JPH10146193A - Dna construct for homologous recombination, selection of transformant and homologous recombination using the construct - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a DNA construct for homologous recombination that can resolve the problems caused by conventional homologous recombination. SOLUTION: A DNA construct for homologous recombination includes a DNA sequence homologous to the DNA sequence of the receptor cells participating to the synthesis of a cell surface substance and the DNA sequence including the part coding for the protein participating to the synthesis of the desired cell surface substance and is constituted so that the protein may be controlled in its expression by the expression-controlling region of the protein participating to the synthesis of the cell surface substance on the receptor cells. When the resultant DNA construct is introduced into the receptor cells, the antigenicity on the cell surface varies depending on the decrease in cell surface substances on the receptor cells or on the presence of a desired foreign cell surface substance, and the homologous recombinant substances can be selected by utilizing the antigen-antibody reaction.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a DNA construct for homologous recombination, a method for selecting a transformant using this construct, and a homologous recombination method. The present invention also relates to a method for converting ABO antigen of a mammalian cell.

[0002]

2. Description of the Prior Art In most cases, conventional integration of a foreign gene into a chromosome is performed by random integration (optional recombination). That is, the integration position of the foreign gene into the chromosome cannot be controlled, the copy number of the foreign gene integrated into the chromosome cannot be controlled,
Usually, a strong promoter is used to ensure the expression of a desired gene, but there is a problem that the influence of such a promoter on an adjacent endogenous gene cannot be controlled. In contrast, homologous recombination has recently attracted attention. In the case of homologous recombination, a foreign gene is integrated orthotopically into a target site using a transfer construct containing a DNA sequence homologous to the target site of the chromosome and a desired DNA sequence. Is resolved. In addition, the above-mentioned problem can be solved since a cell in which only one copy has been recombined can be selected from the introduced cell group. In addition, homologous replacement results in the expression of the desired structural gene in the recipient cell's genomic manner. Therefore, the above problem is also solved. Therefore, according to homologous recombination, the above and the above problems are solved.

[0003]

As described above, homologous recombination is more useful than non-homologous recombination. However, in selecting a recombinant, the same method as in non-homologous recombination is used. In addition, it was necessary to use an introduction construct containing a selectable marker gene which was a foreign gene. This selectable marker gene is usually a drug resistance gene or a gene involved in nutritional auxotrophy, is a foreign gene for the recipient cell, and is usually used to reliably express such a marker gene. , A strong promoter is used. Therefore, in this case, the effect on an endogenous gene group close to a foreign gene containing such a strong foreign promoter cannot be predicted. That is, although homologous recombination is a very useful recombination method compared to non-homologous recombination, in selecting a homologous recombinant, it is still necessary to include a gene involved in a selection marker. Have not been able to rule out the unpredictable effects of In particular, when producing a transgenic animal, it cannot be denied that the problem of introducing a selectable marker gene, which does not originally exist in natural animals, on individuals is inevitable.

Here, a type A antigen which is an ABO blood group antigen (hereinafter, also referred to as an ABO antigen) in mammals,
Both the B-type antigen and the O-type antigen are sugar chains composed of several sugars. These three have the structure of the O antigen as a common sugar chain structural part, and the A antigen and the B antigen are further formed by binding to a monosaccharide by a specific enzyme. That is, the O antigen is one in which fucose is bound to the terminal sugar of the precursor by α1,2-linkage, and is also known as an H antigen. Then, different sugar chains bind to the O antigen, and the A antigen and the B antigen are expressed. Here, focusing on such structural differences focusing on enzymes involved in the synthesis of these antigens, the A antigen is formed by an enzyme that binds N-acetylgalactosamine to the H antigen. This enzyme is called type A transferase (AT). The B-type antigen is formed by an enzyme that binds galactose to the H antigen. This enzyme is called type B transferase (BT). Therefore, when neither AT nor BT exists for the O antigen, the O antigen is expressed.

That is, the individual or cell is ABO
Which antigen is expressed in the group of antigens is distinguished by the presence of the enzyme, whether AT is present, BT is present, or both are present, or neither is present. . Here, by analyzing the ABO antigen gene, the ABO antigen gene, in other words,
The genes of the enzymes that express the ABO antigen are basically present at one locus, and AT is expressed by exhibiting a polymorphism due to a slight difference in the DNA sequence of this locus. Whether BT is expressed, and furthermore, whether OT, which is a dwarfed protein that does not have any of these activities, is expressed, the fact that the expression form of the ABO-type antigen is different is revealed. . The difference between AT and BT (both consisting of 353 amino acids) is that the bases at 7 positions on their cDNA (1062 base pairs) are based on the difference,
(Fumi-ichiro Y
amamoyo et al. Nature vol. 345, 2
29-233, 17 may 1990). And A
The difference between T and OT is due to the dwarfing of AT due to a frame shift based on the deletion of one base on AT cDNA.

[0006] On the other hand, when the phenotype is different even if the difference is very small (genotype difference), it causes a great difference in medical treatment. That is, inconsistency in blood group antigens is a factor that hinders medical treatments such as blood transfusion and transplantation.

[0007] Accordingly, efforts to match blood group antigens are not without fail. However, efforts to match blood group antigens by genetic manipulation are limited to expressing new antigens with foreign genes in addition to the original blood group antigen. In other words, even if the type A can be changed to the type AB by adding a foreign gene, in most cases, the foreign gene is integrated into a nonspecific site on the chromosome. That is, in most cases, the above-described random integration is used, and it is clear that the same problem as described above occurs even when the homologous recombination method is used.

Therefore, an object of the present invention is to provide a homologous recombination construct that can solve the above-mentioned problems in the conventional homologous recombination. Another object of the present invention is to
An object of the present invention is to provide a selection construct and a selection method for selecting a recombinant which can solve the problems in the conventional recombination method. Still another object of the present invention is to provide a novel homologous recombination method capable of easily selecting homologous recombinants. Still another object of the present invention is to provide a DNA construct for mutually converting ABO antigens by utilizing homology between ABO antigen genes, a method for converting ABO antigen using this DNA construct, and this DNA construct. To provide a method for selecting a transformant obtained by introducing the above.

[0009] Here, the present inventors have replaced the DNA sequence of a recipient cell involved in the expression of a cell superficial substance with a DNA sequence involved in the expression of a desired protein by using homologous recombination, When the purpose is to express a new cell superficial substance in a recipient cell, a change in antigenicity or a change in cytotoxicity due to replacement or introductory expression of the cell superficial substance is detected. By doing so, we found that homologous recombinants could be selected directly,
The present invention has been completed.

[0010]

The invention according to claim 1 is a DNA construct for homologous recombination having the following DNA sequence, wherein the DNA sequence is a DNA sequence of a recipient cell involved in the synthesis of a cell surface substance. And a DNA sequence containing a portion encoding a protein involved in the synthesis of a desired cell surface substance, wherein the protein is a cell surface substance of the recipient cell. It is a DNA construct constructed so that the expression is controlled by an expression control region of a protein involved in the synthesis of DNA. In this specification, examples of the cell superficial substance include various compounds such as complex proteins such as saccharides, proteins, lipids, glycoproteins, and glycolipids. These compounds constitute any of a cell surface receptor, an antigen, a cell superficial compound, a compound secreted on the cell surface, and the like.

As a result of the orthotopic substitution of the construct, the expression of the protein is controlled by the expression control region of the protein involved in the synthesis of the superficial substance of the recipient cell. As a result, the D of the recipient cell
When a cell superficial substance is expressed by the NA sequence, a desired cell superficial substance is expressed in a substitutional manner with respect to the cell superficial substance, and the cell superposition is performed by the DNA sequence of the recipient cell. When the sexual substance is not expressed, the desired cell superficial substance is expressed in an introductory manner. In addition, since the antigenicity of the cell surface changes due to the reduction of the cell superficial substance present in the recipient cell or the presence of the desired foreign superficial substance, homologous recombinants can be obtained using an antigen-antibody reaction. Be sorted out.

According to a second aspect of the present invention, in the first aspect, the DNA sequence of the recipient cell is a DNA sequence containing a portion encoding a protein having α1,3-galactosyltransferase activity. The DNA sequence containing a portion encoding a protein involved in the synthesis of a superficial substance is a DNA construct comprising a portion encoding a protein having α1,2-fucosyltransferase activity. . As a result of orthotopic substitution of this construct, H antigen is synthesized instead of αGalactose epitope (G antigen). A transformant is selected by utilizing the antigen-antibody reaction by reducing the G antigen or expressing the H antigen.

According to a third aspect of the present invention, in the first aspect, the DNA sequence of the recipient cell is a DNA sequence containing a portion encoding a protein having an activity of synthesizing an A-type antigen or a B-type antigen. DNA containing a portion encoding a protein involved in the synthesis of a desired cell surface substance
The sequence is a DNA construct characterized in that it is a DNA sequence containing a portion encoding a protein having the activity of synthesizing a B-type antigen or an A-type antigen. As a result of orthotopic substitution of this construct, type A antigen is substituted with type B antigen, or type B antigen is substituted with type A antigen. As a result, the antigenicity of the cell surface changes, and the transformant is selected by detecting the change using an antigen-antibody reaction. Here, the A-type antigen and the B-type antigen refer to the serotypes in the ABO blood group antigen.

According to a fourth aspect of the present invention, in the first aspect, the DNA sequence of the recipient cell is a DNA sequence including a portion encoding a protein having an activity of synthesizing an A-type antigen or a B-type antigen. DNA containing a portion encoding a protein involved in the synthesis of a desired cell surface substance
The sequence is a DNA sequence containing a portion coding for a protein involved in the synthesis of the O-type antigen.
A construct. As a result of orthotopic substitution of this construct, a protein having the activity of synthesizing the type A antigen or a protein having the activity of synthesizing the type B antigen is not expressed. It remains the precursor H-type antigen and is consequently converted to type 0 antigen. Here, the O-type antigen refers to the serotype of the ABO blood group antigen.

According to a fifth aspect of the present invention, in the first aspect, the DNA sequence of the recipient cell is a DNA sequence containing a portion encoding a protein involved in the synthesis of an O-type antigen, and encoding the desired protein. D including the part to be
The NA sequence is a DNA construct characterized by being a DNA sequence containing a portion encoding a protein having a type A antigen or type B antigen synthetic activity. As a result of orthotopic substitution of this construct, the O-type antigen is converted to the A-type antigen or the B-type antigen.

According to a sixth aspect of the present invention, in the first aspect, the DNA sequence of the recipient cell includes a portion encoding a protein having an activity of synthesizing an MHC (major histocompatibility complex) blood group antigen. The DNA sequence, which is a DNA sequence and includes a portion encoding a protein involved in the synthesis of the desired cell superficial substance, encodes a protein having an activity of synthesizing an MHC blood group antigen different from the MHC blood group antigen. It is a DNA construct characterized by being a DNA sequence containing a portion. The orthotopic replacement of this construct results in the replacement of one MHC blood group antigen with another desired MHC blood group antigen.

The invention according to claim 7 is a DNA construct for homologous recombination having the following DNA sequence, wherein the DNA is a DNA of a recipient cell involved in the synthesis of a cell superficial substance.
A DNA construct comprising a DNA sequence homologous to the sequence and a DNA sequence that inhibits the synthesis of the cell superficial substance. By introducing this construct into a recipient cell by homologous recombination, the synthesis of the cell superficial substance is inhibited. As a result, the expression of the cell superficial substance is suppressed or not completely expressed. A transformant is selected by detecting the change in the amount of the cell superficial substance as a change in antigenicity by an antigen-antibody reaction.

The invention according to claim 8 provides a transformant obtained by introducing the DNA construct according to any one of claims 1 to 7 into a recipient cell, the antigenicity obtained by the transformant. It is a method of sorting by the change of Here, the antigenicity is a concept including both agglutination by an antigen-antibody reaction and cytotoxicity by activation of complement following the antigen-antibody reaction. The change in antigenicity refers to such a decrease or increase in agglutination and cell damage.

According to a ninth aspect of the present invention, in the eighth aspect, the selection based on the change in antigenicity is performed by detecting a change in the cytotoxicity of a transformant in an antigen-antibody reaction involving complement. Is a sorting method characterized by the following.

[0020] The invention according to claim 10 is a method for transforming a recipient cell by homologous recombination,
A DNA sequence homologous to the desired DNA sequence of the recipient cell and a DNA containing a portion encoding the desired protein
And a DNA construct for homologous substitution, wherein the desired protein comprises a DNA construct for homologous substitution, the expression of which is controlled by the expression control region of the desired DNA sequence of the recipient cell, and the synthesis of a cell superficial substance. Recipient cell DNA
A screening DN comprising a DNA sequence homologous to the sequence and a DNA sequence that inhibits the synthesis of the cell superficial substance, and is configured to inhibit the synthesis of the cell superficial substance.
A construct and the A construct are simultaneously introduced into the recipient cell, and the transformant obtained by the selection DNA construct is detected by detecting a change in the antigenicity obtained by the transformant, thereby obtaining homology by the selection DNA construct. A homologous recombination method comprising selecting a recombinant, and selecting a homologous recombinant of the DNA construct for homologous replacement from the homologous recombinant.

[0021] The invention according to claim 11 is a method for transforming a recipient cell by homologous recombination,
A DNA sequence homologous to the desired DNA sequence of the recipient cell and a DNA containing a portion encoding the desired protein
And a DNA construct for homologous substitution, wherein the desired protein comprises a DNA construct for homologous substitution, the expression of which is controlled by the expression control region of the desired DNA sequence of the recipient cell, and the synthesis of a cell superficial substance. Recipient cell DNA
A DNA sequence that is homologous to the sequence and a DNA sequence that includes a portion that encodes a protein involved in the synthesis of the desired cell surface substance, wherein the protein is A DNA construct for selection, the expression of which is controlled by the expression control region of a protein involved in synthesis, is simultaneously introduced into the recipient cell, and a transformant using the DNA construct for selection is transformed. Detecting a change in the antigenicity obtained in the body to select a homologous recombinant based on the DNA construct for selection, and selecting a homologous recombinant of the DNA construct for replacement from the homologous recombinant. This is a featured homologous recombination method.

The invention according to claim 12 is the invention according to claim 11, wherein the recipient cell is a non-primate mammal or a cell derived from a non-primate mammal, and the DNA of the recipient cell involved in the synthesis of the cell superficial substance. The sequence is a DNA sequence containing a portion encoding a protein having α1,3-galactosyltransferase activity, and the DNA sequence containing a portion encoding a protein involved in the synthesis of the desired foreign cell surface substance is α1 , A homologous recombination method characterized in that it is a DNA sequence containing a portion encoding a protein having 2-fucosyltransferase activity.

The invention according to claim 13 is characterized in that the recipient cell A
A DNA construct for converting a BO blood group antigen to another ABO blood group antigen, comprising: a DNA sequence homologous to the DNA sequence of the ABO blood group antigen gene of the recipient cell; and a ABO blood group antigen gene of the recipient cell. D to code
A DNA sequence containing a DNA mutated portion of the DNA sequence of the other ABO blood group antigen gene with respect to the NA sequence. According to this construct, regions other than the DNA mutation portion are regions of homology to each other. Therefore, homologous recombination is performed at the ABO-type antigen locus of the recipient cell. In addition, since this construct does not contain a promoter sequence or a marker for selecting a transformant, an unnecessary DNA sequence is not introduced into a recipient cell. In this specification, the ABO blood antigen gene refers to a gene encoding an enzyme AT, BT, or OT that expresses an A type antigen, a B type antigen, or an O type antigen. The A-type gene is synonymous with the AT gene, the B-type gene is synonymous with the BT gene, and the O-type gene is synonymous with the OT gene.

According to a fourteenth aspect of the present invention, in the DNA construct according to the thirteenth aspect, the ABO blood group antigen gene of the recipient cell is an A gene and the other ABO blood group antigen gene is an O gene. It is a DNA construct characterized by being a type gene.

According to a fifteenth aspect of the present invention, in the DNA construct according to the thirteenth aspect, the ABO-type blood antigen gene of the recipient cell is a B-type gene, and the other ABO-type blood antigen gene is an O-type blood antigen gene. It is a DNA construct characterized by being a gene.

[0026] According to a sixteenth aspect of the present invention, in the DNA construct according to the thirteenth aspect, the AB of the recipient cell is used.
The type O blood group antigen gene is a type A gene, and the other A
The BO type antigen gene is a DNA construct characterized by being a B type gene.

According to a seventeenth aspect of the present invention, in the DNA construct according to the thirteenth aspect, the ABO of the recipient cell is used.
The blood group antigen gene is a type B gene, and the other AB
The O-type blood group antigen gene is a DNA construct characterized by being an A-type gene.

The invention according to claim 18 is a method for converting the ABO antigen of a recipient cell by introducing the DNA construct according to claims 13 to 17 into the recipient cell. According to this method, upon gene transfer,
No DNA sequence other than the desired DNA sequence is introduced into the recipient cell, and no adverse effects due to unnecessary DNA sequence introduction occur in the cell.

[0029] According to a nineteenth aspect of the present invention, a transformant obtained by introducing the DNA construct according to any one of the thirteenth to seventeenth aspects into a recipient cell is obtained by subjecting the transformant to the antigenicity acquired by the transformant. It is a method of sorting by the change of According to this method, transformants can be easily selected based on changes in the ABO antigen.

According to a twentieth aspect of the present invention, in the nineteenth aspect, the selection based on the change in antigenicity is performed by detecting a change in the cytotoxicity of a transformant in an antigen-antibody reaction involving complement. Is a sorting method characterized by the following.
According to this method, transformants can be easily selected by antiserum.

[0031]

BEST MODE FOR CARRYING OUT THE INVENTION The present invention relates to (1) a DNA sequence which inhibits the synthesis of a cell superficial substance, which is homologous to the DNA sequence of a recipient cell involved in the synthesis of the cell superficial substance. When introduced by recombination, the synthesis of the cell superficial substance is inhibited, and as a result, the expression of the cell superficial substance is suppressed or not completely expressed. By detecting the change in the amount of the cell superficial substance by antigen-antibody reaction as a change in antigenicity, transformants are selected,
Alternatively, (2) a DNA sequence encoding a protein involved in the synthesis of a desired cell surface substance is homologously recombined with a DNA sequence of a recipient cell involved in the synthesis of the cell surface substance. When introduced, the desired cell superficial substance is substituted or introduced and expressed, and the foreign cell superficial substance is expressed by the expression control region of the cell superficial substance peculiar to the recipient cell. In this manner, the homologous recombinant was used as an antigen to confirm that the expression of the cell superficial substance that was present in the recipient cell was reduced, or that the foreign cell superficial substance was replaced or introduced A transformant is selected by detecting the change in sex by an antigen-antibody reaction.

One allele when the DNA construct is replaced orthotopically does not contain a foreign promoter sequence for a foreign cell superficial substance, so that the influence of the foreign promoter sequence is avoided, Further, since the gene involved in the selection marker is not included, the influence of the promoter sequence is avoided. In addition, this DNA
The construct reduces the cell superficial substance present in the recipient cell, or the cell superficial substance is replaced or introduced, resulting in a change in the antigenicity (cytotoxicity) of the transformant. Can be detected, and transformants are selected. Therefore, according to this DNA construct, all the conventional problems have been solved in homologous recombination for the purpose of reducing, substituting or introducing expression of cell surface substances.

In order to detect a change in cytotoxicity, complement is used together with an antibody corresponding to a cell superficial substance specific to the recipient cell. In the case where the specific cell superficial substance is reduced by the transformation or the desired cell superficial substance is expressed in a substitutional manner, the cell coverage by complement activation following the antigen-antibody reaction is obtained. The non-transformant is excluded by the toxicity, and only the transformant having reduced cell damage in the antigen-antibody reaction system can selectively survive and form a colony. According to this sorting method, the sorting can be performed clearly and the sorting can be easily performed. In this example, the selection is performed by focusing only on the decrease in cell damage, but the selection can be performed based on merely the decrease in agglutination. Also, due to the increase in agglutinability and cell damage due to the presence of the desired cell superficial substance due to substitutional expression or introductory expression,
Alternatively, it is also possible to select in combination with a decrease and an increase in aggregability (cell damage).

As described above, the original cell superficial substance is reduced, or a new cell superficial substance is replaced or newly introduced by homologous recombination, and its expression is reduced. The antigenic change in the transformant,
That is, the method of selection by detecting a change in cell damage is a novel selection method not found in conventional foreign gene transfer techniques. This method is characterized in that the selection is clear and can be easily performed, particularly in terms of utilizing cell damage. In addition, in the case of substitutional expression or introductory expression, the antigen on the cell surface is newly expressed, so that the antigenicity is clearly changed compared to the case where the cell surface substance is reduced. I do.

As an example of such a DNA construct, the DNA sequence of the recipient cell involved in the synthesis of the cell superficial substance is a DNA sequence containing a portion encoding a protein having α1,3-galactosyltransferase activity.
A DNA sequence encoding a protein involved in the synthesis of the desired cell superficial substance;
-A DNA construct comprising a DNA sequence containing a portion encoding a protein having fucosyltransferase activity.

As a result of orthotopic substitution of this construct, a recipient cell expressing a protein having α1,3-galactosyltransferase activity and expressing an αgalactose epitope (G antigen) on the cell surface, specifically, By transforming cells of a non-primate mammal or a non-primate mammal and expressing α1,2-fucosyltransferase, the H antigen can be expressed on the cell surface. Due to the expression of the H antigen instead of the G antigen, the antigenicity changes and transformants can be selected. In addition, homologous recombinants using this DNA construct can be easily selected using human serum (including complement). Since human serum contains a natural antibody against G antigen, if a serum that does not inactivate complement is used, a transformant with reduced G antigen will survive in the serum due to the antigen-antibody reaction. It can be selected as a colony. Here, higher primates are
It refers to a species that has H antigen in vascular endothelial cells and does not have G antigen. For example, among primates Salinae, it refers to nasal monkeys to which humans, chimpanzees, orangutans, baboons, and Japanese monkeys belong. On the other hand, a non-higher primate mammal refers to a species that does not have an H antigen in vascular endothelial cells but has a G antigen, and refers to, for example, primates, Protozoa and Protozoa among primates. Non-primate mammals are defined as H-endothelial cells.
It refers to a species that does not have an antigen and has a G antigen, for example, a mammal that is not a primate.

As a result of the orthotopic substitution of the DNA construct, the H antigen can be expressed by substituting the G antigen on the cell surface of the cell of the non-primate mammal or non-primate mammal. Transformant (including transgenic animal) obtained by this DNA construct
Is suitable as a material for transplantation into humans.
Because humans naturally have natural antibodies against G antigens, G antigens cause hyperacute rejection when these recipient cells are transplanted into humans.

As another example, blood group antigens can be substituted in humans. The protein having the activity of synthesizing human blood group antigen is specifically N-type.
F acting on acetyllactosamine to synthesize H antigen
A-type substance transferase (AT) that acts on T and H antigens to synthesize A-antigen and B-type substance transferase (BT) that synthesizes B-antigen. D replacing such blood group antigens
According to the NA construct, the blood group antigen of the recipient cell (for example, a human cell) is replaced by another blood group antigen, and the cytotoxicity changes, so that transformants can be selected. For example, when converting an O-type recipient cell to A-type or B-type, the O-type gene in the recipient cell has a DNA sequence in which the A-type gene or B-type gene has been inactivated. D encoding the mutant protein
When a DNA sequence encoding a protein having an activity of synthesizing an A-type antigen or a B-type antigen is introduced instead of the NA sequence, the A-type antigen or the B-type antigen can be expressed.

As such a DNA construct,
A D homologous to the DNA sequence of the ABO gene of the recipient cell
A DNA construct having an NA sequence and a DNA sequence containing a difference between the DNA sequence of the ABO type gene of the recipient cell and the ABO type gene to be converted is preferable. Such a construct is, in other words, the DNA sequence of the ABO-type antigen gene to be converted. Since the ABO-type antigen gene is polymorphic, a part of the ABO-type antigen gene (genome) to be converted can be used as a conversion construct so as to include a different part from the ABO-type antigen gene of the recipient cell. . Since the ABO antigen gene is polymorphic, it is possible to construct such a simple construct. Specifically, a DNA sequence containing a different portion (mutated portion) of an ABO antigen gene to be newly expressed by conversion by gene transfer with respect to an ABO antigen gene of a recipient cell;
The ABO antigen gene to be converted is converted into a P-type so as to obtain a DNA fragment having a DNA sequence having a length capable of homologous recombination on each of the 3 'and 5' sides of the sequence.
By amplifying and purifying by the CR method, a DNA construct is constructed.

In constructing such a construct, first, in order to obtain an ABO antigen gene to be converted, the genotype of the ABO type antigen gene of the cell is determined.
Thereafter, the cells are constructed by selecting cells having a homogenous genotype and performing PCR on DNA extracted from the cells. (Construction of Conversion Construct) DNA was extracted from a cell group of individuals whose phenotype was AA type, and the ABO transferase gene of this DNA was amplified by PCR, and the amplified DN
After the A fragment is cleaved with a specific restriction enzyme, it is subjected to polyacrylamide electrophoresis, and cells having the genotype AA are selected from the electrophoresis pattern. For details of the method for determining the genotype of the ABO antigen gene, see DFStroncek et al.
USION 1995; 35: 231-240. By the same method, cells having a genotype BB are selected from a cell group of individuals having a phenotype B. Further, a gene whose phenotype is O-type is selected by the same method.

Next, DNA is extracted from cells in which each blood group antigen is homologous, and the extracted DNA is converted into an ABO blood group antigen gene to be converted, for example, the following primers: Using the set of X and Y,
The specific region is amplified by the PCR method. 4 μl of each reaction solution
By 5% polyacrylamide gel electrophoresis (PAGE)
To purify. Each of the obtained DNA fragments is about 6.4 kb. Primer-X: 5'-agtctttcgttctgtg
tcctgagctttggcacac-3 ′ primer-Y: 5′-gtggcgcagcaggta
cttgttcagggtggctc-3 ′

Each of the purified DNA fragments was extracted from the gel, and a partial fragment of AT gene derived from three types of cells, B
A partial fragment of the T gene and a partial fragment of the OT gene are obtained. That is, according to this primer set, as shown in FIG. 4, a region containing exon 3 to part of exon 6 and exon 7 of the ABO blood group antigen gene and containing all the different sites in the ABO type antigen gene was amplified. can do. Therefore, the AT gene partial fragment, the BT gene partial fragment, and the OT gene partial fragment include the regions from exon 3 to exon 7, respectively.

AT gene, BT gene and OT gene c
According to the base sequence in the DNA, the obtained AT gene partial fragment, BT gene partial fragment and OT gene partial fragment have the following relationship in the ABO blood group antigen gene, respectively. That is, on the basis of the AT gene, the BT gene is represented by 7 in exons 3 to 7 of the AT gene (a region amplified by the primer set, hereinafter referred to as the present region).
The BT gene partial fragment is a construct for homologous recombination for converting an AT gene into a BT gene, since only the bases are replaced at the individual sites and the regions are homologous in other regions. At the same time, the AT gene partial fragment
It is a homologous recombination construct for converting the BT gene to the AT gene.

Further, since the OT gene has only one base deletion in the present region of the AT gene and has a homologous relationship in other regions, the OT gene partial fragment is
It is a construct for converting an AT gene into an OT gene. At the same time, the AT gene partial fragment
It is a homologous recombination construct for converting a gene into an AT gene. Such an OT gene and A
From the relationship between the T gene and the relationship between the AT gene and the BT gene, the OT gene partial fragment is a construct for converting the BT gene to the OT gene, and at the same time, the BT gene partial fragment It is a construct for conversion to the BT gene.

As a result of orthotopic substitution of such a DNA construct, a blood group antigen on the cell surface of a recipient cell can be replaced with another type of blood group antigen. Therefore, in the case where transplantation of cells such as bone marrow cells between humans is difficult due to blood group mismatch, for example, due to blood group mismatch including MHC, the DNA construct can be used to substitute for a more compatible blood group. A more suitable cell group can be prepared.

ABO-type antigens have also been found in mammals other than humans. The ABO-type antigens can be used on human and animal cells and fertilized eggs of non-human animals by using a blood-type antigen conversion construct. Is useful for bone marrow transplantation or xenotransplantation.

The transformant obtained by the homologous recombination can be easily selected by using a blood group antibody which causes an agglutination reaction with the blood group antigen specific to the recipient cell, or further using complement. Can be. In addition, selection can be performed using a monoclonal antibody or lectin that binds to a blood group antigen. For example, when cells with genotype AO are converted to phenotype O with a partial fragment of the OT gene, those that survive are selected using anti-A serum (unheated), It is a transformant in which the OT gene partial fragment has been introduced and the phenotype is O-type. Further, for example, when a phenotype of a cell of the BO type is converted to an O type with a partial fragment of the OT gene, a surviving cell is selected using an anti-B serum (one that has not been subjected to heat treatment). If so, it is a transformant whose phenotype is O-type. In the case where a cell whose genotype is AA is converted from a phenotype to an O-type with a partial fragment of the OT gene, a surviving cell is selected using anti-A serum, and it is determined that the genotype is OO.
This is a transformant in which the phenotype is changed to O type by substituting two AT gene partial fragments in the AT gene. In this way, conversion of other ABO blood group antigens can be similarly selected.

On the other hand, such a DNA construct does not contain a promoter which is not endogenous to the recipient cell, and detects a change in cell damage due to reduction, substitution, or introduction of a cell superficial substance, thereby transforming the transformant. Focusing on the fact that the DNA construct can be selected, this DNA construct can be used also for a construct for selection. That is, by simultaneously introducing another construct for introducing a foreign gene into the recipient cell together with the construct for selection, the recipient cell in which these two constructs are simultaneously incorporated can be transformed into a cell in which the construct for selection is homologously incorporated. Sorting can be achieved by sorting the body for changes in cell damage.

Therefore, any of the DNA constructs described above can be used as a selection construct. In particular, a selection construct that expresses an H antigen instead of a G antigen is convenient when a non-primate mammal or a cell derived from a non-primate mammal is used as a recipient cell. When human-derived cells are used as recipient cells,
A screening construct that replaces the human blood group antigen with another type of blood group antigen is advantageous. The method for selecting a transformant using such a selection construct is useful regardless of whether it is heterologous recombination or homologous recombination.
In particular, it is preferable to use transformants by homologous recombination.

Along with such a screening construct, a DN homologous to the desired DNA sequence of the recipient cell is used.
An A sequence and a DNA sequence encoding a desired protein, wherein the desired protein is a DNA construct for homologous replacement configured to be expression-controlled by an expression control region of the desired DNA sequence of the recipient cell; Can be provided into a recipient cell at the same time to provide a novel transformation method by homologous recombination that does not require a selectable marker. That is, these constructs are simultaneously introduced into a recipient cell, and each construct is used to homologously recombine with the chromosome of the recipient cell. In this case, for example, by detecting the above-mentioned decrease in cytotoxicity using an antigen-antibody reaction in the presence of complement, and selecting a homologous recombinant by the screening construct, They include homologous recombinants of the replacement construct. A homologous recombinant of this replacement construct is obtained from D.H.
Detection can be easily performed by detecting the NA sequence by PCR or Southern blotting.

The homologous recombination method also comprises transforming a non-primate mammal or a cell derived from a non-primate mammal by introducing a desired foreign DNA sequence by homologous recombination into a higher primate mammal. It is very convenient to make a material useful for the implantation of a. As an example of such transformation, the recipient cell is a cell derived from a non-higher primate mammal or a non-primate mammal, and a protein having α1,3-galactosyltransferase activity for synthesizing a G antigen together with a homologous replacement construct. DN homologous to the DNA sequence containing the coding portion
A sequence and a DNA sequence containing a portion encoding an enzyme having α1,2-fucosyltransferase activity for synthesizing H antigen, wherein the α1,2-fucosyltransferase is an α1,3-galactosyltransferase expression control region And a DNA construct for selection, the expression of which is controlled by the above, is simultaneously introduced into the recipient cell. In this transformation, the homologous recombinant by the screening construct is transformed by the transformation with the screening construct to reduce the amount of G antigen or to detect a change in antigenicity due to H antigen expressed instead of the G antigen. Selected,
From this homologous recombinant, a homologous recombinant of the above-mentioned replacement construct can be selected by PCR or Southern blotting.

According to this transformation method, the desired foreign D
Non-higher primate mammals or non-primate mammalian cells containing NA can be easily selected using antibodies and / or complement without integrating the DNA sequence involved in conventional selectable markers into the chromosome. In addition, cells and transgenic animals obtained by this transformation must be able to integrate the foreign gene into a specific position on the chromosome, control the copy number of the foreign gene integrated into the chromosome, Cells and animals are useful and harmless in that the effect of the transgene on the sex gene can be neglected.

In particular, for non-primate primate or non-primate mammalian cells, a DNA sequence homologous to a DNA sequence containing a portion encoding a protein having α1,3-galactosyltransferase activity and an H antigen are synthesized. And a DNA sequence containing a portion encoding an enzyme having α1,2-fucosyltransferase activity.
Selection DNA constructed so that expression is controlled by an expression control region of 1,3-galactosyltransferase
The cells in which the construct has been orthotopically substituted or the transgenic animals thereof can avoid hyperacute rejection upon transplantation into humans and can provide animals containing desired useful genes. Moreover, such animals do not contain any intrinsic drug resistance marker genes, etc., and may also cause deleterious traits often observed in transgenics by random integration or adverse effects on individuals due to the overexpression of specific proteins. Absent.

In particular, for example, cells or animals obtained by converting O-type recipient cells to A-type or B-type
That the foreign gene can be integrated at a specific position on the chromosome, that the copy number of the foreign gene integrated into the chromosome can be controlled, that the effect of the transgene on the endogenous gene close to the integrated position can be ignored,
In that respect, cells and animals are useful and harmless.
Such cells or organs may be organ transplants or cell transplants (including bone marrow transplants) whose blood type is incompatible, including MHC
Can be converted to a combination having fewer incompatible antigens, and
It is more convenient for the recipient in that it does not contain harmful foreign genes.

[0055]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be specifically described below based on embodiments. (Example 1) (Construction of construct) Neomycin resistance gene (p
olyoma viruses thymidine ki
case gene promoter and ne
omycinresistance gene) is pM
C1neo polyA (Stratagene, La
Jolla, CA, USA). PGK
(Promotergene of phosphog
lucocinase) gene and DTA (diph)
thereia toxin fragment Ag
ene) gene is Dr. T. Kodama and Pro
f. S. Obtained from Aizawa. The MC1neo gene, PGK gene and DTA gene are each
SalI / EcoR I site, Pst I / Sma I site, and Ba of the script KSII + (Stratagene) vector
Inserted at the mHI site. This is the sorting vector,
It was called pDTA / neo.

(Construction of Construct for Homologous Recombination)
arsen R. D. , LowJ. B. "Iso"
lationofa cDNA encoding a
murine UDPgalactose: beta
-D-galactosyl-1,4-N-acety
ID-glucosamine alpha-
1,3-galactosyltransferas
e: Expression cloning byge
ne transfer "; Pro. Natl. Aca
d. Sci. , U.S. S. A. , 86: 8227-823.
1 (1989) and LA-PCR (long active) using mouse DNA of the 129 strain as a template.
polymerase chain reaction
n), a murine UDP galactos
e: beta-D-galactosyl-1,4-N
-Acetyl-D-glucosaminoideal
pha-1,3-galactosyl transf
exon2 to exon3 of the erase (GT) gene
And the portions from exon4 to exon6 were extracted (see FIG. 1 (A)). The regions corresponding to exons 2 to 3 correspond to the 5 'flanking regions of the homologous recombination construct, and the regions corresponding to exons 4 to 6 correspond to the 3' flanking regions of the homologous recombination construct.

At this time, GT1; (5′-GTACCTTC) was used as a primer for the 5 ′ flanking region.
CTTTCCTCTCGCTGAGCCCTGCCTCC
(TTAGG-3 ′) and GT2; (5′-AGATCT)
TGAGGAGTTAAGACTTGTTTCTGAC
TTGG-3 ') was used. GT3; (5′-GT) was used as a primer for the 3 ′ flanking region.
CAAGGGAAAAGTAATCCTGTTGATG
(CTG-3 ′) and GT4; (5′-CCAGCTTGG)
GAACCACCAGTCCTTCTCGACATCTG
-3 '). These PCR fragments were converted to pGE
After insertion into an MT vector (Promega), these two plasmids were each replaced with SphI / Cla
I, cut with SalI / ApaI, and cut each with pDTA / n
eo and was designated as homologous recombination vector pTVneo. This pTVneo was digested with SacII and designated as a homologous recombination construct L-TVneo (FIG. 1).
(E)). In this construct, if this construct was incorporated heterologously, DT
The A gene is expressed, and its cytotoxicity causes the cell to die.

(Construction of Homologous Replacement Construct) La
rsen R. D. Lowe J .; B. "Mol
ecocloning, sequence, an
d expression offahuman GDP
-L-fucose: beta-D-galactos
ide 2-alpha-l-fucosyltran
spherase cDNA that can form
the H blood group antige
Proc. Natl. Acad. sci., U.S.A.
S. A. 87: 6674-6678 (1989), by PCR, a human GDP-L-fu.
cose: beta-D-galactoside 2
-Alpha-l-fucosyltransfera
The portion from exon1 to exon2 of the se (FT) gene was extracted (see FIG. 1 (B)). At this time, FT1; (5'-CACGAAAAGCGCGG) was used as a primer.
ACTATCGATCTGCACCTG-3 ') and FT
2; (5′-CAGGAACACCACAAGCTTG
TCGACAAGATGCC-3 '). A SalI cleavage site was created in the 3'-end primer, and this PCR product was digested with XhoI and SalI, and designated as an insert sequence i-FT. The homologous recombination vector pTVneo was prepared using XhoI and Sal.
After digestion with I, the fragment was ligated to the above-mentioned sequence i-FT for insert, and called a replacement vector, pGT / FT. This is cleaved with SacII to obtain a homologous replacement construct,
It was called L-GT / FT (see FIG. 1 (C)). Also in this construct, when this construct is incorporated in a heterologous manner, the DTA gene is expressed, and the cell toxin kills the cell.

(Introduction of Construct) About 1 × 10 6 cells of mouse fibrosarcoma cell line L929 were cultured in a Petri dish (2 lines) having a diameter of 10 cm. As a medium, basically, 10% FCS (heat-inactive) was used.
d Fetal calf serum)
M (Dulbecco's modified Eag
le's medium) was used. Lipofectin (Gibco BRL) was used for the introduction into the cells. The homologous recombination construct L-TVneo and the homologous replacement construct L-GT / FT each used 2 μg. For the details of introduction, the protocol of the above-mentioned manufacturer (Gibco BRL) was followed.

(Selection of colonies) For colony selection, serum obtained from a healthy human was used, and DMEM of the above medium was used.
To a concentration of about 10%. The medium and the serum were appropriately replaced, and after about 7 days, the following colonies were obtained. Type of construct used Number of colonies Number of homologous replacement constructs (L-GT / FT) 17 11 Homologous recombination construct (L-TVneo) 0 1 Control (no DNA introduction) 0 0

After these colonies were passaged, they were further cultured to obtain DNA from the cells. Similarly, DNA was obtained from L929 cells into which DNA had not been introduced.

(Homologous substitution and homologous recombination) In order to confirm homologous substitution of the homologous substitution construct (L-GT / FT), GT was used as a probe A from exon2 to e.
A portion of about 1 kb obtained by digesting the PCR product of xon3 with BamHI and SphI was used (see FIG. 1 (A)). The DNA group obtained by the above-mentioned introduction was digested with SphI, and these were subjected to agarose gel electrophoresis, transferred to a filter, and subjected to Southern blot. As a result, FIG.
As shown in (A), the homologous replacement construct (L-
GT / FT) group, about 12 kb band and about 4.4 k band.
b band was obtained. A band of about 12 kb and a band of about 5.6 kb were obtained from the homologous recombination construct (L-TVneo) group. In the L929 cell group into which DNA had not been introduced, only a band of about 12 kb was obtained (see FIGS. 1 (D) (F)).

As a probe B, a portion of about 0.7 kb obtained by digesting the GT exon4 to exon6 PCR products with NcoI and SphI was used (FIG. 1 (A)).
reference). Southern blots were performed as described above.
As a result, as shown in FIG. 2 (B), a band of about 12 kb and a band of about 6.6 kb were obtained from the homologous replacement construct (L-GT / FT) group. About 12k from the homologous recombination construct (L-TVneo) group
A band of b and a band of about 6.4 kb were obtained. DN
In the L929 cell group into which A was not introduced, about 12
Only the kb band was obtained (see FIGS. 1D and 1F). From the above, it was confirmed that the homologous replacement construct and the homologous recombination construct were subjected to homologous substitution and homologous recombination with respect to the genome, respectively.

Construct for homologous substitution L-GT / FT
Each of the cell groups obtained from the colonies obtained by the introduction of was stained with two lectins. one,
UEA-1, which is a lectin for H antigen, and GS-IB4, another lectin for G antigen, were used. First, mouse L929 into which DNA has not been introduced
For cells, FITC-labeled lectin UEA-
After mixing 1 and incubating for about 30 minutes, the mixture was subjected to flow cytometry. Similarly, FITC-labeled lectin GS-IB4 was added to mouse L929 cells into which DNA had not been introduced, and the same operation was performed.
Flow cytometry was performed. These results are shown in FIGS. 3 (A) and (B), respectively. On the other hand, regarding the homologous replacement construct, UEA-1 and GS-IB4
And mouse L9 not transfected with DNA.
Incubation and flow cytometry were performed as for 29 cells. These results are shown in FIGS. 3 (C) and (D).

According to FIGS. 3 (A) and (B), it was confirmed that mouse L929 cells not transfected with DNA had no H antigen, and that G antigen was expressed. From FIG. 3 (C), in the homologous replacement cells, H
It was confirmed that the antigen was expressed. FIG.
From (D), it was confirmed that the degree of expression of the G antigen was reduced. The degree of the expression was about 1/10 compared to L929 cells into which DNA had not been introduced.

According to the above results, one allele of the GT gene was deleted by L-TVneo, but G antigen was produced by GT of the remaining one allele. The cells were injured and did not form colonies. On the other hand, homologous substitution of L-GT / FT in one allele of the GT gene results in expression of FT instead of GT, and GT It is considered that the expression of more H antigens greatly reduced the amount of G antigens and reduced cell damage.

Example 2 The following example describes the construction of constructs for converting blood group antigens, and examples of converting blood group antigens with these constructs.

Hereinafter, an example in which cells having a phenotype B and a genotype BO are converted to an O-type (genotype OO) using an OT gene fragment will be described. As a genotype BO cell line, SW1417 (Huma)
n adenocarcinoma cell lin
e, supplied by the ATCC) and SW948 (human adenocar) as a genotype O cell line.
Cinoma cell line ATCC) was used.

(Construction of DNA construct for O-type conversion) Cells were separated from the medium in which the genotype SW948 cells were cultured, and DNA was extracted from the separated cells.
For this DNA, primer X of the following DNA sequence
Using the set of Y and Y, about 6.4 kb of the region from exon 3 to about the middle of exon 7 of the O-type gene was amplified by PCR. PCR conditions were as follows: 1st file: 94 ° C./1 minute 30 seconds, once, 2nd file: 94 ° C.
/ 30 seconds, 68 ° C / 1 minute, 72 ° C / 2 minutes, 35 times, 3rd
File: once at 72 ° C./10 minutes. Primer-X: 5'-agtctttcgttctgtg
tcctgagctttggcacac-3 ′ primer-Y: 5′-gtggcgcagcaggta
cttgttcagggtggctc-3 ′

[0070] 10 µl of the obtained PCR solution was collected,
The size of the amplified DNA was confirmed by 5% polyacrylamide gel electrophoresis (PAGE). This DN
The solution A was purified by electrophoresis on a 0.8% low melting point (hereinafter referred to as LMP) gel, and then a Promega Wizard DNA purification system using resin (Wizard).
The rd system. ), The DNA was purified and separated.

(Transfection) A genotype BO-type SW1417 cell line was transformed into a 10 cm-diameter dish (2
About 1 × 10 ⁶ cells). As a medium, basically, 10% FCS (Heat-inactivated fetal) is used.
DMEM supplemented with calf serum) was used. Upon introduction into the cells, the construct DN was used as the solution A.
A mixture of 1 μl of A (10 μg / μl) and 9 μl of DMEM was used. As solution B, 5 μl of DMEM, 5 μl of lipofectin reagent and lectin EEA (Euonymus europa
eus) (1 mg / ml) was used. Add solution A to solution B, mix gently, and add
After leaving still for 5 minutes, 75 μl of DMEM was mixed gently to obtain a complex for transfection with stirring. This complex for transfection was added to one of the above-mentioned dishes of cultured cells and mixed. The remaining one strain used, as a control, a mixed solution in which the same amount of physiological saline was added instead of the DNA construct in the transfection complex.

(Selection of colonies) For selection of colonies,
Serum obtained from a healthy type O human (without heat treatment at 55 ° C. for 30 minutes) was used. The cells that retain the B-type antigen die in the serum containing the anti-B antibody and complement. However, a cell group that does not leave the B-type antigen is considered not to be killed by the serum. In fact, in the colony selection, the serum was added to a concentration of about 10% with respect to the medium DMEM. By appropriately changing the medium, about 3 days later, no colonies were obtained in the control group, but 47 colonies were obtained in the transfection group.

(Confirmation of Genotype by Restriction Enzyme) In order to confirm homology substitution of the DNA construct of this example, the method of DFStroncek et al. (TRANSFUSION 1995; 35:
231-240), DNA is extracted from the selected cell group based on the method described in detail in
A first fragment and a second fragment were extracted from the following two primer sets (first and second), respectively. 4 μl of the obtained PCR solution was collected and purified by 5% polyacrylamide gel electrophoresis (PAGE). The amplified DNA was extracted once from the collected portion of the gel using 200 μl of a phenol: chloroform (1: 1) mixed solution, and further extracted once with chloroform. The obtained DNA was mixed with 1/10 amount of 3M sodium acetate (pH
6.0) and twice as much ethanol at -20 ° C.
For one day and night. Thereafter, the DNA was spun down, washed with 70% ethanol and 95% ethanol, dried, and suspended in 50 μl of distilled water. First set (primers A and B) Primer-A: 5'-gaattcactcgccac
tgcctgggtctc-3 ′ Primer-B: 5′-gaattcatgtgtgggtg
gcaccctgcca-3 ′ Second set (primers C and D) Primer-C: 5′-gaaatcgccctcgtc
ctt-3 'Primer-D: 5'-ggattccaggggtgca
cggccgggcggc-3 ′

The DNA solution of the first fragment was digested by adding restriction enzymes Asp718 and BstEII, respectively, to prepare two types of digested solutions. Also, the DN of the second fragment
For solution A, the restriction enzymes Bss HII and Kas I
And digested to prepare two types of digestive juices. These digestions were separated on 5% PAGE, stained with ethidium bromide, and observed under ultraviolet irradiation.
The DNA solution to which no restriction enzyme was added was applied on PAGE together with a digestion solution of each restriction enzyme as a control. As a control, a DNA solution of the first fragment and a DNA solution of the second fragment were prepared for the genotype BO-type SW1417 cells before the transformation, and two types of digestion fluids were prepared respectively. PAGE as well as
Separated above, stained and observed under UV irradiation.

FIG. 5 and FIG. 6 show the results of electrophoresis of the digested liquid of the first fragment and the second fragment of the cells before transformation and the transformant, respectively. DFStroncek et al.'S method (TR
According to the genotyping method described in ANSFUSION 1995; 35: 231-240), the presence of the B-type gene and the O-type gene was confirmed in the cells before transformation shown in FIG. That is, since the first fragment was cleaved by Asp718 and the second fragment was cleaved by BssHII to obtain a DNA fragment of a predetermined length, the presence of the O-type gene was confirmed.
One fragment was digested with BstEII and the second fragment was digested with KasI to obtain a DNA fragment of a predetermined length, confirming the presence of the B-type gene. Similarly, the method of DFStroncek et al. (TRANSFUSION 1995; 3
5: 231-240), the presence of the O-type gene was confirmed in the transformed cells shown in FIG. 6, but the presence of the B-type gene was confirmed. Did not. That is, the first fragment is cut by Asp718, the second fragment is cut by BssHII and
Since the NA fragment was obtained, the presence of the O-type gene was confirmed. Since the first fragment was not cleaved by BstEII and the second fragment was not cleaved by KasI, the absence of the B-type gene was confirmed. Has been confirmed. Therefore, it was clear that the transformed cells had a genotype of OO and no B-type gene.

[Brief description of the drawings]

1A is a diagram showing a part of a mouse GT gene, FIG. 1B is a diagram showing a part of a human FT gene, and FIG. 1C is a diagram showing a vector for homologous replacement. It is a figure that
(D) shows the mouse GT gene orthotopically replaced by the homologous replacement construct, (E) shows the vector for homologous recombination, and (F) shows the vector for homologous recombination. FIG. 4 is a diagram showing a mouse GT gene orthotopically recombined by a construct. (A) ~
In (B), squares with numbers on the right indicate exons of the mouse GT gene or human FT gene.

FIG. 2 (A) shows the results of a Southern blot using Probe A, and FIG. 2 (B) shows the results of a Southern blot using Probe B.

FIG. 3 (A) shows the results of flow cytometry of control L929 cells using lectin UEA-1, and FIG. 3 (B) shows the flow cytometry of control L929 cells using lectin GS-IB4. (C) shows the results of flow cytometry using Lectin UEA-1 of L929 cells into which L-GT / FT has been introduced, and (D) shows the results of L-GT.
/ FT-Lectin GS-IB in L929 cells
FIG. 4 is a view showing a result of flow cytometry using No. 4;

FIG. 4 shows a type A gene in an ABO blood group antigen gene,
FIG. 6 is a diagram showing the correspondence between the B-type gene and the O-type gene, wherein four base substitution mutations between the A-type gene and the B-type gene in exon 7 and 4
And amino acid substitutions in exon 6 are shown. Also, Primer AB
The bold horizontal lines indicated by the letters O-5 'or PrimerABO-3' are the primers X used in Example 2, respectively.
Alternatively, it indicates the corresponding site of Y.

FIG. 5 is a diagram showing a state in which two types of digestive fluids (a) of a first fragment of SW1417 cells before transformation and two types of digestive fluids (b) of a second fragment are separated by PAGE.

FIG. 6 is a view showing a state in which two types of digestive fluids (a) of the first fragment of SW1417 cells after transformation and two types of digestive fluids (b) of the second fragment are separated by PAGE.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁶ Identification symbol FI C12N 5/10 C12N 9/10 9/10 C12Q 1/68 A C12Q 1/68 G01N 33/53 M G01N 33/53 D C12N 5 / 00 B // (C12N 15/09 ZNA C12R 1:91)

Claims (20)

[Claims] 1. A DNA construct for homologous recombination having the following DNA sequence, wherein the DNA is homologous to the DNA sequence of a recipient cell involved in the synthesis of a cell superficial substance.
A protein comprising a sequence encoding a protein involved in the synthesis of a desired cell superficial substance, wherein the protein is involved in the synthesis of a cell superficial substance of the recipient cell. A DNA construct configured to be expression-controlled by the expression control region of (1). 2. The DNA of claim 1, wherein the DNA of the recipient cell is
The sequence is a DNA sequence containing a portion encoding a protein having α1,3-galactosyltransferase activity, and the DNA sequence containing a portion encoding a protein involved in the synthesis of the desired cell surface substance is α
A DNA construct, which is a DNA sequence containing a portion encoding a protein having 1,2-fucosyltransferase activity. 3. The DNA of claim 1, wherein
The sequence is a DNA sequence including a portion encoding a protein having an activity of synthesizing a type A antigen or a type B antigen, and a DNA sequence including a portion encoding a protein involved in the synthesis of the desired cell surface substance. Is a DNA sequence comprising a portion encoding a protein having the activity of synthesizing type B antigen or type A antigen. 4. The DNA of claim 1, wherein the DNA of the recipient cell is
The sequence is a DNA sequence containing a portion encoding a protein having an activity of synthesizing a type A antigen or a type B antigen, and is a DNA sequence containing a portion encoding a protein involved in the synthesis of the desired cell surface substance. Is a DNA sequence comprising a portion encoding a protein involved in the synthesis of an O-type antigen. 5. The DNA of claim 1, wherein the DNA of the recipient cell is
The sequence is a DNA sequence containing a portion encoding a protein involved in the synthesis of type O antigen, and the DNA sequence containing a portion encoding the desired protein is type A antigen or B type.
A DNA construct comprising a portion encoding a protein having a type antigen synthesis activity. 6. The DNA of claim 1, wherein the DNA of the recipient cell is
The sequence is a DNA sequence containing a portion encoding a protein having an activity of synthesizing MHC (major histocompatibility complex) blood group antigen, and encodes a protein involved in the synthesis of the desired cell surface substance. A DNA construct, wherein the DNA sequence including the portion is a DNA sequence including a portion encoding a protein having an activity of synthesizing an MHC blood group antigen different from the MHC blood group antigen. 7. A DNA construct for homologous recombination having the following DNA sequence, wherein the DNA sequence is homologous to a DNA sequence of a recipient cell involved in the synthesis of a cell surface substance; A DNA sequence that inhibits the synthesis of endogenous substances. 8. A method for selecting a transformant obtained by introducing the DNA construct according to claim 1 into a recipient cell based on a change in antigenicity obtained by the transformant. 9. The selection method according to claim 8, wherein the selection based on the change in antigenicity is performed by detecting a change in cytotoxicity of a transformant in an antigen-antibody reaction involving complement. 10. A method for transforming a recipient cell by homologous recombination, comprising a DNA sequence homologous to a desired DNA sequence of the recipient cell and a DNA containing a portion encoding a desired protein.
A DNA construct for homologous replacement, wherein the expression of the desired protein is controlled by the expression control region of the desired DNA sequence of the recipient cell. A selection comprising a DNA sequence homologous to the DNA sequence of the recipient cell and a DNA sequence that inhibits the synthesis of the cell superficial substance, wherein the synthesis of the cell superficial substance is inhibited And the transformant by the DNA construct for selection is simultaneously introduced into the recipient cell.
By detecting a change in the antigenicity obtained in the transformant, a homologous recombinant based on the DNA construct for selection is selected, and a homologous recombinant of the DNA construct for homologous replacement is selected from the homologous recombinant. A homologous recombination method characterized by selecting. 11. A method for transforming a recipient cell by homologous recombination, comprising a DNA sequence homologous to a desired DNA sequence of the recipient cell and a DNA containing a portion encoding a desired protein.
A DNA construct for homologous substitution, wherein the desired protein is expressed by the expression control region of the desired DNA sequence of the recipient cell, and is involved in the synthesis of a cell superficial substance. Recipient cell DN
A DNA sequence comprising a DNA sequence homologous to the A sequence and a DNA sequence containing a portion encoding a protein involved in synthesis of a desired cell surface substance, wherein the protein is a cell surface substance of the recipient cell. A DNA construct for selection, which is configured to be expression-controlled by an expression control region of a protein involved in the synthesis of, is simultaneously introduced into the recipient cell, and a transformant obtained by the DNA construct for selection is
By detecting a change in antigenicity obtained in the transformant, a homologous recombinant based on the DNA construct for selection is selected, and a homologous recombinant of the DNA construct for replacement is selected from the homologous recombinant. A homologous recombination method. 12. The receptor cell according to claim 11, wherein the receptor cell is a cell derived from a non-primate mammal or a non-primate mammal, and the D of the receptor cell involved in the synthesis of the cell superficial substance.
The NA sequence is a DN containing a portion encoding a protein having α1,3-galactosyltransferase activity.
The DNA sequence containing the portion encoding the protein involved in the synthesis of the desired foreign cell surface substance, which is the A sequence, is a DNA sequence containing the portion encoding the protein having α1,2-fucosyltransferase activity. A homologous recombination method characterized by the above-mentioned. 13. An ABO blood group antigen of a recipient cell
A DNA construct for converting to a BO blood group antigen, which comprises a DNA sequence homologous to the DNA sequence of the ABO blood group antigen gene of the recipient cell and a DNA sequence encoding the ABO blood group antigen gene of the recipient cell. A DNA sequence containing a DNA mutated portion of a DNA sequence of another ABO blood group antigen gene.
construct. 14. The DNA construct according to claim 13, wherein the ABO blood group antigen gene of the recipient cell is an A gene and the other ABO blood group antigen gene is an O gene. A DNA construct. 15. The DNA construct according to claim 13, wherein the ABO-type blood antigen gene of the recipient cell is a B-type gene, and the other ABO-type blood antigen gene is an O-type gene. DNA construct. 16. The DNA construct according to claim 13, wherein the ABO blood group antigen gene of the recipient cell is A
A DNA construct, wherein the ABO-type antigen gene is a B-type gene. 17. The DNA construct according to claim 13, wherein the ABO blood group antigen gene of the recipient cell is a B type gene and the other ABO blood group antigen gene is A gene.
A DNA construct characterized by being a type gene. 18. A method for converting an ABO blood group antigen of a recipient cell by introducing the DNA construct according to claim 13 into a recipient cell. 19. The D according to claim 13, wherein
A method for selecting a transformant obtained by introducing an NA construct into a recipient cell based on a change in antigenicity obtained by the transformant. 20. The method according to claim 19, wherein the selection based on the change in antigenicity is performed by detecting a change in the cytotoxicity of the transformant in an antigen-antibody reaction involving complement.