL-67283
stock. [15] A pharmaceutical comprising the compound according to [1] or a salt thereof. [16] An inhibitor of T cell signaling which comprises the compound according to [1] or a salt thereof. 17. The medicament according to claim 15, which is an immunomodulator. 18. The medicament according to claim 17, wherein the immunomodulator is a transplant rejection inhibitor, an allergy agent, a rheumatism agent, an autoimmune disease agent, a nephritis agent or a diabetes agent. 19. A compound of the general formula [In the formula, R ¹ represents a carboxyl group which may be esterified or amidated, R ³ and R ^{4 each} represent a hydroxyl group which may be substituted same or different, and R ⁵ and R ⁶ represent the same or different. R ⁷ represents a hydrogen atom, a nitro group, a halogen atom, an optionally substituted hydrocarbon group, an optionally substituted heterocyclic group or an optionally substituted acyl group, Y represents an oxygen atom or two hydrogen atoms] or a salt thereof is subjected to a reduction reaction, and if necessary, further subjected to a hydrocarbon group introduction reaction. ] Wherein R ² ′ ″ is a hydrogen atom or a hydrocarbon group which may be substituted, and other symbols have the same meanings as described above. . 20. (1) the amount of binding between CD28 and B7-1-Ig when CHO cells containing CD28 or a cell membrane fraction thereof and soluble B7-1-Ig are contacted, and (2)
CHO cells containing CD28 or a cell membrane fraction thereof,
Activity for inhibiting or enhancing the binding between CD28 and B7-1, characterized by comparing the amount of binding between CD28 and B7-1-Ig upon contacting soluble B7-1-Ig and a test compound A method for screening a compound having the following or a salt thereof. 21. (1) the amount of interleukin-2 produced when a CHO cell containing B7-1 or its cell membrane fraction and T cells are brought into contact, and (2) the amount of C containing B7-1.
A method for screening a compound having interleukin 2 production inhibitory activity or a salt thereof, comprising comparing the amount of interleukin 2 production when contacting a HO cell or its cell membrane fraction, a T cell and a test compound. 22. A compound or a salt thereof having an activity of inhibiting or enhancing the binding between CD28 and B7-1, obtained by using the screening method according to claim 20. (23) a compound having an interleukin-2 production inhibitory activity, or a salt thereof, obtained by using the screening method according to (21); 24. C represented by CD28-CHO-11
HO cells (FERM BP-5431), B7-1-C
CHO cells designated as HO-22 (FERMBP-5
430) or CHO cells marked with sB7-1-Ig-CHO-20 (FERM BP-5432).