JPH10108678A - Heat shock promoter, stress-sensing gene and detection of stress - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new heat shock promoter comprising a stress-sensing gene derived from bacteria belonging to genus nitrosomonas, and capable of readily and speedily detecting a stress of ammonium oxidizing bacteria caused by various factors in the environment. SOLUTION: This heat shock promoter is the new one derived from bacteria belonging to genus nitrosomonas, and a stress of ammonium oxidizing bacteria caused by various factors in the environment can be readily and speedily detected by transforming ammonium oxidizing bacteria by introducing a fused gene obtained by bonding a structure gene coding a protein at the downstream of the promoter, culturing the recombinant body in a stress condition, and measuring the amount of expression of the structure gene. The heat shock promoter is obtained by forming a gene library by using a gene DNA derived from Nitrosomonas europaea IFO14298 strain, and screening the library by using a heat shock gene fragment of different creature as a probe.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a heat shock promoter derived from an ammonia oxidizing bacterium, a stress sensing gene containing the promoter, a recombinant ammonia oxidizing bacterium having the stress sensing gene in a cell, and this recombinant The present invention relates to a method for measuring the stress of ammonia-oxidizing bacteria using the method.

[0002]

2. Description of the Related Art Ammonia-oxidizing bacteria are autotrophic bacteria that obtain energy through a chemical reaction that oxidizes ammonia to produce nitrite, and the ammonia-oxidizing reaction by these bacteria plays an important role in the nitrogen cycle in the natural environment. I am carrying it. Nitrosomonas bacteria are bacteria belonging to such ammonia-oxidizing bacteria, and are known to widely inhabit the environment such as soil, water, and drainage plants.

[0003] In environmental purification, the removal of ammonia nitrogen from wastewater is carried out by a process simulating the circulation of nitrogen in the natural environment. In other words, ammonia in wastewater is oxidized to nitrite or nitric acid using ammonia oxidizing bacteria and nitrite oxidizing bacteria, and then nitric acid and nitrite are reduced by bacteria having nitrogen respiration ability and released into the air as nitrogen gas. . However, compared with BOD removal, the nitrogen removal process is often somewhat unstable, and sometimes the treatment capacity is reduced and the quality of the treated water deteriorates.
This is a problem in the operation management of the wastewater treatment plant.

[0004] The main cause of this is that ammonia oxidizing bacteria contained in activated sludge are different from other heterotrophic microorganisms.
It is highly susceptible to environmental changes, and its biological activity is easily reduced by physical factors such as temperature and pH changes and low-concentration chemical substances present in wastewater. From the viewpoint of molecular microbiology, it has been pointed out that ammonia oxidase (ammonia monooxygenase), which acts as a catalyst in the first oxidation reaction of ammonia oxidation, is easily deactivated by various chemical substances and physical factors.

It is necessary to detect such a decrease in the biological activity of ammonia-oxidizing bacteria due to physical and chemical factors at an early stage and to take measures by quickly improving the treatment process. Desirably, the inhibitors present in the environment and the physical factors that affect them are so diverse that it is virtually impossible to separate and quantify individual factors using instrumental or chemical analysis. For this reason, a measurement method using nitrifying bacteria that can comprehensively evaluate factors inhibiting cells is required. Specifically, it can be estimated from a comparison of ammonia oxidation rates under conditions simulating environmental conditions.

That is, a group of organisms such as ammonia-oxidizing bacteria or activated sludge containing the bacteria is suspended in test water containing ammonia, aerobically incubated under conditions simulating environmental conditions, and ammonia concentration, dissolved oxygen The increase or decrease of the ammonia oxidation rate can be measured by using the concentration, nitrite concentration and the like as indices. More simply, a method has been developed in which a change in the oxygen consumption rate of ammonia-oxidizing bacteria in wastewater is measured using an oxygen electrode on which ammonia-oxidizing bacteria are immobilized.

On the other hand, recently, in order to evaluate a semi-lethal state of a biological cell, a technique for quantifying the expression of a heat shock gene (stress gene) has been developed. Heat shock gene is a generic term for genes whose expression level is specifically increased in a short time when cells are semi-lethal affected by stress such as high temperature conditions, contact with toxic substances, virus infection, It is sometimes called a stress gene.
Heat shock gene is an essential gene that all organisms encoded in common regardless of eukaryotic cells, prokaryotic cells, groEL
Genes such as ( hsp60 ) and dnaK ( hsp70 ) are known. The primary structure of a gene product (heat shock protein) is highly conserved among heterologous organisms, and is considered to be an essential gene for life activity.

[0008] These heat shock proteins mainly function as so-called molecular chaperones that act to restore the three-dimensional structure of the denatured protein, and act to stabilize intracellular homeostasis.
In Gram-negative bacteria such as Escherichia coli, a specific promoter sequence exists upstream of the heat shock gene, and this promoter (heat shock promoter) is different from the normally present RNA polymerase sigma factor, that is, the sigma factor during stress, It is recognized by a special σ factor (σ ³² ) that specifically increases the number of molecules in the cell. Expression of the heat shock gene is regulated at the transcriptional level depending on the number of molecules of this particular sigma factor.

[0009] By quantitatively measuring the expression of the heat shock gene, it is possible to quickly and easily know whether or not the cell is under stress. Attempts to apply the heat shock gene expression mechanism have been made using prokaryotic microorganisms such as animal cells and Escherichia coli.

For example, Chemistry and Biotechnol, USA
Sanders et al. of ogy Research International Corp. have proposed a method to detect the expression of heat shock genes in cells of mussels exposed to toxicants by quantifying mRNA by dot blot and quantifying heat shock proteins by antigen-antibody reaction. (WO 90/02947). Also US XEN
PRO-TOX stress gene assay kit sold by OMETRIX
Is a method for evaluating toxicity using Escherichia coli cells using a fusion gene composed of a lacZ gene and 16 types of gene promoters including a stress gene that responds to a mutagenic substance or a toxic substance. Also, DuPont's Van Dyk
Constructed recombinant Escherichia coli containing a fusion gene in which a bacterial luciferase gene was linked downstream of the promoter region of the Escherichia coli stress gene, specifically, dnaK and grpE genes.
A method for detecting toxic substances from the bioluminescence intensity of this recombinant has been proposed (Appl. Environ. Microbio
l., 60, 1414-1420 (1994)). However, the method for quantitatively measuring the expression of the heat shock gene has not been applied to ammonia oxidizing bacteria.

[0011]

SUMMARY OF THE INVENTION The present inventors quantitatively detect the expression of the heat shock gene of ammonia-oxidizing bacteria, thereby allowing the physical stress such as heat and pH change and the chemical stress such as toxic substances. It was thought that the resulting decrease in the biological activity of ammonia oxidizing bacteria could be detected in its early stages. If such a response can be detected, it becomes possible to improve operating conditions and prevent water quality deterioration before the biological activity of the ammonia-oxidizing bacteria is strongly damaged, which is significant in operation management. However, a heat shock gene derived from an ammonia-oxidizing bacterium and its promoter region have not been cloned and its structure is not known.

An object of the present invention is to provide a heat shock promoter derived from a bacterium of the genus Nitrosomonas, which controls the transcription of a heat shock gene. Another object of the present invention is to
The heat shock promoter and a structural gene,
An object of the present invention is to provide a stress sensing gene that can be used for detecting bacterial stress. Another object of the present invention is to provide a recombinant ammonia-oxidizing bacterium which retains the stress sensing gene and can be used for detecting stress. Still another object of the present invention is to propose a method for easily and rapidly detecting the stress of ammonia-oxidizing bacteria caused by various environmental factors using the above-mentioned recombinant.

[0013]

Means for Solving the Problems The present invention provides the following heat shock promoter, a stress sensing gene containing the promoter, a recombinant ammonia-oxidizing bacterium having the stress sensing gene in a cell, and a recombinant This is a method for measuring the stress of ammonia-oxidizing bacteria used. (1) Heat shock promoter derived from bacteria of the genus Nitrosomonas . (2) The heat shock promoter according to the above (1), wherein the -35 sequence is CTTGA and the -10 sequence is CCCCATTTA. (3) a DNA fragment containing the heat shock promoter according to the above (1) or (2), and a DNA fragment containing a structural gene encoding a protein which is located downstream of the DNA fragment and whose expression level can be easily detected. A stress sensing gene comprising a fusion gene of (4) A recombinant ammonia-oxidizing bacterium, which retains the stress sensing gene according to (3) above in a cell. (5) A method for measuring the stress of ammonia-oxidizing bacteria, comprising culturing the recombinant according to (4) under stress conditions, and then measuring the expression level of the stress-sensing gene according to (3). .

The heat shock promoter of the present invention is a heat shock promoter derived from a bacterium of the genus Nitrosomonas and functioning in the bacterium of the genus Nitrosomonas . Nitrosomonas bacteria used as gene donors for such heat shock promoters are autotrophic bacteria that oxidize ammonia to produce nitrous acid and use the energy obtained to assimilate carbon dioxide. Yes , specifically Nitrosomonas europaea and the like can be used. Nitrosomonas bacteria are ATCC (American
Type Culture Collection), IFO (Institute for Fer)
mentation, Osaka) and can be obtained from these institutions. Specifically, Nitrosomonas europaea IF
O14298 strain and the like. Nitrosomonas bacteria isolated from biological sludge of a nitrification and denitrification treatment system can also be used.

In order to obtain a heat shock promoter of the present invention that functions in a bacterium of the genus Nitrosomonas, a heat shock gene derived from a bacterium of the genus Nitrosomonas must first be cloned, and the upstream region of the obtained heat shock gene must be searched. Must.

The heat shock gene derived from the above-mentioned bacterium of the genus Nitrosomonas is a gene whose expression is induced in a short time and specifically in bacterial cells subjected to stress such as physical or chemical stress. Nitrosomonas europaea
The nucleotide sequence of the dnaK gene, which is a heat shock gene isolated and determined from the IFO14298 strain, is shown in SEQ ID NO: 1 in the sequence listing, and SEQ ID NO: 2 corresponding to the amino group.

The dnaK gene represented by SEQ ID NO: 1 is Nitr
osomonas europaea IFO14298 strain Chromosomal DNA restriction enzyme
It is a 1,935 bp nucleotide sequence gene present in a 11.5 kb DNA fragment obtained by digestion with KpnI.

The following method is used for cloning a heat shock gene from a bacterium of the genus Nitrosomonas. That is, the chromosomal DNA of the bacterium of the genus Nitrosomonas is partially or completely digested with an appropriate commercially available restriction enzyme, and then ligated to a cloning vector capable of autonomous replication in E. coli, for example, a plasmid such as pUC19 or pBR322. Escherichia coli is transformed with the thus obtained recombinant DNA molecule, and a gene library composed of Escherichia coli transformants having various DNA fragments derived from the chromosomal DNA of the genus Nitrosomonas bacteria is constructed.

To screen a transformant containing a heat shock gene from a gene library, (1) screening by colony hybridization using a DNA fragment complementary to the heat shock gene of a heterologous organism as a probe, 2) A method of purifying a protein induced by heat shock in a bacterium of the genus Nitrosomonas and screening by colony hybridization using a synthetic gene as a probe based on a genetic code corresponding to a partial amino acid sequence of the protein. A method of preparing an antibody against the heat shock protein and screening by an antigen-antibody reaction against a foreign protein produced by a transformant of Escherichia coli; (4) Escherichia coli showing a phenotype as a heat shock gene-deficient mutant host; Screen for genes that can complement And a method of training and the like.

Many heat shock genes are known to exist in all organisms, eukaryotic and prokaryotic, and the primary structure of proteins is highly conserved across organisms. The method (1) in which a DNA fragment complementary to the determined heat shock gene (stress gene) of a heterologous organism is used as a probe is the simplest and most suitable method. As a DNA probe that can be used, specifically, the full-length heat shock gene of a heterologous organism or a part thereof can be used. Alternatively, PCR (polymerase chain reaction, polymerase chain reaction) using a part of the heat shock gene of a heterologous organism as a primer and chromosomal DNA of a genus Nitrosomonas bacterium as a template, and the amplified DNA can be used as a probe.

The DNA screened in this way
The fragment can be amplified using E. coli as a host. Using the amplified DNA fragment, a restriction map can be prepared to identify the gene structure. Furthermore, the nucleotide sequence is determined using a known method such as the Sanger method, and an open reading frame presumed to be a heat shock gene can be identified. Whether the specified open reading frame is a heat shock gene depends on the homology between the primary structure of the encoded peptide and the heat shock protein from a heterologous organism, or the difference between the amino acid sequence of the purified heat shock protein and It can be confirmed by checking.

The heat shock promoter of the present invention is derived from a bacterium belonging to the genus Nitrosomonas, and comprises the heat shock gene dnaK.
A promoter that controls gene transcription, comprising -35
The promoter has a sequence of CTTGA and a sequence of -10 as CCCCATTTA. This heat shock promoter is a special RNA whose number of molecules increases specifically during stress such as heat shock.
It appears to be recognized by the polymerase sigma factor.

To clarify the structure of the heat shock promoter, it is necessary to clarify the transcription start site. Prokaryotes often have a sequence that is specifically recognized by RNA polymerase sigma factor at about 10 bases and about 35 bases upstream from the transcription start site. Such sequences are called a -10 sequence and a -35 sequence, respectively, and the promoter structure can be specified by the surrounding sequences. The heat shock promoter of the present invention is also characterized by -10 and -35 sequences.

In order to determine the transcription start point, mRNA is extracted and purified from heat-shock-induced ammonia-oxidizing bacteria.
It can be revealed by determining its 5 'end. Known methods such as the guanidine hydrochloride method, the hot phenol method, and the ISOGEN method can be used for extraction and purification of mRNA from ammonia-oxidizing bacteria. In addition, the 5 ′ end of the heat shock gene mRNA can be determined by a known method such as a primer extension method and an S1 mapping method.

[0025] The stress sensing gene of the present invention comprises a DNA fragment containing the heat shock promoter and a DNA fragment containing a structural gene which is located downstream of the DNA fragment and encodes a protein whose expression level can be easily detected. It consists of a fusion gene and is obtained by ligating the above structural gene downstream of the heat shock promoter.

The DNA fragment containing the heat shock promoter may be a DNA fragment consisting only of the heat shock promoter, or a DNA fragment having a base sequence bound upstream or downstream of such a DNA fragment. Good.

For example, D containing a heat shock promoter
NA fragment (hereinafter sometimes referred to heat shock promoter region) is Nitrosomonas bacterial chromosomal DNA was digested with restriction enzymes Kpn I to obtain a DNA fragment of 11.5 kb, further the DNA fragment restriction enzymes Eco RI and Eco It can be obtained as a 0.65 kb DNA fragment digested with T22I. It can also be chemically synthesized. The heat shock promoter region thus obtained can be amplified by PCR.

The structural gene constituting the stress sensing gene may be a DNA fragment consisting of only the structural gene, or a DNA fragment having a base sequence bound upstream or downstream of such a DNA fragment. Good. As such a structural gene, a known gene whose expression level can be easily detected can be used, and examples thereof include a gene encoding an enzyme such as the lacZ gene encoding β-galactosidase. The lacZ gene is, for example, Escherichia
It can be cut out as a DNA fragment from E. coli K12 strain by a known method. The amount of expression of the gene encoding the enzyme can be easily measured as the activity of the enzyme.

The recombinant ammonia-oxidizing bacterium of the present invention comprises:
A bacterium that holds the stress sensing gene in a cell, and is obtained by introducing a plasmid vector linked with the stress sensing gene into an ammonia-oxidizing bacterium and transforming the bacterium. Ammonia-oxidizing bacteria serving as hosts are bacteria that oxidize ammonia, and are not limited to bacteria of the genus Nitrosomonas.

As a plasmid vector for introducing the stress sensing gene into the ammonia-oxidizing bacterium, a plasmid capable of autonomously replicating in the ammonia-oxidizing bacterium can be used, and examples thereof include a known plasmid for gram-negative bacteria such as pKT240. The plasmid vector linked with the stress sensing gene can be introduced into ammonia-oxidizing bacteria using a known method such as electroporation or conjugation transfer.

The method for measuring stress of the present invention is a method for measuring the expression level of the structural gene in the stress sensing gene after culturing the above-mentioned recombinant ammonia-oxidizing bacteria under stress conditions. Examples of the stress conditions include a high-temperature environment unsuitable for growth, a pH environment unsuitable for growth, an environment in which heavy metals, toxic substances and other inhibitors are present, and a composite environment thereof.

When a recombinant ammonia-oxidizing bacterium is cultured under such a stress environment, a structural gene located downstream of the heat shock promoter is specifically induced, and its trait is expressed. Therefore, by measuring the expression level of the trait, it is possible to detect whether or not the ammonia-oxidizing bacterium is exposed to stress.

In order to measure the expression level of the trait in the ammonia oxidizing bacterium, various methods can be adopted depending on the structural gene in the stress sensing gene. For example, (1) corresponding to the structural gene in the stress sensing gene A method for quantifying the expression level of mRNA by a known method such as dot blotting or Northern blotting, (2) a method for quantifying the expression activity of a protein produced from a structural gene in a stress sensing gene, for example, measuring an enzyme activity by absorbance or the like (3) a method of preparing an antibody of a protein produced from the structural gene in the stress sensing gene, and quantifying the amount of the produced protein by an antigen-antibody reaction. Among them, the method (2) is preferable because it can be more easily and quantitatively quantified.

[0034]

The heat shock promoter of the present invention is a promoter that is specifically recognized when a bacterium is placed in a stress environment such as a high temperature, and detects a stress by linking a structural gene downstream thereof. Can be used for

The stress sensing gene of the present invention comprises a fusion gene of the above-mentioned heat shock promoter or a DNA fragment containing a nucleotide sequence having a similar function to a DNA fragment containing a structural gene. Can be used to detect

The recombinant ammonia-oxidizing bacterium of the present invention comprises:
Since the above-mentioned stress sensing gene is retained, it can be used for detecting the stress of ammonia-oxidizing bacteria.

Since the method for measuring the stress of ammonia-oxidizing bacteria of the present invention uses the above-mentioned recombinant, it is possible to easily and quickly detect the stress of ammonia-oxidizing bacteria caused by various factors in the environment. it can.

[0038]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The following is a description of embodiments of the present invention. The plasmids and microorganisms used in the examples are as follows. 《 Nitrosomonas europaea IFO14298 shares》
t of Cultures 1992 Microorganisms 9th Edition ". << Escherichia coli DH5 strain >> It is commercially available from Toyobo Co., Ltd. as a competent cell. << Escherichia coli K12 strain >> Available from ATCC. ATCC
No.10798 (Catalogue of Bacteria & Phages 17thedit
ion, 1991).

<< pUC19 >> A plasmid vector for Escherichia coli.
Commercially available from Toyobo Co., Ltd. << pHSG296 >> Plasmid vector for E. coli. Commercially available from Takara Shuzo Co., Ltd. << pKK223-3 >> Plasmid vector for E. coli. Commercially available from Pharmacia Biotech. << pKT240 >> IncQ plasmid. Available from ATCC.
ATCC No. 37258 (Catalogue of Recombinabt DNA Materi
als 2nd edition, 1991)

Example 1 << Cloning of dnaK Gene Derived from N. europaea >> This corresponds to the amino acid sequences of two regions having high commonality in the primary structure of DnaK (Hsp70) protein of various organisms reported so far. Oligonucleotide mix primers, NDK-N and NDK-C, were synthesized. The sequences of these oligonucleotides are shown in Table 1.

[0041]

[Table 1] The numbers at both ends of the amino acid sequence indicate the residue numbers in the Escherichia coli DnaK protein. R represents A, G, Y represents T, C, and N represents an equimolar mixture of A, G, T, C.

Next, the synthesized two oligonucleotides (NDK-N and NDK-C) were used as primers and N. europ
PCR was performed using chromosomal DNA derived from aea IFO14298 strain (hereinafter simply referred to as N. europaea ) as a template. As a PCR reagent, Takara PCR amplification kit manufactured by Takara Shuzo Co., Ltd. was used. That is, 0.5 μg of N. europaea chromosomal DNA, 20 pmol
Of each primer, 5 μl of 10 x PCR buffer, 5 μl of 2.5
mM dNTP mixture, 0.5μl 5U / ml Takara Taq polymera
se to PerkinElmer Micro Amp Tube (trademark)
And adjusted to 50 μl with distilled water. Transfer this to PerkinElmer GeneAmp PCR System 2400,
After 30 seconds of pre-treatment, one cycle is 94 ° C for 30 seconds, 55 ° C
, And a reaction consisting of a continuous reaction at 72 ° C. for 1.5 minutes was repeated 25 cycles. Further, a post-treatment was performed at 72 ° C. for 10 minutes.

The amplified PCR product was recovered by ethanol precipitation after phenol-chloroform treatment. That is, the reaction-terminated liquid was mixed with a TE-saturated phenol: chloroform: isoamyl alcohol mixture at a volume ratio of 25: 24: 1, and centrifuged at 10,000 × g for 5 minutes to obtain a supernatant. 3 M sodium acetate corresponding to 1/10 volume of the supernatant was added and mixed well, and then ethanol corresponding to 2.5 volumes was added. After mixing, the mixture was allowed to stand at -80 ° C for 15 minutes. 10,000 xg, 10
The PCR product obtained as a precipitate by centrifugation for 70 minutes was rinsed with 70% ethanol, and then dried under reduced pressure.

The obtained PCR product was prepared in a TE buffer (10 mM Tris-C).
(pH 8.0), 1 mM EDTA) and subjected to 2% agarose gel electrophoresis. After completion of the electrophoresis, the gel was transferred to a 10 μg / ml ethidium bromide solution and left at room temperature for 30 minutes. After sufficiently washing the gel with water, DNA bands were detected by ultraviolet irradiation. As a result, a clear DNA band was detected at a position corresponding to 0.65 kb. Cut out the gel containing the same DNA band, DNA C
DNA contained in the gel was extracted using ELL (trademark, manufactured by Kusano Scientific Instruments). The DNA solution was recovered by ethanol precipitation after phenol / chloroform treatment. Using 1 μg of the recovered DNA as a template, DNA labeled with dioxygenin by a random primer method using a Boehringer Mannheim Nonradioactive DNA Labeling Kit
A probe was made.

3 μg of N. europaea chromosomal DNA was completely digested with KpnI , subjected to 0.8% agarose gel electrophoresis, and then transferred to a nitrocellulose filter. After immobilizing the DNA on the filter by heat treatment at 80 ° C. for 2 hours, Southern hybridization using the DNA probe labeled with dioxygenin was performed. Hybridization: 5xSSC; blocking reagent, 0.5%; N-lauroylsarc
The hybridization was performed at a temperature of 68 ° C. using a hybridization solution having a composition of osine Na-salt, 0.05% (w / v); SDS, 0.1% (w / v). The detection of the signal was performed using the Nonradioactive DNA Detection Kit manufactured by Boehringer Mannheim. As a result, a signal was detected at a position of about 11.5 kb.

Next, 10 μg of chromosomal DNA of N. europaea was again
The whole was digested with KpnI and subjected to 0.8% agarose gel electrophoresis. After the gel was stained with ethidium bromide, a gel containing DNA corresponding to 11.5 kb was cut out, and DNA contained in the gel was extracted using DNA CELL (trademark, manufactured by Kusano Scientific Instruments). The DNA solution was recovered by ethanol precipitation after phenol / chloroform treatment.

About 0.1 μg of the obtained DNA fragment was mixed with 0.05 μg of pUC19 plasmid completely digested with KpnI and treated with alkaline phosphatase, and ligated.
For ligation, a DNA ligation kit manufactured by Takara Shuzo Co., Ltd. was used. That is, after adding the ligation solution A corresponding to 4 times the amount of the mixed DNA solution and mixing well,
Add the same amount of ligation solution B as the mixed DNA solution,
After mixing, the reaction was carried out at 16 ° C. for 1 hour.

The obtained ligation product was used for E. coli DH5
The strain was introduced into competent cells (manufactured by Toyobo Co., Ltd.) and transformed to obtain transformants resistant to ampicillin. 800 transformants arbitrarily selected were replicated on a new LB plate medium containing 50 μg / ml of ampicillin so as to have 100 colonies per plate, and colony hybridization was performed using the DNA probe labeled with dioxygenin. Was. Hybridization is 5xSSC; b
locking reagent, 0.5%; N-lauroylsarcosineNa-salt,
Using a hybridization solution having a composition of 0.05% (w / v); SDS, 0.1% (w / v), the temperature was 68 ° C.

The detection of the signal was carried out using a Nonradioactive DNA Detection Kit manufactured by Boehringer Mannheim. As a result, six positive clones showing a signal were obtained. Alkaline-S from these positive clones
The plasmid was purified by the DS method, and the Kpn I digest was analyzed by agarose gel electrophoresis. As a result, it was revealed that all plasmids had a foreign DNA fragment of 11.5 kb. Any one of these plasmids was selected, named pNEK10, and used in subsequent experiments. The restriction enzyme map of Kpn I region of 11.5kb included in pNEK10 shown in FIG.
In FIG. 1, the thin line is DNA derived from pUC19, the thick line is foreign DNA derived from N. europaea , and the white line is 2.6 kb Ec whose base sequence was determined.
o RI- shows the Hin dIII region. The narrow hatching indicates the position of the DNA probe, and the wide hatching indicates the position of the dnaK gene. The arrows and symbols below them indicate the position, direction, and name of the primer DNA used in the analysis.

[0050] in which position the Kpn I region of 11.5kb included in the PNEK10, in order to clarify whether a region is present a DNA probe homologous used for cloning of the dnaK gene, the PNEK10 as template DNA PCR was performed. Various primers were combined, and four series of reactions from A to D were performed. The combination of primers is as follows: A; M13-47 (Takara Shuzo) and NDK-N, B; M13-47 and NDK-C, C; RV-M (Takara Shuzo) and NDK-N, D; RV -M and NDK-C. As a result, a specific DNA band was detected at 3.5 kb in the A system and at 8.5 kb in the D system. No DNA amplification was observed in the B and C lines. From the above results, it was found that a region having a homology to the sequence used for the DNA probe was present in a narrow hatched region in FIG.

[0051] The 2.6kb containing a region of sequence homology using the DNA probe Eco RI-Hin dIII region (in FIG. 1, the white line)
Was determined for the entire nucleotide sequence. As a result, this fragment
The DNA was found to be composed of 2,618 base pairs. When a major open reading frame (ORF) was searched, an ORF consisting of 1,935 bp starting 321 bases downstream from the Eco RI site was found. The position of this ORF is indicated by a wide oblique line in FIG.

A search for a protein having homology with the amino acid sequence deduced from the ORF from a known database revealed that the protein exhibits homology with the Hsp70 (DnaK) protein of a heterologous microorganism throughout the entire region. For example, from E. coli
In comparison with DnaK protein, it showed 73.9% homology. From the results, the ORF was converted to dnaK derived from N. europaea.
It was determined to be a gene. The nucleotide sequence of this dnaK gene and the primary structure of the gene product are shown in SEQ ID NOs: 1 and 2.

<<N. europaeaOrigindnaKInitiation of gene transcription
Point Determination >>N. europaeaWith 2.5 g / l (NH_Four)_TwoSO_Four,
 0.7g / l KH_TwoPO_Four, 19.5g / l Na_TwoHPO _Four, 0.5g / l NaHCO_Three, 0.
1g / l MgSO_Four・ 7H_TwoO, 5mg / l CaCl_Two・ 2H_TwoO, 1mg / l Fe-EDTA,
pH 8.0) at 28 ° C until the nitrite concentration is approximately 5 mM.
Cultured aerobically. GVWP04700 filter from 400ml culture
-Collect cells using Nippon Millipore Limited
After washing with fresh P medium, 100 ml of fresh P medium
It was transferred to two grounds and cultured again aerobically at 28 ° C.

After culturing for 3 hours, the cells were collected again and suspended in a fresh P medium so that the absorbance at 660 nm became 2. Transfer 1 ml of the suspension to two 1.5 ml microcentrifuge tubes, one at 28 ° C. and the other at 42 ° C. to give heat shock.
And sampled over time (after 0, 10, 30, 90 minutes). The cells were immediately collected from 330 μl of the suspension by centrifugation (10,000 × g, 1 minute),
n (Nippon Gene) was used to extract and purify total RNA. 4 to 12 μg per 330 μl of suspension (equivalent to 60 ml of culture solution)
RNA was extracted and purified.

Using the purified RNA as a template, a fluorescently labeled K337 primer (see FIG. 2) was annealed, and an extension reaction was performed with a reverse transcriptase according to a standard method.
That is, 3 μg of total RNA and 3 pmol of K337 primer (5′-GTTGGT
AGTCCCAAGGTCGATGCC-3 ′, corresponding to the 16th to 39th sequences of the nucleotide sequence of SEQ ID NO: 1), 1.7 μl of 3M KCl, 2.
Add 0 μl of 10 mM TE buffer (pH 8.0) and use sterile water
20 μl. After an annealing reaction at 60 ° C. for 1 hour, the temperature was returned to room temperature, and 60 μl of an RTase buffer (16.7 mM KCl, 1
3.3mM MgCl ₂ , 23.3mM Tris-Cl (pH8.3), 13.3mM DTT, 0.
33mM dNTP mixture, 0.14mg / ml actinomycin D), 1μl
RNase inhibitor (20U / ml; manufactured by Toyobo Co., Ltd.)
1 μl of AMV Reverse transcriptase XL (30 U / ml; manufactured by Toyobo Co., Ltd.) was added, and extension reaction was performed at 37 ° C. for 1 hour.

The extension product was ethanol-precipitated, air-dried, and electrophoresis buffer (95% formamide, 20 mM EDTA, 0.05% Met).
hyl Violet). The suspension was subjected to urea-polyacrylamide gel electrophoresis, and its chain length was measured using a FMBIO-100 fluorescence image analyzer (manufactured by Hitachi Software Engineering Co., Ltd.). As a result, no extension product was obtained from the sample derived from N. europaea incubated at 28 ° C., but from the sample derived from N. europaea subjected to heat shock at 42 ° C., 70 bases and 7 bases were obtained.
An extension product having a length of one base was confirmed (FIG. 3).

From these results, it was found that heat shock induced transcription of the dnaK gene. Further, as shown in FIG. 2, it was revealed that the transcription start point was A or C 31 or 32 bases upstream from the start codon. The 7-35 bases upstream from the A of the transcription initiation point, sequences with homology to the sigma ³² dependent promoters of E. coli (CTTGA-15
bp-CCCCATTTA). From the above results, it was concluded that the above sequence was a heat shock promoter derived from N. europaea dnaK . N. europaea obtained in this way
Table 2 shows the nucleotide sequences of the dnaK promoter and the E. coli heat shock promoter.

[0058]

[Table 2] The numbers at both ends of the base sequence of N. europaea dnaK indicate the number of bases counted from the first A in SEQ ID NO: 1, and a minus indicates that the base is upstream.

<< Construction of Fusion Gene Vector and Preparation of Transformant >> Downstream of the dnaK gene promoter, dnaK - lac
PKLAC72, a plasmid encoding a translational fusion gene for Z
Eight constructions were made. Schematic diagrams are shown in FIGS. First, PCR cloning of the kanamycin acetyltransferase gene (kanamycin resistance gene) derived from Tn903 was performed. That is, the pHSG296 plasmid was used as the template DNA
PCR was performed using the two oligonucleotides shown in Table 3 as primers.

[0060]

[Table 3]

As a result of the PCR, an amplification product of 1.2 kb was obtained. The amplification products Pst I, digested with Pvu II, the advance PKT240 P
st I, and ligated with the 5.8kb fragment was digested with Pvu II. The ligation product is transformed into E. coli DH5 strain,
The desired pKKM712 was obtained from the obtained transformant (see FIG. 4).

Next, PCR cloning of the terminator region of the Escherichia coli 5S RNA gene was performed. That is, pKK223-
3 PCR was performed using plasmid DNA as template DNA and two kinds of oligonucleotides shown in Table 4 as primers.

[0063]

[Table 4]

As a result of the PCR, an amplification product of 0.3 kb was obtained. The amplified product Eco T22I, was digested with Pst I, and ligated with pKKM712 was alkaline phosphatase treated previously digested with Pst I. The ligation product was transformed into Escherichia coli DH5 strain, and the desired pK
TK40 was obtained (see FIG. 4).

Next, the P of the lacZ gene derived from E. coli chromosomal DNA
CR cloning was performed. That is, PCR was performed using chromosomal DNA of the Escherichia coli K12 strain as a template DNA and two types of oligonucleotides shown in Table 5 as primers.

[0066]

[Table 5]

As a result of the PCR, an amplification product of 3.1 kb was obtained. This amplification product was digested with Eco T22I and Pst I, and ligated with pKTK40 previously digested with Pst I and treated with alkaline phosphatase. The ligation product was transformed into Escherichia coli DH5 strain, and the obtained pKLA
C726 was obtained (see FIG. 5).

For ligation with the above pKLAC726
DNA fragments encoding the promoter region of the dnaK gene and the N-terminal region of the DnaK protein were obtained as follows. A schematic diagram is shown in FIG. That is, a 1.05 kb Eco RI fragment encoding the promoter region of the dnaK gene and the N-terminal region of the DnaK protein was removed from pNEK10 , and Eco
PU digested with RI and treated with alkaline phosphatase
Ligation with C19 (see FIG. 6). The ligation product was transformed into Escherichia coli DH5 strain, and the resulting transformant was found to have a Pst I promoter having a promoter region of dnaK gene of 0.62 kb.
-A plasmid pNEK12 present in the Eco T22I region was obtained (see FIG. 6).

From this pNEK12, 0.62 kb encoding the promoter region of the dnaK gene and the N-terminal region of the DnaK protein
Taken out of the Pst I- Eco T22I fragment was ligated with pKLAC726 which had been digested with alkaline phosphatase previously treated with Pst I (see Figure 5). The ligation product was transformed into Escherichia coli DH5 strain, and from the resulting transformant,
The desired 11.0 kb pKLAC728 was obtained (see FIG. 5).

The resulting pKLAC728 contains a translational fusion gene of dnaK - lacZ , which is transcriptionally controlled by the dnaK promoter region. Escherichia coli-derived 5S terminator is present upstream of this promoter region, and suppresses read-through from upstream. Furthermore, the pKLAC728 plasmid carries a kanamycin resistance gene as a marker gene expressed in N. europaea cells.

<< Heat Shock Response of Transformant >> pKLAC728
Was introduced into N. europaea by electroporation to obtain a transformant (recombinant). The apparatus used was a Gene Pulser and a cuvette manufactured by Bio-Rad. That is, pKLAC728 and N. eur
Ice-cooled cuvette of opaea mixture (electrode spacing
0.2 cm) and immediately attached to a Gene Pulser cuvette chamber and subjected to an electric pulse. The pulse setting conditions were 5 to 12.5 kV / cm and 5.0 msec.

The recombinant thus obtainedN. europaea
(pKLAC728) strain, P medium containing 25 μg / ml kanamycin
Using 300 ml, darken at 30 ° C until the nitrite concentration becomes about 5 mM.
The cells were cultured aerobically with shaking. The cells are GVWP04700 fill
Bacteria (manufactured by Nippon Millipore Limited), and 25
Contains 100 ml of fresh P medium containing μg / ml kanamycin
Transfer to a flask and aerobically in the dark at 30 ° C
The cells were cultured with shaking for 4 hours. Bacterial filter again GVWP04700
Harvest cells and immediately use fresh 25 μg / ml kanamycin
Absorbance at 660 nm is about 5 in P medium containing
As above. Add 0.05 ml of suspension to 5 ml of fresh 25 μg / m
Transfer to a culture tube containing P medium containing 1 kanamycin
One was cultured at 30 ° C and the other at 37 ° C with shaking. Sutra
Occasionally sample 0.1 ml from the culture and
Cuctosidase activity was measured.

Β-galactosidase activity was determined according to Miller's method.
Was used. That is, 0.1 ml of culture solution and 0.0
Z buffer containing 05% SDS (4.27 g / l Na_TwoHPO_Four, 2.75g / l Na
H_TwoPO _Four・ H_TwoO, 0.375g / l KCl, 0.125g / l MgSO_Four・ 7H_TwoO, pH
7.0) and pre-incubation at 30 ℃ for 5 minutes
I did. 4mg / ml ortho-nitrophenol galactopyrano
The reaction is started by adding 0.2 ml of an aqueous solution of Sid (ONPG),
For a certain period of time. 0.5ml 1M Na_TwoCO_ThreePlus anti
Stop the reaction and immediately absorb at 420 and 550 nm wavelengths.
I asked. As a blank test, instead of a sample
A similar reaction was performed using fresh P medium. Also,
The absorbance of the sample at 660 nm was also measured separately. The result
As shown in FIG.

The β-galactosidase activity in the sample was calculated by the following equation.

(Equation 1)

As a result, as shown in FIG. 7, a remarkable increase in the activity was observed in the system in which the culture temperature was increased to 37 ° C., and the heat shock response was detected using the N. europaea (pKLAC728) strain. It became clear what was possible.

[0076]

[Sequence List] SEQ ID NO: 1 Sequence length: 1935 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism name: Nitrosomonas europaea Strain name: IFO14298 Sequence ATGGCAAAAA TAATTGGCAT CGACCTTGGG ACTACCAACT CATGCGTTGC CGTCATGGAA 60 GGCAACAAAC CCAAGGTCAT TGAAAATGCT GAAGGTGCAA GGACGACGCC GTCGATTGTC 120 GCCTATGCGG AAGACAATGA AATTCTGGTA GGGGCATCGG CCAAGCGTCA GGCAGTCACC 180 AATCCGGAAA ATACCCTGTT TGCGATCAAA CGGTTGATTG GCCGTCGTTT CGATGAAGAA 240 GTGGTGCAAA AGGATATCAG TGTAACGCCC TACAAAATCG TGCGTGCCGA TAACAACGAT 300 GCATGGATAG AAGCACGCGG AAGGAAAATC GCACCGCCGG AGGTTTCTGC ACAGGTGCTG 360 ATAAAAATGA AAAAAACGGC TGAAGATTAT CTGGGTGAGC CGGTTACAGA AGCCGTCATC 420 ACCGTTCCAG CGTATTTCAA CGATTCTCAG CGTCAGGCTA CCAAGGATGC AGGCCGTATC 480 GCAGGGCTGG AAGTCAAACG TATCATCAAT GAACCAACTG CTGCCGCACT TGCATTCGGT 540 TTAGATAAGA AGGAAGGTGA TCGCAAAATT GCGGTATACG ATCTGGGCGG AGGTACGTTT 600 GATATTTCGA TCATCGGAGAGATCGAGATCGAGAGATCGAGATCGAGATCGAGATCGAGATCGAGCACGATCGAGCACGAGATCGAGCACGATCGAGCACGATCGAGCAGGAGATCGAGCGAGACGCGCAGA GTG ACACTTTCCT CGGCGGTGAG GATTTCGACT CCAGAGTGAT CGAATATCTG 720 GTGGATGAAT TCAGGAAAGA GAGTGGTATC GATCTGAAAA AAGATATGCT GGCATTGCAA 780 CGGCTCAAAG ATGCAGCGGA AAAAGCCAAA ATCGAGCTGT CATCCAGCCA ACAGACCGAA 840 GTGAATCTAC CCTATATCAC GGCAGATGCA TCAGGCCCAA AACACCTGGC TGTCAAGATC 900 ACCCGTGCCA AGCTGGAGAG TCTGGTCGAA GAACTGATCG AGCGTACTGC AGGCCCTTGC 960 CGGACTGCGC TTAAAGATGC GGGTTTGTCG GTTTCTGACA TCAATGACGT CATTCTGGTC 1020 GGTGGACAGA CCCGTATGCC GAAAGTCCAG GAGAAGGTCA AGGAAATCTT CGGCAAAGAG 1080 CCGCGCAAAG ATGTCAATCC TGACGAGGCA GTTGCCATCG GTGCTGCGAT CCAGGGCGGG 1140 GTGCTGAAAG GAGATGTCAA GGATGTGCTG CTGCTGGATG TGACTCCACT GTCGTTGGGA 1200 ATCGAAACAC TGGGTGGCGT CATGACCAAG TTGATCCAGA AGAACACCAC CATTCCGACC 1260 AAGGCGCAGC AGGTGTTCTC GACAGCGGAC GATAACCAGA CAGCGGTGAC CATTCACGTA 1320 TTGCAGGGTG AGCGGGAAGT GGCCTCCGGC AATAAAAGTC TAGGCCAGTT CAACCTGACC 1380 GATATTCCGT CAGCACCCCG CGGAATGCCT CAGATCGAGG TGATTTTCGA TATCGATGCC 1440 AACGGTATTC TGCATGTTTC AGCTAAAGAC AAGGCAACCG GCAAGGAAAA CAAGATCAAG 1500 ATCCAGGCAA GCTCCGG GCT GTCTGAAGAT GAAATCCAGA AAATGGTAAA AGATGCCGAA 1560 GCGCATGCGG AAGAAGACAA AAAAGCACTG GATCTGGTCA ACAGTCGTAA CCAGTGTGAC 1620 GCCATGATTC ATTCAGTCAG AAAATCACTG GCTGAATACG GTGACAAACT GGAAGGGGAT 1680 GAAAAATCCA GAATCGAGGC AGCGTTGAAA GAGGCCGAGG AAGCACTCAA ATCCGGCGAT 1740 AAACAGACGA TCGATGCCAA AACCCAGGCG TTGACCGAAG CTTCGCATAA ACTGGCTGAG 1800 AAGATGTACG CCCAGGAGCA GGCGCAGGCT GGTCAGCAGG CAGGTGCCGG GACTGCATCC 1860 GATCAGTCTC AGGATAAGCC GGTTGAAGGC GAAGTCGTCG ATGCCGAATT CGAGGAAGTC 1920 AAAGATAAAA AATGA

SEQ ID NO: 2 Sequence length: 1935 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism: Nitrosomonas europaea Strain: IFO14298 Sequence ATG GCA AAA ATA ATT GGC ATC GAC CTT GGG ACT ACC AAC TCA TGC GTT 48 Met Ala Lys Ile Ile Gly Ile Asp Leu Gly Thr Thr Asn Ser Cys Val 1 5 10 15 GCC GTC ATG GAA GGC AAC AAA CCC AAG GTC ATT GAA AAT GCT GAA GGT 96 Ala Val Met Glu Gly Asn Lys Pro Lys Val Ile Glu Asn Ala Glu Gly 20 25 30 GCA AGG ACG ACG CCG TCG ATT GTC GCC TAT GCG GAA GAC AAT GAA ATT 144 Ala Arg Thr Thr Pro Ser Ile Val Ala Tyr Ala Glu Asp Asn Glu Ile 35 40 45 CTG GTA GGG GCA TCG GCC AAG CGT CAG GCA GTC ACC AAT CCG GAA AAT 192 Leu Val Gly Ala Ser Ala Lys Arg Gln Ala Val Thr Asn Pro Glu Asn 50 55 60 ACC CTG TTT GCG ATC AAA CGG TTG ATT GGC CGT CGT TTC GAT GAA GAA 240 Thr Leu Phe Ala Ile Lys Arg Leu Ile Gly Arg Arg Phe Asp Glu Glu 65 70 75 80 GTG GTG CAA AAG GAT ATC AGT GTA ACG CCC TAC AAA ATC GTG CGT GCC 288 Val Val Gln Lys Asp Ile Ser Val Thr Pro Tyr Lys Ile Val Arg Ala 85 90 95 GAT AAC AAC GAT GCA TGG ATA GAA GCA CGC GGA AGG AAA ATC GCA CCG 336 Asp Asn Asn Asp Ala Trp Ile Glu Ala Arg Gly Arg Lys Ile Ala Pro 100 105 110 CCG GAG GTT TCT GCA CAG GTG CTG ATA AAA ATG AAA AAA ACG GCT GAA 384 Pro Glu Val Ser Ala Gln Val Leu Ile Lys Met Lys Lys Thr Ala Glu 115 120 125 GAT TAT CTG GGT GAG CCG GTT ACA GAA GCC GTC ATC ACC GTT CCA GCG 432 Asp Thr Leu Gly Glu Pro Val Thr Glu Ala Val Ile Thr Val Pro Ala 130 135 140 TAT TTC AAC GAT TCT CAG CGT CAG GCT ACC AAG GAT GCA GGC CGT ATC 480 Tyr Phe Asn Asp Ser Gln Arg Gln Ala Thr Lys Asp Ala Gly Arg Ile 145 150 155 160 GCA GGG CTG GAA GTC AAA CGT ATC ATC AAT GAA CCA ACT GCT GCC GCA 528 Ala Gly Leu Glu Val Lys Arg Ile Ile Asn Glu Pro Thr Ala Ala Ala Ala 165 170 175 CTT GCA TTC GGT TTA GAT AAG AAG GAA GGT GAT CGC AAA ATT GCG GTA 576 Leu Ala Phe Gly Leu Asp Lys Lys Glu Gly Asp Arg Lys Ile Ala Val 180 185 190 TAC GAT CTG GGC GGA GGT ACG TTT GAT ATT TCG ATC ATC GAA AT C GCA 624 Thr Asp Leu Gly Gly Gly Thr Phe Asp Ile Ser Ile Ile Glu Ile Ala 195 200 205 GAA GTC GAA GGC GAA CAC CAG TTC GAA GTG CTG GCA ACC AAT GGT GAC 672 Glu Val Glu Gly Glu His Gln Phe Glu Val Leu Ala Thr Asn Gly Asp 210 215 220 ACT TTC CTC GGC GGT GAG GAT TTC GAC TCC AGA GTG ATC GAA TAT CTG 720 Thr Phe Leu Gly Gly Glu Asp Phe Asp Ser Arg Val Ile Glu Thr Leu 225 230 235 240 GTG GAT GAA TTC AGG AAA GAG AGT GGT ATC GAT CTG AAA AAA GAT ATG 726 Val Asp Glu Phe Arg Lys Glu Ser Gly Ile Asp Leu Lys Lys Asp Met 245 250 255 CTG GCA TTG CAA CGG CTC AAA GAT GCA GCG GAA AAA GCC AAA ATC GAG 816 Leu Ala Leu Gln Arg Leu Lys Asp Ala Ala Glu Lys Ala Lys Ile Glu 260 265 270 CTG TCA TCC AGC CAA CAG ACC GAA GTG AAT CTA CCC TAT ATC ACG GCA 864 Leu Ser Ser Ser Gln Gln Thr Glu Val Asn Leu Pro Tyr Ile Thr Ala 275 280 285 GAT GCA TCA GGC CCA AAA CAC CTG GCT GTC AAG ATC ACC CGT GCC AAG 912 Asp Ala Ser Gly Pro Lys His Leu Ala Val Lys Ile Thr Arg Ala Lys 290 295 300 CTG GAG AGT CTG GTC GAA GAA CTG ATC GAG CGT AC T GCA GGC CCT TGC 960 Leu Glu Ser Leu Val Glu Glu Leu Ile Glu Arg Thr Ala Gly Pro Cys 305 310 315 320 CGG ACT GCG CTT AAA GAT GCG GGT TTG TCG GTT TCT GAC ATC AAT GAC 1008 Arg Thr Ala Leu Lys Asp Ala Gly Leu Ser Val Ser Asp Ile Asn Asp 325 330 335 GTC ATT CTG GTC GGT GGA CAG ACC CGT ATG CCG AAA GTC CAG GAG AAG 1056 Val Ile Leu Val Gly Gly Gln Thr Arg Met Pro Lys Val Gln Glu Lys 340 345 350 GTC AAG GAA ATC TTC GGC AAA GAG CCG CGC AAA GAT GTC AAT CCT GAC 1104 Val Lys Glu Ile Phe Gly Lys Glu Pro Arg Lys Asp Val Asn Pro Asp 355 360 365 GAG GCA GTT GCC ATC GGT GCT GCG ATC CAG GGC GGG GTG CTG AAA GGA 1152 Glu Ala Val Ala Ile Gly Ala Ala Ile Gln Gly Gly Val Leu Lys Gly 370 375 380 GAT GTC AAG GAT GTG CTG CTG CTG GAT GTG ACT CCA CTG TCG TTG GGA 1200 Asp Val Lys Asp Val Leu Leu Leu Asp Val Thr Pro Leu Ser Leu Gly 385 390 395 400 400 ATC GAA ACA CTG GGT GGC GTC ATG ACC AAG TTG ATC CAG AAG AAC ACC 1248 Ile Glu Thr Leu Gly Glu Val Met Thr Lys Leu Ile Gln Lys Asn Thr 405 410 415 ACC ATT CCG ACC AAG GCG CAG CAG GTG TTC TCG ACA GCG GAC GAT AAC 1296 Thr Ile Pro Thr Lys Ala Gln Gln Val Phe Ser Thr Ala Asp Asp Asn 420 425 430 CAG ACA GCG GTG ACC ATT CAC GTA TTG CAG GGT GAG CGG GAA GTG GCC 1344 Gln Thr Ala Val Thr Ile His Val Leu Gln Gly Glu Arg Glu Val Ala 435 440 445 TCC GGC AAT AAA AGT CTA GGC CAG TTC AAC CTG ACC GAT ATT CCG TCA 1392 Ser Gly Asn Lys Ser Leu Gly Gln Phe Asn Leu Thr Asp Ile Pro Ser 450 455 460 GCA CCC CGC GGA ATG CCT CAG ATC GAG GTG ATT TTC GAT ATC GAT GCC 1440 Ala Pro Arg Gly Met Pro Gln Ile Glu Val Ile Phe Asp Ile Asp Ala 465 470 475 480 AAC GGT ATT CTG CAT GTT TCA GCT AAA GAC AAG GCA ACC GGC AAG GAA 1488 Asn Gly Ile Leu His Val Ser Ala Lys Asp Lys Ala Thr Gly Lys Glu 485 490 495 AAC AAG ATC AAG ATC CAG GCA AGC TCC GGG CTG TCT GAA GAT GAA ATC 1536 Asn Lys Ile Lys Ile Gln Ala Ser Ser Gly Leu Ser Glu Asp Glu Ile 500 505 510 CAG AAA ATG GTA AAA GAT GCC GAA GCG CAT GCG GAA GAA GAC AAA AAA 1584 Gln Lys Met Val Lys Asp Ala Glu Ala His Ala Glu Glu Asp Lys Lys 515 520 525 GCA C TG GAT CTG GTC AAC AGT CGT AAC CAG TGT GAC GCC ATG ATT CAT 1632 Ala Leu Asp Leu Val Asn Ser Arg Asn Gln Cys Asp Ala Met Ile His 530 535 540 TCA GTC AGA AAA TCA CTG GCT GAA TAC GGT GAC AAA CTG GAA GGG GAT 1680 Ser Val Arg Lys Ser Leu Ala Glu Thr Gly Asp Lys Leu Glu Gly Asp 545 550 555 560 GAA AAA TCC AGA ATC GAG GCA GCG TTG AAA GAG GCC GAG GAA GCA CTC 1728 Glu Lys Ser Arg Ile Glu Ala Ala Leu Lys Glu Ala Glu Glu Ala Leu 565 570 575 AAA TCC GGC GAT AAA CAG ACG ATC GAT GCC AAA ACC CAG GCG TTG ACC 1776 Lys Ser Gly Asp Lys Gln Thr Ile Asp Ala Lys Thr Gln Ala Leu Thr 580 585 590 GAA GCT TCG CAT AAA CTG GCT GAG AAG ATG TAC GCC CAG GAG CAG GCG 1824 Glu Ala Ser His Lys Leu Ala Glu Lys Met Thr Ala Gln Glu Gln Ala 595 600 605 CAG GCT GGT CAG CAG GCA GGT GCC GGG ACT GCA TCC GAT CAG TCT CAG 1872 Gln Ala Gly Gln Gln Ala Glu Ala Glu Thr Ala Ser Asp Gln Ser Gln 610 615 620 GAT AAG CCG GTT GAA GGC GAA GTC GTC GAT GCC GAA TTC GAG GAA GTC 1920 Asp Lys Pro Val Glu Gly Glu Val Val Asp Ala Glu Phe Glu Glu Va l 625 630 635 640 AAA GAT AAA AAA TGA 1935 Lys Asp Lys Lys

SEQ ID NO: 3 Sequence length: 20 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic primer DNA sequence CAR GCN ACN AAR GAY GCN GG 20 Gln Ala Thr Lys Asp Ala Gly 1 5

Sequence number: 4 Sequence length: 20 Sequence type: Number of nucleic acid chains: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic primer DNA sequence GCN ACN GCY TCR TCN GGR TT 20 Asn Pro Asp Glu Ala Val Ala 1 5

SEQ ID NO: 5 Sequence length: 24 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic primer DNA sequence GTTGGTAGTC CCAAGGTCGA TGCC 24

SEQ ID NO: 6 Sequence length: 13 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism name: Nitrosomonas europaea Strain name: IFO14298 Sequence characteristics Symbol representing -35 signal Location: 8..12 Method for determining characteristics: E sequence AAGGGTACTT GAG 13

SEQ ID NO: 7 Sequence length: 10 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism name: Nitrosomonas europaea Strain name: IFO14298 Sequence characteristics Features Symbol representing the symbol: -10 signal Location: 1..9 Method used to determine characteristics: E sequence CCCCATTTAC 10

SEQ ID NO: 8 Sequence length: 13 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism name: Escherichia coli sequence characteristics Characteristic symbols: -35 signal Location: 1..13 Method for determining characteristics: S sequence TTTCCCCCTT GAA 13

SEQ ID NO: 9 Sequence length: 10 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism name: Escherichia coli sequence characteristics Characteristic symbols: -10 signal Location: 1..10 Method for determining features: S array CCCCATTTCT 10

SEQ ID NO: 10 Sequence length: 13 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism name: Escherichia coli sequence characteristics Characteristic symbols: -35 signal Location: 1..13 Characteristic determination method: S sequence TCTCCCCCTT GAT 13

SEQ ID NO: 11 Sequence length: 10 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism name: Escherichia coli sequence characteristics Characteristic symbols: -10 signal Location: 1..10 Method for determining characteristics: S array CCCCATTTAG 10

SEQ ID NO: 12 Sequence length: 13 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism name: Escherichia coli sequence characteristics Characteristic symbols: -35 signal Location: 1..13 Method for determining characteristics: S sequence TTGGGCAGTT GAA 13

SEQ ID NO: 13 Sequence length: 10 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism name: Escherichia coli sequence characteristics Characteristic symbols: -10 signal Location: 1..10 Method for determining characteristics: S array CCCCTATTAC 10

SEQ ID NO: 14 Sequence length: 13 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism name: Escherichia coli sequence characteristics Characteristic symbols: -35 signal Location: 1..13 Method for determining characteristics: S sequence TCTCGGCGTT GAA 13

SEQ ID NO: 15 Sequence length: 10 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism name: Escherichia coli sequence characteristics Characteristic symbols: -10 signal Location: 1..10 Method for determining characteristics: S array CCCCATATAC 10

SEQ ID NO: 16 Sequence length: 29 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic primer DNA sequence GGCTGCAGGA TCCAGCCAGA AAGTGAGGG 29

SEQ ID NO: 17 Sequence length: 27 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic primer DNA sequence GGCAGCTGCC GTCCCGTCAA GTCAGCG 27

SEQ ID NO: 18 Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic primer DNA sequence GGATGCATGC GAGAGTAGGG AACTGCC 27

SEQ ID NO: 19 Sequence length: 37 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid Synthetic primer DNA sequence GGCTGCAGCA TGCGACAGGA AGAGTTTGTA GAAACGC 37

SEQ ID NO: 20 Sequence length: 27 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic primer DNA sequence GGCTGCAGCC GTCGTTTTAC AACGTCG 27

SEQ ID NO: 21 Sequence length: 31 Sequence type: number of nucleic acid strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic primer DNA sequence CCATGCATAC GGGCAGACAT GGCCTGCCCG G31

SEQ ID NO: 23 Sequence length: 180 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism name: Nitrosomonas europaea Strain name: IFO14298 Sequence characteristics Features Symbol indicating -35 signal Location: 85..89 Method for determining characteristics: E sequence characteristics Symbol for characteristic: -10 signal Location: 105..113 Method for determining characteristics: E sequence CATGCAAAAA GGTTATATGT TGCACGATCG GGTAATTCGT CCCGCTATGG TGACTGTTTC 60 AAAGGCCAAG GGTACTTGAG ATTTTCAGGA GAGCCCCCAT TTACGCTACA GGATAAATTT 120 CAATTCATAA AGGACATACT ATGGCAAAAA TAATTGGCAT CGACCTTGGG ACTACCAACT 180

SEQ ID NO: 24 Sequence length: 27 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: other nucleic acid Fusion DNA sequence GATAACAACG ATGCAGCCGT CGTTTTA 27

[Brief description of the drawings]

[1] restriction enzyme map of Kpn I fragment of 11.5kb included in pNEK10 obtained in Example. The map, the thin line DNA derived from pUC19, the thick line is the foreign DNA, the white line portion derived from N. europaea indicates the Eco RI-Hin dIII region of 2.6kb was sequenced. The narrow diagonal lines indicate the position of the DNA probe, and the wide diagonal lines indicate the position of the dnaK gene. The arrows and symbols below them indicate the position, direction, and name of the primer DNA used in the analysis.

FIG. 2 shows the nucleotide sequence of the upstream region of the dnaK gene.

FIG. 3 is an image diagram of polyacrylamide gel electrophoresis of RNA purified from N. europaea cultured at 28 ° C. or 42 ° C. The left lane is dn using K377 primer.
Shows the ladder when the aK upstream region was sequenced.

FIG. 4 is a schematic diagram showing the construction process of pKLAC728 in Example 1.

FIG. 5 is a schematic diagram showing the construction process of pKLAC728 in Example 1.

FIG. 6 is a schematic diagram showing the process of constructing a DNA fragment encoding the promoter region of the dnaK gene and the N-terminal region of the DnaK protein used in Example 1.

FIG. 7. Heat shock response of N. europaea (pKLAC728) strain.
In the figure, open circles indicate the β-galactosidase activity of cells cultured at 30 ° C. and solid circles at 37 ° C.

──────────────────────────────────────────────────続 き Continued on front page (51) Int.Cl. ⁶ Identification code FI C12R 1:01) (C12N 1/21 C12R 1:01)

Claims (5)

[Claims] 1. A heat shock promoter derived from a bacterium of the genus Nitrosomonas . 2. The -35 sequence is CTTGA, and the -10 sequence is CCCCA.
The heat shock promoter according to claim 1, which is TTTA. 3. A DNA fragment containing the heat shock promoter according to claim 1 or 2, and a DNA fragment containing a structural gene encoding a protein which is located downstream of the DNA fragment and whose expression level can be easily detected. A stress sensing gene comprising a fusion gene. 4. A recombinant ammonia-oxidizing bacterium comprising the stress-sensing gene according to claim 3 in a cell. 5. A method for measuring the stress of ammonia-oxidizing bacteria, comprising culturing the recombinant according to claim 4 under stress conditions, and then measuring the expression level of the stress-sensing gene according to claim 3. .