JPH0959174A - Bone metabolism promoting agent - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject agent containing a macrophage-stimulating protein as an active component and effective for promoting the bone-resorption action of osteoclast and activating the bone metabolism. SOLUTION: This agent contains a macrophage-stimulating protein(MSP) as an active component. The MSP preferably has the amino acid sequence of the formula or an amino acid sequence obtained by the addition, depletion or substitution of amino acid in the sequence of the formula and acts on peritoneal macrophage of mouse to promote the phagocytic activity, stimulate the chemotaxis and induce the morphological transformation. The MSP can be produced e.g. by transforming a host cell with a recombinant vector containing a gene fragment coding for the amino acid sequence of the formula, culturing the transformant and collecting the substance from the cultured product. The objective agent is usually used as an injection, etc. containing MSP as exclusive component or together with a carrier, etc. In the case of a liquid preparation such as injection, the agent is preserved in frozen state or after removing water by freeze-drying, etc. The daily dose of the agent is preferably 0.1-100mg in terms of MSP.

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a bone metabolism promoter containing macrophage stimulating protein (MSP) as an active ingredient.

[0002]

2. Description of the Related Art There are three types of cells that make up bone: osteoblastic bones, which are mainly involved in bone formation, osteoclasts, which are involved in bone resorption, and bone cells, which are embedded in a self-formed bone matrix. Osteoclasts are cells closely related to macrophages and monocytes that are differentiated from hematopoietic stem cells to dissolve bone matrix and minerals and absorb bone to trigger bone remodeling. On the other hand, mesenchymal-derived osteoblasts differentiate and mature from progenitor cells in the vicinity of the resorption site and secrete bone matrix in the state where bone formation is stimulated. The activities of osteoblasts and osteoclasts are balanced under physiological conditions by complex regulatory mechanisms that maintain a dynamic equilibrium between generative and degradative processes. When the balance between bone formation and bone resorption is lost, bone diseases such as marble disease, osteogenesis imperfections and osteoporosis occur.

Recently, it has become possible to form osteoclasts by culturing mouse bone marrow cells in vitro. Since osteoclasts are cells derived from blood stem cells, in vitro culture from bone marrow cells is possible. In addition, bone marrow cells were cultured in the presence of interleukin-3 or granulocyte-macrophage colony-stimulating factor (GM-CSF) to increase monocyte-macrophage progenitor cells, and activated vitamin D3 (1,25-dihydroxy- It is known that when vitamin D3) is added, the cells fuse to become multinucleated giant cells. These cells are tartrate-resistant acid phosphatase (TRACP) -positive or calcitonin receptor-positive and show osteoclast traits. In fact, when this cell group is placed on the bone material such as an ivory slice, a bone resorption pit is formed within 2 to 3 days. This allows the bone resorption activity of osteoclasts to be measured.

As described above, osteoclasts are cells involved in bone remodeling, but the molecular approach to the bone resorption mechanism has been difficult. The cause is that there are few trait markers specific to osteoclasts and functional. Tartrate-resistant acid phosphatase (TRACP)
Originally, it is one of the lysosomal enzymes that hydrolyze phosphate monoesters in the acidic region, and its substrate specificity is not necessarily high. Osteopontin is a sialic acid-rich glycoprotein having an RGD sequence, and plays an important role in adhesion to bone matrix by binding to vitronectin. However, since it is also found in osteoblasts, it cannot be used as an indicator of osteoclasts. The calcitonin receptor receives calcitonin stimulation and suppresses the bone resorption effect of osteoclasts. However, detection of receptors in osteoclasts is not always easy. It was difficult to analyze the final differentiation of osteoclasts because it was not known from which differentiation stage of the macrophage lineage the osteoclasts diverge.

Molecules that modify the bone resorption effect of osteoclasts include parasolmon, tumor growth factor, and tumor necrosis factor. Furthermore, recently, interleukin-6 (IL-
6), Leukemia inhibitory factor (LIF) is attracting attention. But,
At present, a physiologically active substance that directly acts on osteoclasts and activates bone resorption has not been clarified.

Bone formation is dominated by osteoclastic bone resorption and osteoblast calcification,
Marble disease or osteoporosis is considered a failure of remodeling. It is necessary to clarify the molecules that cause or modify these pathological conditions.

[0006]

[Means for Solving the Problems] Receptor (RON) cDNA for human macrophage stimulating protein (MSP) has been cloned from human keratinocytes, and the receptor (RON) for human macrophage stimulating protein (MSP) has a 35 Kd α chain and 1
It is known to be a heterodimer consisting of a 50 Kd transmembrane β chain (Ronsin et al .: Oncogene 8,1195 (199
3)). The present inventors have conducted research on the differentiation of blood stem cells for many years, and as a result, succeeded in cloning the gene for the receptor (STK) of mouse macrophage stimulating protein (MSP) from mouse bone marrow cells (Iwama
Et al .: Blood 83,3160 (1994)). Further, in screening for cells expressing the receptor (STK), the receptor (S
We found that TK) was expressed and examined the relationship between macrophage stimulating protein (MSP) and receptor (STK) in detail, and found that macrophage stimulating protein (MSP)
It was found that there is an activity of inducing bone resorption of osteoclasts. That is, it was found that the macrophage stimulating protein (MSP) identified as a factor that stimulates mouse peritoneal macrophages to induce chemotaxis, phagocytosis and morphological changes also has an activity of promoting bone resorption of osteoclasts, The present invention has been completed.

The present invention relates to a macrophage stimulating protein (MS
It is a bone metabolism promoter containing P) as an active ingredient.

Further, one example of the present invention is a macrophage stimulating protein (hereinafter, referred to as a protein having the following physicochemical properties)
Bone metabolism promoting agent containing MSP as an active ingredient. Action: Acts on mouse peritoneal macrophages to enhance phagocytosis, stimulate chemotaxis, and induce morphological changes. Molecular weight: It is about 70 Kd according to SDS-polyacrylamide gel electrophoresis (SDS-PAGE) under non-reducing conditions. Under reducing conditions, an α chain with a molecular weight of 47 Kd and a molecular weight of 22 K
It has a heterodimer structure in which the β chain of d is divided.

Further, the bone metabolism promoting agent of the present invention preferably contains macrophage stimulating protein (MSP), which is a glycoprotein composed of 693 amino acids, as an active ingredient.

In the present invention, the amino acid sequence shown in Sequence Listing / SEQ ID NO: 1 or one or more amino acids in the amino acid sequence are added, deleted or substituted,
A bone metabolism promoting agent containing a macrophage stimulating protein (MSP) containing an amino acid sequence that acts on mouse peritoneal macrophages to enhance phagocytosis, stimulate chemotaxis, and induce morphological changes Preferably there is.

The present invention also relates to a single chain inactive type (Pro-
It is preferable that the bone metabolism promoting agent contains macrophage stimulating protein (MSP), which is a glycoprotein secreted by MSP), as an active ingredient.

Further, in the present invention, when at least human kallikrein acts, Pro-MSP becomes Arg (493) and Val (4
94), a bone metabolism promoter containing macrophage stimulating protein (MSP), which is a glycoprotein that is specifically cleaved by a peptide chain and converted into an active double-chain MSP, as an active ingredient is preferable. .

The present invention relates to a macrophage stimulating protein (M
It is a bone metabolism promoter containing SP) and a pharmaceutically acceptable active ingredient.

[0014]

BEST MODE FOR CARRYING OUT THE INVENTION The macrophage stimulating protein (hereinafter abbreviated as MSP) used in the present invention is a protein that acts on mouse peritoneal macrophages to enhance their phagocytic ability, stimulate chemotaxis, and induce morphological changes. Was found in human serum as (Leonard et al .: Exp. Cell Res. 102,434 (1976)),
It is then the protein that has been isolated and purified. MSP is a glycoprotein composed of 693 amino acids excluding the signal sequence. MSP is a single chain inactive form (hereinafter, P
secreted by ro-MSP). When enzymes such as human kallikrein act, Pro-MSP becomes Arg (493).
A peptide chain is specifically cleaved between Val (494) and converted into an active double-chain MSP (Wang et al .: J. Biol. Che.
m., 269, 3436 (1994)). SDS-PAGE under non-reducing conditions
, A single band with a molecular weight of about 70 Kd, but under reducing conditions it separates into two bands, an α chain band with a molecular weight of about 47 Kd and a β chain of a 22 Kd band. That is, the MS chain α chain (Gln19 to Arg493) and β chain (Val494 to Gly71)
1) is bridged by a disulfide bond. By analogy with the amino acid sequences of hepatocyte growth factor and plasminogen, Cys (468) and Cys (588) on the amino acid sequence of MSP
It is believed that the disulfide bond between the two bridges the α and β chains.

As an example of MSP, one or more amino acids are added, deleted or substituted in the amino acid sequence shown in SEQ ID NO: 1 or the amino acid sequence, and it acts on mouse peritoneal macrophages. A protein containing an amino acid sequence that enhances phagocytosis, stimulates chemotaxis, and induces a morphological change is exemplified.

MSP may be a protein produced by a gene recombination method. It may also be a glycoprotein derived from human or animal tissues or blood components. Examples of blood components include human serum, and examples of human or animal tissues include liver cancer cells such as HepG2.

As the method for producing the MSP used in the present invention, for example, the MSP described in Sequence Listing / SEQ ID NO: 1 is used.
A host cell is transformed with a recombinant vector containing the gene fragment encoding the amino acid sequence constituting the amino acid sequence or the gene fragment encoding the MSP described in SEQ ID NO: 2 of the Sequence Listing,
There is a method of culturing the transformant and collecting MSP from the culture.

As a method for preparing MSP cDNA,
For example, acidic guanidinium / thiocyanate / phenol / chloroform extraction method [Analytical Biochemistry, 1
62, 156-159 (1987)], total RNA was extracted from cultured cells or human tissues, and poly-A / poly (A) was prepared using an oligo dT cellulose column or Oligotex-dt30 (Nippon Roche).
RNA. Single-stranded cDNA can be synthesized by reverse transcriptase using an oligo dT primer, and double-stranded cDNA can be obtained by reacting RNase and DNA polymerase I. Obtained c
DNA of human MSP by incorporating the DNA into λ phage etc.
CD of human MSP using a probe created based on information
NA can be screened. In addition, human M
By preparing an appropriate PCR primer based on the DNA information of SP and carrying out a PCR reaction, c of human MSP can be obtained.
DNA can be obtained.

The recombinant vector of the present invention is obtained by incorporating the above-mentioned MSP-encoding gene fragment into an appropriate vector (plasmid) having a DNA expression function. Examples of the vector include a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis, a plasmid derived from yeast, a plasmid derived from animal virus, and the like.

DNA encoding MSP and vector DN
The recombination with A can be performed using a general DNA technique in which both DNAs are digested with a restriction enzyme and then ligated with T4 DNA ligase or the like. At the time of ligation, the end of the DNA fragment digested with a restriction enzyme was
It can also be carried out by a method of processing using an embedding reaction using NA polymerase I / Klenow fragment, an embedding reaction using T4 DNA polymerase or a shaving reaction, or a method using a DNA linker.

The vector containing the recombinant DNA having the nucleotide sequence encoding MSP thus constructed is used to produce a transformant carrying the vector. Examples of the host cell include Escherichia coli, Bacillus subtilis, yeast, animal cells and the like. Animal cells used as host cells include monkey cells COS-1, Chinese hamster C
HO cells and the like can be mentioned.

For transforming the above-mentioned host cells, for example, Methods in Enzymology (Goeddel, Ed., (1991) 185).
Volume, Academic Press Inc.,) etc. Transformation of animal cells is performed using, for example, the lipofection method. Thus, a transformant carrying a vector containing a recombinant DNA having a base sequence encoding MSP can be obtained.

MSP is produced by culturing the transformant in a medium. When the transformant in which the host cell is an animal cell is cultivated, for example, about 1 to about 1 is used as a medium.
MEM medium containing 20% fetal bovine serum (Science, 122, 5
01 (1952)), PRMI1640 medium (Journal of the Americ
an Medical Association, 199, 519 (1967)). The pH is preferably about 6-8. The culture time is about 15 to 60 hours, and aeration and agitation are added if necessary.

Another method for producing MSP is, for example, a protein in which the cysteine at the 672nd position from the N-terminal of the amino acid sequence constituting MSP shown in SEQ ID NO: 1 is replaced with another amino acid. There is a method of transforming a host cell with a recombinant vector containing a gene fragment encoding a certain MSP variant, culturing the transformant, and collecting the MSP variant from the culture. Examples of other amino acids include alanine, glycine, serine and the like.

Another method for producing MSP is a method for extracting and purifying from human serum as described in US Pat. No. 5,219,991.

In the present invention, the fact that MSP has an activity of inducing bone resorption of osteoclasts means that osteoclast-like cells showing the expression of a receptor (STK) obtained in a long-term culture system of mouse bone marrow cells. The effect of MSP on the bone resorption capacity of the rat is examined.
Actually, osteoclast-like cells were cultured on ivory, and its action was examined and confirmed.

In the present invention, the effect of the receptor (STK) on the mouse osteoclast formation system and isolated osteoclast cells is determined by immunohistochemical and fluorescent cell separation (FACS) using anti-STK monoclonal antibody. Explore. As osteoclasts, osteoclast-like cells that are induced and formed by adding interleukin-3 and active vitamin D3 to a culture system of bone marrow cells separated from mouse long stem bone are used. Identification of receptor (STK) -positive cells in immunostaining is performed by using NIH3T3 cells introduced with STK gene as a control. Osteoclasts are identified by staining with tartrate-resistant acid phosphatase (TRACP) and expression of calcitonin receptor. Evaluation of osteoclast-like cells using purified MSP is performed by morphological change under a microscope and measurement of resorption pits by culturing on ivory pieces.

Receptor tyrosine kinase, which belongs to the receptor (SKT) family, is not expressed in monocyte-macrophage in bone marrow and peripheral blood, but is expressed in specialized macrophages such as peritoneal resident macrophages. . Also,
Exudative peritoneal macrophages also do not express the receptor (SKT), and the receptor is expressed during the differentiation process. Further, using this antibody, osteoclasts and their progenitor cells are separated by a fluorescence cell sorter (FACS).

MSP, which is an active ingredient of the present invention, exhibits an excellent bone resorption effect on mammals such as cows including humans, horses, rats and sheep, and is effective on any mammals. It is a potent bone metabolism promoter.

The bone metabolism promoter of the present invention is usually MSP.
In general, an injection or the like is used alone or together with a carrier known per se. For example, an injection can be prepared by dissolving MSP in an appropriate buffer and then aseptically filtering with a filter or the like.

The bone metabolism promoting agent of the present invention may contain an additive substance such as a stabilizing substance, a shaping substance, a solubilizing substance, an anti-adsorption substance, an antioxidant substance, and the like, for example, mannitol or glucose. Sugars, amino acids such as glycine, alanine, lysine, and arginine, proteins such as albumin, hydrophilic polymers such as ethylene glycol and glycerol, inorganic salts such as NaCl, surfactants such as polysorbate 80, and sulfur-containing reducing agents. And may contain one or more of these.

It is preferable that the liquid preparation is stored by freezing, or by removing water by a method such as freeze drying and vacuum drying. Further, the factor can be precipitated by an aqueous solution containing MSP, a salting-out method or a solvent precipitation method, and the obtained precipitate can be dried and stored. The bone metabolism promoter of the present invention is usually administered by an administration route such as a vein, an artery or a subcutaneous route. The dose is 0.1 mg as MSP
˜100 mg, which is preferably administered once or several times a day in divided doses.

[0033]

EXAMPLES The present invention will be further described below with reference to examples to clarify the embodiments and effects of the present invention, but the present invention is not limited to these examples.

Reference Example 1 Human MSP gene clonin
The grayed cell line Hep G2 mRNA from a template, the following primers 1, using primers 2 and Pfu polymerase, PCR was carried out by a conventional method. Obtained 0.3
The Kb fragment was subcloned into the restriction enzyme EcoRV site of pBlueScript SK + (Stratagene). After confirming the DNA sequence of the clone obtained by subcloning, it was treated with restriction enzymes EcoRI and HindIII to obtain a 0.36 Kb fragment of the inserted MSP. Using this fragment as a DNA probe, the cDNA derived from the above cell line Hep G2
From the library (Clontech), 5 × 10 ⁵ clones were screened by plaque hybridization to obtain 4 positive clones. The longest clone (MSP with an insert length of approximately 2.3 Kb)
9) was selected and subcloned into the restriction enzyme EcoRI site of pBluescript SK +. The resulting clone (pBS (MSP
The DNA sequence of 9)) was confirmed and confirmed to be the sequence described in SEQ ID NO: 1 in the sequence listing. Primer 1: TGGCCATTGAATGACTTCCA Primer 2: TGATCATTCGGGAACTTGTG

Reference Example 2 CHO expression vector of MSP gene
Preparation of recombinant human and CHO plasmid A 2.3 Kb DNA fragment containing human MSP cDNA was obtained from pBS (MSP9), which is a plasmid vector incorporating human MSP cDNA, by digestion with restriction enzyme EcoRI. The resulting DNA fragment was treated with T4 DNA polymerase I and Klenow fragment to give blunt-ended DN.
A. Next, the restriction enzyme site of EcoRV in the gene insertion site of pEVSV, a CHO expression vector having SV40 early promoter and poly (A) addition signal, was digested and treated with alkaline phosphatase to prevent self-ligation. A vector having blunt-ended DNA after EcoRV digestion and the above-mentioned DNA fragment containing human MSP cDNA were mixed and ligated with T4 DNA ligase. Connected DN
E. coli JM109 was transformed with A and plated on LB plates containing ampicillin. A clone in which the MSP cDNA was inserted downstream of the SV40 early promoter was selected to obtain an expression vector for CHO, pEVSV (MSP).

The vector DNA for preparing the transformant was prepared as follows. C in 40 ml of LB medium
An E. coli strain harboring the expression vector for HO, pEVSV (MSP), was cultured overnight, and plasmid DNA was prepared from the obtained bacterial cells by the alkaline method. The obtained DNA was further subjected to ultracentrifugation with cesium chloride. It was purified and used for the production of a recombinant using human MSP CHO cells as a host. The DHFR-deficient CHO cell DUKX strain was used for transformation, and the transformation was performed by the lipofection method. The obtained cell line contained no nucleic acid, and dialyzed using 10% fetal bovine serum (Gibco), 1% glutamine and α-MEM medium containing 50 nM methotrexate (Flow Laboratories),
Cells with high MSP concentration in the culture supernatant were screened by the limiting dilution method. The colonies that developed were 100 nM thereafter,
250 nM, 500 nM, 750 nM and 1 μM and grow in the same medium with increasing concentrations of methotrexate,
Further stable MSP high-producing strain 105-5 was obtained. The MSP productivity of this cell was 5 mg / L / 2 days.

Reference Example 3 Production and Purification of MSP The CHO recombinant of MSP was expanded and cultured in a T225 flask until it became confluent, using an RPMI medium supplemented with 10% fetal bovine serum. Serum-free RPM supplemented with 50 μl / ml leupeptin to obtain single-chain MSP
The medium was replaced with I medium. The culture supernatant was collected every day, and about 10 L of the culture supernatant was collected and used for purification of the recombinant protein having MSP activity. The culture supernatant was adjusted to pH 5.8 by adding citric acid, applied to an S-Sepharose column equilibrated with 10 mM citric acid, 10 mM sodium phosphate, pH 5.8, and thoroughly washed, then 20 mM, Tris-HCl, p
Eluted with H8.5, 0.5M NaCl. The active fraction was further applied to an anti-human MSP monoclonal antibody column.
After thorough washing with a phosphate buffer, MSP was eluted with a glycine buffer having a pH of 2.8. The obtained crude product is SDS
-By PAGE electrophoresis, it was confirmed that single-stranded MSP was obtained. Further, using human kallikrein, arginine at position 493 of the purified single-chain MSP and 49
The peptide bond between valine at position 4 was specifically digested.
That is, Affi- conjugated with 1 mg of human kallikrein
The purified fraction was passed through a Gel 10 column. The obtained fraction was adjusted to pH 5.0 and loaded on a CM-Sepharose column. After washing with 10 mM sodium acetate, pH 5.0, elution was performed with the same buffer using a 0 to 5 M NaCl solution gradient. Free α chain, double chain MSP, free β
The chains were eluted in order, and only the double-stranded MSP fraction was collected and used as purified MSP.

Example 1 Isolation of mouse bone marrow cells and MSP
Osteoclasts expressing STK receptor STK were isolated from femurs of 2-week-old C57BL / 6 mice. The femur was taken out, and after removing the soft tissue around the bone, the bone was cut with scissors, fragmented, transferred to a test tube, and vortexed gently for 30 seconds in 3 ml of α-MEM. Then, the mixture was allowed to stand for 3 minutes, and the supernatant was collected to obtain bone cells. The osteoclasts were cultured in a dish having a diameter of 90 mm for 2 days to obtain osteoclasts. To identify osteoclasts, the cells were stained with a tartrate-resistant acid phosphatase (TRACP) activity measurement kit (Sigma), incubated at 37 ° C for 30 minutes, and then positive cells were identified and counted. In addition, cells expressing the receptor (STK) were stained with a specific anti-STK monoclonal antibody, and identified immunologically. That is, after fixing cells with 1% formaldehyde, anti-STK
Monoclonal antibody clone 1B (IgG2a, K) (Iwama et al .;
After treatment with Blood, in press (1995)), biotinylated anti-rat IgG and alkaline phosphatase-conjugated streptavidin (ABC-AP kit, Vector Lab) were added and stained. As a result, tartrate-resistant acid phosphatase (TRAC
Most of the (P) -positive multinucleated osteoclasts are receptors (STK)
Was found to be expressed.

Example 2 Isolation of mouse bone marrow cells and long-term culture
Formation of osteoclast-like cells by feeding Bone marrow cells were isolated from the femur of C57BL / 6 mice aged 6 to 8 weeks. Take out the femur, cut both ends,
Bone marrow cells were collected in a test tube by inserting a 22G injection needle and injecting 10 ml of α-MEM into the needle. Suspend bone marrow cells by repeating pipetting,
10 ⁶ cells / ml were seeded on a 24-well plastic plate and cultured under the conditions of 37 ° C. and 5% CO ₂ . After 1 day, the medium was replaced with the same medium containing interleukin-3 (100 Unit / ml) and active vitamin D3 (10 ⁻⁸ M), and the medium was replaced every 3 days and cultured. After one week of culture, the number of osteoclast-like multinucleated cells (3 or more nuclei per cell) was counted by a phase contrast microscope. The expression of calcitonin receptor (CTR) was detected as follows. That is, Lab-Te
k After culturing on the chamber slide (Nunc) for 1 week, the cells were incubated with α-MEM (+ 0.1% BSA) containing 0.2 nm [ ¹²⁵ I] calcitonin (Amersham) for 90 minutes at room temperature, and then incubated. 30% glutaraldehyde
Fixed for minutes. After thorough washing with PBS, it was immersed in an NTB-3 emulsifier (Eastman Kodak Company), exposed for 14 days, and judged by autoradiograph. As a result, Table 1
As shown in, only osteoclast-like multinucleated cells expressing the receptor (STK) expressed the calcitonin receptor (CTR). On the other hand, expression of STK was observed in 50% of mononuclear cells (probably osteoclast precursor cells), but expression of calcitonin receptor (CTR) was not observed.

[0040]

[Table 1]

Example 3 In a long-term culture system of mouse bone marrow cells
MSP on the bone resorption activity of the obtained osteoclast-like cells
In order to investigate whether MSP acts on the bone resorption ability of osteoclast-like cells in which the expression of the receptor (STK) obtained in a long-term culture system of mouse bone marrow cells is observed, the osteoclast-like cells on dentin pieces are examined. The cells were cultured and their effects were investigated. That is, after slicing sperm whale tooth dentin (dentin) and polishing the surface, a thickness of 1
Sections were prepared to 50 μm and sterilized by ultrasonic treatment in 70% ethanol. Next, a circle having a diameter of 6 mm was hollowed out, washed with α-MEM (+ 5% FBS), and ivory pieces were placed on the 96 well. Furthermore, 200 containing bone marrow cells (1 × 10 ⁵ cells / ml) obtained as described in Example 2.
37 μl of α-MEM (+ 5% FBS) was placed on the ivory piece, and 37 μm of α-MEM (+ 5% FBS) was added in the presence of interleukin-3 and active vitamin D3.
After culturing for 7 days at 5 ° C. and 5% CO ₂ and confirming the formation of multinucleated cells, MSP (25 ng / ml) was added and culturing was continued for 2 days. During this period, cells on the section were removed after a certain time, the section was stained with hematoxylin for 3 minutes, and the number of resorption pits was counted by a microscope. As a result, as shown in Table 2, MSP
Increased the formation of resorption pits compared to the control group. The formation of this resorption pit increased with time by the addition of MSP when observed at 48 hours. This is a result of promoting the bone resorption effect of osteoclast-like cells.

[0042]

[Table 2]

[0043]

INDUSTRIAL APPLICABILITY The bone metabolism promoter of the present invention stimulates bone resorption of osteoclasts by MSP and activates bone metabolism.

[0044]

[Sequence Listing] SEQ ID NO: 1 Sequence length: 711 Sequence characteristics: Amino acid Topology: Linear Sequence type: Protein Sequence: Met Gly Trp Leu Pro Leu Leu Leu Leu Leu Thr Gln Tyr Leu Gly Val 1 10 Pro Gly Gln Arg Ser Pro Leu Asn Asp Phe Gln Val Leu Arg Gly Thr 20 30 Glu Leu Gln His Leu Leu His Ala Val Val Pro Gly Pro Trp Gln Glu 40 Asp Val Ala Asp Ala Glu Glu Cys Ala Gly Arg Cys Gly Pro Leu Met 50 60 Asp Cys Arg Ala Phe His Tyr Asn Val Ser Ser His Gly Cys Gln Leu 70 80 Leu Pro Trp Thr Gln His Ser Pro His Thr Arg Leu Arg Arg Ser Gly 90 Arg Cys Asp Leu Phe Gln Lys Lys Asp Tyr Val Arg Thr Cys Ile Met 100 110 Asn Asn Gly Val Gly Tyr Arg Gly Thr Met Ala Thr Thr Val Gly Gly 120 Leu Pro Cys Gln Ala Trp Ser His Lys Phe Pro Asn Asp His Lys Tyr 130 140 Thr Pro Thr Leu Arg Asn Gly Leu Glu Glu Asn Phe Cys Arg Asn Pro 150 160 Asp Gly Asp Pro Gly Gly Pro Trp Cys Tyr Thr Thr Asp Pro Ala Val 170 Arg Phe Gln Ser Cys Gly Ile Lys Ser Cys Arg Glu Ala Ala Cys Val 180 190 Trp Cys A sn Gly Glu Glu Tyr Arg Gly Ala Val Asp Arg Thr Glu Ser 200 Gly Arg Glu Cys Gln Arg Trp Asp Leu Gln His Pro His Gln His Pro 210 220 Phe Glu Pro Gly Lys Phe Leu Asp Gln Gly Leu Asp Asp Asn Tyr Cys 230 240 Arg Asn Pro Asp Gly Ser Glu Arg Pro Trp Cys Tyr Thr Thr Asp Pro 250 Gln Ile Glu Arg Glu Phe Cys Asp Leu Pro Arg Cys Gly Ser Glu Ala 260 270 Gln Pro Arg Gln Glu Ala Thr Thr Val Ser Cys Phe Arg Gly Lys Gly 280 Glu Gly Tyr Arg Gly Thr Ala Asn Thr Thr Thr Ala Gly Val Pro Cys 290 300 Gln Arg Trp Asp Ala Gln Ile Pro His Gln His Arg Phe Thr Pro Glu 310 320 Lys Tyr Ala Cys Lys Asp Leu Arg Glu Asn Phe Cys Arg Asn Pro Asp 330 Gly Ser Glu Ala Pro Trp Cys Phe Thr Leu Arg Pro Gly Met Arg Ala 340 350 Ala Phe Cys Tyr Gln Ile Arg Arg Cys Thr Asp Asp Val Arg Pro Gln 360 Asp Cys Tyr His Gly Ala Gly Glu Gln Tyr Arg Gly Thr Val Ser Lys 370 380 Thr Arg Lys Gly Val Gln Cys Gln Arg Trp Ser Ala Glu Thr Pro His 390 400 Lys Pro Gln Phe Thr Phe Thr Ser Glu Pro His Ala Gln Leu Glu Glu 410 Asn Phe Cys Arg Asn ProAsp Gly Asp Ser His Gly Pro Trp Cys Tyr 420 430 Thr Met Asp Pro Arg Thr Pro Phe Asp Tyr Cys Ala Leu Arg Arg Cys 440 Ala Asp Asp Gln Pro Pro Ser Ile Leu Asp Pro Pro Asp Gln Val Gln 450 460 Phe Glu Lys Cys Gly Lys Arg Val Asp Arg Leu Asp Gln Arg Arg Ser 470 480 Lys Leu Arg Val Val Gly Gly His Pro Gly Asn Ser Pro Trp Thr Val 490 Ser Leu Arg Asn Arg Gln Gly Gln His Phe Cys Gly Gly Ser Leu Val 500 510 Lys Glu Gln Trp Ile Leu Thr Ala Arg Gln Cys Phe Ser Ser Cys His 520 Met Pro Leu Thr Gly Tyr Glu Val Trp Leu Gly Thr Leu Phe Gln Asn 530 540 Pro Gln His Gly Glu Pro Ser Leu Gln Arg Val Pro Val Ala Lys Met 550 560 Val Cys Gly Pro Ser Gly Ser Gln Leu Val Leu Leu Lys Leu Glu Arg 570 Ser Val Thr Leu Asn Gln Arg Val Ala Leu Ile Cys Leu Pro Pro Glu 580 590 Trp Tyr Val Val Pro Pro Gly Thr Lys Cys Glu Ile Ala Gly Trp Gly 600 Glu Thr Lys Gly Thr Gly Asn Asp Thr Val Leu Asn Val Ala Leu Leu 610 620 Asn Val Ile Ser Asn Gln Glu Cys Asn Ile Lys His Arg Gly Arg Val 630 640 Arg Glu Ser Glu Met Cys Thr Glu Gly Leu Leu Ala Pro Val Gly Ala 650 Cys Glu Gly Asp Tyr Gly Gly Pro Leu Ala Cys Phe Thr His Asn Cys 660 670 Trp Val Leu Glu Gly Ile Ile Ile Pro Asn Arg Val Cys Ala Arg Ser 680 Arg Trp Pro Ala Val Phe Thr Arg Val Ser Val Phe Val Asp Trp Ile 690 700 His Lys Val Met Arg Leu Gly *** 710

SEQ ID NO: 2 Sequence length: 2216 Sequence type: Nucleic acid Number of strands: Double-strand Topology: Linear Sequence type: cDNA Sequence characteristics Origin organism name: Human Sequence characteristics Characteristic symbol : Sig peptide Location: 1..54 Characteristic symbol: CDS Location: 1..2133 Sequence: ATG GGG TGG CTC CCA CTC CTG CTG CTT CTG ACT CAA TAC TTA GGG GTC 48 Met Gly Trp Leu Pro Leu Leu Leu Leu Leu Thr Gln Tyr Leu Gly Val 1 10 CCT GGG CAG CGC TCG CCA TTG AAT GAC TTC CAA GTG CTC CGG GGC ACA 96 Pro Gly Gln Arg Ser Pro Leu Asn Asp Phe Gln Val Leu Arg Gly Thr 20 30 GAG CTA CAG CAC CTG CTA CAT GCG GTG GTG CCC GGG CCT TGG CAG GAG 144 Glu Leu Gln His Leu Leu His Ala Val Val Pro Gly Pro Trp Gln Glu 40 GAT GTG GCA GAT GCT GAA GAG TGT GCT GGT CGC TGT GGG CCC TTA ATG 192 Asp Val Ala Asp Ala Glu Glu Cys Ala Gly Arg Cys Gly Pro Leu Met 50 60 GAC TGC CGG GCC TTC CAC TAC AAC GTG AGC AGC CAT GGT TGC CAA CTG 240 Asp Cys Arg Ala Phe His Tyr Asn Val Ser Ser His Gly Cy s Gln Leu 70 80 CTG CCA TGG ACT CAA CAC TCG CCC CAC ACG AGG CTG CGG CGT TCT GGG 288 Leu Pro Trp Thr Gln His Ser Pro His Thr Arg Leu Arg Arg Ser Gly 90 CGC TGT GAC CTC TTC CAG AAG AAA GAC TAC GTA CGG ACC TGC ATC ATG 336 Arg Cys Asp Leu Phe Gln Lys Lys Asp Tyr Val Arg Thr Cys Ile Met 100 110 AAC AAT GGG GTT GGG TAC CGG GGC ACC ATG GCC ACG ACC GTG GGT GGC 384 Asn Asn Gly Val Gly Tyr Arg Gly Thr Met Ala Thr Thr Val Gly Gly 120 CTG CCC TGC CAG GCT TGG AGC CAC AAG TTC CCG AAT GAT CAC AAG TAC 432 Leu Pro Cys Gln Ala Trp Ser His Lys Phe Pro Asn Asp His Lys Tyr 130 140 ACG CCC ACT CTC CGG AAT GGC CTG GAA GAG AAC TTC TGC CGT AAC CCT 480 Thr Pro Thr Leu Arg Asn Gly Leu Glu Glu Asn Phe Cys Arg Asn Pro 150 160 GAT GGC GAC CCC GGA GGT CCT TGG TGC TAC ACA ACA GAC CCT GCT GTG 528 Asp Gly Asp Pro Gly Gly Pro Trp Cys Tyr Thr Thr Asp Pro Ala Val 170 CGC TTC CAG AGC TGC GGC ATC AAA TCC TGC CGG GAG GCC GCG TGT GTC 576 Arg Phe Gln Ser Cys Gly Ile Lys Ser Cys Arg Glu Ala Ala Cys Val 180 190 TGG TGC AAT GGC GAG GAA TAC CGC GGC GCG GTA GAC CGC ACG GAG TCA 624 Trp Cys Asn Gly Glu Glu Tyr Arg Gly Ala Val Asp Arg Thr Glu Ser 200 GGG CGC GAG TGC CAG CGC TGG GAT CTT CAG CAC CCG CAC CAG CAC CCC 672 Gly Arg Glu Cys Gln Arg Trp Asp Leu Gln His Pro His Gln His Pro 210 220 TTC GAG CCG GGC AAG TTC CTC GAC CAA GGT CTG GAC GAC AAC TAT TGC 720 Phe Glu Pro Gly Lys Phe Leu Asp Gln Gly Leu Asp Asp Asn Tyr Cys 230 240 CGG AAT CCT GAC GGC TCC GAG CGG CCA TGG TGC TAC ACT ACG GAT CCG 768 Arg Asn Pro Asp Gly Ser Glu Arg Pro Trp Cys Tyr Thr Thr Asp Pro 250 CAG ATC GAG CGA GAG TTC TGT GAC CTC CCC CGC TGC GGG TCC GAG GCA 816 Gln Ile Glu Arg Glu Phe Cys Asp Leu Pro Arg Cys Gly Ser Glu Ala 260 270 CAG CCC CGC CAA GAG GCC ACA ACT GTC AGC TGC TTC CGC GGG AAG GGT 864 Gln Pro Arg Gln Glu Ala Thr Thr Val Ser Cys Phe Arg Gly Lys Gly 280 GAG GGC TAC CGG GGC ACA GCC AAT ACC ACC ACT GCG GGC GTA CCT TGC 912 Glu Gly Tyr Arg Gly Thr Ala Asn Thr Thr Thr Ala Gly Val Pro Cys 290 300 CAG CGT TGG GAC GCG CAA ATC CCT CAT CAG CAC CGATTT ACG CCA GAA 960 Gln Arg Trp Asp Ala Gln Ile Pro His Gln His Arg Phe Thr Pro Glu 310 320 AAA TAC GCG TGC AAA GAC CTT CGG GAG AAC TTC TGC CGG AAC CCC GAC 1008 Lys Tyr Ala Cys Lys Asp Leu Arg Glu Asn Phe Cys Arg Asn Pro Asp 330 GGC TCA GAG GCG CCC TGG TGC TTC ACA CTG CGG CCC GGC ATG CGC GCG 1056 Gly Ser Glu Ala Pro Trp Cys Phe Thr Leu Arg Pro Gly Met Arg Ala 340 350 GCC TTT TGC TAC CAG ATC CGG CGT TGT ACA GAC GAC GTG CGG CCC CAG 1104 Ala Phe Cys Tyr Gln Ile Arg Arg Cys Thr Asp Asp Val Arg Pro Gln 360 GAC TGC TAC CAC GGC GCA GGG GAG CAG TAC CGC GGC ACG GTC AGC AAG 1152 Asp Cys Tyr His Gly Ala Gly Glu Gln Tyr Arg Gly Thr Val Ser Lys 370 380 ACC CGC AAG GGT GTC CAG TGC CAG CGC TGG TCC GCT GAG ACG CCG CAC 1200 Thr Arg Lys Gly Val Gln Cys Gln Arg Trp Ser Ala Glu Thr Pro His 390 400 AAG CCG CAG TTC ACG TTT ACC TCC GAA CCG CAT GCA CAA CTG GAG GAG 1248 Lys Pro Gln Phe Thr Phe Thr Ser Glu Pro His Ala Gln Leu Glu Glu 410 AAC TTC TGC CGG AAC CCA GAT GGG GAT AGC CAT GGG CCC TGG TGC TAC 1296 Asn Phe Cys Arg Asn Pro Asp Gly Asp Ser His Gly Pro Trp Cys Tyr 420 430 ACG ATG GAC CCA AGG ACC CCA TTC GAC TAC TGT GCC CTG CGA CGC TGC 1344 Thr Met Asp Pro Arg Thr Pro Phe Asp Tyr Cys Ala Leu Arg Arg Cys 440 GCT GAT GAC CAG CCG CCA TCA ATC CTG GAC CCC CCA GAC CAG GTG CAG 1392 Ala Asp Asp Gln Pro Pro Ser Ile Leu Asp Pro Pro Asp Gln Val Gln 450 460 TTT GAG AAG TGT GGC AAG AGG GTG GAT CGG CTG GAT CAG CGG CGT TCC 1440 Phe Glu Lys Cys Gly Lys Arg Val Asp Arg Leu Asp Gln Arg Arg Ser 470 480 AAG CTG CGC GTG GTT GGG GGC CAT CCG GGC AAC TCA CCC TGG ACA GTC 1488 Lys Leu Arg Val Val Gly Gly His Pro Gly Asn Ser Pro Trp Thr Val 490 AGC TTG CGG AAT CGG CAG GGC CAG CAT TTC TGC GGG GGG TCT CTA GTG 1536 Ser Leu Arg Asn Arg Gln Gly Gln His Phe Cys Gly Gly Ser Leu Val 500 510 AAG GAG CAG TGG ATA CTG ACT GCC CGG CAG TGC TTC TCC TCC TGC CAT 1584 Lys Glu Gln Trp Ile Leu Thr Ala Arg Gln Cys Phe Ser Ser Cys His 520 ATG CCT CTC ACG GGC TAT GAG GTA TGG TTG GGC ACC CTG TTC CAG AAC 1632 Met Pro Leu Thr Gly Tyr Glu V al Trp Leu Gly Thr Leu Phe Gln Asn 530 540 CCA CAG CAT GGA GAG CCA AGC CTA CAG CGG GTC CCA GTA GCC AAG ATG 1680 Pro Gln His Gly Glu Pro Ser Leu Gln Arg Val Pro Val Ala Lys Met 550 560 GTG TGT GGG CCC TCA GGC TCC CAG CTT GTC CTG CTC AAG CTG GAG AGA 1728 Val Cys Gly Pro Ser Gly Ser Gln Leu Val Leu Leu Lys Leu Glu Arg 570 TCT GTG ACC CTG AAC CAG CGC GTG GCC CTG ATC TGC CTG CCC CCT GAA 1776 Ser Val Thr Leu Asn Gln Arg Val Ala Leu Ile Cys Leu Pro Pro Glu 580 590 TGG TAT GTG GTG CCT CCA GGG ACC AAG TGT GAG ATT GCA GGC TGG GGT 1824 Trp Tyr Val Val Pro Pro Gly Thr Lys Cys Glu Ile Ala Gly Trp Gly 600 GAG ACC AAA GGT ACG GGT AAT GAC ACA GTC CTA AAT GTG GCC TTG CTG 1872 Glu Thr Lys Gly Thr Gly Asn Asp Thr Val Leu Asn Val Ala Leu Leu 610 620 AAT GTC ATC TCC AAC CAG GAG TGT AAC ATC AAG CAC CGA GGA CGT GTG 1920 Asn Val Ile Ser Asn Gln Glu Cys Asn Ile Lys His Arg Gly Arg Val 630 640 CGT GAG AGT GAG ATG TGC ACT GAG GGA CTG TTG GCC CCT GTG GGG GCC 1968 Arg Glu Ser Glu Met Cys Thr Glu Gly Leu Leu Ala Pr o Val Gly Ala 650 TGT GAG GGT GAC TAC GGG GGC CCA CTT GCC TGC TTT ACC CAC AAC TGC 2016 Cys Glu Gly Asp Tyr Gly Gly Pro Leu Ala Cys Phe Thr His Asn Cys 660 670 TGG GTC CTG GAA GGA ATT ATA ATC CCC AAC CGA GTA TGC GCA AGG TCC 2064 Trp Val Leu Glu Gly Ile Ile Ile Pro Asn Arg Val Cys Ala Arg Ser 680 CGC TGG CCA GCT GTC TTC ACG CGT GTC TCT GTG TTT GTG GAC TGG ATT 2112 Arg Trp Pro Ala Val Phe Thr Arg Val Ser Val Phe Val Asp Trp Ile 690 700 CAC AAG GTC ATG AGA CTG GGT TAGGCCCAGC CTTGATGCCA TATGCCTTGG 2163 His Lys Val Met Arg Leu Gly 710 GGAGGACAAA ACTTCTTGTC AGACATAAAG CCATGTTTCC TCTTTATGCC TGT 2216

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁶ Identification code Agency reference number FI Technical display location // (C12P 21/02 C12R 1:91)

Claims (12)

[Claims] 1. A bone metabolism promoter comprising a macrophage stimulating protein (MSP) as an active ingredient. 2. The bone metabolism promoter according to claim 1, wherein the macrophage stimulating protein (MSP) is a protein having the following physicochemical properties. Action: Acts on mouse peritoneal macrophages to enhance phagocytosis, stimulate chemotaxis, and induce morphological changes. Molecular weight: It is about 70 Kd according to SDS-polyacrylamide gel electrophoresis (SDS-PAGE) under non-reducing conditions. Under reducing conditions, an α chain with a molecular weight of 47 Kd and a molecular weight of 22 K
It has a heterodimer structure in which the β chain of d is divided. 3. The bone metabolism promoter according to claim 1, wherein the macrophage stimulating protein (MSP) is a glycoprotein composed of 693 amino acids. 4. A macrophage stimulating protein (MSP) having the amino acid sequence set forth in SEQ ID NO: 1 of the Sequence Listing or one or more amino acids added to the amino acid sequence,
The bone metabolism promotion according to claim 1, which is deleted or substituted and contains an amino acid sequence which acts on mouse peritoneal macrophages to enhance phagocytosis, stimulate chemotaxis and induce morphological changes. Agent. 5. The bone metabolism promoting agent according to claim 1, wherein the macrophage stimulating protein (MSP) is a glycoprotein secreted in a single chain inactive form (Pro-MSP). 6. When at least human kallikrein acts on macrophage stimulating protein (MSP), Pro-M
The bone metabolism promoter according to claim 5, wherein SP is a glycoprotein in which a peptide chain is specifically cleaved between Arg (493) and Val (494) to be converted into an active double-chain MSP. 7. The bone metabolism promoter according to claim 1, wherein the macrophage stimulating protein (MSP) is a protein produced by a gene recombination method. 8. The bone metabolism promoter according to claim 1, wherein the macrophage stimulating protein (MSP) is a glycoprotein derived from human or animal tissues or blood components. 9. The bone metabolism promoter according to claim 8, wherein the blood component is human serum. 10. The bone metabolism promoter according to claim 8, wherein the human or animal tissue is a liver cancer cell. 11. The bone metabolism promoter according to claim 10, wherein the human liver cancer cell is HepG2. . 12. Macrophage stimulating protein (MSP)
And a bone metabolism promoter containing a pharmaceutically acceptable active ingredient.