JPH0959299A - Fused muts protein and its production - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new fused protein having high reactivity with mismatched double stranded DNA and useful for detection of spot mutation of DNA by the combination of N terminal of MutS protein with a segment of N terminal side of N protein of lamda phage. SOLUTION: This new protein has the sequence of the formula and prepared by the combination of N terminal of MutS protein with a segment of N terminal side of N protein of lamda phage. This protein is highly reactive with mismatched double stranded DNA and useful for detecting spot mutation of DNA namely for the detection of the mismatched region of the double stranded DNA. This fused MutS protein is obtained by sampling the DNA from the restriction enzyme treated vector comprising the DNA coding the MutS protein, combining the terminal of N side with a synthetic DNA coding the segments of 1-33th amino acids of N terminal side of lamda phage N protein and integrating this into the vector, introducing to a host cell allowing the manifestation of the structural gene.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a fused MutS protein and a method for producing the same. The fused MutS protein of the present invention is useful for detecting point mutations in DNA, that is, for detecting mismatch sites in double-stranded DNA.

[0002]

2. Description of the Related Art With the rapid development of molecular biology in recent years, it has become clear that various diseases are caused by genetic abnormalities. They can be point mutations, abnormalities at the chromosomal level such as translocations, large deletions, etc.
There are many types up to molecular-level abnormalities such as frame shift due to deletion of several base pairs. Of these, abnormalities at the molecular level are particularly frequent and difficult to analyze under a microscope, so that an effective detection method is widely desired.

Several methods for detecting current point mutations have been proposed. The most widely used of these is the “single-strand DNA conformation polymorphism (SSCP) analysis method” by Sekiya et al., Which has a detectable DNA length. Is 30
It has a defect that it is 0 bp or less and the resulting pattern is not constant.

On the other hand, a MutS protein that binds specifically to a mismatch site of double-stranded DNA is known (Pr
oc. Natl. Acad. Sci. USA, Vol.83, pp.5057-5061, Ju
ly 1986). The present inventors previously invented a method for detecting a point mutation in DNA using this MutS protein and filed a patent application (Japanese Patent Application No. 7-112467).

[0005]

In the above detection method, if a protein having a higher reactivity between the MutS protein and the mismatched DNA than the native MutS protein is present, it is possible to detect the protein as compared with the case where the native MutS protein is used. It is preferable because the sensitivity can be increased and the same level of detection sensitivity can be obtained with a smaller amount of protein.

Therefore, it is an object of the present invention to use native M
It is intended to provide a novel protein having higher reactivity with mismatched double-stranded DNA than utS protein and a method for producing the same.

[0007]

Means for Solving the Problems As a result of earnest studies, the inventors of the present invention have found that the N-terminal fragment of the N protein of lambda phage is bound to the N-terminal of the native MutS protein and the mismatched DNA of the fused MutS protein. The present inventors have found that the reactivity is higher than the reactivity between native MutS protein and mismatched DNA, and completed the present invention.

That is, the present invention provides a fused MutS protein in which the N-terminal fragment of the Lambda phage N protein is bound to the N-terminal of the MutS protein. The present invention also relates to a promoter that does not express a structural gene downstream thereof to a detectable level except at the time of induction, and a DNA sequence encoding the fusion MutS protein according to any one of claims 1 to 4 downstream of the promoter. Expressing a vector containing at least
Provided is a method for producing a fused MutS protein, comprising recovering tS protein.

The present invention will be described in more detail below.

As described above, the fused MutS protein of the present invention is obtained by ligating the N-terminal side fragment of the N protein of lambda phage to the N-terminal of the MutS protein. Here, examples of the N-terminal side fragment of the N protein of lambda phage include fragments composed of the 1st to 33rd amino acids from the N terminus of the N protein, such as those produced in the following Examples. It may be slightly shorter or longer than the native MutS protein as long as it has higher reactivity with mismatched DNA than the native MutS protein.
The “native MutS protein” referred to here also includes the MutS protein produced by a genetic engineering method using a natural gene or cDNA as obtained in Comparative Example 1 below.

The N-terminal of the MutS protein and the N-terminal side fragment of the lambda phage N protein may be directly linked, or other oligopeptide may be interposed therebetween. In the fusion proteins produced in the examples below, Asn Ser Lys Val Gly Se was prepared as such an oligopeptide.
It contains an amino acid sequence consisting of r. The amino acid sequences of the fusion proteins prepared in the following Examples, which contain the amino acid sequences 1 to 33 from the N-terminus of the N protein of lambda phage, the above oligopeptide sequence downstream thereof, and the MutS protein further downstream thereof, are arranged. It is shown in SEQ ID NO: 1 in the row table.

[0012] Generally, even when a small number of amino acids among amino acids constituting a protein having physiological activity are substituted or deleted or other small number of amino acids are added or inserted into the protein, It is well known to a person skilled in the art that its physiological activity may be hardly affected, and also substitution of a small number of amino acids,
Deletions, insertions and additions can be easily made by well-known site-specific mutations. Therefore, the amino acid sequence represented by SEQ ID NO: 1 has a small number of amino acids substituted or deleted, or a small number of other amino acids inserted or added, and is more reactive with mismatched DNA than the native MutS protein. High are included in the present invention.
The "minor number of amino acids" as used herein means a sufficient number of amino acids that can be substituted, deleted, inserted or added by site-specific mutation.

The fusion protein of the present invention comprises DN encoding the above fusion protein of the present invention downstream of the promoter.
Transforming a host cell with a recombinant vector containing the A sequence,
It can be obtained by producing a fusion protein in the host cell and recovering the produced fusion protein. Although this is an ordinary genetic engineering technique, the present invention requires the use of a promoter satisfying specific requirements. That is, it is necessary to use a promoter that does not express the structural gene downstream thereof to a detectable level except at the time of induction. This is a new finding found by the inventors of the present application by accumulating failures made by using various promoters as shown in the following comparative examples. Most of the promoters currently used in genetic engineering techniques induce induction when a desired gene is desired to be expressed, but many promoters have a small amount of downstream structural gene even if they are not induced. Express. When such a promoter is used, the expressed fusion protein is insolubilized or decomposed into an inactive one, or a transformant producing the fusion protein cannot be obtained.
This is probably because the MutS protein is somewhat toxic, so that the host cell self-protects, insolubilizing and encapsulating the protein, degrading it into an inactive one, or killing the cell itself. It is thought that it is because it gets lost. On the other hand, with a promoter that expresses a structural gene downstream thereof only upon induction, this adverse effect is considerably reduced, and large-scale expression becomes possible as shown in the Examples below. P _L promoter and T from lambda phage Examples of such promoters
₇ promoters can be mentioned.

The fusion protein of the present invention can be produced by a conventional genetic engineering method except that the above promoter is used. As shown in the following examples, expression vectors containing a P _L promoter and an N protein gene are commercially available. Therefore, by inserting the MutS protein gene into the N protein gene of such a commercially available vector, the desired vector can be obtained. Can be obtained. Since the MutS protein gene has a known base sequence, it can be easily prepared by PCR using E. coli genomic DNA as a template. The specific operating method is described in detail in the examples below.

Since the fusion protein of the present invention specifically binds to double-stranded DNA having a mismatch site, DN
It can be used to detect A point mutations. For example,
The sample DNA and the control DNA are annealed to form these hybrid double-stranded DNAs, which are reacted with the fusion protein, and then subjected to gel electrophoresis to form the double-stranded DNAs.
By forming a band of a fusion protein conjugate with and detecting this band, it can be known whether or not a point mutation exists in the sample DNA.

[0016]

EXAMPLES The present invention will be described more specifically below based on Examples and Comparative Examples. However, the present invention is not limited to the following examples.

Comparative Example 1 Production of MutS Protein (1) Construction of MutS Protein-Producing Bacteria (FIG. 2) Escherichia coli DH5α strain (Hanahan, D., J. Mol. Biol. 166: 55)
7 (1983)) and the genomic DNA was recovered by a conventional method. PCR is performed using this E. coli genomic DNA as a template, and Mu
A 2.6 kbp fragment containing the tS protein gene was replicated. The sequences of the two types of oligonucleotide primers used for PCR were 5'GGATCCATGAGTGCAATAGAAAAT3 '5'GAATTCTTATTACACCAGGC3', respectively. PCR was performed using a commercially available kit according to the attached manual. The above primers are BamH
Since it has an I site and an Eco RI site, the DNA fragment thus obtained has a Bam HI site on the 5'side and an Ec on the 3'side.
o Has RI site.

Commercially available plasmid vector pGEX-2T
(Manufactured by Pharmacia) was digested with Bam HI and Eco RI, and the MutS protein gene fragment obtained as described above was digested with pG
It was inserted into the multiple cloning site of EX-2T. The resulting recombinant vector was digested with Bam HI and Pvu II and Pvu
II site, Bam HI site, Xho I site in the center, ribosome binding site between the Xho I site and the downstream Bam HI site (hereinafter,
The double-stranded oligonucleotide fragment shown in FIG. 2 having RBS) was inserted therein. This was digested with PvuII and EcoRI to make both ends of the DNA fragment containing the MutS protein gene blunt-ended.

On the other hand, a commercially available vector pPL-λ
(Manufactured by Pharmacia) was digested with Hpa I and ligated with the DNA fragment containing the MutS protein obtained above,
A recombinant vector pPLλ (mutS) was obtained. E. coli N4830-
One strain (Pharmacia) was transformed with pPLλ (mutS) by the conventional calcium chloride method, a transformant strain was selected according to the drug marker (ampicillin resistance), and the prepared plasmid (pPLλ (mutS)) was selected. Of the MutS protein high-producing bacterium N4
830-1 / pPL-λ (mutS) was selected.

(2) Partial purification of MutS protein N4830-1 / pPL λ (mutS) culture solution was centrifuged, and the precipitated cell paste was subjected to a known method (PREPARATION OF EXTRACTS FROM
PROKARYOTES, Methods in Enzymology, Vol.182, pp.1
49-150) and lysed the cells by treatment with lysozyme.
The resulting cell lysate was ice-cooled for 1 hour and then heated at 37 ° C for 4 minutes. Then, the mixture was centrifuged at 23,000 g for 1 hour, and solid ammonium sulfate was added to the supernatant so that the final concentration was 18% (w / v) or 30% saturation. 20 mM T of the precipitate fraction
It was suspended in ris-HCl (pH 7.5) and used as a partially purified MutS protein sample (protein concentration 10 mg / ml). The precipitation fraction was obtained in an amount of 43 mg from about 3 g of Escherichia coli. A part of the obtained MutS protein sample was subjected to SDS-
PAGE, Coomassie Brilliant Blue (CB
Bands were stained with B). The results are shown in FIG. As shown in FIG. 3, the large-scale expression product of N4830-1 / pPL λ (mutS) seemed to be MutS protein in terms of molecular weight, and was partially purified to 90% or more by the above method.

(3) Confirmation of Activity of Partially Purified MutS Protein It is determined by gel shift method whether or not the MutS protein partially purified as described above has an activity of specifically binding to a mismatch site of double-stranded DNA. Investigated by.
This operation was performed as follows.

Double-stranded D that serves as a substrate for MutS protein
To prepare NA, two types of single-stranded oligonucleotides (I) and (II) having the following base sequences were commercially available.
It was synthesized by an NA synthesizer. 5'-GCA TAC GGA AGT TAA AG T GCG GAT CAT CTC TAG CCA-3 '(I) 5'-TGG CTA GAG ATG ATC CGC N CT TTA ACT TCC GTA TGC-3' (II) These oligonucleotides are ( I) T underlined
And (II) are perfectly complementary except for the underlined N pairing. When (I) and (II) are annealed, (I)
The underlined T and (II) underlined N are paired, but when N is A, (IIc) is completely complementary to (I) and (IIc). Does not occur. This served as a control.
On the other hand, one in which N is G (IIm) and one in which N is deleted (I
Id) was also prepared and used as a sample in the test.
When (IIm) is used, mispairing occurs only in this part (point mutation). When (IId) is used, (I) and (IId) hybridize (deletion) in a form in which the corresponding T in (I) protrudes in a loop. In addition, these oligonucleotides were end-labeled using [γ- ³² P] ATP and T4 nucleotide kinase. Oligonucleotides (I) and (IIm), (IId) or (IIc) were added to the analysis buffer (20 mM T
ris-HCl pH 7.6, 5 mM MgCl ₂ , 0.1 mM DTT, 0.01 mM ED
In TA), the mixture was heated at 70 ° C. for 10 minutes, cooled to room temperature, and allowed to stand at room temperature for 30 minutes for annealing to obtain double-stranded oligonucleotides.

The MutS protein sample (protein amount 40 pmol (about 4 μg)) and 4 μl of x5 analytical buffer (100 mM Tris-HCl pH 7.5, 50 mM MgCl ₂ , 2.5 mM CaCl _2)
2 , 5 mM DTT, 0.5 mM EDTA), 12 pmol (300 ng) of the 36 bp DNA sample, and d ₂ W were mixed to obtain a total volume of 20 μl.
And incubated at 30 ° C. for 20 minutes. A sample prepared in the same manner was used for DNase I (concentration, 25, 50, 1
50, 300 ng / μl)
Oligonucleotides not covered by S protein were degraded. The reaction was stopped by adding 100 mM EDTA. These samples were subjected to native PAGE. For native PAGE, each sample was run on a 20% polyacrylamide gel (1xTBE) with 3 μl of 6xLB buffer (loading buffer) at a voltage density of 20 V / cm from 3 to 3.
It was performed by performing electrophoresis for 5 hours. Then, the band was detected by staining the gel with ethidium bromide by a conventional method. For comparison, the same test was performed using a 36 bp single-stranded DNA (the results are shown in lane “s” in FIG. 4). Further, for comparison, an extract prepared from cells into which only the pPL-λ vector had been introduced was prepared in the same manner as MutS was tested in the same manner (this result is referred to as “pPLλ” on the right side in FIG. 3). Shown in lanes "m", "d", "c" of the book).

The results are shown in FIG. From Figure 4, (IIm) or
When (IId) was used, a band was observed at a position different from that when (IIc) was used, and when (IIc) was used, no band was observed at this position. Also, when a sample prepared from cells containing only the pPLλ vector without the MutS protein gene was used, no band was observed at this position as well. Therefore, it can be seen that the MutS protein bound only to the double-stranded oligonucleotide having a point mutation or deletion. The results for the sample treated with DNase I are shown in FIG. As shown in FIG.
When the control (IIc) was used, the band itself disappeared according to the concentration of DNase I, but when (IIm) was used, the band moved to the lower molecular weight side when the concentration of DNase I was increased. Shifted. From this, the MutS protein binds to the double-stranded DNA having a mismatch and coats a part of the DNA, and this coated part is protected from degradation by DNAase I, while a completely complementary control is obtained. Double-stranded D
It can be seen that DNA did not bind to MutS protein in NA, and DNA was completely degraded by DNase I.
From the above, the partially purified M obtained by the above method
It was confirmed that the utS protein has activity as a MutS protein.

(4) Purification of MutS protein 1 liter of N4830-1 / pPL λ (mutS) culture solution was centrifuged and
The cells were lysed in the same manner as (2). The lysate was centrifuged, solid ammonium sulfate was added to a final concentration of 18% (w / v), the mixture was centrifuged, and the precipitate was dissolved in 20 mM Tris-HCl (pH 7.5). At this time, the amount of protein (measured by Coomassie reagent manufactured by Bio Rad with BSA as a standard) was 1376.6 μg. Then, add this to buffer A (20 mM KPO ₄ , 1 mM E
It was dialyzed against DTA, 1 mM PMSF, 10 mM 2ME, 0.1 M KCl, pH 7.5), and heparin-Sepharose column (1 × 13).
cm, manufactured by Pharmacia). Buffer the column with buffer A
And washed with 0.1% 1M linear gradient of KCl.
This is subjected to native PAGE by a conventional method, and 97 kD
Bands were collected. The amount of protein at this time is 176.5
It was μg. It was then loaded onto a hydroxyapatite column (1.5 x 8.5 cm) and buffered (20 mM KPO ₄ , 0.1 mM).
After washing the column with mM EDTA, 1 mM PMSF, 10 mM 2ME, 0.2 M KCl), elution was carried out with a 0.02 → 0.2 M linear gradient of potassium phosphate and subjected to native PAGE to obtain 97 kD.
Bands were collected. The amount of protein at this time is 78.3μ
g.

(5) Activity measurement of MutS protein MutS protein reacts as shown in the following reaction formula [I].

[0027]

Embedded image

The equilibrium constant Kd of the above reaction formula [I] is represented by the following formula [II].

[0029]

Embedded image

The above oligonucleotides (I) and (I
Using I) (GT mismatch), the Kd value of the partially purified MutS protein was determined by gel shift assay. This operation was specifically performed as follows. Comparative Example 1
0.1 pmol of ³² P-labeled double-stranded DNA obtained in (3)
And 0.1 μg to 5 μ of the partially purified MutS protein
g (about 1 to 50 pmol), 50 mM NaCl, 1 m
M dithiothreitol (DTT) and 1 mM polyphenylmethanesulfonyl fluoride (PMSF) 10m
A solution (15 μl) in M Tris-HCl (pH 7.5) buffer was incubated for 30 minutes at 4 ° C., then subjected to 6% PAGE (non-denaturing) and bands were detected by autoradiography. In the above formula [II], [D
When NA] = [MutS-DNA], Kd≈ [Mut
S], and an approximate Kd value can be estimated (this estimation method is commonly used, and Methods in Enzymology 208 , 1
03-117 (Academic Press Inc.)), the "band intensity" of MutS-DNA and the "free D" that migrated to the bottom of the gel in the pattern of this band.
Mu in the lane with the same NA band strength "
The tS concentration was obtained and the Kd value was estimated. As a result, the Kd value was about 3.3 × 10 ⁻⁶ .

Example 1 (1) Preparation of Fusion MutS Protein (FIG. 1) The pPL-λ (Pharmacia) vector was digested with Sma I and then ligated as it was to obtain two
The region flanked by Sma I sites (including the Bam HI site) was deleted. This vector was then cut with Hpa I, annealed with a synthetic oligo DNA linker having the sequence shown in Figure 1 and ligated. This synthetic oligo DNA linker
It contains a region encoding the amino acid sequence of Asn Ser Lys Val Gly Ser, has a Bam HI site in the center, and is a palindrome. Then, the obtained vector was digested with Bam HI, while the pPL-λ (mutS) prepared in Comparative Example 1 (1) was digested with Ba
After digestion with mHI, these were annealed and ligated.
The resulting vector (Asn Se was added upstream of the MutS protein)
An oligopeptide composed of r Lys Val Gly Ser, and further upstream from the N-terminal end of the N-protein of lambda phage
Escherichia coli N4830-1 strain (Pharmacia) was transformed with the fused MutS protein (named F9) to which a peptide consisting of up to the third amino acid was bound, in the same manner as in Comparative Example 1 (1), Transformed strain N4830-1 / pPL-λ (F9)
I got

(2) Preparation of partially purified F9 product By the same procedure as in Comparative Example 1 (2), a partially purified product of F9 (however, the protein concentration was 5 to 10 mg / ml) was obtained.

(3) Activity of partially purified F9 product The activity of the partially purified F9 product was measured in the same manner as in Comparative Example 1 (5). As a result, the Kd value was about 1.3 × 10 ^-7 . From this, the activity of the fusion protein of the present invention is higher than that of the native MutS protein prepared in Comparative Example 1.
It can be seen that the binding ability with mismatched DNA is 25 times higher.

Comparative Example 2 BamHI / Ec at the multicloning site of pGEX-2T (Pharmacia), a commercially available expression vector.
The MutS protein gene prepared in the same manner as in Comparative Example 1 was inserted into the oRI site. The pGEX-2T vector is
The tac promoter and its downstream glutathione-S-
It has a structural gene for transferase (GTS) (the molecular weight of the expression product is about 26 kD), and the integrated gene product is produced as a fusion protein with glutathione-S-transferase. Escherichia coli DH5α was used as a host and expression was induced by IPTG.

When E. coli DH5α expressing this GTS-MutS fusion protein was dissolved in the same manner as in Comparative Example 1, most of this fusion protein was found in the insoluble fraction. This insoluble protein was solubilized with 6 M guanidine hydrochloric acid, but when the concentration of guanidine hydrochloric acid was lowered by dialysis, it was insolubilized again, and it was not possible to examine the activity.

Comparative Example 3 BamHI / XbaI at the multiple cloning site of the commercially available expression vector pEX (manufactured by Clontech).
The MutS protein gene prepared in the same manner as in Comparative Example 1 was inserted into the site. Incidentally, pEX is for controlling the lambda P _R promoter cI repressor temperature-sensitive, lambda cro-beta-galactosidase gene (molecular weight product of about 120 kD) with a. Expression is carried out by heat induction and the inserted gene product is obtained as a fusion protein with lambda cro-β-galactosidase. E. coli N4830-1 was used as a host.

E. coli N expressing this fusion protein
When 4830-1 was dissolved in the same manner as in Comparative Example 1, it was fractionated into an insoluble fraction as in Comparative Example 2, and the activity could not be measured. Moreover, when Western analysis was performed using an anti-β-galactosidase antibody, it was found that this fusion protein was considerably degraded in E. coli. It was also shown that it was already expressed before induction, although in a small amount.

Comparative Example 4 The MutS protein gene prepared in the same manner as in Comparative Example 1 was inserted into the BamHI site in the multicloning site of the commercially available expression vector pSE380 (manufactured by Invitrogen), and the upstream NcoI site was inserted. The Bam
An oligonucleotide linker encoding the amino acid of Met Gly Ser Ser Arg Gln Gly Ser was inserted between it and the HI site. In addition, pSE380 is a promoter
It has an ac promoter and is induced by IPTG. E. coli DH5α as a host was transformed with the above recombinant vector. As a result, in all of the 31 colonies obtained, a recombinant vector having a structure containing the MutS protein gene in the opposite direction to the intended insertion was found. Therefore, for the purpose of forcibly inserting the gene in the correct direction, the MutS protein gene was inserted between the BamHI site and the SpeI site of the multicloning site, and Escherichia coli DH5α was transformed. However, this time, no transformed strain was obtained. This experiment was repeated several times and all gave the same results. This result suggests that E. coli harboring the MutS protein gene in the desired direction will be culled due to the toxicity of the MutS protein, which is only slightly expressed prior to induction.

[0039]

INDUSTRIAL APPLICABILITY The present invention provides a novel fusion protein having a higher binding property to mismatched DNA than the native MutS protein and a method for producing the fusion protein. By using the fusion protein of the present invention, a point mutation of DNA can be detected with high sensitivity.

[0040]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 892 Sequence type: Amino acid sequence Met Asp Ala Gln Thr Arg Arg Arg Glu Arg Arg Ala Glu Lys Gln Ala 1 5 10 15 Gln Trp Lys Ala Ala Asn Pro Leu Leu Val Gly Val Ser Ala Lys Pro 20 25 30 Val Asn Ser Lys Val Gly Ser Met Ser Ala Ile Glu Asn Phe Asp Ala 35 40 45 His Thr Pro Met Met Gln Gln Tyr Leu Arg Leu Lys Ala Gln His Pro 50 55 60 Glu Ile Leu Leu Phe Tyr Arg Met Gly Asp Phe Tyr Glu Leu Phe Tyr 65 70 75 80 Asp Asp Ala Lys Arg Ala Ser Gln Leu Leu Asp Ile Ser Leu Thr Lys 85 90 95 Arg Gly Ala Ser Ala Gly Glu Pro Ile Pro Met Ala Gly Ile Pro Tyr 100 105 110 His Ala Val Glu Asn Tyr Leu Ala Lys Leu Val Asn Gln Gly Glu Ser 115 120 125 Val Ala Ile Cys Glu Gln Ile Gly Asp Pro Ala Thr Ser Lys Gly Pro 130 135 140 Val Glu Arg Lys Val Val Arg Ile Val Thr Pro Gly Thr Ile Ser Asp 145 150 155 160 Glu Ala Leu Leu Gln Glu Arg Gln Asp Asn Leu Leu Ala Ala Ile Trp 165 170 175 Gln Asp Ser Lys Gly Phe Gly Tyr Ala Thr Leu Asp Ile Ser Ser Gly 180 185 190 Arg Phe Arg Leu Ser Glu Pro Ala Asp Arg Glu Thr Met Ala Ala Glu 195 200 205 Leu Gln Arg Thr Asn Pro Ala Glu Leu Leu Tyr Ala Glu Asp Phe Ala 210 215 220 Glu Met Ser Leu Ile Glu Gly Arg Arg Gly Leu Arg Arg Arg Pro Leu 225 230 235 240 Trp Glu Phe Glu Ile Asp Thr Ala Arg Gln Gln Leu Asn Leu Gln Phe 245 250 255 Gly Thr Arg Asp Leu Val Gly Phe Gly Val Glu Asn Ala Pro Arg Gly 260 265 270 Leu Cys Ala Ala Gly Cys Leu Leu Gln Tyr Ala Lys Asp Thr Gln Arg 275 280 285 Thr Thr Leu Pro His Ile Arg Ser Ile Thr Met Glu Arg Glu Gln Asp 290 295 300 Ser Ile Ile Met Asp Ala Ala Thr Arg Arg Asn Leu Glu Ile Thr Gln 305 310 315 320 Asn Leu Ala Gly Gly Ala Glu Asn Thr Leu Ala Ser Val Leu Asp Cys 325 330 335 Thr Val Thr Pro Met Gly Ser Arg Met Leu Lys Arg Trp Leu His Met 340 345 350 Pro Val Arg Asp Thr Arg Val Leu Leu Glu Arg Gln Gln Thr Ile Gly 355 360 365 Ala Leu Gln Asp Phe Thr Ala Gly Leu Gln Pro Val Leu Arg Gln Val 370 375 380 Gly Asp Leu Glu Arg Ile Leu Ala Arg Leu Ala Leu Arg Thr Ala Arg 385 390 395 400 Pro Arg Asp Leu Ala ArgMet Arg His Ala Phe Gln Gln Leu Pro Glu 405 410 415 Leu Arg Ala Gln Leu Glu Thr Val Asp Ser Ala Pro Val Gln Ala Leu 420 425 430 Arg Glu Lys Met Gly Glu Phe Ala Glu Leu Arg Asp Leu Leu Glu Arg 435 440 445 Ala Ile Ile Asp Thr Pro Pro Val Leu Val Arg Asp Gly Gly Val Ile 450 455 460 Ala Ser Gly Tyr Asn Glu Glu Leu Asp Glu Trp Arg Ala Leu Ala Asp 465 470 475 480 Gly Ala Thr Asp Tyr Leu Glu Arg Leu Glu Val Arg Glu Arg Glu Arg 485 490 495 Thr Gly Leu Asp Thr Leu Lys Val Gly Phe Asn Ala Val His Gly Tyr 500 505 510 Tyr Ile Gln Ile Ser Arg Gly Gln Ser His Leu Ala Pro Ile Asn Tyr 515 520 525 Met Arg Arg Gln Thr Leu Lys Asn Ala Glu Arg Tyr Ile Ile Pro Glu 530 535 540 Leu Lys Glu Tyr Glu Asp Lys Val Leu Thr Ser Lys Gly Lys Ala Leu 545 550 555 560 Ala Leu Glu Lys Gln Leu Tyr Glu Glu Leu Phe Asp Leu Leu Leu Pro 565 570 575 His Leu Glu Ala Leu Gln Gln Ser Ala Ser Ala Leu Ala Glu Leu Asp 580 585 590 Val Leu Val Asn Leu Ala Glu Arg Ala Tyr Thr Leu Asn Tyr Thr Cys 595 600 605 Pro Thr Phe Ile Asp Lys Pro Gly Ile Arg Ile Thr Glu Gly Arg His 610 615 620 Pro Val Val Glu Gln Val Leu Asn Glu Pro Phe Ile Ala Asn Pro Leu 625 630 635 640 Asn Leu Ser Pro Gln Arg Arg Met Leu Ile Ile Thr Gly Pro Asn Met 645 650 655 Gly Gly Lys Ser Thr Tyr Met Arg Gln Thr Ala Leu Ile Ala Leu Met 660 665 670 Ala Tyr Ile Gly Ser Tyr Val Pro Ala Gln Lys Val Glu Ile Gly Pro 675 680 685 Ile Asp Arg Ile Phe Thr Arg Val Gly Ala Ala Asp Asp Leu Ala Ser 690 695 700 Gly Arg Ser Thr Phe Met Val Glu Met Thr Glu Thr Ala Asn Ile Leu 705 710 715 720 His Asn Ala Thr Glu Tyr Ser Leu Val Leu Met Asp Glu Ile Gly Arg 725 730 735 Gly Thr Ser Thr Tyr Asp Gly Leu Ser Leu Ala Trp Ala Cys Ala Glu 740 745 750 Asn Leu Ala Asn Lys Ile Lys Ala Leu Thr Leu Phe Ala Thr His Tyr 755 760 765 Phe Glu Leu Thr Gln Leu Pro Glu Lys Met Glu Gly Val Ala Asn Val 770 775 780 His Leu Asp Ala Leu Glu His Gly Asp Thr Ile Ala Phe Met His Ser 785 790 795 800 Val Gln Asp Gly Ala Ala Ser Lys Ser Tyr Gly Leu Ala Val Ala Ala 805 810 815 Leu Ala Gly Val Pro Lys Glu Val Ile Lys Arg Ala Arg Gln Lys Leu 820 825 830 Arg Glu Leu Glu Ser Ile Ser Pro Asn Ala Ala Ala Thr Gln Val Asp 835 840 845 Gly Thr Gln Met Ser Leu Leu Ser Val Pro Glu Glu Thr Ser Pro Ala 850 855 860 Val Glu Ala Leu Glu Asn Leu Asp Pro Asp Ser Leu Thr Pro Arg Gln 865 870 875 880 Ala Leu Glu Trp Ile Tyr Arg Leu Lys Ser Leu Val 885 890

[Brief description of drawings]

FIG. 1 shows a method of constructing a vector encoding the fusion MutS protein of the present invention.

FIG. 2 shows a method for constructing a vector encoding MutS protein.

FIG. 3: SDS-P of partially purified MutS protein
It is a schematic diagram which shows the result of AGE.

FIG. 4 Native PAG examined to see whether partially purified MutS protein has MutS protein activity
It is a schematic diagram which shows the result of E.

FIG. 5 shows the reaction products of partially purified MutS protein with various double-stranded oligonucleotides at various concentrations of DNase I.
It is a schematic diagram which shows the result of what subjected to what was processed by 1. to native PAGE.

Continued on the front page (51) Int.Cl. ⁶ Identification number Agency reference number FI Technical display location C12R 1:19) (C12P 21/02 C12R 1:19)

Claims (6)

[Claims] 1. A fused MutS protein in which an N-terminal fragment of N protein of lambda phage is bound to the N-terminus of MutS protein. 2. The N of the N protein of lambda phage
The terminal fragment is the first to the third from the N-terminus of the N protein.
The fused MutS protein according to claim 1, which is a fragment consisting of the third amino acid. 3. The fusion Mu according to claim 1, further comprising an oligopeptide between the N-terminus of MutS protein and the N-terminal fragment of N-protein of lambda phage.
tS protein. 4. A fused MutS protein having the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing. 5. A promoter which does not express a structural gene downstream thereof to a detectable level except at the time of induction, and a DNA sequence encoding the fusion MutS protein according to any one of claims 1 to 4 downstream of the promoter. Expressing at least a vector containing in the host cell,
A method for producing a fusion MutS protein, comprising recovering tS protein. 6. The method according to claim 5, wherein the promoter is a P _L promoter or a T ₇ promoter.