JPH09509323A - Methods and reagents for inhibiting expression of disease-related genes - Google Patents

Abstract

(57) [Summary] ICAM-1 mRNA, IL-5 mRNA, relA mRNA, TNF-α mRNA, RSV mRNA or enzymatic RNA molecule that cleaves RSV genomic RNA or CML-related mRNA, and their mRNA levels Use of these molecules for treating etiological conditions; 2 ', 3'or 5'modified ribonucleotides or nucleotides, methods of synthesis, purification and deprotection thereof; chimeric form with tRNA A vector containing a number of enzymatic nucleic acids; a method of introducing an enzymatic nucleic acid into a cell by forming a complex with a second nucleic acid molecule, wherein the complex has an R-loop base pair structure. DsRNA deaminase can be activated, enzymatically active or chemically mutated How to change the variant nucleic acid by hybridizing with an oligonucleotide in vivo including Hatsuzai. Further disclosed are hairpin ribozymes that lack the substrate RNA portion and can be cleaved and / or ligated in trans, as well as hammerhead ribozymes that have an interconnecting loop between base pairs in stem II.

Description

Detailed Description of the Invention             Methods and reagents for inhibiting expression of disease-related genesBackground of the Invention   The present invention is useful for treating inflammation or autoimmune diseases, chronic myelogenous leukemia, airway diseases and the like. The present invention relates to a reagent useful as an inhibitor of expression of a gene associated with a disease.Summary of the invention   The present invention relates to novel enzymatic RNA molecules, ribozymes, and their Disease-related genes (eg, ICAM-1, IL-5, relA, TNF-α, p2 10^bcr-abl, And respiratory syncytial virus (respiratory syn The method is used for inhibiting the expression of a (cytic viral) gene). Such ribozymes are found in humans and other animals, including other primates. It can be used for the treatment of diseases caused by the expression of these genes.   Ribozymes direct other distinct RNA molecules in a nucleotide sequence-specific manner. It is an RNA molecule with enzymatic activity that can be repeatedly cleaved. These enzymatic RNAs The molecule can target virtually any RNA transcript, Effective cutting has been achieved in. Kim et al. , 84 Proc. N atl. Acad. Sci. USA 8788, 1987; Haseloff. and Gerlach, 334 Nature 585, 1988; Cech. , 260 JAMA 3030, 1988; and Jefferies, et.   al. , 17 Nucleic Acids Research 1371, 1989.   To date, six basic variants of naturally occurring enzymatic RNA are known. Each ribozyme is an RNA phosphodiester in trans under physiological conditions. Can catalyze the hydrolysis of nucleoside bonds (thus cleaving other RNA molecules as well) Possible). Table] summarizes some of the properties of these ribozymes.   Ribozymes act by first binding to the target RNA. This join Retained in close proximity to the enzymatic portion of the RNA that acts to cleave the target RNA, It is performed by the target RNA binding part of the ribozyme. Therefore, ribozyme The target RNA and then binds to the target RNA by complementary base pairing, Once bound to the site, it acts enzymatically to cleave the target RNA. Like that Strategic cleavage of a large target RNA impairs its ability to direct the synthesis of the protein it encodes. Will destroy. The ribozyme binds to its RNA target and cleaves it, then From other RNAs to search for other targets and repeatedly bind and cleave new targets Can be   The enzymatic properties of ribozymes can be determined by other techniques, such as the antisense method (in this case, nucleic acid The molecule simply binds to the nucleic acid target and blocks its translation) You. The effective concentration of ribozyme required to carry out the therapeutic treatment is the antisense oligonucleic acid. Because it is lower than that of leotide. The advantage is that ribozymes act enzymatically It reflects that In other words, one ribozyme molecule contains many target RNA components. May sever a child. Furthermore, ribozymes are highly specific inhibitors, and their Isomerism is not only the mechanism of base pairing of bonds, but also the R It also depends on the mechanism that inhibits NA expression. That is, inhibition is the cutoff of the RNA target Caused by cleavage of the target R and therefore the specificity of target R to the rate of cleavage of non-target RNA It is defined as the ratio of the cutting speed of NA. This cleavage mechanism contributes to base pairing. Depends on factors other than those involved. Therefore, the specificity of action of ribozymes is the same. Considered larger than that of antisense oligonucleotides that bind to the same RNA site available. Due to their catalytic activity and increased site specificity, ribozymes are It is a more potent and safer therapeutic molecule than antisense oligonucleotides.   Therefore, in a first aspect, the present invention provides ICAM-1, IL-5, r elA, TNF-α, p210^bcr-ablOr RNA encoding RSV protein It relates to ribozymes or enzymatic RNA molecules that direct the cleavage of molecular species. More detailed Specifically, the present invention provides for the selection and function of ribozymes capable of cleaving these RNAs, And in various tissues ICAM-1, IL-5, relA, TNF-α, p210^bcr-ablOr reducing the level of RSV protein, discussed herein. These uses are described for treating the diseases described. Such a ribozyme It is also useful for diagnostic use.   In the present invention, these ribozymes are ICAM-1, IL-5, relA. , TNF-α, p210^bcr-abl, Or capable of inhibiting the expression of the RSV gene, And the catalytic activity of ribozymes has been shown to be required for these inhibitory effects. You. One of ordinary skill in the art would appreciate from the examples provided herein that target ICAM-1, IL-5 , RelA, TNF-α, p210^bcr-abl, Or mRN encoding RSV The ability to design other ribozymes that cleave A and they are also within the scope of the present invention. It will be seen that it is clear that it is inside the enclosure.   These chemically or enzymatically synthesized RNA molecules are linked to their target mRNA. It contains a substrate binding domain that binds to an accessible region. RNA molecules are also RN It also contains a domain that catalyzes the cleavage of A. When bound, the ribozyme encodes the target It cleaves mRNAs that interfere with translation and protein accumulation. Target gene expressed If not, a therapeutic effect will be observed.   A "gene" is a protein coding region of a cognate mRNA, or Any control in RNA that regulates protein synthesis or the stability of its mRNA. Area. This term also refers to the ORF of the cognate polypeptide product. These regions of the encoding mRNA are also represented, as well as the proviral genome.   "Enzymatic RNA molecule" refers to a specific gene target in the substrate binding region. Enzymatic activity that is complementary and acts to specifically cleave RNA within its target. It means an RNA molecule that also has sex. That is, an enzymatic RNA molecule splits RNA Interstitial cleavage, which can inactivate the target RNA molecule. this Complementarity is sufficient to bring an enzymatic RNA molecule into the target RNA sufficient to cause cleavage. It has the function of hybridizing. 100% complementarity is preferred, but 50-7 Complementarity as low as 5% is also useful in the present invention. What is "equivalent" RNA for viruses? , In animals, including humans, cats, monkeys and other primates. RNA components encoded by naturally-occurring viruses associated with the disease involved It shall include children. Coded by these viral RNAs or viruses The resulting RNAs have similar structures and equivalent genes to each other.   "Complementarity" refers to the traditional Watson-Crick or other Non-traditional types of base pair interactions (eg, Hoogsteen) n) A nucleic acid capable of forming a hydrogen bond by any of type).   In a preferred embodiment of the invention, the enzymatic nucleic acid molecule is a hammerhead or a hammerhead. Formed in the motif of the Apin, hepatitis delta virus, group I intron , Or RNaseP RNA (related to RNA guide sequences) or Neur It may also be formed with the motif of ospora VS RNA. Hammer like this -Examples of head motifs can be found in Rossi et al, 1992, Aids Re. in search and Human Retroviruses, 8, 183 Described; examples of hairpin motifs are Hampel and Tritz, 198. 9 Biochemistry 28, 4929, EP 0360257 and Hampel et al. , 1990, Nucleic Acids Res . 18, 299; examples of hepatitis delta virus motifs are described in Perott. a and Been, 1992 Biochemistry, 3116. Listed; examples of RNaseP motifs are described in Guerrier-Takada et.   al. , 1983 Cell, 35849; Neurospor. a VS RNA ribozyme motif is based on Collins (Seville a nd Collins, 1990 Cell 61, 685-696; Savi. ll and Collins, 1991 Proc. Natl. Acad. Sci. , USA 88, 8826-8830; Collins and Ol. ive, 1993 Biochemistry 32, 2795-2799, G uo and Collins, 1995 EMBO. J. , 14,368) Group I introns are described by Cech et al. , US Patent No. 4,987,071. These specific motifs are Without limiting the clarity, all that is important in the enzymatic nucleic acid molecules of the invention is Specific substrate binding that is complementary to one or more target gene RNA regions And has an RNA cleavage activity on the molecule within or around its substrate binding site. It is recognized by those skilled in the art that it has a nucleotide sequence that imparts sex. Will   The present invention provides a group of enzymatic cleaving agents that exhibit high specificity for a desired target RNA. And a method for producing the same. The enzymatic nucleic acid molecule is preferably one or several. Targeting such that the enzymatic nucleic acid provides a specific treatment for the disease or condition. (That is, ICAM-1, IL-5, relA, TNF-α, p210^bcr-abl Or a highly conserved sequence region of mRNA encoding RSV protein) And Such enzymatic nucleic acid molecules are delivered externally to specific cells as needed. be able to. Alternatively, the ribozyme is from a vector that is delivered to the particular cell. Can be expressed. "Vector" is used to deliver a desired nucleic acid Means any nucleic acid and / or virus-based technology involved.   The synthesis of nucleic acids longer than 100 nucleotides may be dependent on automated methods. Difficult, and the therapeutic cost of such molecules is significant. In the present invention, a small fermentation External transmission of elementary nucleic acid motifs (eg hammerhead or hairpin structures) Used for The simplicity of the structure of these molecules implies that enzymatic nucleic acids are Enhance the ability to penetrate into the target area of the structure. However, these catalytic RNA molecules Can also be expressed in cells from eukaryotic promoters (eg, Sca Nion, K.N. J. et al. , 1991, Proc. Natl. Acad. Sci. , USA, 88, 10591-5; Kashani-Sabet, M .; , Et al. , 1992, Antisense Res. Dev. , 2,3- 15; Dropoulic, B .; , Et al. , 1992, J. Virol, 66, 1432-41; Weerasinghe, M .; , Et al. , 191 J. Virol, 65, 5531-4; Ojwang, J .; O. , Et al . , 1992, Proc. Natl. Acad. Sci. , USA, 89 10 802-6; Chen C .; J. , Et al. , 1992, Nucleic Acids Res. , 20, 4581-9; Sarver, H .; , Et al . , 1990, Science, 247, 1222-1225). Suitable for those skilled in the art Any ribozyme can be added to a eukaryotic cell from the appropriate DNA or RNA vector. It will be understood that they can be expressed as The activity of such ribozymes is Ribozymes increase their release from their primary transcripts (Draper et al., PCT WO93 / 23569, And Sullivan et al. , PCT WO94 / 02595 (this The entire contents of which are incorporated herein by reference); Ohkawa, J. , Et al. , 1992, Nucleic Acids Symp. Se r. 2 7, 15-6; Taira, K .; et al. , Nucleic Acids Res. , 19, 5125-30; Ventura, M .; , Et al. , 19 93, Nucleic Acids Res. , 21, 3249-55, Cho wrira et al. , 1994 J .; Biol. Chem. , 269, 2 5856).   “Inhibition” means ICAM-1, relA, IL-5, TNF-α, p210^{bc r-abl} Alternatively, the activity or level of mRNA encoding RSV is increased by the ribozyme. Less than that observed in the absence of, preferably the same part of the mRNA Observed in the presence of an inactive RNA molecule that can bind to a position but cannot cleave that RNA. It means that it is lower than the level.   Such ribozymes are useful for the diseases and conditions mentioned above, as well as ICAM-1, I. L-5, relA, TNF-α, p210^bcr-ablOr RSV protein level Or of any other disease or condition associated with activity in cells or tissues Useful for prevention. "Related" means ICAM-1, IL-5, relA, T NF-α, P210^bcr-ablOr inhibition of translation of RSV mRNA, and thus , ICAM-1, IL-5, relA, TNF-α, p210^bcr-ablOr R Reduced levels of SV protein may alleviate some of the symptoms or conditions of the disease. It means that there will be.   Ribozymes can be added directly, but complexed with cationic lipids Or encapsulated in liposomes or otherwise delivered to target cells Can be. RNA or RNA complexes can be incorporated into biopolymers or Related tissue using a catheter, infusion pump or stent without uptake Can be administered topically. In a preferred embodiment, the ribozyme is 2, 3, 6-9, 11, 13, 15-23, 27, 28, 31, 33, 34, 3 It has binding arms complementary to sequences 6 and 37.   Examples of such ribozymes are shown in Tables 4-8, 10, 12, 14-16, 19-2. 2, 24, 26-28, 30, 32, 34 and 36-38. This Examples of such ribozymes consist essentially of the sequences defined in these tables. "Consisting essentially of ..." means that an active ribozyme will cleave at the target site As it occurs, it binds to an enzymatic center and mRNA that are equivalent to the ribozyme shown in the example. It is meant to include a mating coupling arm. Other arrangements that do not interfere with such disconnection There may be columns.   Those skilled in the art will appreciate that these sequences may affect the enzymatic portion of the ribozyme in order to affect its activity. Much more such arrays where the minutes (all but the binding arms) have changed It will be understood that this is just a representative example of. For example, listed in the table above The stem-loop II sequence of the hammerhead ribozyme has a minimum of two base pairs. Modified to include any sequence (substitution, deletion, And / or insertion). Similarly, the hair listed in the table above The stem-loop IV sequence of the pin ribozyme has a minimum of two base-paired stems. Modified to include any sequence (substitution, deletion, and / or Or insert). The sequences listed in the table above are ribonucleotidies. Or other nucleotides or non-nucleotides. That Such ribozymes are equivalent to the ribozymes specifically listed in the table.   In another aspect of the invention, the target molecule is determined and ICAM-1, IL-5, relA, TNF-α, p210^bcr-ablOr inhibit RSV gene expression Ribozymes are transcriptions inserted into DNA, RNA, or viral vectors. Expressed from the unit. Others for high accumulation of ribozymes in cells The method involves incorporating a sequence encoding a ribozyme into a DNA or RNA expression vector. It is to let in. Transcription of the ribozyme sequence is a eukaryotic RNA polymerase I (pol), RNA polymerase II (polII), or RNA polymer It is driven by the promoter of zeIII (polIII). polII or polIII Transcripts from promoters are expressed at high levels in all cells. There will be. The levels of certain pol II promoters in certain types of cells are close Depending on the nature of the gene regulatory sequences (enhancers, silencers, etc.) present in . Prokaryotic RNA polymerase promoters are also used, provided that Biological RNA polymerase enzymes are expressed in appropriate cells (Elroy-Stei n and Moss, 1990 Proc. Natl. Acad. Sci. U SA, 87,6743-7; Gao and Huang 1993 Nucl. eic Acids Res. , 21 2867-72; Lieber et al. , 1993 Methods Enzymol. , 217, 47-66; Zhou   et al. , 1990 Mol. Cell. Biol. , 10, 4529- 37). Some researchers have used ribozymes expressed from such promoters. Have been shown to be functional in mammalian cells (eg, Kashani-Save t et al. , 1992 Antisense Res. Dev. , 2, 3 -15; Ojwang et al. , 1992 Proc. Natl. Aca d. Sci. USA, 90, 6340-4; L'Huiller et al. , 1992 EMBO J .; 11, 4411-8; Lisziewicz et.   al. 1993 Proc. Natl. Acad. Sci. USA. , 90 , 8000-4). The ribozyme transcription unit described above is introduced into mammalian cells. Can be incorporated into various vectors for With such a vector For example, a plasmid DNA vector or a viral DNA vector (for example, adenovirus) Ruth or adeno-associated viral vector), or viral RNA vector (eg Retrovirus or alphavirus vector). However, the present invention is not limited to this.   Other features and advantages of the invention will be set forth in the following description of the preferred embodiments of the invention and the features and advantages thereof. It will be apparent from the appended claims.Description of the preferred embodiment   First, the drawings will be briefly described.Drawing :   FIG. 1 is a schematic depiction of a hammerhead ribozyme domain known in the art. It is. Stem 2 can be 2 base pairs or more in length.   FIG. 2 (a) is an illustration of a hammerhead ribozyme domain known in the art. Fig. 2 (b) is a Uhlenbeck (1987). , Nature, 327, 596-600). Fig. 2 (c) is a schematic representation of the hammerhead ribozyme Latch (Haseloff and Gerlach) (1988, Natu Re, 334, 585-591) and a hammerhead divided into two parts. To Figure 2 (d) shows Jeffrey and Simmons. Symons) (1989, Nucl. Acids Res., 17, 1371). -1371) in a similar drawing showing a hammerhead divided into two parts is there.   FIG. 3 is a schematic depiction of the general structure of the hairpin ivozyme. Helix 2 (H2) is provided at least 4 base pairs (ie, n is 1, 2, 3 or 4) , Helix 5 is optionally a base of length 2 or more (preferably 3-20 bases, ie, m can be provided at 1-20 or more). Helix 2 and helic S5 may be covalently bound by one or more bases (ie r is one or more bases). Helicopter Cux 1, 4 or 5 is also extended by 2 or more base pairs (for example, 4- 20 base pairs) may stabilize the ribozyme structure, preferably at the protein binding site. You. In each instance, each N and N'is independently any conventional base or Modified bases, and each dash represents a potential base pair interaction. These nuku Leotide may be modified with sugar, base or phosphate moieties. Perfect base pairing Not required in the helix but preferred. Helices 1 and 4 have several It can be of any size as long as base pairs are maintained (ie, o and p are each 0 to any numerical value, for example, 20). Essential bases are specific in the structure Although shown as a base, one or more skilled in the art will appreciate that one or more Modified (abasic, base, sugar and / or phosphate modification) or Will recognize that it may be replaced by other bases. 2 helix 4 Can be formed from separate molecules, i.e. without connecting loops. Connection loop exists In some cases, it is a ribonucleotide that may or may not be modified at the base, sugar or phosphate. It can be a cleotide. “Q” is two or more bases. Connection loop is non-nucleo It may be replaced with a tide linker molecule. H means base A, U, or C. Y is Means pyrimidine base. " "" Means a covalent bond.   Figure 4 is a generic representation of hepatitis delta virus ribozyme domains known in the art. It is a depiction of the structure.   Figure 5 is a depiction of the general structure of the self-cleaving VSRNA ribozyme domain.   FIG. 6 is a schematic depiction of the genetic map of RSV strain A2.   FIG. 7 is a schematic depiction of solid phase synthesis of RNA.   FIG. 8 is a schematic depiction of an exocyclic amino protecting group for nucleic acid synthesis.   Figure 9 is a schematic depiction of RNA deprotection.   FIG. 10 was synthesized, deprotected and purified using the improved methods described herein. 1 is a schematic depiction of RNA substrate cleavage by ribozymes.   FIG. 11 is a schematic depiction of the two-pot deprotection protocol. Deprotection of base is water It is carried out at 65 ° C. for 10 minutes using a neutral methylamine. Samples are RNA synthesis samples Dry in a speed bag with kale for 2-24 hours. 2'-hydroxyl position The silyl protecting group in the sample was treated with 1.4 M anhydrous HF at 1.5 ° C at 65 ° C. Removed by time treatment.   Figure 12 shows one pot of RNA synthesized using RNA phosphoramidite chemistry It is a schematic depiction of deprotection. The base was removed with anhydrous methylamine at 65 ° C for 15 minutes. Protect. Cool the sample for 10 minutes and add TEA / 3HF reagent to the same pot. Thus, the protecting group at the 2'-hydroxyl position is removed. Deprotect for 1.5 hours.   13a-b are HPLC of a 36 nt long ribozyme targeting site B. It is a profile. RNA is either a two-pot or a one-pot deprotection protocol Deprotect with or. Peaks corresponding to full length RNA are shown. The sequence of part B is CCUGGGCCAGGGAUUAAUGGAGAUGCCCCACU.   Figure 14: Deprotected ribozyme by a 2-pot to 1-pot deprotection protocol. 2 is a graph comparing the RNA cleaving activity of the.   FIG. 15 is a schematic depiction of an improved method for synthesizing RNA containing phosphorothioate linkages. It is.   FIG. 16 shows RNA cleavage catalyzed by a ribozyme containing a phosphorothioate bond. Shows disconnection reaction. Hammerhead ribozymes targeting site C have 4's at the 5'end. The base is synthesized to contain a phosphorothioate bond. P = O is a post-thio A ribozyme having no ate bond is meant. P = S is a phosphorothioate bond Means a ribozyme having. The sequence of site C is UCAUUUUGGGCCAUC UC UUCCUUCAGGCGUGG.   FIG. 17: Synthesis of 2'-N-phthalimido-nucleoside phosphoramidite Is a schematic depiction of.   FIG. 18 shows a conventional method for solid-phase synthesis of RNA using silyl ether, and S 1 is a schematic depiction of a method of the present invention using EM as a 2'protecting group.   Figure 19 shows 2'SEM-protected nucleosides and phosphoamids useful for RNA synthesis. 1 is a schematic depiction of the synthesis of dytes. B is any nucleotide salt exemplified in the drawings Is a group, P is a purine, and I is inosine. Known in the industry Standard abbreviations used are used throughout the specification.   FIG. 20 is an illustration of a method for protecting RNA using TBDMS protection of the 2'hydroxyl group. It is a depiction.   FIG. 21 is a schematic depiction of the deprotection of RNA with SEM protection of the 2'hydroxyl group. It is a photo.   Figure 22 shows a fully deprotected 10mer HPLC chromatogram of uric acid. It is a depiction of Mu.   23-25 show hammerhead, hair containing self-processing RNA transcripts. 1 is a schematic depiction of pin or hepatitis delta virus ribozyme. The solid arrow is self Indicates the processing site. Boxes indicate nucleotide substitution sites. The solid line is Subtract to indicate the binding site of the primer used in the Limer extension assay is there. Lower case symbols are when transcribed from a HindIII linearized plasmid Shows the vector sequences present in the RNA of. (23) HH cassette made by 3'cis Hammerhead trans-acting ribozyme bound to a hammerhead ribozyme It is a transcription product containing a film. The structure of the hammerhead ribozyme is a phylogenetic analysis and And mutation analysis (as described by Simmons). The transribozyme domain is Cleotides range from 1 to 49. After processing the 3'end, the transribozyme Im contains two non-ribozyme nucleotides at the 3'end (positions 50 and 51). UC). The 3'processing ribozyme consists of 44 to 96 nucleotides. . Roman numerals I, II and III represent the 3'cis acting hammerhead ribozyme. Shown are three helices that contribute to the structure (Hertel et al., 199). 2 Nucleic Acids Res. 20, 3252). G₇₀And A₇₁ To U and G respectively inactivate the hammerhead ribozyme (ruff Na Ruffner et al., 1990 Biochemistry 29, 1069. 5), resulting in HH (mutant) constructs. (24) HP cassette has 3'cis action A transfer containing a hammerhead-type trans-acting ribozyme bound to an apin ribozyme. It is a photograph. The structure of the hairpin ribozyme is based on phylogenetic and mutational analysis. (Berzal-Herranz et al., 1993. EMBO. J. 12, 2567). Transribozyme domains range from 1 to 49 It extends to cleotides. After processing the 3'end, transribozyme It contains a ribozyme nucleotide at the 3'end (50-54th UGGCA). The 3'cis-acting ribozyme consists of 50 to 115 nucleotides. HP (GU The transcript named) is G₅₂To U₇₇Constructed by potentially unstable base pairs between And HP (GC) is G₅₂To C₇₇Between the Watson-Crick base pairs. Truncated helix 1 (5 base pairs) and stable tetra at the end of helix 1 Use the loop (GAAA) to bind the substrate to the catalytic domain of the hairpin ribozyme (Feldstein & Bruen ing), 1993 Nucleic Acids Res. 21, 1991; Altschuler et al., 1992, supra). (25) HD V cassette bound to the 3'cis-acting hepatitis delta virus (HDV) ribozyme A transcript containing a trans-acting hammerhead ribozyme. HDV ribozyme The secondary structure of bean and co-workers (Been et al., 1992 Bi Chemistry 31, 11843). G The lance ribozyme domain spans nucleotides 1 to 48. 3'end After processing, the transribozyme will add two non-ribozyme nucleotides at the 3'end. Included at the edge (49th and 50th AA). 50 '3'cis acting HDV ribozyme To 114 nucleotides. Roman numerals I, II, III and IV are The positions of the four helices within the 3'cis-acting HDV ribozyme are shown (perota ( Perrota & Bean), 1991 Nature 350, 434). . ΔHDV transcript contains a 31 nucleotide deletion in the HDV portion of the transcript (Deleted nucleotides 84 to 115).   Figure 26: Schematic of plasmids containing inserts encoding self-processing cassettes It is a depiction. The figures are not drawn to scale.   Figure 27: Effect of 3'sequence on RNA self-processing in vitro. Is shown. H is a template for a plasmid linearized with the restriction enzyme HindIII. You. The transcript from the H template contains four non-ribozyme nucleotides at the 3'end. N is a template for a plasmid linearized with the restriction enzyme NdeI. From N mold Transcript contains 220 non-ribozyme nucleotides at the 3'end. R is a restriction enzyme This is a template for a plasmid linearized with RcaI. 3 transcripts from R template It contains 450 non-ribozyme nucleotides at the'-end.   FIG. 28 shows the trans-cleavage reaction catalyzed by hammerhead ribozyme. 3 shows the effect of the 3'flanking sequence. 622-nucleotide internally labeled RNA ( <10 nM was incubated with ribozyme under single turnover conditions (her Shrug and Keck (Herschlag and Cech), 1990 Bi Chemistry 29, 10159). HH + 2, HH + 3 and HH + 52 was generated by transcription from HH, ΔHDV and HH (mutant) constructs, respectively. Is a trans-acting ribozyme produced and has 2,37 and And 52 extra nucleotides. The uncleaved substrate fraction plot versus time. Lot is a two-stage index using a Kaleida graph drawing program A curve was fitted (double exponential curve) (S ynery Software, Reading, PA). Suitable for two-step exponential curve The reason for using the match is that the data points are probably for ribozyme and / or substrate RNA. This was because the linear exponential curve was not fitted due to the change of type.   Figure 29 shows RNA self-processing in OST7-1 cells. In vitro Lanes are full-length unprocessed transcripts added to cell lysates prior to RNA extraction. Including things. These RNAs are hybridized with 5'end labeled primer Before MgCl₂Incubate with either (+) or DEPC treated water (-) in advance. Was Cell lanes transfected with one of four self-processing constructs Includes total cellular RNA from intact cells. Cellular RNA has sequence-specific primer extension The length assay is used to probe for ribozyme expression. The solid arrow indicates the full length RN The positions of the primer extension bands corresponding to A and 3'cleavage products are shown.   Figures 30 and 31 show that at the 5'and 3'ends following self-processing Releases a trans-acting ribozyme with a stable stem-loop structure defined by A self-processing cassette is depicted schematically. Figure 30 shows hammerhead self The various permutations of the processing cassettes are shown. Figure 31 indicates the various permutations of the hairpin self-processing cassette.   32a-b are schematic depictions of the RNA polymerase III promoter structure. is there. Arrows indicate the direction of the transcription start site and the coding region. A, B and C are It refers to the consensus A, B and C box promoter sequences. I is intermediate By cis-acting promoter sequence. PSE means proximal array element. D SE means distal array element. ATF means activation of transcription factor binding element You. ? Means a cis-acting sequence element that has not been fully characterized. EBER is RNA encoded by the Ebstein-Barr virus. TATA is a business It is a well-known box in the world.   33a-e show early tRNA_i ^metAnd sequences of Δ3-5 transcripts. Bock Subs A and B are internal promoter regions required for transcription of pol III. Arrow Indicates an endogenous tRNA processing site. Δ3-5 transcripts are defective in tRNA. And the 3'sequence of box B is deleted (Adeny-Zones ( Adeniii-Jones), 1984, supra). Due to this modification, Δ3-5R NA becomes resistant to the processing of endogenous tRNA.   FIG. 34 is a schematic depiction of the RNA structural motif inserted in Δ3-5 RNA. . Δ3-5 / HHI: Hammerhead (HHI) ribozyme of Δ3-5 RNA It was cloned into the 3'region. S3: A stable stem-loop structure of Δ3-5 / HHI It was inserted at the 3'end of the chimera. S5: A stable stem-loop structure of Δ3-5 / HH The I ribozyme chimera was inserted at the 5'and 3'ends. S35: Δ3-5 / HH The sequence at the 3'end of the I ribozyme chimera was changed so that the A duplex was formed with the complementary 3'region. S35 Plus: Structural change of S35 In addition, by changing the sequence, the non-ribozyme of Δ3-5 / HHI ribozyme chimera An additional duplex was formed in the sequence.   35 and 36 are ribozymes of T cell lines transduced with the Δ3-5 vector. Northern analysis for quantifying. (35) Δ3-5 / HHI and mutants thereof Were individually cloned into a DC retroviral vector (Slengel (Sulgel Lenger) et al., 1990, supra). Ribozymes expressed in MT-2 cells Northern analysis of chimeras was performed. Total RNA was isolated from cells (Komotinsky And Thatch (Chomczynski & Sacci), 1987 Anal vertical Biochemistry 162, 156-159), FIG. 34. Various constructs were transduced as described in. Northern analysis is standard The protocol was used (Curr. Protocols Mol. Bio. l. 1992, Ausbel et al., Wiley & Sons, NY). The naming is the same as in FIG. This assay is a type 2 pol III The expression level from Lomotor is measured. (36) S35 construct in MT2 cells Expression. S35 (+ ribozyme) is an S35 construct containing HHI ribozyme . S35 (-ribozyme) is a ribozyme-free S35 construct.   FIG. 37 shows ribozyme activity in total RNA extracted from transduced MT2 cells. Shows sex. Total RNA transduces the Δ3-5 construct described in Figures 35 and 36. Isolated from isolated cells. In a standard ribozyme cleavage reaction, 5 μg of total RN A and trace 5'end labeled ribozyme target RNA in 50 mM Tris-H. Cl, pH 7.5 and 10 mM MgCl₂2 minutes at 90 ° C in the presence Individually denatured. RNA was used to cool the reaction mixture to 37 ° C for 10-15 minutes. Played more. For the cleavage reaction, the labeled substrate RNA and total cellular RNA are mixed at 37 ° C. It started by doing. After allowing the reaction to proceed for about 18 hours, the sample was treated with 20% urea- It was analyzed by acrylamide gel. Band visible by autodageography It has become.   38 and 39 are ribozymes of cloned CEM cell line transduced with S35. System expression and activity levels. 38) Clone CE transduced in S35 Northern analysis of M cell lines. The standard curve shows the known amount of R of in vitro transcribed S5. NA was spiked into total cellular RNA isolated from untransduced CEM cells (spi). ke). The pool is a storage cell transduced with the S35 construct. Includes RNA from cells. Pool (-G418, 3Mo) was initially G418 resistant From preserved cells that were selected for and then grown for 3 months in the absence of G418. Includes RNA. Lanes A to N are from stored cells transduced with the S35 construct Contains RNA from the resulting individual clones. tRNA_i ^metMeans endogenous RNA I do. S35 indicates the position of the ribozyme band. M indicates a marker lane. 39) Activity levels of cloned CEM cell lines transduced with S35. RNA alone The detachment and cleavage reactions were as described in Figure 37. Nomenclature is shown in Figures 35 and 36. And S is a 5'end labeled substrate RNA, P Is an 8 nt 5'-end labeled ribozyme-mediated RNA cleavage reaction product.   40 and 41 show S35 and S containing the desired RNA (HHI), respectively. 35 proposed secondary structures. The location of the HHI ribozyme is shown in Figure 41. I have. The intramolecular stem is an intramolecular base pair phase between the 3'sequence and the complementary 5'end. It means a stem structure formed by interaction. The length of the stem is 15-16 bases It is a pair range. The positions of the A and B boxes are shown.   42 and 43 show S35 plus and SHI plus containing HHI ribozyme. Is the proposed secondary structure of.   44, 45, 46 and 47 show S35, HHIS35 and S35 processes, respectively. It is the nucleotide base sequence of Russ and HHIS35 plus.   Figures 48a-b are general formulas for pol III RNA of the invention.   Figure 49 is a schematic depiction of the 5T construct. In this construct, the desired RNA Is located 3'to the intramolecular stem.   Figures 50 and 51 show only the 5T construct and the desired RNA (HHI lysate, respectively). Bozyme) containing 5T proposed secondary structure.   Figure 52 is a schematic depiction of the TRZ-tRNA chimera. Of the desired RNA insert Indicates the position.   Figure 53 shows the general structure of the HHITRZ-A ribozyme chimera. Part Hammerhead ribozymes targeting I are stems of the TRZ-tRNA chimera It is inserted in the II region.   Figure 54 shows the general structure of the HRITRZ-A ribozyme chimera. Part I Hairpin ribozymes targeting the Cloned.   FIG. 55 shows HHITRZ-A, HHITRZ-B and chemically synthesized H. 5 shows a comparison of RNA cleavage activity of HI hammerhead ribozyme.   Figure 56: Ribozymes in T cell lines stably transduced with viral vectors The expression of M is a marker, lane 1 is non-transduced CEM cells, Lanes 2 and 3 are MT2 and CEM transduced with retroviral vector Cell line, lanes 4 and 5 are MT2 and AAV vector transduced CEM cell line.   57a-b show adeno-associated virus and adduct for delivery of ribozymes. It is a schematic diagram of a novirus vector. Both vectors contain RNA polymerase II or Or one or more probes based on the RNA polymerase III promoter. A transcription unit (RZ) encoding a bozyme is used. A is the vector genome Inverted terminal repeat (ITR) at each end of exogenous, exogenous promoter (Pro) Any selectable marker (Neo), ribozyme transcription unit, or And sufficient addition to maintain a vector of appropriate length for efficient packaging Of AAV-based vector containing minimal AAV sequence consisting of specific sequence (stuffer) It is a solution. B is a deletion of one or more wild type adenovirus coding regions. Including losses (hatched boxes labeled E1, pIX, E3 and E4), and The insertion of a ribozyme transcription unit into any one or several of these deletion regions is included. FIG. 1 is an illustration of a ribozyme expressing adenovirus vector.   Figure 58 shows the activity of the ligated hammerhead (HH) ribozyme. It is a graph which shows the influence of the change of the length of an arm which it has. 5/5, 6/6, 7/7 , 8/8 etc. means the number of base pairs formed between the ribozyme and the target . For example, 5/8 is the 5'side of the cleavage site when the HH ribozyme is 13 bp in total. To form 5 bp on the 3'side and 8 bp on the 3'side. -ΔG is ribozai Free energy of binding calculated for base-pair interactions between membrane and substrate RNA -Turner and Sugimoto (Turner and Sugimoto ), 1988 Ann. Rev .. Biophys. Chem. 17, 167). RPI A is an HH ribozyme with a 6/6 binding arm.   Figures 59 and 60 and 61 show the ligated HH ribozyme. Cleavage of long substrate (622 nt) is shown.   FIG. 62 shows a hammerhead ribozyme targeting a site designated H (H HH) is a schematic depiction. Two base pair stem II (HH-H1 and HH- H2) or 3 base pair stem II (HH-H3 and HH-H4) The included HH-H variants are also shown.   63 and 64 show the RNA cleaving activity of HH-I and its variants (Figure 62). 63) Cleavage of matched substrate RNA (15 nt). 64) long group Of high quality RNA (613nt).   65a-b show the method of the invention for synthesizing full length hairpin ribozymes. Is a schematic depiction of. Ligation does not require splints, but two instead Fragment hybridizes in helix 4 before ligation. Only before All that is required is that the 3'fragment be phosphorylated at its 5'end. , And the 3'end of the 5'fragment has a hydroxyl group. Hairpin Bozyme targets site J. H1 and H2 form between the ribozyme and the substrate. It is the formed intramolecular helix. H3 and H4 are hairpin ribozyme models. It is an intramolecular helix formed in the chief. The arrow indicates the cleavage site.   FIG. 66 shows R of a ligated hairpin ribozyme targeting site J Shows NA cleaving activity.   67a-b show hairpin ribozymes / groups as described in the art. Of the site K hairpin ribozyme (HP-K) showing the proposed secondary structure of the protein complex A schematic depiction (Berzal-Herranz et al. , 1993 EMBO. J. 12, 2567). The ribozyme is composed of two fragments Assembled (two-molecule ribozyme; Cholia and Burke (Chowria)   and Burke), 1992, Nucleis Acids Res. 2 0,2835), # H1 and H2 are intermolecular helices between the ribozyme and the substrate. Represents formation. H3 and H4 represent intramolecular helix formation within the ribozyme (Intermolecular helix in the case of bimolecular ribozyme). The left panel (HP-K1) is A 4 base pair helix 2 is shown and the right panel (HP-K2) shows a 6 base pair helix. Helicopter Socks 2. The arrow indicates the RNA cleavage site. As discussed herein All ribozymes use RNA phosphoramidite chemistry unless otherwise indicated. Then, it was chemically synthesized by solid phase synthesis. Those skilled in the art will be able to import these ribozymes. It will be appreciated that it may be produced by transcription in vitro and in vivo.   Figure 68 is a graph showing RNA cleavage by hairpin ribozymes targeting site K. It's rough. Fragment of uncut target RNA (non-cut fraction ) Is shown as a function of time. HP-K2 (6 bp helix 2) Cleaves 422 target RNA to a higher degree than HP-K1 (4 bp helix 2). Refuse.   In order to prepare an internal labeled substrate RNA for transribozyme cleavage reaction, Use a primer that places the T7 RNA promoter upstream of the amplified sequence The 422 nt region (including hairpin site A) was synthesized by PCR. Target RN A is [α-³²Transcribed in standard transcription buffer in the presence of P] CTP (Chowria and Burke, 1991, before Record). The reaction mixture was treated with 15 units of ribonuclease-free DNase I Extract with phenol, and then extract with chloroform: isoamyl alcohol (25: 1). After taking out, it was precipitated with isopropanol and washed with 70% ethanol. Dried pea The lett was suspended in 20 μl of DEPC-treated water and stored at −20 ° C.   Unlabeled ribozyme (1 μM) and internally labeled 422 nt substrate RNA (< 10 nM) separately in standard cleavage buffer (50 mM Tris-HCl, pH 7). . 5 and 10 mM MgCl₂In) for 10 minutes by heating at 90 ° C for 2 minutes It was denatured and regenerated by slow cooling to 37 ° C. during. The reaction is a ribozyme Incubate at 37 ° C starting by first mixing the substrate mixture with Was. Aliquots of 5 μl were removed at regular time intervals and an equal volume of 2 × formami Quench by adding dogel loading buffer and dry ice. Frozen above. Samples were separated on a 5% polyacrylamide sequencing gel and The results are shown in Phosphorimager (Molecu). radiometric image using lar Dynamics, Sunnyvale, CA) Quantitative analysis.   Figure 69a-b is the site L hairpin ribozyme (HP-L) and shows Figure 3 shows the proposed secondary structure of the Bozyme / Substrate complex. The ribozyme is as described above. It was assembled from two pieces. The nomenclature is as described above.   Figure 70 shows RNA cleavage by a hairpin ribozyme targeting site L. A is a fraction of the uncleaved target RNA (non-cleaved fraction) Is shown as a function of time. HP-L2 (6 bp helix 2) is HP- Cleaves 2 kB of target RNA to a greater extent than L1 (4 bp helix 2). To generate an internal labeled substrate RNA for transribozyme cleavage reaction, P using a primer that places the T7 RNA promoter upstream of the widened sequence A 2 kB region (including a hairpin site L) was synthesized by CR. The cleavage reaction is above Was carried out as follows.   71a-b is the site M hairpin ribozyme (HP-M), Figure 3 shows the proposed secondary structure of the Bozyme / Substrate complex. The ribozyme is as described above. It was assembled from two pieces.   FIG. 72 is a graph showing RNA cleavage by a hairpin ribozyme targeting site M. It's rough. Ribozymes were tested at both 20 ° C and 26 ° C. Transribozer Of the amplified sequence to create an internal labeled substrate RNA for the immunocleavage reaction. By PCR using a primer that places the T7 RNA promoter upstream, 1 . A 9 kB region (including hairpin site M) was synthesized. The cleavage reaction is as described above Performed, but using temperatures of 20 ° C and 26 ° C.   73a-d show various structural modifications of the present invention. a) Missing helix 5 Hairpin ribozyme. The nomenclature is as described in FIG. b) Helix 4 And a hairpin ribozyme lacking helix 5. Helix 4 is a nucleotide loop Has been replaced with q, and q has 2 or more bases. The naming is as described in Figure 3. is there. c) relates to a hairpin ribozyme lacking helix 5. Helix 4 roux Has been replaced with linker 103 "L", where L is a non-nucleotide linker Molecule (Benseler et al., 1993 J. Am. Che. m. Soc. 115, 8483; Jennings et al., WO9. 4/13688). The nomenclature is as described in FIG. d) Helix 4 and Hairpin ribozyme lacking helix 5. Helix 4 is a non-nucleotide linker -Replaced by the molecule "L" (Benceller et al., 1993 supra; Jenning Su et al., Supra). The nomenclature is as described in FIG.   74a-b show that the nucleotide spacer region "s" was included at the indicated position. Indicates an apin ribozyme, where s is 1 or greater. Hair with spacer regions Can the pin ribozyme be synthesized as a single fragment or multiple fragments? Can be assembled. The nomenclature is as shown in FIG.   75a-e show the structures of 5'-C-alkyl modified nucleotides. R₁Is As defined above. R is OH, H, O-protecting group, NH, or Is any of the groups described in the following documents. B is as defined in the figure Or other equivalent nucleotide bases. CE is cyanoethyl, DMT is a standard blocking group. Other abbreviations are standard in the industry It is.   Figure 76 is a 5'-C-alkyl-D-allose nucleotide. And a schematic depiction of its phosphoramidite.   Figure 77: 5'-C-alkyl-D-talose nucleotides And a schematic depiction of its phosphoramidite.   Figure 78 shows 5'-C-methyl- at various positions targeting site O. 1 is a schematic depiction of a hammerhead ribozyme containing an L-taro modification.   FIG. 79 shows the RNA cleavage activity of HH-O ribozyme. Not cut The fractional RNA is shown as a function of time.   FIG. 80 is numbered at the position of the hammerhead ribozyme indicating the particular substitution. A schematic depiction of something (Hertel et al., Nucleic Ac ids Res. 1992, 20, 3252).   81a-j also show the structures of various 2'-alkyl modified nucleotides. , And they exemplify the invention. R is an alkyl group, Z is a protecting group is there.   Figure 82 is a schematic depiction of the synthesis of 2'-C-allyluridine and cytidine. You.   Figure 83 shows 2'-C-methylene and 2'-C-difluoromethyleneuridine. Is a schematic depiction of the synthesis of.   Figure 84 shows 2'-C-methylene and 2'-C-difluoromethylene cytidine. Is a schematic depiction of the synthesis of.   Figure 85 shows 2'-C-methylene and 2'-C-difluoromethylene adenosine. Figure 3 is a schematic depiction of the synthesis of the   FIG. 86 shows 2'-C-carboxymethylidine uridine, 2'-C-methoxycarcinone. A schematic depiction of the synthesis of ruboximetyridine uridine and its derived amidites. It is a photo. X is CH as described above_ThreeOr is alkyl or other substitution Group.   Figure 87 shows the nucleoside 5'-deoxy-5'-difluoromethylphosphone. 3 is a schematic depiction of a composition of g.   Figure 88 shows the nucleoside 5'-deoxy-5'-difluoromethylphosphone. Of 3'-phosphoramidites, dimers and solid-supported dimers 1 is a schematic depiction of a composition.   Figure 89 shows the nucleoside 5'-deoxy-5'-fluoromethylene triphosphate 1 is a schematic depiction of a composition.   Figures 90 and 91 show 3'-deoxy-3'-difluoromethylphosphonate. And is a schematic depiction of the synthesis of dimers.   FIG. 92 is a diagram showing the RNA ho of the nucleotide containing the 2′-hydroxyl group modification of the present invention. 1 is a schematic depiction of the synthesis of a formamidite.   Figure 93a-b shows oligonucleotidies containing a 2'-hydroxyl group modification of the present invention. Describe the deprotection method for   Figure 94 is a schematic depiction of a hammerhead ribozyme targeting site N. . The position of substitution of the 2'-hydroxyl group is shown.   Figure 95: RNA cleavage of ribozymes containing 2'-hydroxyl modification of the present invention Shows activity. Total RNA is hammerhead without 2'-hydroxyl modification Represents ribozyme (HHN). U7-ara is 2'-NH-alanine at the U7 position. Represents a HHN ribozyme with modifications. U4 / U7-ala is in U4 and U7 positions Represents an HHA containing a 2'-NH-alanine modification. U4 lys is second in U4 Represents an HHA containing a'-NH-lysine modification. U7 lys is 2'-N in U7 position Represents HHA with H-lysine modifications. U4 / U7-lys are U4 and U7 Represents HHN with a 2'-NH-lysine modification at position.   96 and 97 show the synthesis (solid phase synthesis) of the 3'end of RNA with the modifications of the invention. Is a schematic representation of. B is a base, a modified base, or H.   98 and 99 show the synthesis (solid phase synthesis) of the 5'end of RNA with the modifications of the invention. Is a schematic representation of. B is a base, a modified base, or H.   100 and 101 are general schematic depictions of the invention.   102a-d are schematic depictions of the method of the present invention.   103 is a graph of the results of the experiment illustrated in FIG. 104.   Figure 104 is a schematic depiction of the fusion mRNA used in the experiment illustrated in Figure 102. It is a photo.   Figure 105 is a schematic depiction of a method of selecting useful ribozymes of the present invention.   Figure 106 generally shows R-loop formation and R-loop complexes. further, At least three different methods, such as ligand-receptor interaction, lipid or R-loop replication using calcium phosphate-mediated delivery or electroporation Positions that can provide a ligand for targeting the merger to cells are indicated.   FIG. 107. Self-Processing to Generate Unit-Length Therapeutic Ribozymes The method of using the gribozyme is shown. This method is essentially a Draper. er) et al. (PCT WO 93/23509).   FIG. 108 shows that a liga such as folate, carbohydrate or peptide. Shows the method of binding the RNA to the RNA loop forming RNA.   The ribozyme of the present invention comprises ICAM-1, IL-5, relA, TNF-α, p. 210^bcr-ablOr block the expression of the RSV gene to some extent, and It can be used for the treatment or diagnosis of such diseases. Ribozymes are used in cells in culture. And will be delivered to tissues in animal models. ICAM- in these systems 1, IL-5, relA, TNF-α, p210^bcr-ablOr RSV mRNA Cleavage of ribozymes may prevent or alleviate the symptoms or condition of the disease. I. Target site   Useful ribozyme targets are PCT WO93 / 23509, such as Draper, PCT WO94 / 02595 such as Sullivan and PCT / such as Draper US94 / 13129, which is hereby incorporated by reference in its entirety. You can make decisions as follows. Provided in these documents in this document Without repeating the example given, we provide specific examples of these methods below, These are not limited to methods in the art. Ribozyme against such a target Designed as described in these applications and as described. And are tested in vitro and in vivo. Such ribozymes are books It can also be optimized and delivered as described in the application. Animals and Specific examples are provided for human RNA, or one skilled in the art will appreciate the equivalent human RNs described. It will be appreciated that the A target can be used as described below. Thus , The same target can be used, but suitable for targeting human RNA sequences The binding arm that exists is in the ribozyme. Such targets are described below. You can also select.   Part predicted by computer-based RNA folding algorithm It must be established that the position corresponds to a potential open site. Hammer head Or a hairpin ribozyme is designed to bind to the Rita Tami (Jaeger et al., 1989 Proc. Natl. Acad. Sci., USA,86 7706 ~ 7710) Whether the ribozyme sequence is folded into a suitable secondary structure Evaluate. Has unfavorable intramolecular interactions between the binding arm and the catalytic core Ribozymes are excluded from consideration. Optimum activity by choosing different binding arm lengths Can be Generally, at least 5 bases in each arm bind to the target RNA It may or may not interact with the target RNA.   Regarding the cleavage site that can be used for mRNA, PCT WO93 / 235 by Draper et al. 69, which is generally described herein, which is incorporated herein by reference. To screen. Simply put, a potential hammerhead or hairpin A DNA oligonucleotide representing the ribozyme cleavage site is synthesized. Polymerer The T7 RNA polymerase transcription group from the cDNA clone using the ze chain reaction. Give rise to quality. Labeled RNA transcripts are synthesized in vitro from a DNA template. Oh Anneal the lygonucleotide to the labeled transcript. Add Ribonuclease H , And incubate the mixture at 37 ° C for the specified time. Reaction stopped And the RNA is separated on a sequencing polyacrylamide gel. Cleaved substrate Percentage of autoradiographic quantification using a phosphorus imaging system taking measurement. From these data, the hammerhead or hairpin ribozyme sites were identified. Select as the most available.   Design a hammerhead or hairpin motif ribozyme to design mRNA Anneal to various sites in the cage. The binding arm contains the target site sequence described above. It is complementary. Ribozymes are chemically synthesized. The synthesis method used is Usman (Usman) et al., 1987 J. Am. Chem. Soc.,109, 7485 and Scaringe ), Etc., 1990 Nucleic Acids Res.,18, 5433 and the 5'end Conventional nucleic acid protecting groups such as toxitrityl, 3'-terminal phosphoramidite and The usual RNA synthesis method using a pulling group is followed. Average gradual coupling The ring yield is> 98%. Inactive ribozyme is G_FiveInstead of U then A₁₄of Instead, synthesize using U (Hertel et al., 1992 Nucleic Acids Res.,20, 32 Number by 52). Hairpin ribozyme synthesized in two parts and annealed To reconstitute active ribozymes (Chowrira and Burke, 1992 Nucleic Acids Res.,20, 2835-2840). Ribozymes are bacteriophage T7 RNA polymers Is also synthesized from a DNA template using the enzyme (Milligan and Uhlenbach, 1989, Mehtods Enzymol,180, 51). Ribozymes all have nuclease resistant groups such as With 2'-amino, 2'-C-allyl, 2'-fluoro, 2'-O-methyl, 2'H Extensively modified to enhance stability (for review see Usman and Cedergren, 1992 TIBS17, 34). Ribozymes are labeled using standard methods. Gel electrophoresis or high pressure liquid chromatography and reconstituted in water. Suspend.Example 1: ICAM-1   Ribozymes that cleave ICAM-1 mRNA are associated with inflammatory or autoimmune diseases. 2 shows a new treatment method for treatment. Of ICAM-1 using a monoclonal antibody Machine Noh can be therapeutically blocked. Ribozymes are generally immunologically inactive Has the advantage of being sexual, while some monoclonal antibody therapies A significant neutralization of the anti-IgG response can be observed.   The physiological role of ICAM-1 is briefly described below. Seems to be complete It is provided only to understand the invention that is not intended and which follows. this Summary is that any of the studies described below is prior art to the claimed invention I do not admit.   Intercellular adhesion molecule-1 (ICAM-1) is expressed by inflammatory mediators Is a cell surface protein that is induced. In ICAM-1, leukocytes contact endothelial cells Are required for attachment and presentation of antigen, immunoglobulin production and cytotoxicity. It is required for several immunological functions including cystic activity. Blocks ICAM-1 function Then animals undergoing transplant rejection as well as rheumatoid arthritis, asthma and reperfusion injury Interfere with immune cell recognition and activity in the model.   Cell-cell adhesion plays a crucial role in inflammatory and immune responses (Springer 1987 Ann. Rev. Immunol.Five, 223-252). As for cell adhesion, leukocytes are vascular endothelial cells. Needed to bind to and migrate through the cell. In addition, cell-cell Adhesion involves antigen presentation to T cells, induction of B cells by T cells, and T cells, NK It is required for cytotoxic activity of cells, monocytes or granulocytes. Intercellular adhesion molecule-1 (IC AM-1) is an immunoglobulin involved in all these cell-cell interactions A member of the superfamily of 110 kilodaltons (Simmons et al., 1988 Na ture (London)331, 624-627).   ICAM-1 is only in a limited number of cells and low in the absence of stimulation Expression only in (Dustin et al., 1986 J. Immunol.137, 245-254). Numerous inflammations Sex mediators (lipopolysaccharide, γ-interferon, tumor necrosis factor-α or Interleukin-1) treats various cell types (endothelium, Epithelia, fibroblasts and hematopoietic cells) express high ICAM-1 values on their surface ( Sringer et al., Supra; Dustin et al., Supra; and Rothlein et al., 1988 J. Am. Immunol.141 , 1665-1669). Induction occurs by increased transcription of ICAM-1 mRNA (Sim mons et al., supra). Increased expression was detectable 4 hours after induction and after 16-24 hours Reach maximum.   ICAM-1 induction is important for many inflammatory and immune responses. In vitro, I CAM-1 antibody blocks adhesion between leukocytes and cytokine-activated endothelial cells (Boyd, 1988 Proc. Natl. Acad. Sci. USA85, 3095-3099; Dustin and sprin ger, 1988 J. Cell Biol.107, 321-331). Thus, immune cells are at the site of inflammation Expression of ICAM-1 appears to be required for overflow. Of ICAM-1 The antibody also blocks T cell killing, mixed lymphocyte reaction and T cell mediated B cell differentiation, It has been suggested that ICAM-1 is required for the interaction of these syngeneic cells (B oyd et al., supra). The importance of ICAM-1 in antigen presentation is due to the fact that ICAM-1 deletion Highlighted by the inability of Zumi B cell mutants to stimulate antigen-dependent T cell proliferation (Dang et al., 1990 J. Immunol.144, 4082-4091). Conversely, murine L cells In addition to HLA-DR, human ICAM-1 is used to provide antigen to human T cells. Transfection (Altmann et al., 1989 Nature, London)Three 38 , 512-514). In summary, in vitro evidence suggests that inflammatory responses, cellular immune responses and ICAM-1 is required for cell-cell interactions critical for humoral antibody responses Is shown.   By manipulating the ribozyme motif, the inventor discovered that ICAM-1 Several ribozymes were designed for mRNA sequences. These are nuclease resistant It was synthesized with modification so as to improve the sex. These ribozymes are IC Cleaves the AM-1 target sequence.   Sequences of human, rat and mouse ICAM-1 mRNA are computer folded. It is possible to screen for available sites using a folding algorithm it can. Not forming a secondary folding structure and potentially hammerhead or A region of mRNA containing the hairpin ribozyme cleavage site can be identified . These sites are shown in Tables 2, 3 and 6-9. (In these tables, the sequences are all 5 ' 3 '). Rat, mouse and human sequences were screened and Bozymes can be designed, but human targeting sequences are of most benefit.   The sequences of chemically synthesized ribozymes useful in this study are shown in Tables 4-8 and 10. Skilled person These sequences affect the activity of the enzyme part of the ribozyme (all but the binding arm). Modified to give a sonic effect and ribonucleotides or other nucleos Are only representative of the large number of sequences that can be made from nucleotides or non-nucleotides Will admit. Such ribozymes are the same as those listed in the table. Are equivalent.   Ribozymes are delivered exogenously to human umbilical vein endothelial cells (HUVECs). To test for in vivo function. Ribozymes are incorporated into liposomes By complexation with cationic lipids, by microinjection, Alternatively, it is delivered by expression from the DNA or RNA vector described above. Sa Itokine-induced ICAM-1 expression was determined by ELISA and indirect immunofluorescence. , And / or monitored by FACS analysis. ICAM-1 mRNA level is By Northern method, by ribonuclease protection, by primer extension , Or by quantitative RT-PCR analysis. ICAM-1 protein and Ribozymes that block mRNA induction by 90% or more are identified.   Disclosed in PCT WO94 / 02595, such as Sullivan, incorporated herein by reference. As described above, the ribozyme and / or the gene encoding the ribozyme is an animal Delivered locally to the ex vivo implant of the model. Ribozyme expression is ICA By the ability to block ex vivo induction of M-1 mRNA and protein Monitor. Next, the effect of anti-ICAM-1 ribozyme on graft rejection To evaluate. Similarly, ribozymes affect mice with collagen-induced arthritis or It is introduced into the joints of rabbits with Streptococcus cell wall-induced arthritis. Uses liposome delivery, cationic lipid delivery or adeno-associated viral vector delivery can do. A stable anti-ICAM-1 ribozyme or essentially a ribozyme These can be achieved by a single administration (or a few irregular administrations) of the expressing gene construct. Can end the inflammation and immune response of the disease.use   ICAM-1 plays a central role in immune cell recognition and function. Riboza Blocks ICAM-1 Expression by Im Alleviates Graft Rejection and Rheu To relieve symptoms in patients with matoid arthritis, asthma or other acute and chronic inflammatory diseases. Can be. The inventors have identified several ribozymes that cleave ICAM-1 mRNA. Designed. Ribozymes that effectively block ICAM-1 expression in cells are easy And their activity is associated with graft rejection in animal models and It can be measured for its ability to block symptoms of joint inflammation. These anti-IC AM-1 ribozymes represent a new treatment for treating immunological or inflammatory diseases You.   Therapeutic usefulness by reducing the activity of ICAM-1 function is as follows. And clear. The references cited are for the role of ICAM-1 and herein. Demonstrating the therapeutic potential of ribozymes. Thus, these targets are ICAM- 1 can be treated with a substance that reduces expression or function. These diseases and their Studies supporting the crucial role of ICAM-1 in their pathology are listed below. Indicated by This list is not intended to be complete and those skilled in the art Additional conditions and diseases can be identified that can be effectively treated using the ribozymes of the invention. There will be. ・ Graft rejection       ICAM-1 is a human heart biopsy specimen with histological signs of graft rejection. Expressed in venules and capillaries (Briscoe et al., 1991 Transplantation51, 537 ~ 539).       Antibodies to ICAM-1 were derived from primate kidney (Cosimi et al., 1990 J. Immunol.144 , 4604-4612) and the heart (Flavin et al., 1991 Transplant Proc.twenty three, 533 ~ 534 ) Block graft rejection.       Phase I clinical trial of monoclonal anti-ICAM-1 antibody is human kidney transplant It showed a marked reduction in rejection and a marked increase in graft function in one patient (Hau 1993 Transplantation55, 766-772). ・ Rheumatoid arthritis       ICAM-1 overexpression results in synovial fibroblasts, endothelial cells, macrophages and Found on certain lymphocytes (Chin et al., 1990 Arthritis Rheum33, 1776 to 1786; K och et al., 1991 Lab Invest64, 313-320).       Soluble ICAM-1 levels are associated with disease severity (Mason et al., 1993 Art. hritis Rheum36, 519-527).       Anti-ICAM antibody blocks collagen-induced arthritis in mice (Kakimoto Et al., 1992 Cell Immunol142, 326-337).       Anti-ICAM antibody blocks adjuvant-induced arthritis in rats (Iigo et al. , 1991 J Immunol147, 4167-4171). ・ Myocardial ischemia, stroke and reperfusion injury       Anti-ICAM-1 antibody blocks neutrophil adhesion to anoxic endothelial cells (Yoshida et al., 1992 Am J Physiol262, H1891-198).       Anti-ICAM-1 antibody reduces neurological damage in a rabbit stroke model (B owes et al., 1993 Exp Neurol119, 215-219).       Anti-ICAM-1 antibody protects against reperfusion injury in a feline myocardial ischemia model (Ma et al. , 1992 Circulation86, 937-946). ・ Asthma       ICAM-1 antibody partially blocked eosinophil adhesion to endothelial cells And overexpressed in vivo in inflamed airway endothelium and epithelium (Wegner et al., 1990 Sci. ence247, 456-459).       Anti-ICAM-1 antibody blocks airway eosinophilia in a primate model of asthma (Wegner et al., Supra) and recovery of airway inflammation and hyperresponsiveness after dexamethasone treatment. Life (Gundel et al., 1992 Clin Exp Allergytwenty two, 569-575). ・ Psoriasis       Surface ICAM-1 and truncated solubles of ICAM-1 are expressed in psoriatic lesions, And expression is associated with inflammation (Kellner et al., 1991 Br J Dermatol.125, 211 ~ 2 16; Griffiths 1989 J Am Acad Dermatol20, 617-629; Schopf et al., 1993 B r J Dermatol128, 34-37).       Anti-ICAM-1 antibody blocks keratinocyte antigen presentation to T cells (Nickoloff et al., 1993 J Immunol150, 2148-2159). ・ Kawasaki disease       Surface ICAM-1 expression is associated with Kawasaki disease and effective immunoglobulin Decreased by treatment (Leung et al., 1989 Lancet2, Number 1298 to 1302).       Soluble ICAM levels are elevated in patients with Kawasaki disease; especially high levels are in patients with coronary artery disease See Furukawa et al., 1992 Arthritis Rheum35, 672-677; Tsuji, 1992 Year Arerugi41, 1507-1514).       Circulating LFA-1⁺T cells are deleted in Kawasaki disease patients (probably ICAM- 1 By vector spill) (Furukawa et al., 1993 Scand J Immunol37, 377-380).Example 2: IL-5   Ribozymes that cleave IL-5 mRNA are new to inflammatory diseases such as asthma It shows the method of treatment of the regulation. The present invention uses ribozymes, for example in lymphocytes By blocking the synthesis of IL-5 and preventing recruitment and activation of eosinophils , Characterized by treating chronic asthma.   In addition to IL-5, platelet activating factor, IL-1, IL-3, IL-4, GM-CSF , TNF-α, gamma interferon, VCAM, ILAM-1, ELAM-1 And numerous cytokines including NF-κB are also involved in inflammatory activation in asthmatics There is a possibility. In addition to these molecules, any that mediate the activity of cytokines Cellular receptors also appear to be good targets for mediating inflammatory disease. These targets include airway keratinocytes, epithelial and endothelial cell IL-1R and T NF-αR is included, but is not limited to. Recent data show that It suggests that the peptide plays a role in asthma symptoms. These pepti The substance contains substance P, neurokinin A and calcitonin-gene-related peptide. I will. These target genes may have a more general role in inflammatory diseases However, at present it is believed to have a role only in asthma.   The ribozymes of the present invention block IL-5 expression to some extent and treat disease or Can be used to diagnose such diseases. Ribozymes affect cells in culture And delivered to cells or tissues in animal models of asthma (Clutterbuck et al., 1989, supra;  Garssen et al., 1991 Am. Rev. Respir. Dis.144, 931-938; Larsen et al., 1992.  J. Clin. Invest.89, 747-752; Mauser et al., 1993, supra). In these systems Ribozyme cleavage of IL-5 mRNA prevents inflammatory cell function and The symptoms of the disease can be relieved.   The sequences of human and mouse IL-5 mRNA are computer-folded. Were screened for available sites. Potential hammer The DNA or hairpin ribozyme cleavage site was identified. These sites are shown in Tables 11, 13 and Shown in 14 and 15. (All sequences in the table are 5'to 3 '). Mouse and human sequences The ribozyme can be engineered and then designed for human targeting. The columns are the most informative. However, the effectiveness of the action of ribozymes before they were tested in humans Mouse-targeted ribozymes are useful for testing sex. Nucleotide base position Is described in the table as a site that is cleaved by the designated ribozyme type. (In Table 12 , The letters in the lower case indicate unconserved positions between human and mouse IL-5 sequences. Show. )   The sequences of chemically synthesized ribozymes useful in this study are shown in Tables 12, 14-16. Those skilled in the art These sequences affect the activity of the enzyme part of the ribozyme (all but the binding arm) Acknowledged to be only representative of the large number of sequences that have been modified to give Will For example, the stem heads of the hammerhead ribozymes shown in Tables 12 and 14 Group II sequence (5'-GGCCGAAAGGCC-3 ') contains a minimum of two base pairs. As long as it can form a system structure, it is modified to include any sequence (substitution, deletion and And / or insertion). Similarly, for the hairpin ribozymes shown in Tables 15 and 16, The stem-loop IV sequence (5'-CACGUUGUG-3 ') has at least two base pairs. As long as it can form the stem structure of (change, deletion, And / or insertion). The sequences shown in Tables 12 and 14-16 are ribonucleotides. Or it can be made from other nucleotides or non-nucleotides. like this Ribozymes are equivalent to the ribozymes explicitly listed in the table.   By manipulating the ribozyme motif, the present inventor has found that the IL-5 mR Several ribozymes were designed towards the NA sequence. These ribozymes are Synthesized with modification to improve ase resistance. IL-5 target sequence in vitro so Assess the ability of the ribozyme to cleave.   Ribozymes were tested for in vivo function by analyzing IL-5 expression levels. Test. Ribozymes bind to cationic lipids by incorporation into liposomes. By plex formation, by microinjection, or DNA or RNA vector Is delivered to the cells by expression from the cell. IL-5 expression is a biological assay. By Liza, by indirect immunofluorescence, and / or by FACS analysis. Nitto. IL-5 mRNA levels were analyzed by Northern analysis, ribonuclease protection and Is assessed by primer extension analysis or quantitative RT-PCR. IL-5 activity And / or identify ribozymes that block the induction of IL-5 mRNA by 90% or more You.use   Cytokines produced by CD4 + T helper cells and mast cells Turleukin 5 (IL-5) was originally designated as B cell growth factor II (Takatsu et al., 19 1988 Immunol. Rev.102, 107). This is the proliferation of activated B cells It stimulates and induces the production of IgM and IgA. IL-5 is differentiated (Clutterbuck et al. , 1989 Blood73, 1504-1512), vascular adhesion (Walsh et al., 1990 Immunology71 , 258-265) and in vitro survival of eosinophils (Lopez et al., 1988 J. Exp. Med.167 , 219-224) and play a major role in eosinophil function. This cytokine also enhances histamine release from basophils (Hirai et al., 1990 J . Exp. Med.172, 1525-1528). The following summary of clinical results for treating asthma Supporting the selection of IL-5 as a primary target.   Several studies have shown that the number of activated T cells obtained from asthmatic vs. normal patients and their favorable A direct relationship between eosinophil numbers has been shown (Oehling et al., 1992 J. Investig. Allerg. ol. Clin. Immunol.2, 295-299). Which of allergic asthma or intrinsic asthma Some patients were treated with corticosteroids. Eosinophils, activity over 28-30 days Bronchoalveolar lavage was monitored for activated T helper cells and lung function recovery. Acid acid The number of spheres and activated T helper cells is intrinsic to those not treated with corticosteroids. There was a gradual decrease with subsequent improvement in lung function as compared to patients with asthma.   Bronchoalveolar lavage cells were subsitized using in situ hybridization of mRNA. Screened for production of itocaine. In-situ hybrid formation Gnar was detected in IL-2, IL-3, IL-4, IL-5 and GM-CSF. Upregulation of mRNA was observed with IL-4, IL-5 and GM-CSF (Robinso n et al., 1993 J. Allergy Clin. Immunol.92, 313-324). Another study is allergic Shows up-regulation of IL-5 transcripts from asthmatic patients treated with saline versus saline. (Krishnaswamy et al., 1993 Am. J. Respir. Cell. Mol. Biol.9, 279-286).   To determine the mechanism of action of corticosteroid improvement of asthma symptoms A patient study was conducted. Improvement was monitored by methacholine responsiveness. Metaco Phosphorus responsiveness, decreased number of eosinophils, decreased number of cells expressing IL-4 and IL-5 mRNA And a relationship between increased numbers of interferon-gamma expressing cells was observed.   Bronchial biopsies of 15 patients were analyzed 24 hours after allergen administration (Bentley et al. , 1993 Am. J. Respir. Cell. Mol. Biol.8, 35-42). Eosinophil and IL-2 receptor An increase in the number of putter-positive cells was found in these biopsies. Total white blood cell count, T lymph Lymphocyte count, elastase positive neutrophil count, macrophage count or mast cell subtype No difference in numbers was observed. Cells expressing IL-5 and GM-CSF mRNA. The number of cells increased remarkably.   In another patient's study, the eosinophil phenotype was identical in asthmatics and healthy individuals. However Asthma patients' eosinophils have greater leukotriene C4 production and migration abilities. Had. Increased IL-3, IL-5 and GM-CSF levels in the circulation of asthmatics However, it did not increase in healthy subjects (Bruijnzeel et al., 1992 Schweiz. Med. Woch enschr.122, 298-301).   The efficacy of IL-5 antibody was evaluated in a guinea pig asthma model. Obalumi to animals And responsiveness to eosinophils and bronchoconstrictor P did. Intraperitoneal administration of 30 mg / kg of antibody induces ovalmine for substance P Block sex sensitivity enhancement and increase eosinophil bronchoalveolar and lung tissue accumulation. Locked (Mauser et al., 1993 Am. Rev. Respir. Dis.148, 1623-1627). separate Guinea pigs treated with ovalmin for 8 days were tested for IL-5 Treated with antibody. Treatment reduced the number of eosinophils in bronchial lavage. Obalumi No reduction was observed in guinea pigs not treated with arginine and guinea pigs treated with control antibody. Perceived Was not. Antibody therapy against histamine and arecoline after administration of ovalmine Completely prevented the occurrence of hyperreactivity (van Oosterhout et al., 1993 Am. Rev. Res. pir. Dis.147, 548-552).   Results from human clinical analysis and animal studies show activated T helpers in asthma It shows the role of cells, cytokines and eosinophils. In eosinophil development and function The role of IL-5 in making it a good candidate for target selection. Antibody test Neutralized circulating IL-5 and thus prevented eosinophilia. Block production of IL-5 If stopped, the same purpose will be achieved.   Asthma-The main features of asthma are eosinophil infiltration and toxic eosinophil protein in the lungs. Quality deposits (eg major basic protein, eosinophil-derived neurotoxin). I Many T cell-derived factors such as L-5 are responsible for the activation and maintenance of eosinophils (K ay, 1991 J. Allergy Clin. Immun.87, 893). Blocking IL-5 expression in the lung Can reduce the activation of eosinophils and thus help relieve the symptoms of asthma. Would.   Atopy is the development of type I hypersensitivity reactions associated with exposure to certain environmental antigens. Characterized by raw. One of the usual clinical exacerbations of atopy is eosinophilia (in the blood It is an abnormally high accumulation of eosinophils). Antibodies against IL-5 are eosinophils in mice (Cook et al., 1993 Immunopharmacol. Eosinoph). Edited by ils, Smith and Cook, pages 193-216, Academic, London, UK).   Parasitic infection-associated eosinophilia-severe eosinophilia due to infection with helminth-like parasites Additional illness (Cook et al., 1993, supra). Animal models of eosinophilia , For example, mice can be infected with blood, peritoneal and / or tissue eosinophilia And all these increases are directed against IL-5. Seems to be reduced to varying degrees by.   Pulmonary infiltrative eosinophilia is characterized by high eosinophil accumulation in the lung parenchyma (Gleich, 1990 J. Allergy Clin. Immunol.85, 422).   L-tryptophan-related eosinophilia-myalgia syndrome (EMS) -EMS disease Is an essential amino acid, L-trypto, used to treat conditions such as insomnia Closely related to fan consumption (for a review, see Varga et al., J Invest 1993). . Dermatol.100, 97 et seq.). EMS patients by pathological and histological studies High eosinophil and mononuclear inflammatory cell levels were demonstrated. IL-5 and transforming growth factors Offspring play an important role in the development of EMS by activating eosinophils and other inflammatory cells. It seems to be doing well (Varga et al., 1993, supra).   Thus, it cleaves IL-5 mRNA and thereby eliminates IL-5 activity The rehozymes of the present invention have many potential therapeutic uses, and There are rational modes of delivering ribozymes in possible indications. IL- 5 The development of an effective ribozyme that blocks 5 functions is described above; Available cells And activity assays are numerous, reproducible and accurate. IL-5 function And there are animal models for each of the suggested disease targets (Cook et al., 1993, supra) and It can be used to optimize activity.Example 3: NF-κB   Ribozyme cleaving relA mRNA is a novel method for treating inflammatory or autoimmune diseases Shows the law. Lipopolysaccharide (LPS), interleukin-1 (IL-1) or Inflammatory mediators, such as tumor necrosis factor-a (TNF-α), interact with other cytokines. By inducing transcription of multiple secondary mediators, including in and adhesion molecules. Acts on cells. In many cases, this gene activation is a transcriptional regulator , Is known to be mediated by NF-κB. One subunit of NF-κB And the relA gene product (called RelA or p65) is specific for inducing an inflammatory response Are related to each other. Ribozyme therapy is so specific that it causes disease pathology. It is particularly well suited to target intracellular factors that contribute to science. Thus, relA Alternatively, ribozymes that cleave mRNA encoded by TNF-α are inflammatory and autologous. Novel therapeutics for treating immune disorders are shown.   Nuclear DNA-binding activity, NF-κB, is initially associated with immunoglobulin κ light chain enhancement in B cells. Was identified as a factor that binds to and activates the sensor. NF-κB is currently Diverse stimuli (eg phorbol esters, mitogens, cytokines and acids Other diverse cellular genes (eg cytokines, in response to oxidative stress) Transcription of adhesion proteins, oncogenes and viral proteins) It has been known. In addition, the molecular and biochemical characteristics of NF-κB indicate that this activity is D By homodimers or heterodimers of the family of NA-binding subunits It indicates that there is. Each subunit contains 300 genes homologous to the oncogene, v-rel. It has the length of mino acid. The activity originally described as NF-κB was p49 or p It is a heterodimer of 50 and p65. The p49 and p50 subunits of NF-κB (each Is encoded by the nf-κB2 or nf-κB1 gene) is a precursor, NF -ΚB1 (p105) or NF-κB2 (p100). P65 of NF-κB The subunit (now called RelA) is encoded at the rel A locus.   The role of each specific transcriptional activation complex is now being elucidated in cells. (N.D. Perkins et al., 1992 Proc. Natl Acad. Sci USA89, 1529-1533) . For example, the heterodimer of NF-κB1 and Rel A (p50 / p65) is an adhesion molecule, V It activates the transcription of the CAM-1 promoter, while NF-κB2 / RelA heterozygous The monomer (p49 / p65) actually blocks transcription (H. B. Shu et al., Mol. Cell. Biol.13 , 6283-6289 (1993)). Conversely speaking, NF-κB2 / RelA heterodimer ( p49 / p65) act on Tat-I to activate transcription of the HIV genome, while NF-κ The B1 / RelA (p50 / p65) heterodimer has little effect (J. Liu, N. D. Perkins, R.M. Schmid, G.J. Nabel, J. Virol. 199266, 3883 to 3887). Similarly, blocking the expression of the relA gene with antisense oligonucleotides Specifically blocks embryonic stem cell adhesion; N with antisense oligonucleotides Blocking F-κB1 gene expression has no effect on cell adhesion (Narayanan et al., 1993 Mol. Cell. Biol.13, 3802-3810). Thus, A promiscuous role initially assigned to NF-κB in photoactivation (M.J. Lenardo, D . Baltimore, 1989 Cell58, 227-229) is a rel family of DNA-binding proteins. It represents the total activity of Lee. This conclusion applies to individual members of the rel family Recent Tran It is supported by transgenic "knockout" mice. Such "No “Cookout” indicates that there is almost no developmental defect, and essential transcriptional activation Suggests that the function may be performed by more than one member of the rel family ing.   There are many specific inhibitors of NF-κB function in cells, among them Treatment with holothioate antisense oligonucleotides, double-stranded NF-κB Treatment at the binding site and the natural inhibitor MAD-3 (members of the IκB family -) Overexpression is included. These are involved in inflammation, as described below Used to show that NF-κB is required to trigger multiple molecules Have been.   ・ NF-κB is IL-6 (I. Kitajima et al., Science285, 1792-1795 (1992) ) And IL-8 (Kunsch and Rosen, 1993 Mol. Cell. Biol.13, 6137-6146) Is required for phorbol ester-mediated induction of.   NF-κB is an adhesion molecule ICAM-1 in endothelial cells (Eck et al., 1993 Mol. Cell. . Biol.13, 6530-6536), VCAM-1 (Shu et al., Above) and E-select (Read et al. , 1994 J. Exp. Med.179, 503-512) required for induction.   NF-κB is an integrin subunit, CD18 and other adhesive properties of leukocytes (Eck et al., 1993, supra).   The above study shows that NF-κB is a cytokine and adhesive component by inflammatory mediators. It suggests that it is essential for the induction of offspring. Two recent papers are N Another link between F-κB and inflammation is pointed out: Glucocorticoids are N Anti-inflammatory effects can be exerted by blocking F-κB. Glucoco Both ruticoid receptor and p65 bind to NF-κB of ICAM-1 promoter Acting at the site (van de Stolpe et al., 1994 J. Biol. Chem.269, 6185-6192). Glucocorticoid receptor blocks NF-κB-mediated induction of IL-6 (Ray Over And Prefontaine, 1994 Proc. Natl Acad. Sci USA91, 752-756). Conversely, p65 Overexpression induces glucocorticoids in the mouse mammalian tumor virus promoter Prevent. Finally, p65 and Direct physical interactions between corticoid receptors have been demonstrated (Id.).   The ribozymes of the invention block NF-κB expression to some extent and cure disease. It can be treated or used to diagnose such diseases. Ribozai Cells in culture and for restenosis, graft rejection and rheumatoid arthritis. Delivered to cells or tissues in an animal model. Of relA mRNA in these systems Ribozyme cleavage can prevent inflammatory cell function and relieve symptoms of disease You.   Human and mouse relA mRNA sequences are computer-folded algorithms Can be used to screen for available sites. potential Various hammerhead or hairpin ribozyme cleavage sites were identified. These sites Shown in Tables 17, 18 and 21-22. (In these tables, the sequences are all 5'to 3 '). Ma To screen the mouse and human sequences and then design ribozymes Yes, but human targeting sequences are most beneficial.   The sequences of chemically synthesized ribozymes useful in this study are shown in Tables 19-22. Those skilled in the art These sequences affect the activity of the enzyme part of the ribozyme (all but the binding arm). Ribonucleotides or other nucleotides or Acknowledge that they are only representative of the large number of sequences that can be made from non-nucleotides Will Such ribozymes are equivalent to the ribozymes explicitly listed in the table. is there.   By manipulating the ribozyme motif, we have discovered that relA mRN Several ribozymes were designed for the A sequence. These ribozymes are It is modified and synthesized to improve the enzyme resistance. Open relA target sequence in vitro Assess the ability of the ribozyme to cleave.   Ribozymes are cytokine-induced VCAM-1, ICAM-1, IL-6 and IL Test for in vivo function by analyzing -8 expression values. Ribozyme Is incorporated into liposomes to form a complex with cationic lipids. Yo Cells by microinjection or by expression from DNA and RNA vectors. Will be delivered to. Cytokine-induced VCAM-1, ICAM-1, IL-6 and IL -8 expression is by ELISA, by indirect immunofluorescence, and / or by FACS analysis. Monitor by analysis. relA mRNA levels were analyzed by Northern analysis, ribonuclease Assess by protection or primer extension analysis or quantitative RT-PCR. N The activity of F-κB is monitored by gel retardation assay. NF-κB activity and / or Ribozymes that block induction of relA mRNA by 50% or more are identified.   RNA ribozymes and / or genes encoding them are used as transplant models in animal models. Delivered locally to the fabric ex vivo. Ribozyme expression is VCAM-1, IC Block ex vivo induction of AM-1, IL-6 and IL-8 mRNA and protein. Monitor by the ability to lock. Next, the anti-relA level given to graft rejection Evaluate the effects of Bozyme. Similarly, ribozymes have collagen-induced arthritis. Joints in mice with active or streptococcal cell wall-induced arthritis Will be introduced. Liposome delivery, cationic lipid delivery or adeno-associated virus vector Tar delivery can be used. Stable anti-relA ribozyme or essentially ribozyme By a single dose (or a few occasional doses) of the gene construct expressing the zym Can terminate the inflammation and immune response of these diseases.use   Block cytokine gene expression, block adhesion molecule expression and crucocorti A therapeutic agent that mimics the anti-inflammatory effect of coid (without inducing a steroid response gene) Is ideal for treating inflammation and autoimmune diseases. The target of disease for such drugs is a lot. The target indications and the delivery options each requires are summarized below. You. Potential immunosuppressive properties of ribozymes that cleave relA mRNA in all cases Therefore, its use is limited to local delivery, acute indications or ex vivo treatment.   Rheumatoid arthritis (RA).   Due to the chronic nature of RA, gene therapy is logical. To inflamed joints Delivery of bozymes can be achieved with adenovirus, retrovirus or adeno-associated virus vectors. Is mediated by Tar. For example, a suitable adenovirus vector can be injected directly It can therefore be administered in synovial fluid: high levels of gene transfer and expression for several months Expected to be effective (B.J.Roessler, E.D.Allen, J.M. Wilson, J.W.Hart man, B.L. Davidson, J. Clin. Invest.92, 1085-1092 (1993)). Disease course Does not appear to be reversed by transient topical administration of anti-inflammatory agents. Need multiple doses It appears to be. Joints with retrovirus and adeno-associated virus vectors Will lead to permanent gene transfer and expression in E. coli. But we have strong anti-inflammatory Localized immune deficiency may result from permanent expression of the drug.   ・ Recurrent stenosis.   Expression of NF-κB in the vascular wall of pigs resulted in overdeposition of extracellular matrix components. Therefore, the lumen gap is narrowed. This phenotype is associated with matrix deposition that occurs after coronary angioplasty. Similar to clothes. In addition, NF-κB is required for expression of the oncogene c-myb. (F.A.La Rosa, J.W.Pierce, G.E.Soneneshein, Mol.Cell.Biol.14, 103 9-1044 (1994)). Thus, NF-κB is associated with smooth muscle proliferation and excess matrix. Induces the Expression of the Slice Component: Together, These Processes Contribute to Vascular Reocclusion Following Coronary Angioplasty It is believed that.   -Transplant.   NF-κB is required for the induction of adhesion molecules that function in immune recognition and inflammatory responses (Eck et al., Supra, K. O'Brien et al., J. Clin. Invest.92, 945-951 (1993)). Few At least two potential modes of treatment are possible. First, the transplanted organ is ribozyme or Ex vivo treatment with ribozyme expression vector. To prevent graft-related vasculitis Primary inhibition of NF-κB in transplanted endothelium is sufficient and graft rejection Seems to regulate significantly. Second, donor B cells are ribozyme or ribozyme Ex vivo treatment with the murine expression vector. Transplant recipient will be treated prior to transplant . T cell costimulatory molecules (eg, ICAM-1, VCAM-1, and / or B7 and Treatment of transplant recipients with B cells that do not express B7-2) and antigen-specific anergy Can be triggered. Resistance to donor histocompatibility antigens will develop ; Potentially, any donor could be used in the transplant procedure.   ·asthma.   Granulocyte-macrophage colony-stimulating factor (GM-CSF) against asthmatic trauma Thought to play a major role in recruiting eosinophils and other inflammatory cells during the late phase reaction Have been. It also blocks local induction of GM-CSF and other inflammatory mediators. Clicking may also reduce the persistent inflammation observed in chronic asthma. Ribozai Delivery of viral or adenovirus ribozyme expression vectors is a feasible treatment. Therapy.   -Gene therapy.   The immune response limits the effectiveness of many gene transfer techniques. Retro virus vector Cells that have been transfected with-have a short life span in immunocompetent individuals. Most Expression period of adenovirus vector in terminally differentiated cells is Longer in epidemic-damaged animals. Small ribozyme-expressing cassettes that regulate inflammation and immune response Insertion into the existing adenovirus or retrovirus constructs Greatly enhances ability.   Thus, it cleaves relA mRNA and thereby abolishes NF-κB activity. The ribozymes of the present invention, which allow them to have numerous potential therapeutic uses, and There are rational modes of delivering ribozymes in the indicated indications. NF-κB The development of effective ribozymes that block function is described above; And activity assays are numerous, reproducible and accurate. NF-αB function (Kita jima et al., supra), and animal models of each of the suggested disease targets exist and are maximally active. Can be used to suit.Example 4: TNF-α   Ribozymes that cleave specific sites of TNF-α mRNA are inflammatory or autoimmune. A new treatment method for a disease is shown.   Tumor necrosis factor-α (TNF-α) is a protein secreted by activated leukocytes. Quality, a powerful mediator of inflammatory reactions. Injection of TNF-α into experimental animals Then systemic and local inflammatory disease such as septic shock or rheumatoid arthritis. Can stimulate the symptoms of the disease.   TNF-α is initially an activated macrophage that mediates the destruction of solid tumors in mice Described as a factor secreted by Di (Old, 1985 Science.230, 4225 ~ 4231). TNF- [alpha] was subsequently used for weight loss and wasting associated with tumors and chronic infections. It was found that it is the same as catechin which is the causative agent of the symptom group (Beutler et al., 1985 Nature316, 552-554). Cloning the TNF-α cDNA and genomic loci And was found to be associated with TNF-β (Shakhov et al., 1990 J . Exp. Med.171, 35-47). Both TNF-α and TNF-β bind to the same receptor. And have nearly the same biological activity. Most cell types tested Two TNF receptors have been found in (Smith et al., 1990 scienc248, 1 019-1023). TNF-α secretion is associated with monocyte / macrophage, CD4 + and CD8 + T cells. Cells, B cells, lymphokine-activated killer cells, neutrophils, astrocytes, endothelial cells, flat cells It has been detected in smooth muscle cells and in various non-hematopoietic tumor cell lines (for a review , Turestskaya et al., 1991 Tumor Necrosis Factor: Structure Function and Me. chanism of Action B.B. Aggarwal, J. Edited by Vilcek, Marcel Dekker, Inc., 35 (See page 60). TNF-α is transcriptionally and translationally regulated and secreted Require proteolytic treatment of plasma membranes (Kriegler et al., 1988 Cell53, 45 ~ 53). When secreted, the serum half-life of TNF-α is approximately 30 minutes. Of TNF-α Tight regulation is important because this cytokine is highly toxic. Increased indicators Addition can lead to severe systemic toxicity and death due to overproduction of TNF-α during infection (Tracey & Cerami, 1992 Am. J. Trop. Med. Hyg.47, 2 ~ 7).   Antisense RNA and hammerhead ribozymes target specific cleavage sites Is used in an attempt to reduce the expression value of TNF-α by oud et al., 1992 J. Mol. Biol.223831; Sioud WO94 / 10301; Kisich and Joint Research Researcher, 1990 abstract (FASEB J.Four, A1860; 1991 Slide presentation (J. Leukocyte B iol. Above2, 70); December 1992, anti-HIV treatment in San Diego, California. Poster presentation at the conference; and "Anti-TNF for controlling TNF-α gene expression -Development of alpha ribozymes "-Kisich, PhD thesis, 1993 University of California, Dav is], various TNF-α targeting ribozymes have been shown.   The ribozymes of the invention block TNF-α expression to some extent and cure disease. It can be treated or used to diagnose such diseases. Ribozai Cells in culture and an animal model of septic shock and rheumatoid arthritis Cells or tissues. Ribo of TNF-α mRNA in these systems Zym cleavage can prevent inflammatory cell function and alleviate the symptoms of the disease.   The sequences of human and mouse TNF-α mRNA are computer-folded. Gorythm can be used to screen for available sites. Hammerhead or hairpin ribozyme cleavage sites were identified. These sites are 23, 25 and 27-28 (in these tables the sequences are all 5'to 3 '). mouse And human sequences can be screened and then ribozymes designed However, human targeting sequences are most useful. But before we test it on humans, we Mouse-targeted ribozymes are useful for testing the efficacy of the action of the enzyme. Nu The position of the cleotide base is the site of cleavage by the specified type of ribozyme. Described in the table. (In Table 24, the letters in the lower case are human and mouse TNF-α sequences. Shows positions that are not held between. )   The sequences of chemically synthesized ribozymes useful in this study are shown in Tables 24, 26-28. Those skilled in the art These sequences affect the activity of the enzyme part of the ribozyme (all but the binding arm) Acknowledged to be only representative of the large number of sequences that have been modified to give Will For example, the stem heads of the hammerhead ribozymes shown in Tables 24 and 26. Group II sequence (5'-GGCCGAAAGGCC-3 ') contains a minimum of two base pairs. As long as it can form a system structure, it is modified to include any sequence (substitution, deletion and And / or insertion). Similarly, the hairpin ribozymes shown in Tables 27 and 28 The stem-loop IV sequence (5'-CACGUUGUG-3 ') has at least two base pairs. As long as it can form the stem structure of (change, deletion, And / or insertion). The sequences shown in Tables 24 and 26 to 28 are ribonucleotides. Or it can be made from other nucleotides or non-nucleotides. like this Ribozymes are equivalent to the ribozymes or AAV explicitly listed in the table.   In a preferred embodiment of the invention, the ribozyme which cleaves TNF-α RNA is The transcription unit to be expressed is a plasmid DNA vector or adenovirus DN. A virus vector or AAV or alphavirus or retrovirus vector Insert it in the doctor. Viral vectors can be applied to intact vasculature or joints of living animals. It has been used to transfer genes (Willard et al., 1992 Circulation,86, 1-473; Nabel et al., 1990 science,249, 1285-1288), and both of these Induces primary gene expression. Adenovirus vector is recombinant Delivered as denovirus particles. DNA may be delivered alone or co-cultured with vehicle. Complexes can be formed (as described for RNA above). DNA, DNA / Vehicle Complex or Recombinant Adenovirus Particles at Treatment Site Locally, for example using an infusion catheter, stent or infusion pump. Given or added directly to cells or tissues ex vivo.   In another preferred embodiment of the invention, for continuous expression of the ribozyme , TNF-α RNA-cleaving ribozyme expression Insert into vector.   By manipulating the ribozyme motif, the present inventor has found that TNF-α Several ribozymes were designed for mRNA sequences. These ribozymes are Synthesized with modification to improve clease resistance. Incorporating the TNF-α target sequence Assess the ability of the ribozyme to cleave in vitro.   Ribozyme analysis of bacterial lipopolysaccharide (LPS) -induced TNF-α expression levels To test for intracellular function. Ribozyme incorporation into liposomes By microinjection, by complex formation with cationic lipids, by , Or by expression from a DNA vector into cells. TNF-α expression By Elisa, by indirect immunofluorescence, and / or by FACS analysis Monitor. Northern analysis of TNF-α mRNA level, ribonuclease protection , Primer extension analysis or quantitative RT-PCR. TNF-α activity A ribozyme that blocks the induction of sex and / or TNF-α mRNA by 90% or more Identify.   RNA ribozymes and / or the genes encoding them are injected intraperitoneally Delivered locally to macrophages. After the period of ribozyme uptake, peritoneal macrophage The cells are harvested and induced ex vivo with LPS. TNF-α secretion Select a ribozyme that significantly reduces TNF-α is an alternative to ex vivo Induced by ribozyme treatment with streptococcus fixed in the peritoneal cavity You can also. In this way, TNF-α secretion in the local inflammatory response is blocked. The ability of the TNF-α ribozyme to block is evaluated. In addition, the inventor To deliver TNF-α ribozyme after induction by injecting leptococcus Therefore it is determined whether ribozymes can block the ongoing inflammatory response.   To test the effect of anti-TNF-α ribozymes on systemic inflammation, ribozyme Im is delivered intravenously. TNF-α secretion and lethality caused by systemic LPS administration Assess the ability of ribozymes to prevent lethal shock. Similarly, collagen induction TNF-α ribozyme can be introduced into the joints of arthritic mice . In these animal model experiments, free delivery, liposomal Delivery, cationic lipid delivery, adeno-associated viral vector delivery, adenovirus Vector delivery, retrovirus vector delivery or plasmid vector delivery It can be used. A stable anti-TNF-α ribozyme or essentially ribozyme By a single dose (or a few occasional doses) of the gene construct expressing the zym Can end the tissue damage of these inflammatory diseases.   Macrophage isolation.   Sterile liquid thioglycollate buoys to produce responsive macrophages. 6-week-old female C57bl / 6 NCR mice with 1 ml of Yong (Difco, Detroit, MI) An intraperitoneal injection was made 3 days before peritoneal lavage. Mice are autoclaved in a laminar flow hood Maintained in a cage as a special pathogen-free and "natural" activation of macrophages Sterile water was provided to minimize The resulting peritoneal exudate cells (PEC) are Hanks Obtained by washing with a balanced salt solution (HBSS) of Using Eagle's minimum essential medium (EMEM) containing activated fetal bovine serum, 2.5 x 10 on a plate (Costar, Cambridge, MA)^FivePieces / we I sprinkled with Le. After adhering for 2 hours, the wells were washed to remove non-adherent cells. Profit The cultures grown were 97% maternal as measured by morphology and nonspecific esterase staining. It was a clofage.   Transfection of ribozymes into macrophages:   Ribozyme was diluted 2-fold to the final concentration, and an equal volume of 11 nM Lipofectamine (Life Technologies, Gaitherberg, Md.) And stirred. Next , 100 ml of lipid: ribozyme complex was added directly to the cells, followed immediately by 10 ml of fetal calf serum was added. Three hours after addition of ribozyme, 1 mg / ml of bacterial lipopolysaccharide was added. 100 ml of sugar (LPS) was added to each well to stimulate TNF production.   Quantification of TNF-α in mouse macrophages:   Supernatants were sampled at 0, 2, 4, 8 and 24 hours after LPS stimulation and at -70 ° C. Stored at TNF-α was quantified by the specific ELISA method. Eliza Plate is 1: 100 Coat with 0 dilution rabbit anti-mouse TNF-α serum (Genzyme) followed by milk protein Quality blocked and incubated with TNF-α containing supernatant . Next, a murine TNF-α-specific hamster monoclonal antibody (Genzyme) was added. Was used to detect TNF-α. The Elisa method is coupled to alkaline phosphatase. Color development was performed with a goat anti-hamster IgG that had been applied.   Evaluation of reagent toxicity   After ribozyme / lipid treatment of macrophages and collection of the supernatant, the cells were 3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium broth Cell viability was assessed by incubation with 5 mg / ml of Mido (MTT) . This compound is depleted in mitochondrial dihydrogenase, so its activity is Has a good correlation with cell viability. After 12 hours, the reduced MTT absorbance was reduced to 58 Measure at 5 nm.use   Relationship between TNF-α and bacterial sepsis, rheumatoid arthritis and autoimmune diseases Have made TNF-α an attractive target for therapeutic intervention (Tracy & Cerami 1992). Years Above; Williams et al., 1992 Proc. Natl. Acad. Sci. USA89, 9784-9788; J acob, 1992 J. Autoimmun.Five(Appendix A), 133-143).Septic shock   Septic shock is associated with high fever, increased cardiac output, decreased blood pressure and lungs and other major organs. Is a complication of major surgery, bacterial infection and multiple trauma characterized by infiltration of neutrophils into the lung. Current Treatment Options for Antibiotics to Reduce Bacterial Load and Nonsteroids to Reduce Fever Limited to anti-inflammatory agents. Despite these treatments at the best intensive care locations Mortality from septic shock is mainly due to multi-organ injury and diffuse vascular coagulation. The average is more than 50%. Sepsis with an incidence of 200,000 cases per year in the United States Shock is the leading cause of death in the intensive care unit. In septic shock syndrome, Tissue damage or bacterial products initiate strong immune activation, resulting in TNF-α, Interleukin-1β (IL-1β), γ-interferon (IFN-γ), Like interleukin-6 (IL-6) and interleukin-8 (IL-8) Secreted proinflammatory cytokines that are not normally detected in serum. Interroy Other non-cytokine proteins such as kin b4, prostaglandin E2, C3a and C3d. Diators also reach high levels (de Boer et al., 1992 Immunopharmacologytwenty four, 135-148).   TNF-α is detected early in the process of septic shock in most patients (de B Oer et al., 1992, supra). In an animal model, injection of TNF-α resulted in LPS injection It has been shown to induce a shock-like syndrome similar to that induced (Beutler et al., 1985 Science229, 869-871); in contrast, of IL-1β, IL-6 or IL-8 Injection does not induce shock. Injection of TNF-α also resulted in I in serum of experimental animals. L-1β, IL-6, IL-8, PgE₂, Acute phase proteins and TxA₂Also raise (De Boer et al., 1992, above). In animal models, the lethal effect of LPS is anti-TNF It can be blocked by pre-administration of the α antibody. Cumulative evidence is TNF-α Plays an important role in the etiology of septic shock, making it a good candidate for treatment intervention. Is shown.Rheumatoid arthritis   Rheumatoid arthritis (RA) is a joint disorder that leads to bone destruction and loss of joint function. It is an autoimmune disease characterized by chronic inflammation. At the cellular level, autoreactive T-phosphorus Paocytes and monocytes are typically present, and synovial cells are often morphological and immunostaining The pattern is changing. RA joints have high TNF-α, IL-1α and IL-1β, It contains IL-6, GM-CSF and TGF-β values (Abney et al., 1991 Imm. Rev. .119, 105-123), and some or all of them contribute to the pathological course of the disease. It has been shown that there is a possibility of giving.   Cells cultured from RA joints show all proinflammatory cytokai detected in vivo. Secretes naturally. Antiserum to TNF-α was added to these cultures. IL-1α / β production by these cells was shown to be reduced to undetectable values (Abney et al., 1991, supra). Thus, TNF-α is the other size of RA joints. The production of tocaine can be directly triggered. Anti-inflammatory cytokine, TGF- Addition of β has no effect on cytokine secretion by RA cultures. Human RA Immunocytochemical study of surgical specimens causes pannus to invade and thrive on cartilage When, from macrophages near the cartilage / pannus joint, TNF-α, IL-1α / It has been clearly demonstrated that β and IL-6 are produced (Chu et al., 1992 Br.J.R. heumatology31, 653-661). GM-CSF is predominantly vascular in these samples. It was shown to be produced by the endothelium. Both TNF-α and TGF-β are fibroblasts Has been shown to be a cell growth factor and is one of the deposits of scar tissue in RA joints. May be the cause. TNF-α also enhances osteoclast activity and bone resorption Have also been shown and have a role in bone erosion normally seen in RA joints (Cooper et al., 1992 Clin. Exp. Immunol.89, 244-250).   Elimination of TNF-α from rheumatoid joints leads to MHC class II, IL-1α / Β, IL-6 and GM-CSF production and decreased T cell activation Would be expected to reduce overall inflammation. Osteoclast activity is also reduced , Would reduce the rate of bone erosion at joints. Finally, eliminate TNF-α And can reduce the accumulation of scar tissue in joints by removing fibroblast growth factor Expectations Let's do it.   Treatment with anti-TNF-α antibody causes joint swelling and collagen-induced arthritis in mice Histological severity is reduced (Williams et al., 1992 Proc. Natl. Acad. Sci. USA  89, 9784-9788). In addition, intravenous injection of anti-TNF-α monoclonal antibody was received. Studies of active RA patients reported a reduction in the number and severity of inflamed joints after treatment ing. The benefits of long-term monoclonal antibody therapy depend on the cost and immunogenicity of the antibody. May be restricted.psoriasis   Psoriasis is a skin inflammatory characterized by keratinocyte hyperproliferation and immune cell infiltration. Disease (Kupper, 1990 J. Clin. Invest.86, 1783-1789). This is the population It is a fairly normal condition affecting 1.5 to 2.0%. The severity of this disease The range is from mild to easily exfoliated skin pieces to severe ones related to inflammation of the entire epidermis. It is. Cellular infiltrates of psoriasis include T lymphocytes, neutrophils, macrophages and dermal densities. It contains dorosite. Most of T lymphocytes are T_H-1 Phenotype of activated CD4⁺ However, CD8⁺And CD4^-/ CD8^-There are some. B lymphocytes are typical Is not abundant in psoriatic plaques.   Regarding the basic cause of psoriasis, overproduction of autoantibodies, autoreactive T cells and growth factors Many hypotheses have been provided, including raw as well as genetic predisposition. These in psoriasis There is evidence to support the involvement of each factor, but they are neither mutually exclusive nor None of them are necessary and sufficient for the etiology of psoriasis (Reeves, 1991 semin . Dermatol.Ten, 217).   The role of cytokines in the etiology of psoriasis was investigated. Abnormal expression Among these cytokines in which TGF-α, IL-1α, There were IL-1β, IL-1ra, IL-6, IL-8, IFN-γ and TNF-α. . In addition to aberrant cytokine production, ICAM-1, ELAM-1 and VCAM Increased expression has been observed (Reeves, 1991, supra). This cytokine profile Is similar to the normal wound healing profile, with the notable exception of healing Then, the cytokine level is lowered. Keratinocytes themselves have recently become EGF , Has been shown to be capable of secreting TGF-α, IL-6 and TNF-α, and These could enhance proliferation in an autocrine fashion (Oxholm et al., 1991 AMPIS).99 , 58-64).   Nickoloff et al., 1993 (J Dermatol Sci6, 127-133) is psoriasis The following models have been proposed for plaque initiation and maintenance:   Tissue damage evokes a skin wound healing response. Keratinocytes are IL-1α, I Secretes L-1β, IL-6, IL-8 and TNF-α. These factors are dermal capillaries Activates the vascular endothelium and recruits PMNs, macrophages and T cells to the trauma site You.   The dermal dendrocytes near the dermis / epidermis junction are said to have returned to their resting state. Remain activated and subsequently contain TNF-α, IL-6 and IL-8. Secretes cytokines. Cytokine expression, in turn, maintains the activated state of the endothelium. Keratins that carry extra immune cell extravasation and secrete TGF-α and IL-8 Allows the activated state of nocites. Keratinocyte IL-8 changes from dermis to epidermis Replenish immune cells. During passage through the dermis, T cells_H-1 Effectively activate phenotype Encounter activated dermal dendrocytes. Activated T cells continue to migrate to the epidermis and T cells are stimulated by keratinocyte-expressing ICAM-1 and MHC class II in the skin . IFN-γ secreted by T cells is TNF-α from dermal dendrocytes. Synergize with keratinocyte proliferation and TGF-α, IL-8 and IL-6 production Increase the value. IFN-γ is also fed back to the dermal dendrocytes, and the activation table Maintains the current and inflammatory cycle.   Elevated serum titers of IL-6 are associated with acute phase proteins including complement factors by the liver. Increases synthesis and antibody production by plasma cells. Elevated complement and antibody levels are autoimmune Increase the likelihood of response.   Maintenance of psoriatic plaques requires continuous expression of all these processes The attractive point is that TNF-α expression by dermal dendrocytes activates activated endothelium and Dermal dendritic that maintains keratinocytes and is activated by IFN-γ expression by T cells To maintain the Rosite.   There are 3 million patients in the United States who suffer from psoriasis. Cortico is the treatment available for psoriasis It is a steroid. The most widely prescribed is Temobe, which is prescribed for topical application. ー (TEMOVATE) (clobetasol propionate), Redex (LIDEX) (full Osinonide), diprolene (DIPROLENE) (betamethasone propionate), psol PSORCON (diflorazone diacetate) and triamcinolone (TRIAMCI NOLONE). The mechanism of action of corticosteroids is multifactorial. this Remains the underlying cause of this illness and can be undone if treatment of the illness is discontinued. It is a temporary cure. Treatment discontinuation is often atrophy, telangiectasia And is promoted by the appearance of side effects such as purpura. Long-term corticosteroids Not recommended when treatment or treatment of large and / or inflammatory areas is required. Alternative Treatment includes etretina (etretina), which is approved for the treatment of severe refractory psoriasis. te) like retinoids. Alternative retinoid-based therapies are clinical trials The test is in the advanced stage. Retinoids transform keratinocytes into a differentiated state and It works by restoring normal skin development. Immunity like cyclosporine Inhibitory drugs are also in the stage of advanced clinical trials. Corticosteroids, retinoids And, due to the non-specific mechanism of action of immunosuppressive drugs, these treatments have severe side effects. Long-term use unless the condition is life threatening or disabling. Should not Demand for less toxic and effective therapeutic agents in patients with psoriasis There is.HIV and AIDS   The human immunodeficiency virus (HIV) has been completely acquired since the time of infection. By the time AIDS occurs, it causes some basic changes in the human immune system. these Changes in the ratio of CD4 + to CD8 + T cells, a continuous increase in IL-4 levels, T Transient elevation of NF-α and TNF-β levels, hypergammaglobulinemia and phosphorus Includes papilloma / leukemia (Rosenberg & Fauci, 1990 Immun. Today11, 176; We iss 1993 Science260, 1273). Many patients have unique tumors, Kaposi's sarcoma and / or Or rare opportunistic infections (eg Karini pneumocisti, Cytomegauroi) Rus, herpes virus, hepatitis virus, papilloma virus and tuberculosis) I do. The immunological dysfunction of individuals due to AIDS is a cytokai in this pathology. It is suggested that there is a dysregulation of the protein.   Serum TNF-α and IL-6 levels are often elevated in AIDS patients Seen (Weiss, above 1933). In tissue culture, HI of monocytes isolated from healthy people V infection stimulates the secretion of both TNF-α and IL-6. This response is CD-4 Reproduced using purified gp120, a viral coat protein that contributes to the binding of Escherichia coli (Buonaguro et al., 1992 J. Virol.66, 7159). Viral gene regulator -It has also been demonstrated that Tat directly induces TNF transcription. TNF-α and I HIV's ability to directly stimulate L-6 secretion is a viral adaptation mechanism. Seem. TNF-α upregulates the transcription of HIV LTRs and causes HI in infected cells. It has been shown to increase the number of V-specific transcripts. IL-6 increases HIV production However, post-transcriptional values reveal the efficiency with which HIV transcripts are translated into proteins. Enhance. Thus, stimulation of TNF-α secretion by the HIV virus is a potential infectious agent. Cells to enhance virus production and allow the virus to replicate in newly infected cells. Both can promote infection of nearby CD4 + cells.   The role of TNF-α in HIV replication is well established in a tissue culture model of infection. (Sher et al., 1992 Immun. Rev.127, 183), HIV replication and TNF-α replication That reciprocal induction can produce positive feedback in vivo It suggests. However, we believe that such an active feedback Evidence of his existence is not abundant. Although TNF-α levels are not in all patients tested, It has been found to rise in some people. Of AIDS given zidovudine Children have reduced TNF-α levels compared to children not receiving zidovudine (Cremoni et al., 1993 AIDS7, 128). This correlation suggests that viral replication is reduced It provides support for the hypothesis that it is physiologically related to TNF-α levels. Change In addition, polyclonal B cell activation associated with HIV infection is mediated by membrane-bound TNF-α. It has recently been shown to be one. Thus, the secreted TNF-α value is AIDS. It may not accurately reflect the contribution of this cytokine to the etiology.   Chronic elevation of TNF-α is associated with cachexia (Tracey et al., 1992 Am. J. Trop. Med. Hy. g.47, 2-7), increased autoimmune disease (Jacob, supra, 1992), lethargy, and animal models. Immunosuppression (Aderka et al., 1992 Isr. J. Med. Sci.28, 126-130) It is shown to do. AIDS-related cachexia is frequently observed in AIDS patients It seems to be related to the chronic elevation of TNF-α. Similarly, TNF-α Can stimulate proliferation of spindle cells isolated from Kaposi's sarcoma lesions in AIDS patients Yes (Barillari et al., 1992 J Immunol149, 3727).   Block cytokine gene expression, block adhesion molecule expression, and Cures that mimic the anti-inflammatory effects of thicoids (without inducing steroid-responsive genes) Therapeutic agents are ideal for treating inflammatory and autoimmune diseases. Such drugs There are many disease targets. Targeted indications and the delivery options required for each are summarized below. . In all cases, the latent ribozyme that cleaves a specific site in TNF-α mRNA. Due to its inherent immunosuppressive properties, its use in local delivery, acute indications or ex vivo treatment Limited.   ・ Septic shock.   Outpatient delivery of ribozymes to macrophages was achieved by intraperitoneal or intravenous injection can do. Ribozymes can be incorporated into liposomes or by cations. It is delivered in complex with lipids.   ・ Rheumatoid arthritis (RA)   Due to the chronic nature of RA, gene therapy is logical. To inflamed joints Delivery of bozymes can be achieved with adenovirus, retrovirus or adeno-associated virus vectors. Is mediated by Tar. For example, a suitable adenovirus vector can be injected directly It can therefore be administered in synovial fluid: high levels of gene transfer and expression for several months. Expected to be effective (B.J.Roessler, E.D.Allen, J.M. Wilson, J.W.Hart man, B.L. Davidson, J. Clin. Invest.92, 1085-1092 (1993)). Disease course It seems unlikely that the topical administration of anti-inflammatory drugs could reverse this. Multiple doses required Seems important. By retrovirus and adeno-associated virus vectors Permanent gene transfer and expression in the joint will be guided. However, the strong anti Permanent expression of inflammatory agents can lead to local immune deficiency.   ·psoriasis   Psoriasis plaques are particularly good candidates for ribozyme or vector delivery. Puller The stratum corneum of Quercus is thin and provides access to proliferating keratinocytes. T cells And dermal dendrocytes can be effectively targeted by transepidermal diffusion. You.   Organ culture systems for biopsy specimens of psoriatic and normal skin are described in the current literature. (Nickoloff et al., 1993, supra). Primary human keratinocytes are easily obtained. And grown in epidermal sheets in tissue culture. In addition to these tissue culture models Thus, peelable skin mice develop psoriatic skin in response to UV light. This model is It will allow the demonstration of animal efficacy for ribozyme treatment of psoriasis.   -Gene therapy.   The immune response limits the effectiveness of many gene transfer techniques. Retro virus vector Cells that have been transfected with-have a short life span in immunocompetent individuals. Most Expression period of adenovirus vector in terminally differentiated cells is Longer in epidemic-damaged animals. Small ribozyme-expressing cassettes that regulate inflammation and immune response Insertion into the existing adenovirus or retrovirus constructs The ability is greatly enhanced.   Thus, it cleaves TNF-α mRNA and thereby causes TNF-α activity. The ribozymes of the present invention that eliminate L. There are rational modes of delivering ribozymes in the possible indications of TN The development of effective ribozymes that block F-α function is described above; available Cell and activity assays are numerous, reproducible and accurate. TNF-α function And for each suggested disease target there is an animal model and to optimize activity Can be used forExample 5: p210 ^bcr-abl   Chronic myelogenous leukemia has a characteristic course of disease, initially as chronic granulocytic hyperplasia. Clonal of cells with a poorly differentiated phenotype It develops into acute leukemia (ie, the sudden onset of disease) caused by spread. CM L is an unstable disease that progresses to a final stage that ultimately resembles acute leukemia. This deadly disease affects approximately 16,000 patients each year. Hydroxyurea Although chemotherapeutic agents like busulfan can reduce the burden of leukemia It does not affect the life expectancy of the patient (eg, about 4 years). Therefore, CML patients It is a candidate for bone marrow transplant (BMT) treatment. However, patients who survived BMT Relapse of Disease Remains a Major Disability (Apperley et al., 1988 Br. J. H. aematol.69, 239).   A fib derived from the transposition of the abl oncogene from chromosome 9 to the bcr gene on chromosome 22. The Radelphia (Ph) chromosome is found in more than 95% of CML patients and has acute lymphoma Found in 10-25% of all cases of blastic leukemia [(ALL); on leukemia chromosomes 4th International Workshop 1982, Cancer Genet. Cytogenet.11, 316]. In fact In the Ph-positive CML and about 50% of the Ph-positive ALL in all of the above, leukemic cells were bc It expresses the r-abl fusion mRNA, in which the major breakpoint class of the bcr gene is expressed. Exon 2 (b2-a2 junction) or exon 3 (b3-a2 junction) in the star region is abl Spliced into exon 2 of the gene (Heisterkamp et al., 1985 Natur e315, 758; Shtivelman et al., 1987, Blood.69, 971). The rest of the Ph-positive ALL In the case, the first exon of the bcr gene is spliced into exon 2 of the abl gene. (Hooberman et al., 1989 Proc. Nat. Acad. Sci. USA)86, 4259; Hei sterkamp et al., 1988 Nucleic Acids Res.16, 10069).   The fusion mRNA of b3-a2 and b2-a2 is a 210 kd bcr-abl fusion protein showing oncogenic activity. Code quality (Daley et al., 1990 Science247, 824; Heisterkamp et al., 1990. Year Nature344, 251). Bcr-abl in the evolution and maintenance of the leukemia phenotype of human disease Fusion protein (p210^bcr-abl) Is important in p210^bcr-ablExpression antisense Proven using Rigonucleotide blocking. These blocking molecules are associated with CML Have been shown to block in vitro proliferation of leukemia cells in human bone marrow (Szczyli k et al., 1991 science253, 562).   Reddy US Pat. No. 5,246,921 (incorporated herein by reference) Chronic Myelogenousness by Targeting a Specific Junction Region of the bcr-abl Fusion Transcript Describe the use of ribozymes as therapeutic agents for leukemias such as leukemia (CML) I You. This patent describes a hybrid chromosome breakpoint as described above or near it. Have been shown to undergo cleavage by ribozymes, and in particular the sequence GUX ( Where X is A, U or G). One example shown Opens the sequence 5'-AGC AGAGUU (cleavage site) CAA AAGCCCU-3 '. It is to split.   Scanlon's WO 91/18625, WO 91/18624 and WO 91/18913 WO 93/03141 and WO 94/13793 of Sinider et al. Are H-ras RNAs. Ribozymes effective for cleaving oncogenic mutants of E. coli. This ribozyme It is said to block H-ras expression in response to external stimuli.   The present invention uses ribozymes to regulate the expression of genes that contribute to the expression of CML. To develop or express a transformed phenotype in humans and other animals by It is characterized by blocking. Targeted mR expressed before tumor expression and in transformed cells Cleavage of NA induces arrest of the transformed state.   The present invention can be used to treat cancer or pre-tumor conditions. Two preferred The administration protocol is either in vivo administration to reduce tumor burden or prior to reimplantation. Of ex vivo treatment to clear transformed cells from bone marrow-like tissue Can be used in   The present invention provides an enzyme RNA component that cleaves mRNA associated with the development or maintenance of CML. Characterized by a child (or ribozyme). mRNA target is b2-a2 and b3-a2 recombination It is present in 425 nucleotides around the fusion site of the mRNA bcr and abl sequences. b Other sequences at the 5'-position of cr mRNA or at the 3'-position of abl mRNA are also markers for ribozyme cleavage. Can be targeted. Cleavage of the fusion mRNA molecule at any of these sites Thus, translation of the fusion protein in treated cells is blocked.   The present invention provides a class of clones that show a high degree of specificity for CML-causing mRNAs. A chemically cleaved substance of Such enzymatic RNA molecules can Alternatively, it can be delivered exogenously or endogenously. Preferred hammerhead In the motif, the molecular size is small (nucleotides less than 40 in length, preferably Between 32 and 36 nucleotides), thus reducing treatment costs.   The smallest ribozyme delivered to date for any type of therapy reported to date (According to Rossi et al., 1992, supra) is an invitro with a length of 142 nucleotides. It is a transcript. Ribozymes longer than 100 nucleotides in length can be used with automated methods. Are very difficult to synthesize and use, and the therapeutic costs of such molecules are prohibitive. It is something. Delivery of ribozymes by expression vector uses ex vivo treatment Can only be implemented for the first time. This limits the usefulness of this method. In the present invention Otherwise uses smaller ribozyme motifs and exogenous delivery. this Ability of ribozymes to enter the targeted region of mRNA structure, even the simple structure of these molecules Enhance. Thus, the hammerhead structure is contained within the longer transcript. In contrast, the correct folding of the ribozyme structure as well as the ribozyme and mRN There are no non-ribozyme flanking sequences that interfere with complementary binding of the A target .   Treatment of human CML or precancerous conditions using the enzymatic RNA molecules of the present invention it can. Diseased animals can be treated at the time of cancer detection or in a prophylactic manner . This timing of treatment reduces the number of diseased cells and disables cell replication. This It is designed so that the ribozymes disable the structures required for successful cell growth. Yes, it is possible.   The ribozyme of the present invention is p210^bcr-ablBlock expression to some degree and prevent disease It can be used to treat or diagnose such diseases. Riboza Im is delivered to cells in culture and tissues of animal models of CML. In these systems Ribozyme cleavage of bcr / abl mRNA prevents disease symptoms or conditions and Can be relieved.   Sequence of human bcr / abl mRNA uses computer folding algorithm Then, the available sites can be screened. Secondary folding No structure is formed and potential hammerhead or hairpin ribozyme cleavage sites The region of the contained mRNA can be identified. These sites are shown in Table 29 ( In the table, the sequences are all 5'to 3 '). The position of the nucleotide base is It is described in the table as the site cleaved by the ribozyme of ip.   The sequences of the most useful chemically synthesized ribozymes in this study are shown in Table 30. Those skilled in the art These sequences affect the activity of the enzyme part of the ribozyme (all but the binding arm). Acknowledge that they are only representative of the large number of sequences that have been modified to There will be. For example, the stem-loop II sequence of the hammerhead ribozyme shown in Table 30. (5'-GGCCGAAAGGCC-3 ') has a stem structure of at least two base pairs. Change to include any sequence (substitution, deletion and / or insertion) as long as it can be formed. )be able to. The sequences shown in Table 30 are ribonucleotides or other nucleonucleotides. It can be made from nucleotides or non-nucleotides. Such ribozymes are clearly shown in the table It is equivalent to the ribozyme described above.   By skillfully manipulating the ribozyme motif, the present inventors have found that the bcr-abl mR Several ribozymes were designed towards the NA sequence. These are It was synthesized with modification to improve clease resistance. These ribozymes are Cleaves the bcr-abl target sequence in vitro.   Ribozymes are transferred to cells expressing bcr-abl by exogenously delivering in vivo Test for BO function. Ribozymes are positively linked by their incorporation into liposomes. By complex formation with ionic lipids, by microinjection or by DNA vector It is delivered by expression from the vector. The expression of bcr-abl was Monitor by immunofluorescence and / or by FACS analysis. bcr-ab l mRNA levels can be analyzed by Northern analysis, ribonuclease protection, primer extension analysis or It is evaluated by the quantitative RT-PCR technique. p210^bcr-ablProtein and mRN Ribozymes that block A induction by 20% or more are identified.Example 6: RSV   Riboza as an inhibitor of respiratory syncytial virus (RSV) production Immunization, and in particular to blocking RSV replication.   RSV is a member of the paramyxoviridae family of viruses and Classified as illus (for review, see Mclntosh and Chanock, 1990 Virolog y, B.N. Edited by Fields, 1045 pages or less, Raven Press Ltd. See New York). infection The sex virus particle is made up of an enveloped nucleocapsid. The nucleocapsid forms a compact structure and thereby allows RNA to The repeating subunit of the capsid protein protects it from nuclease degradation. It is composed of negative linear single-stranded non-cleaving RNA bound to G. All Nucleocapsid The body is enclosed by an envelope. The size of virus particles is 150 to 3 in diameter It is in the range of 00 nm. The complete life cycle of RSV occurs in the cytoplasm of infected cells and Cleocapsid never reaches the nucleoli (Hall, 1990 (Actual and actual, edited by Mandell et al., Church Hill Livingston, NY).   RSV genome encodes 10 viral proteins essential for virus production . RSV protein products are two structural glycoproteins found in envelope spikes. Proteins (G and F), two matrix proteins found in the inner membrane [M and M2 (22K)], three proteins located in the nucleocapsid (N, P and L), one protein (SH) present on the surface of infected cells and only on infected cells Contains two non-structural proteins not found [NS1 (1C) and NS2 (1B)] ing. MRNAs of 10 RSV proteins have similar 5'and 3'ends . The UV inactivation test shows that one promoter is used at many transcription start sites. (Barik et al., 1992 J. V1rol.66, 6813). For genomic RNA The transcription order corresponding to the protein assignment is 1C, 1B, N, P, M, SH, G, F, 22. K and L genes (Huang et al., 1985 Virus Res.2, 157), and the abundance of transcription Abundance corresponds to the order in gene assignment (eg, 1C and 1B mRNAs have LmR Much richer than NA). The synthesis of viral messages is the RSV infection of cells It begins shortly afterwards and reaches a maximum 14 hours after infection (Mclntosh and Chanock, Above).   There are two antigenic subgroups in RSV, A and B, and these differ Can co-circulate simultaneously in different proportions in different years (Mclntosh and Chano ck, above). Subgroup A usually predominates. Many in two subgroups Have stocks. Similar sequence variability is observed within subgroups but is not available. Nucleotide sequence homology between subgroups due to limited sequence analysis It seems more complete within the subgroup. Antigenic determinants are mainly on both surfaces It originates from glycoproteins, F and G. In F, at least half of the neutralizing epitope Has been stable for 30 years. But in G et al., A and B subgroups It does not appear to be antigenically relevant in as little as a few percent. But Samurai At the nucleotide level, most of the diversity of the G coding region is extracellular domain. (Johnson et al., 1987, Proc. Natl. Acad. Sci. USA).84, 56 twenty five).   Respiratory sib virus (RSV) is a major cause of lower respiratory tract disease in infancy and childhood Cause (Hall, above) and estimated 90,000 people in the United States alone as such a cause Hospitalization and 4500 deaths (latest version: respiratory sibling virus activity −  USA, 1993, Mmwr Morb Mortal Wkly Rep,42, 971). RSV infection is generally It ranks above all other microbial agents that lead to both pneumonia and bronchitis. main It affects children under 2 years of age with imperfect immunity as Reinfection of hospitalized nurses (Mclntosh and Chanock, supra) is not uncommon. Immune damage Patients are severely affected and RSV infection is a major concomitant of patients undergoing bone marrow transplants. It is a comorbidity.   Calm RSV respiratory illness resembles a common cold and recovers in 7 to 12 days I do. Lower qi including cough and wheezing 1 to 3 days after initial symptoms (nasal discharge, nasal congestion, low-grade fever, etc.) Signs of road infection continue. In some cases, these mild symptoms are rapid tachypnea, Must progress to cyanosis and etiquette and be hospitalized. Heart or respiratory system In sick infants, the progression of symptoms is particularly rapid and becomes ill 2 or 3 May cause respiratory failure in the day. However, with modern intensive care, Mortality is usually less than 5% of hospitalized patients (Mclntosh and Chanock, supra).   Currently, neither effective vaccines nor special antiviral agents are available. Virus Immune responses to surface glycoproteins provide resistance to RSV in many experimental animals And the subunit vaccine was previously hospitalized for RSV infection. Have been shown to be effective in children up to 6 months (Tristam et al., 1993, J. . Infect. Dis.167, 191). Attenuated bovine RSV vaccine is also effective for calves for the same period (Kubota et al., 1992 J. Vet. Med. Sci.54, 957). I Prior to Kashiwa et al., The formalin-inactivated RSV vaccine was then used to give RSV a natural feeling. Staining was associated with a very common and serious illness (Connors et al., 1992 J. Viol. .66, 7444).   The current treatment for RSV infection requiring hospitalization is aerosolized ribavirin (r ibavirin), a guanosine analogue is used [antiviral agents and human viral disease Patient, Third Edition, 1990 (edited by G.J.Galasso, R.J.Whitley and T.C.Merigan) Raven Press Ltd. New York]. Ribavirin therapy reduces the severity of symptoms, arterial oxygen And reduction of viral shed at the end of the treatment period. However, Does ribavirin treatment actually reduce patient hospital stay? It is not clear if the need will disappear (Mclntosh and Chanock, supra). Re The benefits of babyline therapy are the high-risk infants or bronchi with the most serious symptoms. This is especially apparent in patients with lung or heart disease. Viral polymerase compression Inhibition of virus is due to ribavirin-mediated viral polypeptide synthesis in RSV-infected cells. , But not cell polypeptide synthesis, the effect of ribavirin Supported as a major blocking mechanism for RSV [antiviral drugs and human Ils Disease, Third Edition, 1990 (edited by G.J.Galasso, R.J.Whitley and T.C.Merigan ) Raven Press Ltd. New York]. Ribavirin delivered by aerosol application Target cells of the epithelium because they are at least partially effective against RSV when It can be assumed to be at or near the surface. In this regard, deadly pneumonia Biopsy test showed that RSV antigen did not extend deeper than the superficial layer of respiratory epithelium (Mclntosh and Chanock, supra).   WO 94/13688 of Jennings et al. Describes certain types of ribozymes. Shows that its target contains respiratory sibling virus.   The present invention relates to novel enzyme RNA molecules or ribozymes and respiratory syncytial virus The method used to block production of RSV (RSV) is featured. Such a resource Bozymes cure humans and other animals in diseases caused by these related viruses. Can be used in medical treatment methods. The present invention also uses these ribozymes. It is also characterized by the cleavage of Ilus genomic RNA and mRNA. In particular, the described riboza The im molecule is directed to NSI (1C), NS2 (1B) and N viral genes. These genes are known in the art (for a review, see Mclntosh and Cha. nock, 1990, see above).   Ribozymes that cleave specific sites in RSV mRNA are new to respiratory disease It shows the method of treatment of the regulation. Applicants have shown that ribozymes can block the activity of RSV and It is shown that these catalytic activities are required for the blocking effect of ribozyme. This The Those with ordinary skill in the art are familiar with R encoding 1C, IB and N proteins. To facilitate the design of other ribozymes that cleave these sites in SV mRNA And it is clear from the described examples that these are within the scope of the invention. You will see that Further, a person having a normal skill in the relevant skill field is RS V and other mRNAs encoded by genomic RNA (P, M, SH, G, F , 22K and L) can be easily designed and these It will be clear from the described examples that are also within the scope of the invention. Would. -In a preferred embodiment, the ribozyme is complementary to the sequences of Tables 31, 33, 35, 37 and 38. It has various connecting arms. Examples of such ribozymes are shown in Tables 32, 34, 36-38. You. Examples of such ribozymes consist essentially of the sequences identified in these tables . By "consisting essentially of", the active ribozyme is equivalent to the enzyme center in the examples. Binding arm capable of binding mRNA so that cleavage occurs at the valency and target sites Is meant to contain. There are other sequences that do not interfere with such cleavage. Can be   The ribozymes of the invention block RSV production to some extent and treat disease. Or can be used to diagnose such diseases. Ribozymes Delivered to cells in culture and to cells or tissues in animal models of respiratory disorders. these Ribozyme cleavage of RSV-encoded mRNA or genomic RNA in the system is a symptom of disease Can be relieved.   All 10 RSV-encoded proteins (1C, 1B, N, P, M, SH, 22K, F , G and L) are essential for the viral life cycle and are all latent for ribozyme cleavage. Proteins (mRNAs) are the target of ribozymes More desirable as a target. For example, RSV-encoded proteins 1C, 1B, SH and 22K is unique to RSV because it is not found in other members of the Paramyxoviridae family It seems to be. In contrast, the ectodomain of the G protein and the F protein The signal sequence, at the nucleotide level, is significant among various RSV subgroups. Shows sequence diversity (Johnson et al., 1987, supra). RSV protein 1C, 1B And N are highly distributed between various subtypes at both the nucleotide and amino acid levels. To Is held. Furthermore, 1C, 1B and N are the most RSV proteins of all Abundant.   The sequences of human RSV mRNA encoding the 1C, 1B and N proteins are Screener for available sites using the Futtor folding algorithm To run. Hammerhead or hairpin ribozyme cleavage sites were identified. these The sites are shown in Tables 31, 33, 34, 37 and 38 (in these tables the sequences are all 5'to 3 ' is there). The position of the nucleotide base is opened by the ribozyme of the specified type. The site to be cleaved is described in the table.   Design a hammerhead or hairpin motif ribozyme to design mRNA Anneal to various sites in the cage. The binding arm contains the target site sequence described above. It is complementary. Ribozymes are chemically synthesized. The synthesis method used is Usman 1987 J. Am. Chem. Soc.,109, 7845-7854 and Scalinge et al., 1990 Nuc leic Acids Res.,18, 5433-5441, according to the usual method for RNA synthesis. And 5'-terminal dimethoxytrityl and 3'-terminal phosphoramidite. Such conventional nucleic acid protecting and coupling groups are used. Average gradual coupling Ring yield was> 98%. Inactive ribozymes have U and A instead of G5₁₄ Was synthesized in place of U (Hertel et al., 1992 Nucleic Acids Res.,20, 3252 number). The hairpin ribozyme is synthesized in two parts and is annealed. To reconstitute active ribozymes (Chowrira and Burke, 1992 Nucleic Acids  Res.,20, 2835-2840). Hairpin ribozyme is a bacteriophage T7 RNA It is also synthesized from a DNA template using a polymerase (Milligan and Uhlenbeck, 1989, Methods Enzymol.180, 51). Ribozymes are all nuclease resistant groups , 2'-amino, 2'-C-allyl, 2'-fluoro, 2'-O-methyl, Extensive modification to enhance stability by modification with 2'-H (for review see Usman and Cedergren, 1992 TIBS17, 34). Ribozymes are a common method Purified by gel electrophoresis or by high pressure liquid chromatography, Then resuspend in water.   Sequences of chemically synthesized ribozymes useful in this study are shown in Tables 32, 34, 36, 37 and 38. . Those of skill in the art will recognize that these sequences can be found in the enzyme portion of the ribozyme (all but the binding arm). Live It is only representative of the large number of sequences that have been modified to affect sex. Will admit. For example, for the hammerhead ribozymes shown in Tables 32 and 34 The stem-loop II sequence (5'-GGCCGAAAGGCC-3 ') contains at least two salts. Change to include any sequence (substitution, as long as it can form a base pair stem structure) Deletion and / or insertion). Similarly, the hairpin ribos shown in Tables 37 and 38 are At least 2 stem-loop IV sequences (5'-CACGUUGUG-3 ') of zym As long as the stem structure of the base pair of Replacement, deletion and / or insertion). Sequences shown in Tables 32, 34, 36, 37 and 38 Is made from ribonucleotides or other nucleotides or non-nucleotides Can be. Such ribozymes are equivalent to the ribozymes explicitly listed in the table. You.   By skillfully manipulating the ribozyme motif, the inventor discovered that the RSV code Several ribozymes were designed to target the modified mRNA sequence. These ribozymes Synthesized with modifications to improve nuclease resistance. Target sequence in vitro Assess the ability of the ribozyme to cleave at.   Many conventional cell lines can be infected with RSV for experimental purposes. To these Includes HeLa, Vero and some early epithelial cell lines. Experimental human RSV feeling Dyeing cotton rat animal model is also available, and bovine RSV It is completely homologous to Ruth. Rapid clinical diagnosis is immunofluorescence staining of RSV infected cells or Made using a kit designed for the Eliza assay, and both methods Suitable for experimental studies. RSV-encoded mRNA levels were analyzed by Northern analysis, ribonucleotide Assess by ase protection, primer extension analysis or quantitative RT-PCR. R 90 induction of SV activity and / or mRNA encoding 1C, 1B and N proteins Identify ribozymes that block% or more.Optimization of ribozyme activity   Ribozyme activity is described by PCT WO93 / 23569 by Draper et al. Can be optimized in this way. I won't repeat those details here Modified to prevent degradation by serum ribonuclease (e.g., Eckstein International Publication Number WO 92/07065; Perrault et al., 1990 Nature344, 565; Pieke n, etc. 1991 science253, 314; Usman and Cedergren, 1992 Trends in Biochem. S ci.17, 334; Usman et al., International Publication Number WO 93/15187; and Rossi, etc. International Publication Number See WO 91/03162 and Jennings et al. WO 94/13688, which are enzymatic RNAs. It describes various chemical modifications that can be made to the sugar portion of the molecule. These publications Are incorporated herein by reference in their entirety. ), To increase its effectiveness in cells To reduce RNA synthesis time and RNA synthesis time and chemical requirements The length of the ribozyme binding arm or chemically synthesized ribozyme is removed by removing the stem II base. Is included.   PCT WO94 / 02595, such as Sullivan, incorporated herein by reference, is the enzyme R General delivery methods for NA molecules are described. Ribozymes in liposomes By a variety of methods known to those of skill in the art, including but not limited to encapsulation. , By iontophoresis, or by hydrogels, cyclodextrins, biodegradable Cells can be introduced by introduction into other media such as nanocapsules and bioadhesive microspheres. It can be administered. RNA / vehicle combination can be directly injected or catheterized , Delivered locally using an infusion pump or a stent. To another delivery route Is intravenous injection, intramuscular injection, subcutaneous injection, aerosol inhalation, oral (tablet or pill form), Local, systemic, ocular, intraperitoneal and / or intrathecal delivery, including but not limited to . A more detailed description of ribozyme delivery and administration is incorporated herein by reference. Sullivan et al., Supra and Draper et al., Supra.   Another means of accumulating high concentrations of ribozymes inside cells is the ribozyme code. The introduction of a modified sequence into a DNA expression vector. Transcription of the ribozyme sequence Eukaryotic RNA polymerase I (pol I), RNA polymerase II (pol II) or It is performed from the promoter of RNA polymerase III (pol III). pol II or po Transcription from the lIII promoter is expressed at high levels in all cells; The value of certain pol II promoters in cell types is closely related to gene regulatory sequences ( Enhancer, silencer, etc.) Prokaryotic RNA Polymerer Prokaryotic RNA polymerase promoter, as long as the zymase is expressed in the appropriate cells Also used (Elroy-Stein and Moss, 1990 Proc. Natl. Acad. Sci. USA ,87, 6743-6747; Gao and Huang 1993 Nucleic Acids Res.,twenty one, 2867 ~ 2872 ; L ieber et al., 1993 Methods Enzymol.,217, 47-66; Zhou et al., 1990 Mol. Cell . Biol.,Ten, 4529-4537). Some researchers have found such promoters It has been demonstrated that the expressed ribozyme can function in mammalian cells (e.g. For example, Kashani-Sabet et al., 1992 Antisense Res. Dev.,2, 3-15; Ojwang et al., 19 1992 Proc. Natl. Acad. Sci. USA,89, 10802-10806; Chen et al., 1992 Nuclei c. Acids Res.,20, 4581-4589; Yu et al., 1993 Proc. Natl. Acad. Sci. USA,90 , 6340-6434; L'Huillier et al., 1992 EMBO J .;11, 4411-4418; Lisziewicz 1993 Proc. Natl. Acad. Sci. USA,90, 8000-8004). Ribozyme above The transcription unit is used to introduce a plasmid DNA vector, a plasmid, into a mammalian cell for introduction into the cell. Rus DNA vector (eg, adenovirus or adeno-associated virus vector) ) Or viral RNA vectors (eg retroviruses or alphaviruses) Vector) and can be incorporated into a variety of vectors, including but not limited to it can.   In a preferred embodiment of the invention, a ribozyme that cleaves the target RNA is expressed. Transcription unit is plasmid DNA vector, retrovirus DNA virus vector , Adenovirus DNA virus vector or adeno-associated virus vector Alternatively, it is inserted into an alphavirus vector. These and other vectors -Transfers genes to live animals (for a review, see Friedman, 1989 Science.2 44 , 1275-1281; Roemer and Friedman, 1992 Eur. J. Biochem.208, 211 ~ 22 5)) and to lead to transient or stable gene expression. Vek Are delivered as recombinant viral particles. DNA can be delivered alone or Can form a complex with the body (as described above for RNA like). DNA, DNA / vehicle complex or recombinant virus particles are examples Administration locally at the treatment site using a catheter, stent or infusion pump Is done.Diagnostic use   The ribozyme of the invention is a diagnostic tool for testing gene drift and mutations in diseased cells. It can be used as a step. The close relationship between ribozyme activity and the structure of the target RNA In the molecular region where the base pairing and three-dimensional structure of the target RNA changes depending on the relationship It is possible to detect mutations in Uses a number of ribozymes described in this invention This has implications for RNA structure and function in vitro as well as in cells and tissues. The required nucleotide changes can be mapped. Target RN by ribozyme Specific gene products using cleavage of A to block gene expression and during disease progression Can identify the (essential) role of. In this way, other gene targets Can be identified as an important mediator of the disease. These experiments are a combination Enable therapeutics (eg, many ribozymes targeting different genes, Ribozyme bound to a known small molecule inhibitor, or ribozyme and / or Intermittent treatment with other chemical or biological molecule combinations) It will lead to a better treatment of disease progression. Other in vivo ribozymes of the invention Toro use is well known in the art, and they include ICAM-1, relA, TNF-α, p210^bcr-ablOr detecting the presence of mRNA associated with RSV related status Output is included. Such RNAs are ribozyme treated using standard methodologies. It is detected by measuring the presence of the cleavage product after placement.   In certain embodiments, ribonucleotides that can cleave only wild-type or mutant target RNAs Zyme is used in the assay. The first ribozyme is the wild-type RN present in the sample Used to identify A and the second ribozyme is the mutant RN in the sample. Used to identify A. Both wild type and mutant RNA as reaction controls Cleavage the synthetic substrate of ribozyme with both ribozymes to determine the relative ribozyme efficiency in the reaction. And the absence of cleavage of the "non-target" RNA species. Cleavage from synthetic substrates The product produces size markers for analysis of wild-type and mutant RNA in the sample population. It will also help you to achieve. Thus, two ribozymes and two for each assay Substrate and 1 unknown sample to be combined in 6 reactions. Cleavage product The presence of the total length of each RNA and the cleaved fragment Measured using a ribonuclease protection assay so that it can be analyzed in two lanes You. Putative expression of mutant RNAs and desired phenotypic changes in target cells Quantifying results is not absolutely necessary to identify risks . The protein product of the mRNA is phenotypic (ie ICAM-1, relA, TNFα , P210^bcr-ablOr expression of mRNA as involved in the development of RSV) is dangerous Suitable for establishing sex. When probes with similar specific activity are used for both transcripts To Would be adequate for qualitative comparison of RNA values and would reduce initial diagnostic costs. Whether comparing RNA values qualitatively or quantitatively, the ratio of mutant type to wild type is The higher the higher, the higher the risk will be correlated with.II. Chemical synthesis of ribozyme   High biological activity for milligram amounts of RNA, enzymatic RNA or modified RNA The ensuing chemical synthesis, deprotection, and purification proceed. Applicant is enzymatically active The high-yield, high-yield synthesis of complete RNA is associated with some of the key practices used during its construction. I confirmed that it depends on the policy. Particularly importantly, RNA phosphoramidites , Combined efficiently in terms of both yield and time, the correct exocyclic That a mino protecting group should be used, the exocyclic amino protecting group and the 2'-hydro Appropriate conditions should be used for the removal of the alkylsilyl protecting group on xyl And proper post-treatment and purification of the resulting ribozyme must be taken. It is not necessary.   From the yield and biological activity of large RNA molecules (ie, about 30-40 nucleotide bases) In order to achieve a visually correct synthesis, the protection of the amino function of the base must be protected by an amide or One of the alternative amide protecting groups is required, which, on the other hand, allows the synthetic conditions to be maintained. It must be sufficiently stable while it must be removable at the end of the synthesis. These requirements are related to the amide protecting groups shown in Figure 8 and, in particular, to benzoyl for adenosine. Isobutylyl or benzoyl for cytidine, and for guanosine Satisfied with isobutylyl, these were used to NH_Three65 ° C-2 in EtOH It can be removed by incubating for 0 hours. For guanosine and adenosine The phenoxyacetyl type protecting group and cytidine shown in FIG. In the case of radicals, ethanol ammonia is used to achieve complete removal of these protecting groups. Incubation at 65 ° C for 4 hours is used. Removal of alkylsilyl 2'-hydroxyl protecting group Can be accomplished using a solution of TBAF in tetrahydrofuran for 8-24 hours at room temperature. Can be.   The most quantitative method for extracting well deprotected RNA molecules is scaringe et al., Nucleic  Acids Res. 1990, 18, 5433-5341, ethanol precipitation, or Is either by anion exchange cartridge desalting. Purification of long RNA sequences requires two steps It may be achieved by chromatographic techniques, in which case the molecule is first placed in the 5'position. G Purified on a reverse phase column with or without lytyl groups. This purification is based on the aqueous phase Using an acetonitrile gradient with triethylammonium or bicarbonate as Achieved. In the case of purification using trityl, the trityl group should be It may be removed by drying the chemically purified RNA molecule. The final purification should be To elute the produced RNA molecule as a suitable metal salt, such as Na +, Li +, etc. Performed on an anion exchange column with a gradient of alkali metal perchlorate. small The final desalting process with a reversed-phase cartridge completes the purification process. Like that Not only has no adverse effect on the activity of the ribozyme, it also cuts the target RNA molecule. Applicants have found that their activity of refusing can be improved.   Applicants have also found that a significant improvement in the yield of the required full-length product (FLP) is achieved by Confirmed that can be achieved with:   1. 0.25-0.5M or 0.25M for activation of RNA (or similar) amidites during binding treatment Is a delivered or effective concentration of 0.15-0.35M of 5-S-alkyltetrazole To use. (Experience means that the actual amount of chemicals in the reaction mixture is known. To taste. This means that the reaction vessel must be large enough to allow such operations. For some reason, it is possible for large scale synthesis. The term effective is a mixture That the reaction mixture is actually provided with a usable amount of chemical that can react with the other reagents in it. Means and. The skilled artisan will understand the meaning of those terms from the examples provided herein. You will recognize. ) This process takes 10-15 m, see above, 5-10 Shortened to m. Alkyl, as used herein, includes straight chain, branched chain, and ring. Refers to a saturated aliphatic hydrocarbon containing a linear alkyl group. Preferably, the alkyl group is It has 1 to 12 carbons. More preferably it is 1 to 7 carbons, more preferably Is lower alkyl having 1 to 4 carbons. The alkyl group is not You don't have to. When substituted, the substituent (s) are preferably Cyano, alkoxy, = O, = S, NO₂Or N (CH_Three)₂, Amino, or SH. That section Also includes alkenyl groups, which include at least linear, branched, and cyclic groups. Is also an unsaturated hydrocarbon containing one carbon-carbon double bond. Preferably, The lucenyl group has 1 to 12 carbons. More preferably it has 1 to 7 carbons , More preferably lower alkyl having 1 to 4 carbons. The alkenyl group is Even if replaced It does not have to be replaced. When substituted, the substituent (s) is preferably a hydroxyl group. Le, cyano, alkoxy, = O, = S, halogen, NO₂, Halogen, N (CH_Three)₂,amino , Or SH. The term "alkyl" also includes alkynyl groups, which are straight chain, Unsaturation involving at least one carbon-carbon triple bond including branched chains and cyclic groups It is a Japanese hydrocarbon. Preferably, the alkynyl group has 1 to 12 carbons. Yo More preferably, it is a lower alkenyl having 1 to 7 carbons, more preferably 1 to 4 carbons. It is Rukiru. The alkyl group may be substituted or unsubstituted. Will be replaced At this time, the substituent (s) is preferably hydroxy, cyano, alkoxy, ═O, ═S , NO₂Or N (CH_Three)₂, Amino, or SH.   The aforementioned alkyl groups may also be aryl, alkylaryl, carbocyclic aryl. , Heterocyclic aryl, amide and ester groups may be included. "Aryl" The group has at least one ring with a conjugated π electron system and all of them are Optionally substituted carbocyclic aryl, heterocyclic aryl and biaryl Refers to included aromatics. Preferred substituent (s) for the aryl group are halogen, tri Halomethyl, hydroxyl, SH, OH, cyano, alkoxy, alkyl, alkene And alkynyl and amino groups. An "alkylaryl" group (as described above N) refers to an alkyl group (as described above) covalently linked to an aryl group. Carbocyclic A reel is a group in which all ring atoms of the aromatic ring are carbon atoms. Carbon atom is optional Is replaced by. Heterocyclic aryl groups have 1 to 3 ring atoms in the aromatic ring. A group having a hetero atom and the rest of the ring atoms being carbon atoms. Suitable hate B atoms include oxygen, sulfur, and nitrogen, all of which are optionally substituted, Furanyl, thienyl, pyridyl, pyrrolyl, N-lower alkylpyrrolo, pyrimidyl , Pyrazinyl, imidazolyl OYOBI and the like. "Amide" is -C (O) -NH-R Refers to any of alkyl, aryl, alkylaryl or hydrogen. It is. "Ester" refers to -C (O) -OR ', where R is alkyl, aryl , Alkylaryl or hydrogen.   2. 0.1-0.35M for activation of RNA (or similar) amidites during binding treatment Use an effective, or final, concentration of 5-S-alkyltetrazole. In this process The time required is 10-15 m, see above and reduced to 5-10 m.   3. To remove the exocyclic amino protecting group (NH_FourOH / EtOH or NH_ThreeOH / EtOH, look up , Using 55-65 ℃ for 4-20 hours), 65 ℃ -10-15 minutes, alkylamine (MA, where alkyl is preferably methyl, ethyl, propyl or butyl ) Or NH_FourOH / Alkylamine (with the same alkyl groups as noted in MA, AM Use A). Other alkylamines such as ethylamine, propylamine , Butylamine, etc. may be used.   4.2 To remove 2'-hydroxylalkylsilyl protecting groups (TBAF, see above) , 8-24 hours or TEA / 3HF for 24 hours (Gasparutto et al. Nucleic Acids re s.1992, 20, 5159-5166), 65 ° C-0.5-1.5 hours, anhydrous tritylamine Use hydrogen fluoride. Other alkylamine / HF complexes such as triethyl Amine or diisopropylethylamine may be used.   5. Use of anion exchange resin to purify and / or analyze fully deprotected RNA. These resins include, but are not limited to, silica or polystyrene. Includes quaternary or tertiary amino derivatized stationary phases. In a specific embodiment, Dionex-NA100^{(R )} , Mono-Q^(R), Poros-Q^(R)Is included.   Accordingly, the invention provides for the attachment of RNA phosphoramidites; amides or substituted amides. For removal of the amide protecting group; and removal of the 2'-hydroxylalkylsilyl protecting group Featuring an improved method for. The method may include a substituted 2'-group of the type described above. Improved production of RNA or analogs, and efficient synthesis of large amounts of the RNA . The RNA may also have enzymatic activity and should not lose that activity. It can be easily purified. Even though a specific example is given here, the equivalent The chemical reactions were performed with the above mentioned alternatives that can be optimized and selected in routine experimentation. Those of ordinary skill in the art will appreciate that it is acceptable.   In another aspect, the invention provides for the analysis of RNA or enzymatic RNA molecules by HPLC, eg reverse phase and / or Pass the RNA or fermentation through an anion exchange chromatography column. Modifications for purification or analysis of elementary RNA molecules (eg 28-70 nucleotides in length) Characterized by good law. With the purification method, the catalytic activity of enzyme RNA (s) related to the gel purification method Sex is improved (see FIG. 10).   In Draper et al., PCT WO93 / 23569, cited here as a reference, reverse phase HPLC purification was used. Manufacture is disclosed. Anion exchange chromatography for purification of long RNA molecules May be achieved especially with alkali perchlorates. This system is extremely It may be used to purify long RNA molecules. In particular, RNA purification by anion exchange method Made of Dionex NucleoPak 100^(C)Or Pharmacia Mono Q^(R)Use of is advantageous . This anion exchange purification method may be used subsequent to or prior to reverse phase purification. . This method produces the sodium salt of the ribozyme during chromatography. Will be. Sodium alkaline earth salts can be replaced with other metal salts such as lithium, mag Substitution with nesium or calcium perchlorate will result in corresponding salts of RNA molecules during purification. Occurs.   In the case of 2-step purification, in this case the first step is reverse phase purification followed by anion exchange The reverse phase purification is carried out with either 5'-trityl-on or 5'-trityl-off. Best way to use polymeric, eg polystyrene based, reversed phase media Achieved. Either molecule can be recovered using this reverse phase method, and thus Once tritylated, the two fractions can be pooled and then as described above. It may be supplied for anion exchange purification.   The method involves passing enzymatically active RNA molecules across a reverse-phase HPLC column. Enzymatically active RNA molecules are synthetic chemical methods and Formed; and the enzymatically active RNA molecule is partially blocked and partially blocked. The enzymatically active RNA molecule that has been blocked is reversed to separate it from other RNA molecules. Pass over a phase HPLC column.   In a more preferred embodiment, the enzymatically active RNA molecule is run on a reverse phase HPLC column. After a period of time, it is deprotected and then a second reverse-phase HPLC column (this is the same as the reverse-phase HPLC column). (Which may be any) to remove the enzymatic RNA molecule from other components. In addition, the column is a C4, C8 or C18 column of silica or organic polymer matrix. , With a porosity of at least 125Å, preferably 300Å, and at least 2 μm, preferably It has a particle size of 5 μm.activation   Synthesis of RNA molecules may be performed chemically or enzymatically. Place of chemical synthesis If It is known to use tetrazole as an activator of RNA phosphoramidite (Usman et al. J. Am. Chem. Soc. 1987, 109, 7845-7854). Here and after In a subsequent report, a 0.5M solution of tetrazole was reacted with RNA phosphoramidite and The polymer is bound to the 5'-hydroxyl group for 10 minutes. 5-S-alkyltetrazole Using a 0.25-0.5M solution for 5 minutes only will give comparable or better results. The applicant has confirmed that The following illustrates the procedure.Example 7: of RNA and ribozyme using 5-S-alkyltetrazole as activator Synthesis   The synthetic method used is described by Usman et al., 1987 (supra) and Scaringe et al., Nucl. eic Acids Res. 1990, 18, 5433 = 5441 for general procedures for RNA synthesis. Therefore, the 5'-terminal dimethoxytrityl, and the 3'-terminal phosphoramidite It utilizes such ordinary nucleic acid protection / binding groups. The main differences used are Activator, 5-S-ethyl or -methyltetrazole at a concentration of -0.25M for 5 minutes Was.   All small scale syntheses were performed using a modified 2.5 μmol The ligation process was shortened by 5 minutes for ril-protected RNA and for 2'-O-methylated RNA Performed on a 394 (ABI) synthesizer with a 2.5 minute binding process. Polymer bound 5'-hydroxy 6.5-fold excess of phosphoramidite (162.5 μL of 0.1 M = 32.5 μmol) and 40-fold excess of S-ethyltetrazole (400 μL of 0.25 M = 100 μmo l) was used for each binding cycle. Colorimetric determination of trityl fraction The average coupling yield at 394 was 97.5-99%. Other oligonucleosides for 394 Tide synthesis reagent: Detrimethylation solution was 2% TCA in methylene chloride; The formation of 16% N-methylimidazole in THF and 10% acetic anhydride in THF / 10% 2,6- Titidine was performed; the oxidizing solution was 16.9 mM I in THF.₂, 49 mM pyridine, 9% in water there were. Fisher Synthesis Grade acetonitrile was used directly from the reagent bottle. S-Ethyltetrazole solution (0.25 M in acetonitrile) was applied by Applied Biosystems. Made from solid obtained from.   All large scale syntheses were performed using a modified 25 μmol For ril-protected RNA, the conjugation process was shortened by 5-15 minutes and for 2'-O-methylated RNA. Is Improved with 7.5 minutes of combined processing (8 amidite port capacity) 390Z (ABI) synthesizer gave. 6-fold exce of phosphoramidite with respect to polymer bound 5'-hydroxyl 45-fold excess (4.5 mL of 0.1 M = 150 μmol) and S-ethyltetrazole (4.5 mL of 0.1 M = 150 μmol)  mL of 0.25 M = 1125 μmol) was used for each binding cycle. Trityl Fluxi The average binding yield at 390Z was 95.0-96.7%, as determined by a colorimetric assay . Oligonucleotide synthesis reagent for 390Z: Detrimethylation solution in methylene chloride Was 2% DCA; cap formation was in THF with 16% N-methylimidazole in THF 10% acetic anhydride / 10% 2,6-lutidine; the oxidizing solution was 16.9 mM I in THF.₂ , 49 mM pyridine, 9% water. Fisher Synthesis Grade acetonitrile is Used directly from reagent bottle. S-ethyltetrazole solution (0.25-0 in acetonitrile .5M) was made from solids obtained from Applied Biosystems.Deprotection   The first step in deprotecting RNA molecules is NH_FourOH / EtOH: 3/1 (Usman et al. J. Am. Chem. So c. 1987, 109, 7845-7854) or NH_ThreeOH / EtOH (Scaringe et al. Nucleic Acids Res . 1990,18,5433-5341) at 55-65 ℃ for ~ 20 hours to remove exocyclic amino protecting group May be performed by doing. 55-65 ℃ -10-15 minutes, methylamine or NH_FourOH / me Applicants have confirmed that tilamine gives comparable or better results doing. The following illustrates the procedure.Example 8: Exocyclic amino protection using methylamine (MA) or NH ₄ OH / methylamine (AMA). Deprotection of RNA and ribozymes for protecting groups   A polymer-bound oligonucleotide, either trityl-on or off, is methylated. Amine (MA) or NH_FourSuspended in OH / methylamine (AMA) solution at 55-65 ℃ for 5-15 minutes To remove the exocyclic amino protecting group. Polymer-bound oligonucleotide synthesis column To a 4 mL glass screw cap bottle. NH_FourSame volume of OH and aqueous methylamine Mixed. Add 4 mL of the resulting reagent to the bottle for 5 minutes at room temperature, then add 55 or 6 Heat at 5 ° C for 5-15 minutes. After cooling to -20 ° C, remove the supernatant from the polymer support Was. The support was added with 1.0 mL of EtOH: MeCN: H.₂Wash with O / 3: 1: 1, vortex, then ,Moreover Clarity was added to the first supernatant. Its bound supernatant containing oligonucleotides Dried to a white powder. Similar procedure for aqueous methylamine reagent Also carried out.   Table 40 was obtained using the improved methods outlined herein for base deprotection. It is a summary of the results.   The second step in the deprotection of RNA molecules is to use the 2'-hydroxyl alcohol with TBAF for 8-24 hours. This may be achieved by removing the silylsilyl protecting group (Usman et al. J. Am. Chem. Soc. 1987, 109, 7845-7854). Anhydrous TEA ・ HF in N-methylpyrrolidine (NMP) at 55-65 ℃ Applicants have found that if used for 0.5 to 1.5 hours, equivalent or better results can be obtained. I have confirmed. The following illustrates this procedure.Example 9: 2'-hydroxylalkylsilyl protecting group using anhydrous TEA-HF RNA and ribozyme deprotection   Ammonia deprotected oligonucleotides to remove the alkylsilyl protecting group. Cleotide 250 μL of 1.4 M anhydrous HF solution (1.5 mL N-methylpyrrolidine, 750 μL It was suspended in TEA and 1.0 mL TEA.3HF) and heated at 65 ° C. for 1.5 hours. 9 mL of 50 mM  TEAB was added to quench the reaction. The resulting solution was prewashed with 10 mL of 50 mM TEAB. Qiagen 500^(R)It was filled on an anion exchange cartridge (Qiagen). That power Wash the cartridge with 10 mL of 50 mM TEAB and elute the RNA with 10 mL of 2 M TEAB. , Dried to a white powder.   Table 41 uses the improved methods outlined herein for deprotection of alkylsilyl. It is a summary of the results obtained.Example 10: HPLC purification, anion exchange column   For small scale synthesis, the crude material was water treated with diethylpyrocarbonate. Diluted to 5 mL. The sample was added to 100% buffer A (10 mM NaClO_Four) At Pharmacia Mono Q^(R) 16/10 or Dionex NucleoPac^(R)Inject over any of the columns. Pharmacia Mono Q^(R)180-210 mM at a rate of 0.85 mM / void volume for anion exchange column  NaClO_FourOr Dionex NucleoPac^(R)1.7mM / vold volum for anion exchange column e 100-150 mM NaClO at a rate of_FourWas used for RNA elution. Dion the fraction ex NucleoPac^(R)It was analyzed by HP-1090 HPLC with column. > 80% total in peak area Fractions containing long product were pooled.   For large-scale trityl-off synthesis, the crude material was used to quench the desilylation reaction. 53 mL Pharmacia HiLoad 26/10 Q-Sepharose^(R)Fast Flow Desalted in addition to rum. Wash the column thoroughly with 10 mM sodium perchlorate buffer. Clean Orionucleotides elute from the column with 300 mM sodium perchlorate did. Quantify the eluent and run an analytical HPLC to determine the percentage of full-length material in the composition. Specified. Aseptic H₂Dilute 4 times in O to reduce salt concentration, and use Pharmacia Mo noQ^(R)Added on 16/10. 4 column volumes of a gradient of 10-185 mM sodium perchlorate Elute the relatively short sequence over the entire length of the column, then add 30 columns of full-length product. Elution with a gradient from 185-214 mM sodium perchlorate in solution. Target hula The Dionex NucleoPac^(R)It was analyzed by HP-1090 HPLC with column. Over 85% The fractions containing the full length material were pooled. Desalination of the pool For Pharmacia RPC^(R)Added to the column.   For large-scale synthesis of trityl-on, the crude material was the quench of the desilylation reaction. 53 mL Pharmacia HiLoad 26/10 Q-Sepharose^(R)Fast Flow Desalted in addition to rum. Column with 20 mM NH_FourCO_ThreeH / 10% CH_ThreeWash thoroughly with CN buffer did. Orionucleotides have 1.5 M NH_FourCO_ThreeFrom the column with H / 10% acetonitrile Eluted. Quantify the eluent and run an analytical HPLC to determine the percentage of full length material in the composition. Was measured. The oligonucleotide was then loaded onto the Pharmacia Resource RPC column. I got it. 20-55% B (20 mM NH_FourCO_ThreeH / 25% CH_ThreeCN, buffer A = 20 mM NH_FourCO_ThreeH / 10% CH_ThreeThe gradient from (CN) was run over 35 column volumes. Fraction to be targeted Dionex NucleoPac^(R)It was analyzed by HP-1090 HPLC with column. All over 60% Fractions containing long material were pooled. Then the pooled hula The tissue was detritylated manually with 80% acetic acid, immediately dried and sterile H₂In O Suspend, dry, h₂Resuspended in O 2. This material is Dionex NucleoPac^(R) It was analyzed by HP-1090 HPLC with column. Like the trityl-off (above) Purified by anion exchange chromatography as in the formula.Example 11: Ribozyme activation assay   Purified 5'-end labeled RNA substrate (15-25-mers) and purified 5'-end labeled ribozyme ( ~ 36-mers) together at 95 ° C, quenched on ice and equilibrated separately at 37 ° C. did. The ribozyme stock solution is 1 μM, 200 nM, 40 nM or 8 nM and the final substrate RNA concentration was ~ 1 nM. The total reaction volume was 50 μL. Assay buffer , 50 mM Tris-Cl, pH 7.5 and 10 mM MgCl₂Met. The reaction is the reaction with substrate at t = 0. It was started by mixing with the Bozyme solution. Aliquot 5 μL of each time point It was taken out at 1, 5, 15, 30, 60 and 120 m. Fill each aliquot with formamide. Quenched in buffer and loaded onto 15% denatured polyacrylamide for analysis. Re Quantitative analysis was performed using an optical imager (Molecular Dynamics).Example 12: One-pot deprotection of RNA   Aqueous methylamine is an efficient reagent for deprotecting the bases of RNA molecules. Was indicated by the applicant. However, processing that requires a lot of time (2 to 24 hours) Shows that RNA samples are completely dried prior to deprotection of the sugar 2'-hydroxyl group There is a need. Furthermore, deprotection of RNA synthesized on a large scale (eg, 100 μmol) Intriguing because the volume of solid support used is quite large. Has become. Minimize and deprotect time required for deprotection of RNA synthesized on a large scale In an attempt to simplify the protection process, Applicants have found that one-pot deprotection protocols (Fig. 12). Following this protocol, aqueous methylamine Anhydrous methylamine is used instead. Deprotect the base at 65 ° C for 15 minutes and then Allow the reaction to cool for 10 minutes. Then, deprotect the 2'-hydroxyl group with TEA / 3HF. Perform for 90 minutes in the same container with reagents. Quench reaction with 16 mM TEAB solution You.   Figure 13Referring to, the hammerhead ribozyme directed to site B was RNA phosphorylated. Synthesized using Madite chemistry and either a two-pot or one-pot protocol It is deprotected by using. Compare the profiles of these ribozymes on the HPLC column. Compare. Figures deprotected by either one-pot or two-pot protocol The resulting RNAs show similar full-length product profiles. One pot Using the protocol, the time required for RNA deprotection can reduce the quality or yield of full-length RNA. It has been shown by the applicant that it can be considerably reduced without even doing so.   Fig. 14See ((From Figure 13)Hammerhead ribozyme for RNA site B , For their ability to cleave RNA.As shown in Figure 14,One-pot Ribozymes that are deprotected using the two-pot protocol Thus, it has a catalytic activity comparable to that of the deprotected ribozyme.Example 12a: RNA and ribozyme using 5-S-alkyltetrazole as activator Modified Protogol for the Synthesis of Phosphorothioate Containing Plum   The two sulfiding reagents that have been used to synthesize ribophosphorothioate are the Traethylthiuram disulfide (TETD; Vu and Hirschbein, 1991, Tetrahedron  Letter 31, 3005), and 3H-1,2-benzodithiol-3-one 1,1-dioxide (B eaucage reagent; Vu and Hirschbein, 1991 supra). TETD requires a long sulfidation time (600 seconds for DNA and 3600 seconds for RNA). For sulfonation of DNA, Beauca The ge reagent has recently been shown to be more effective than TETD (Wyrzkiewicz and Ravikuma r, 1994 bioorganic Med. Chem. 4, 1519). Beaucage reagent is also 2'-dioxy-2 ' -For the synthesis of phosphorothioate oligonucleotides containing fluoromorphs Used in this case, the waiting time is 10 minutes (Kawasaki et al., 1992 J. Me. d. Chem).   The synthetic method used follows the procedures for RNA synthesis as described herein and is conventional. Nucleic acid protection / binding group, such as 5'-terminal dimethoxytrityl, and 3'-terminal phosphine Use formamidite. Sulfurization treatment of RNA described in the literature requires 8 seconds And a waiting time of 10 minutes (Beaucage and Iyer, 1991 Tetrahedron 49, 6123). This Under these conditions, about 95% sulfurization was determined by HPLC analysis (Morvan et al ,. 1990 Tetrahedron Letter 31, 7149). This 5% contaminated oxidation was dissolved in the solvent Trace iodine adsorbed on the inner surface of the work line during the presence of oxygen and / or the previous synthesis Can be elevated by slow release of.   The major improvement is the activator, 5-S-ethyltetrazole at a concentration of 0.25 M or Is to use 5-S-methyltetrazole for 5 minutes. In addition, phosphorothioate For those linkages that are the same, the iodine solution is 3H-1,2-benzoin in acetonitrile. Dithiol-3-one Replaced with 1,1-dioxide (Beaucage reagent) 0.05 M . Outwork time for sulfurization is reduced to 5 seconds and waiting time is reduced to 300 seconds .   RNA synthesis was performed using a modified 2.5 μmol scale protocol with alkylsilyl protected R The binding treatment was shortened by 5 minutes for NA and 2.5 minutes for 2'-O-methylated RNA. The combined process was performed on a 394 (ABI) synthesizer. Regarding polymer bound 5'-hydroxyl 6.5-fold excess of phosphoramidite (162.5 μL of 0.1 M = 32.5 μmol) and S -40-fold excess of ethyl tetrazole (400 μL of 0.25 M = 100 μmol) Used in combined cycle. Colorimetric determination of the trityl fraction, 39 The average coupling yield at 4 was 97.5-99%. Other oligonucleotide synthesis for 394 Reagent: Detrimethylation solution was 2% TCA in methylene chloride; cap formation , 16% N-methylimidazole in THF and 10% acetic anhydride / 10% 2,6-lutidine in THF Performed; oxidizing solution was 16.9 mM I in THF₂, 49 mM pyridine, 9% water. Fisher Synthesis Grade acetonitrile was used directly from the reagent bottle. S-ethyl Tetrazole solution (0.25 M in acetonitrile) available from Applied Biosystems Made from solids. Sulfiding reagent was obtained from Glen Research.   The average sulfidation efficiency (ASE) is determined using the following formula:           ASE = (PS / Total)^{1 / n-1}   Where PS = P = S of diester³¹P NMR integrated value         Total = integrated value of all peaks             n = length of oligo   Refer to Tables 42 and 43 to vary the appearance and latency of sulfurization with Beaucage Reagent. Effect is explained. These data suggest a 5 second latency and 3 It means that the use time of 00 seconds is the condition under which the ASE becomes maximum.   Using the above conditions, a 36-mer hammerhead ribozyme was synthesized and labeled at site C. Turn to. Ribozymes contain a phosphorothioate bond at the 4'position towards the 5'-end. To be synthesized. The RNA-cleaving activity of this ribozymeFig. 16Shown in Phosphorothioe Ito Ribozyme activity is the activity of any phosphorothioate bond lacking a ribozyme. It is comparable to sex.Example 13: For the synthesis of 2'-N-phthalimido-nucleoside phosphoramidites protocol   The 2'-amino group of 2'-deoxy-2'-amino nucleoside is N- (9-florenylmethyl Normally protected by xycarbonyl) (Fmoc; Imazawa and Eckstein, 1979 supra ; Pieken et al., 1991 Science 253, 314). This protecting group is CH_ThreeIn CN solution or Not stable even in dry form during extended storage at -20 ° C. These issues are There is a need to overcome to achieve large-scale synthesis of NA.   Applicant has proposed that an alternative replacement for the 2'-amino group of the 2'-deoxy-2'-aminonucleoside. It describes the usage of the guardian.Fig. 17With reference to the phosphoramidite 17 , 2'-deoxy-2'-aminonucleoside with temporary protection by Markevich reagent It was synthesized starting from (Markiewicz J. Chem. Res. 1979, S, 24). 50% of intermediate 13 Yield, but subsequent N- by the Nefken method (Nefkens, 1960 Nature 185, 306) Introduction of phthaloyl (Pht), desilylation (15), dimethoxytritylation (16) and phosphine Phosphoramidite 17 was reached by phytization. The overall yield of this multi-step process is low (20%), the applicant was able to use N-phthaloyl without acrylation of the 5'and 3'hydroxyls. Focused on the selective introduction of ru radicals, several alternative approaches were examined.   2'-deoxy-2'-amino nucleoside with 1.05 equivalent of Nefkens reagent in DMF overnight React, then Et_ThreeWhen treated with N (1 hour), only 10-15% N and 5 '(3')-bis- A phthaloyl derivative was formed, and the main component was the N-Pht-derivative 15. N, O-bis By-products were selectively and quantitatively treated by treatment of the crude reaction mixture with cat.KCN / MeOH. Converted to N-Pht-derivative 15.   Selective N-phthaloylation for a convenient "one-pot" procedure for the synthesis of key intermediate 16 Subsequent DMTC / Et_ThreeDimethoxytritylation with N was included, and 85% of An overall yield of DMT derivative 16 preparation is obtained. 87% yield of phosphating with 16 standard phosphites It gave birth to a squalamidite 17. 1 gram of 2'-amino, for example 2'-aminourigi (US Biochemicals^(R)part # 77140) from dry dimethylformamide (Dmf). Co-evaporate,In vacuumDry overnight. 50 mls of Aldrich sure-s via syringe eal Dmf was added to dry 2'-aminouridine and the mixture was stirred for 10 minutes to give a clear product. Was born. 1.0 gram (1.05 eq.) Of N-carbethoxyphthalimide (Nefken's reagent , 98% Jannsen Chimica) and the solution was stirred overnight. Thin-phase chromatograph (TLC), the faster moving product (CHCl_Three90% conversion to 10% ETOH in) And 57 μl TEA (0.1 eq.) Was added to perform phthalimide ring closure. 1 hour Later, an additional 855 μl (1.5 eq.) Of TEA was added, followed by 1.53 g (1.1 eq.) Of DMT-C. l (Lancaster Synthesis^(R), 98%) was added. Allow the reaction mixture to stir overnight Quenched with ETOH and then TLC showed> 90% desired production. Dmf in vacuum , The mixture is washed with sodium bicarbonate solution (5% aq., 500 mls) and vinegared. Extracted with ethyl acidate (2 x 200 mls). 25 mm x 300 mm flash column for purification (75 grams Merck flash silica) was used. The compound is 80-85% in hexane Elute ethyl acetate (Yield: 80% Purity:> 95% by¹HNMR). Then, the above-mentioned mark Phosphoramidites were made using a quasi protocol.   With the phosphoramidite 17 at hand, the applicant also made a 2'-deoxy-2'-amino modification. Several ribozymes were synthesized. Synthetic analysis showed binding efficiencies in the 97-98% range. Proven. If the 2'-amino position is both protected by Fmoc or Pht, then U4 and And / or RNA cleavage of ribozymes containing a 2'-deoxy-2'-amino-U modification at position U7 The activity was the same. In addition, complete deprotection of 2'-deoxy-2'-aminouridine The protection was confirmed by base-composition analysis. The binding efficiency of phosphoramidite 17 is Was not effective over the long-term storage (1-2 months).Protection of the 2'position on the SEM group   In the synthesis of oligonucleotides, and especially enzyme molecules as described above, 2 '-( The procedure with the lymethylsilyl) ethoxymethyl protecting group (SEM) is followed. RNA's With respect to synthesis, it is important that the 2'-hydroxyl protecting group be used in various synthetic and salt processes. It must be stable throughout the group deprotection procedures. at the same time This group must also be easily removable when needed. In this regard, The t-butyldimethylsilyl group was effective (Usman, N .; Ogilvie, K.K .; Jiang, M.-Y. Cedergren, R.J. J. Am. Chem. Soc. 1987, 109, 7845-7854 and Scaringe, S.A.; Fra nkly n, C.; Usman, N. Nucl. Acids Res. 1990, 18, 5433-5441). However, this protecting group Removal from 2'-hydroxyl is generally accomplished by tetra-n-butylammonium fluoride. Need to be exposed to Lido (TBAF) for a long time. In addition, bulky alkyl substituents are bonded Proved to be an obstacle to and therefore requires longer binding times . Finally, TBDMS is a reactive base and during treatment with ethane ammonia It was shown to be partially deprotected (Scaringe, S.A .; Franklyn, C .; Usman, N. Nu. cl.Acids Res. 1990, 18, 5433-5441 and Stawinski, J .; Stromberg, R .; Thelin, M .; Westman, E. Nucleic Acids Res. 1988, 16,9285-9298).   (Trimethylsilyl) ethoxymethyl ether (SEM) seems a suitable substituent It is. This protecting group is stable to all except bases and the most severe acid conditions . Therefore, it is stable under the conditions required for oligonucleotide synthesis. So They can be easily introduced and cannot be transferred by oxygen-carbon bonds. Finally, the SEM group BE_ThreeOEt₂Can be removed very quickly.   During RNA synthesis, the 2'-position of the nucleotide is replaced by (trimethylsilyl) ethoxymethyl ether. Protecting with ether (SEM) continues the method for RNA synthesis. The method is described below. Use of standard RNA synthesis conditions such as these, or any other equivalent treatment is included. Business The person is familiar with the processes described above. The nucleotide used can be any of the usual A method that may be nucleotides or is well known in the art, for example Eckste in et al., International Publication No. WO 92/07065, Perrault et al., N ature 1990, 344, 565-568, Pieken et al., Science 1991, 253, 314-317, Usm an, N .; Cedergren, R.J. Trends in Biochem.Sci, 1992, 17, 334-339, Usman et a l., PCT WO93 / 15187, and Sproat, B.I. European Patent Application 92110298.4 The various positions may be replaced by methods such as those described in.   The invention also features a method of covalently attaching an SEM group to the 2'-position of a nucleotide. You. The method involves contacting a nucleotide with a SEM-containing molecule under SEM-binding conditions. Is included. In a preferred embodiment, the conditions are dibutyltin oxide, tetrafluoride. Butyl ammonium and SEM-CI. However, one skilled in the art may use other equivalent conditions. You will find that you can do it.   In another aspect, the invention relates to SEM from nucleoside molecules or oligonucleotides. Base It is characterized by the removal method of. The method is performed under SEM removal conditions, for example, acetonitrile. Where the molecule or oligonucleotide is boron trifluoride etherate (BE_Three OEt₂) Contacting with).   Figure 18, A method for solid phase synthesis of RNA is shown. 2 ', 5'-Protection Otides can be contacted with solid phase bound nucleotides under conditions of RNA synthesis to To form The protecting group at the 2'-position in the prior art method is a silyl group as shown in the figure. It may be a ruther. In the method of the present invention, the SEM group replaces the silyl ether. Used for Alternatively, RNA synthesis may be performed using standard methods.   FIG.2'-O-SEM protected nucleoside and phosphoramidite Indicates success. Briefly, the 5'-protected nucleoside (1) will induce SEM under appropriate conditions. Protected at the 2'- or 3'-position by contacting the conductor. In particular, these articles In some cases, the nucleoside may be contacted with dibutyltin oxide and SEM chloride. included. The two regioisomers are chromatographically separated and 2'-protected half Is converted to a phosphoramidite by standard procedures. The 3'-protected nucleoside is It is converted to a derivative of succinate suitable for derivatization of solid supports.   Referring to Figure 20, a conventional method of RNA deprotection using silyl ethers is shown. . This contrasts with the method shown in Figure 21, where deprotection of RNA containing SEM groups is performed. What to do. In step 1, the base protecting group and the cyanoethyl group are removed using standard procedures. Left. The SEM group is then removed as shown. Phosphoramidite and S Details of the synthesis of EM-protected nucleosides and their use in the synthesis of oligonucleotides Deprotection of usage and subsequent ...Example 14: 2'-O-((trimethylsilyl) ethoxymethyl) -5'-O-dimethoxytriti Synthesis of Luuridine (2)   FIG.Refer to CH_Three5'-O-dimethoxytrityluridine 1 in CN (18 mL) (1.0 G, 1.83 mmol) dibutyltin oxide (1.0 g, 4.03 mmol) and TBAF (1M, 2.38 mL) , 2.38 mmol). The mixture was stirred at room temperature (about 20-25 ° C) for 2 hours and then (Trimethylsilyl) ethoxymethyl chloride (SEM-CI) (487 μL, 2.75 mmo l) was added. The reaction mixture was stirred overnight, then filtered and evaporated. flash Chromatography (30% hexane in ethyl acetate) gave 347 mg (28.0%) of 2'-hydride. Roxyl-protected nucleoside 2 and 314 mg (25.3%) of 3'-hydroxyl protected nucleoside I gave birth to Do 3.Example 15: Synthesis of 2'-O-((trimethylsilyl) ethoxymethyl) uridine (4)   FIG.Nucleoside 2 was detritylated according to standard methods as shown in.Example 16: 2'-O-((trimethylsilyl) ethoxymethyl) -5 ', 3'-O-acetyluri Synthesis of gin (5)   FIG.Nucleoside 4 was acetylated according to standard methods, as shown in.Example 17: Synthesis of 5 ', 3'-O-acetyluridine (5)   FIG.Refer to to see the well protected uridine 5 (32 mg, 0.07 mmol) in CH_ThreeCN (700 μL) and BE_Three.OEt₂(17.5 μL 0.14 mmol) was added. Stir the reaction mixture 15 m. The reaction was quenched by stirring and adding MeOH. Flash chromatography ー (CH₂Cl₂20% (88%) of SEM deprotected nucleoside 6 with 5% MeOH).Example 18: 2'-O-((trimethylsilyl) ethoxymethyl) -3'-O-succinyl-5'-O-di Synthesis of methoxytrityluridine (2)   FIG.Nucleoside 3 is succinylated and supported according to standard methods, as shown in. Bound to a holding body.Example 19: 2'-O-((trimethylsilyl) ethoxymethyl) -5'-O-dimethoxytriti Synthesis of luuridine 3 '-(2-cyanoethyl N, N-diisopropylphosphoramidite) ( 8)   FIG.Nucleoside 3 was phosphinated according to standard methods as shown in .Example 20: Synthesis of RNA with 2'-O-SEM protection   Figure 18, The synthetic method used is: Usman, N .; Ogilvie, K.K .; Jiang, M.-Y .; Cedergren, R.J. J. Am. Chem. Soc. 1987, 109,7845-7854 and Scaringe, S.A .; Frankl. yn, C .; Usman, N. Nucl. Acids Res. 1990, 18, 5433-5441 Follow the general procedure for preparation. The phosphoramidite 8 was bound according to standard RNA methods. A 10-mer uridylic acid was produced. The synthesis was performed using a modified 2.5 μmol scale protocol. Was performed on a 394 (ABI) synthesizer with a 10 m binding process. Polymer bound 5'-hydro 13-fold excess (325 μL of 0.1 M = 32.5 μmol) and tetrazole for xyl 80-fold excess of (400 μL of 0.5 M = 200 μmol) was used for each binding cycle. Was. The average binding yield at 394, determined by colorimetric determination of the trityl fraction, is , 98-99%. Other oligonucleotide synthesis reagents for 394: Detrimethylation The solution was 2% TCA in methylene chloride; cap formation was 16% N-methyl in THF. Performed with 10% acetic anhydride / 10% 2,6-lutidine in THF and THF; oxidative dissolution The solution is 16.9 mM I in THF.₂, 49 mM pyridine, 9% water. Fisher Synthesis G rade Acetonitrile was used directly from the reagent bottle.   Fig. 21For homopolymers, see NH at 65 ° C._ThreeBase deprotected with / EtOH. Its melting Decant liquid and support 1: 1: 1 H₂O: CH_ThreeIt was washed twice with a solution of CN: NeOH. Mixed The combined solution is dried, then CH_ThreeDiluted with CN (1 mL). BE_Three.OEt₂(2.5 μL, 30 μmo l) was added to the solution and an aliquot was removed at the 10 time point. From the result, As shown in FIG. 22, it can be seen that deprotection is completed after 30 minutes.III. Vector-expressing ribozyme   Here, a method for expressing a ribozyme in bacteria or eukaryotes, and Follow the large-scale manufacturing method of ribozyme such as. In general, the present invention reduces costs Multiplexes encoding defined ribozymes for producing ribozymes in It features a method of making a copy cassette. A vector is created, which is Only one ribozyme cuts at the 3'and 5'ends from an RNA transcript made from the vector. Encode multiple ribozymes that are turned off. The system is a ribozyme production scale It is useful for expanding the intestine, whether modified in situ or in vitro. You don't have to. The vector system allows expression of a desired ribozyme in a particular cell. Can be used or used in in vitro systems to enable the production of large quantities of the desired riboqyne You can also. The vector of this invention allows in-situ or ex-vivo before and after transcription. A higher yield of ribozyme can be synthesized in the form of RNA transcript cleaved by.   Therefore, the present invention does not treat only one end, or only one ribozyme. To treat the 3'and 5'ends of each therapeutic, trans-acting or desired ribozyme. This is a distinction from the prior art which uses a single ribozyme. By this Multiple mRNAs that are released from the mRNA transcript by only one other ribozyme. Bozymes can induce smaller vectors. Applicant also revoked The mRNA fold between the vector encoding the im and the corresponding transcript By designing it to be uninterrupted by treatment with released ribozyme, Also provided is a method by which the activity of bozymes is increased relative to those of the prior art.   The stability of ribozymes made in this way is demonstrated by Draper et al., PCT WO93 / 23509. Sequence at the end of the ribozyme, as described in It can be improved by providing.   The method of the present invention provides a low cost copy method compared to current chemical ribozyme synthesis. High-yield ribozyme synthesis was achieved using Use the separation techniques currently used to generate the produced oligonucleotides It is beneficial because it can. Therefore, analysis and diagnosis by the same method Alternatively, the ribozyme can be synthesized at low cost and high yield for therapeutic use.   The method also includes ribozyme structural studies, enzymatic studies, and target RNA accessibility studies. , Synthesis of in vitro ribozymes for transcriptional inhibition studies and nuclease protection studies Are also useful, many of which are referred to by Draper et al., PCT WO9, incorporated herein by reference. It is described in 3/23509.   The method can also be used to increase the intracellular concentration of the desired therapeutic ribozyme, Or the subsequent generation of chain transcripts for in vitro separation of unit length ribozymes. It can also be used to make ribozymes in situ. The desired ribozyme is , For the analysis of molecular inheritance or for inhibiting gene expression in infectious cell lines, and It can be used to test the efficiency of therapeutic molecules or untreated cells.   Therefore, in general, the present invention relates to plasmids, cosmids, fagmids, viruses, Inside the viroid, virusoid or phage vector, bacteria, virus or Is characterized by a vector containing a eukaryotic promoter. Same for other vectors Suitable for, and formed by amplification methods such as the polymerase chain reaction Strand, or partially double-stranded DNA, or viral or viroid RNA genome Double-stranded, partially double-stranded or single-stranded formed by site-directed homologous recombination into Contains single-stranded RNA. The vectors need not be circular. First Ribozyme The coding region is transcriptionally linked to the promoter region and is Ribozyme cleavage sequences flanking the region encoding the second ribozyme To sequence the nucleotides. In a DNA vector or RNA Appropriate restriction enzymes were added to facilitate the construction of this vector in the required DNA of the current system. Endonuclease sites can be provided. The desired second ribozyme is Han Such as Marhead, hairpin, hepatitis delta virus (HVD) or other catalytic centers, It may be any desired type of ribozyme, and as described above, Group I and group II introns may be included. The first ribozyme is Enco Selected to cleave the opened cleavage sequence, and also any desired ribozyme. A ribozyme derived from Tetrahymena, which is, for example, Restricted end-nucks embedded in the center of the self-recognition sequence to aid in actor construction It may include a lease site. This endonuclease site is the constituent of the vector , And subsequent analysis of the vector.   When the promoter of the above-mentioned vector is activated, an RNA transcript is created and It contains first and second ribozyme sequences. The sequence of the first ribozyme is Under certain conditions, it acts to cause cleavage at the cleavage site and release the sequence of the second ribozyme. Can be These second ribozyme sequences are then linked to their target RNA part. Position or may be separated for later use or analysis.   Thus, in one aspect, the invention provides a (first ribozyme having intramolecular cleavage activity). The first nucleic acid sequence, which encodes the RNA that is cleaved by the first ribozyme is released to release the second ribozyme from the transcript. Flanked by nucleic acid sequences encoding A vector comprising a second nucleic acid sequence (encoding a ribozyme). second Ribozymes are flanked by the first ribozyme on either the 5'side or the 3'side. Been Good. If desired, the first ribozyme can be encoded in a separate vector and It may have intramolecular cleavage activity.   As discussed above, the first ribozyme can be any self-cleaving ribozyme. And the second ribozyme can be selected to be any desired ribozyme. You may The flanking sequence is selected so as to include a sequence group recognized by the first ribozyme. Selected. When the vector is made to express RNA from these nucleic acid sequences, the RNA will , Has the ability to cut each of the flanking regions under suitable conditions, and thus 1 Releases one or more copies of the second ribozyme. If necessary, use the same vector It is possible to make several different secondary ribozymes, or several different vectors. Different ribozymes can be made by placing the vector in the same container or cell .   In a preferred embodiment, the vector comprises nucleic acid sequences each recognized by the first ribozyme. Includes multiple nucleic acid sequences encoding a second ribozyme flanked by rows I do. More preferably, the plurality is at least 6 to 9 or a number between 60 and 100. Contains up to nucleic acid sequences. In another preferred embodiment, the vector is A ribozyme encoding a nucleic acid encoding a ribozyme of , Vectors are plasmids, cosmids, fagmids, viruses, viroids or Selected from phages. In the most preferred embodiment, the multiple nucleic acid sequences are identical and Sequenced so that they are present and have the same end closest to the promoter. Must If necessary, the poly (A) sequence adjacent to the sequence encoding the first and second ribozymes Rows may be provided to enhance the stability of the RNA produced by the vector; and The restriction endonuclease adjacent to the nucleic acid encoding the first limbozyme is Allows insertion of a nucleic acid encoding a second ribozyme during construction of the vector Will be given   In a second aspect, the invention encodes the first ribozyme as described above. By generating a vector containing the nucleic acid and as described above Ribozyme expression vectors were generated by generating single-stranded DNA encoding the enzyme. It is characterized by a method of forming a target. Then, the single-stranded DNA is annealed to It forms a double-stranded helix DNA that acts like a DNA polymerase in the presence of dNTPs. A double helix that can be loaded by treatment with an appropriate enzyme and then bound to the vector Shape DNA Can be achieved. The large vector generated in this way will therefore enclose the second ribozyme. Ensuring that the high copy number single-stranded DNA encoding it is integrated into the vector You can choose to.   In yet another aspect, the invention produces a vector as described above, the vector comprising Expresses RNA and cleaves with the first ribozyme to release the second ribozyme It is characterized by a method of producing a ribozyme by   In a preferred embodiment, three different ribozyme models are used as the cis-cleaving ribozyme. The chief is used. Hammerhead, hairpin, and hepatitis delta virus (HDV ) Is a small, well-defined ribozyme motif that undergoes rapid self-cleavage in vitro. Sequence (Symons, 1992Annu.Rev.Biochem. 61, 641). Three ribozymes Although there are structural and functional differences between motifs, they are efficiently self-generated in vivo. Act on your own. All three ribozyme motifs have 8 deletions in the 3'flanking sequence. 7-95% self-acting to completion. In vitro, the self-acting structure described in this invention is , Taira et al., 1990the above; And Altschuler et al., 1992Gene By 122,85 Are clearly more active than those reported in. The present invention is a cis-cleaving ribozyme. In vivo, by ensuring the deletion of secondary structures that protect It makes it possible to efficiently cut an RNA molecule at a specific site.Separation of therapeutic ribozymes   The preferred method of separating therapeutic ribozymes is by chromatographic techniques. This The HPLC purification method according to Draper et al., PCT WO 93/23509, cited here for reference, and And reverse HPLC purification methods can be used. Alternatively, a complementary oligonucleotide If attached to cellulose or other chromatography column, for example, By hybridizing to the region between the arming arm and the enzymatic RNA, a therapeutic first The two ribozymes can be separated. This hybridization results in the desired enzyme RN Selection for short flanking sequences without A and for released first ribozyme Is done. Hybridization is a chaotropic agent to prevent nuclease degradation. Can be achieved in the presence of. The oligonucleotides on the matrix are It may be modified, for example with 2'-O-methyl RNA, to minimize the activity of the rease. . column Such modification of the oligonucleotides attached to the matrix allows Multiple use of the column is possible with the minimum decomposition of gogo. Many such modification methods Are known in the art, but desirable are chemically stable non-reducing modifications. For example, phosphorothioate modifications may be used.   The expressed ribozyme RNA was lysed followed by separation of guanidine isothiocyanate. It can be isolated from bacteria or eukaryotes by conventional procedures such as.   The currently known self-cleavage site of Tetrahymena is used for the alternative vector of the present invention. Can be. If desired, the full length Tetrahymena sequence may be used, or shorter You can use a different array. Reduced extra sequences at the self-cleavage site at the 5'cleavage end For this reason, the hairpins normally present on the Tetrahymena ribozyme are the secondary therapeutic ribozymes. It is desirable to include the 3'sequence of murine and its complement. That is, the first release ribozyme Encoding DNA is provided in two parts and encodes the desired second ribozyme. It is separated by the DNA to be read. For example, the therapeutic second ribozyme recognition sequence is CGGACGA If / CGAGGA, then CGAGGA will recognize that it is recognized by the Tetrahymena ribozyme. It is given to the loop of the self-cleavage site so as to form a structure. The stem loop is The restriction endonuclease into which the desired second ribozyme-encoding DNA is placed. An ase site may be included.   If desired, the vector may be found in Lechner, PCT WO92, incorporated herein by reference. Secondary ribozyme for use in treatment protocols using the system described in / 13070 May allow for timely expression of, as well as appropriate block of cell or gene function. Therefore , A vector is a promoter that appropriately expresses enzymatically active RNA only in the presence of RNA. Data or another molecule that represents the presence of an unwanted organism or condition. At that time , The enzymatically active RNA described above, as described by Lechner (Id.), It kills or injures the cells that are there, or produces the desired protein. It acts to reduce the expression of the product.   Many suitable RNA vectors may also be used in the present invention. The vector includes plants Plant viruses and RNA genomes, including roids, single-stranded or double-stranded RNA genomes Included animal viruses, such as picornavirus, myxovirus, paramic There are soviruses, hepatitis A virus, reoviruses and retroviruses. Quote Done Often, the use of these viral vectors has also led to tissue identification of ribozymes. It will be a sting.Example 21: Design of a self-acting cassette   In a preferred embodiment, Applicants have determined that three different ribozyme motifs Hammerheads, hairpins and hepatitis delta virus ribozymes in vitro and Their ability to process the ends of in vivo transcripts by comparing in vivo cis-cleaving activity Was tested. However, ribozyme-containing transcripts are not available for direct comparison between the three. It is important to design to be as similar as possible. For this, the ribozyme cassette All of them are identical transductants immediately followed by one of the three cis-acting ribozymes. Contains hammerhead ribozyme (Figure 23-25). For simplicity, the applicant We call each cassette an abbreviation that represents only the downstream cis-cleaving ribozyme. . Therefore, HH is a cis-cleaving ribozyme containing a hammerhead ribozyme. HP and HDV mean hairpin and hepatitis delta virus cis-, respectively. Refers to the cassette containing the truncated ribozyme. General design of ribozymes, and The specific differences between the cassettes are outlined below.   The sequence predicted to form a stable stem-loop structure is the 5'end of all transcripts. include. The hairpin stem is a stable tetraloop (Antao et al., 1991).Nucle ic Acids Res . 19, 5901), T7 RNA polymerase initiation sequence (Milligan  & Uhlenbeck, 1989Methods Enzymol. 180, 51) and its complement. T7 start By incorporating the sequence into a stem-loop structure, Applicants are able to trans-act Unproductive base-pairing interactions with ribozymes or with cis-acting ribozymes I expected to avoid it. The presence of hairpins at the ends of the transcript also results in in vivo transcription. It may contribute to the stability of the product. These are non-limiting examples. Those skilled in the art Combination of various well-known promoters, initiator sequences and stem-loop structures It will be appreciated that other aspects can easily be devised using.   The trans-acting ribozyme used in this study is based on the site B (5 '... CUGGACUC↓ GACC Target UUC ... 3 '). Ribozyme 5'binding arm, 5'-GAAGGUC-3 ', and ribozyme Zyme's nucleus, 5'-CUGAUGAGGCCGAAAGGCCGAA-3 ', is invariant in all cases . In addition, all transcripts were also found between the 5'stem loop and the first nucleotide of the ribozyme. single Contains one nucleotide. Linker nucleotides are identical nucleotides lacking the 5'hairpin. Required to obtain the same in vitro activity as measured by Bozyme. Three shi Sub-cleaving ribozymes have different requirements at the cleavage site, so 3'of processed transcripts Some differences at the ends were unavoidable. However, trans- and cis-acting ribozymes The ligation between the immunozymes is 3'of the trans-cleaving ribozyme once cis-cleavage occurs. Designed to leave minimal foreign sequences at the ends. Only the differences between the structures of the ribozyme It resides in the 3'binding arm, where it contains 6 or 7 nucleotides complementary to the target sequence. Otide, 5'-ACUCCA (+/- G) -3 'is present, and 2 to 5 extracts after treatment La nucleotide remains.   The cis-cleaving hammerhead ribozyme used in the HH cassette is Grosshans and Based on the design of Cech, 1991 (supra). As shown in Figure 23, trans-action The 3'binding arm of the ribozyme is the cis-cleaving ribozyme required to form stem I. Included in the base pairing interactions of the The two extra nucleotides, UC, and 3 ' Included at the end of the binding arm, self-acting followed by the 3'end of the trans-acting ribozyme. A self-acting hammerhead ribozyme site at the end (Ruffner et al., 1990 (supra) Was formed.   The hairpin ribozyme portion of the HP self-acting structure is based on minimal wild-type sequence (Ham pel & Tritz, 1989 (above)). Tetraloop at the end of helix 1 (3 ' The side) acts to join the two parts and thus self-action follows the release tran It leaves 5 minimal nucleotides at the end of the non-acting ribozyme. Two variants of HP , HP (GU) and HP (GC) were designed. HP (GU) is the G ・ U fluctuation base in Helix 2. Composed of pairs (A₅₂G substitution;Fig. 24). Some instability of this helix 2 is due to the product Attempts to improve self-acting activity by promoting release and preventing reverse reactions (Berzal-Herranz et al., 1992Genes & Dev. 6,129; Chowrira et al ., 1993Biochemistry 32, 1088). The HP (GC) cassette is a strong Configured as a control for strong base-pairing interactions (U₇₇C and A₅₂G replacement ;Fig. 24). Another modification that interferes with the reverse ligation of the hairpin ribozyme is the wild-type sequence. By one base pair associated withFig. 24) Was shortened (Cho wrira & Burke, 1991Biochemistry 30, 8518).   The HDV ribozyme is used when the nucleotide 5'for the cleavage site is a pyrimidine. Efficiently self-acts, and when there is adenosine at that position, it is somewhat less effective. None of the other sequence requirements identified upstream of the cleavage site, but the stem-loop structure We observed some loss of activity when present within 2 nt of the cleavage site. HDV Self-acting structure (FIG.) Is, after self-action, only two nucleotidies at its 3'end. Was designed to generate a trans-acting hammerhead ribozyme. The HDV sequence used here is an anti-genomic sequence (Perrota & Been, 1992 (above)) Based on that of Been et al., 1992 (Biochemistry 31, 11843) In the case of ribozymes, the cis-cleavage activity of the ribozyme was It is improved by replacing X4 (FIG.).   To create a DNA insert encoding a self-acting ribozyme cassette, the partial Overlapping top-and bottom-strand oligonucleotides (60-90 nucleotides) 7 Promoters, trans-acting ribozymes, cis-cleaving ribozymes and clones Designed to contain the appropriate restriction site sequences that can be used forFigure 26). Annealed The single-stranded portion of the oligonucleotide^(R)Use (U.S. Biochemicals) Converted to double strand. Insert DNA was EcoR1 / Hindlll-diges using standard protocols ligated to ted puc 18 and transformed into E. coli strain DH5α (Maniatis et al. ., 1982 inMolecular Cloning Cold Spring Harbor Press). Same as positive clone Unisex was confirmed by sequencing a small scale plasmid formulation.   A relatively large scale plasmid DNA formulation that can be used as an in vitro transcription template and for processing QIAG except that incidental ethanol precipitation was included as a final step treatment. Created using protocols and columns from EN Inc. (Studio City, CA).Example 22: In vitro RNA treatment   The transcription reaction containing the linear plasmid template is essentially as described. (Milligan & Uhlenbeck, 1989 (above); Chowrira & Burke, 1991 (above)) . To generate a transcript labeled at the 5'end, use 10-20 μCi [γ^-32P] GTP, 200 μM A standard transcription reaction was performed in the presence of each NTP and 0.5 to 1 μg of linearized plasmid template. Was given. MgCl₂Was maintained at 10 mM above the concentration of total nucleotides.   To compare the ability of individual ribosome cassettes to be suitable for in vitro self-action, The structure was transcribed and allowed to self-act under the same conditions at 37 ° C. For these comparisons , Using the same amount of linearized DNA template with various ribozyme cassettes [γ^-32P] GTP Transcribed in the presence to create a transcript labeled at the 5'end. With this method (full length, Only processed transcripts and released trans-ribozymes are visible by autoradiography Was Mg in all reactions²⁺Indicates that cleavage is favored by all ribozyme cassettes. 10 mM above the concentration of nucleotides included. Transfer template is downstream To different restriction enzymes so that the self-actions with increasing length of Linearized at several positions by digestion with (Figure 26). The resulting transcript is at the 3'end 4-5 Non-ribozyme nucleotides (HindIII digested template), 220 nucleotides of downstream sequence It has either leotide (Ndel digested template) or 454 nucleotides (Rcal digested template).   Figure 27All four ribozyme cassettes are capable of self-acting and It produces an RNA product with a waiting size. 2 essential for hammerhead ribozyme activity Two nucleotides (Ruffner et al., 1990 (supra)) into the HH (mutant) nuclear sequence Be changed atFigure 23), So this transcript cannot self-act (Figure 27 ). This indicates that full-length RNA is present, but the released 5'RNA in HH (mutant) Proved by the deletion of Transribozyme ((Figure 27) Amount of And, especially in relation to the presence of downstream sequences, these It is shown that there is a difference in ribozyme capacity. HP (GC) for two HP structures With or without an extra downstream sequence is more likely than the HP (GU) ribozyme. It is clear that it is effective. In addition, HP (GU) activity is dependent on the presence of downstream sequences. Will decline dramatically more and more. The relatively strong G: C base pairs are probably due to the ability of the HP (GC) structure. Contributing, even when as few as 216 extra nucleotides are downstream Correctly (and / or more quickly) folded into the structure of production. HH ribozyme structure Is also very effective during self-acting, and HP (GU) structure is present even in the presence of downstream sequences. It is slightly better than the structure.   For the three ribozyme motifs, the presence of extra downstream sequences increases HDV efficiency. Seems to have the most effect on. When there is no extra sequence on the downstream side, HDV is extremely effective and self-acting to approximately the same level as HH and HP (GC) cassettes You You. However, in the presence of extra downstream sequences, the self-acting activity is (suboptimal) It seems to decrease almost as dramatically as the HP (GU) cassette.Example 23: Dynamics of self-action reaction   Hindlll digested template (250 ng) was used for standard transcription. Reaction mixture: 50 mM T ris.HCl pH 8.3; 1 mM ATP, GTP and UTP; 50 μM CTP; 40 μCi [α^-32P] CTP; 12  mM MgCl₂10 mM DTT. Transcription / self-action reaction is T7 RNA polymerase (15 U / μl) Started with the addition of. Aliquots of 5 μl were taken at regular time intervals and the reaction Add equal volume of 2x formamide loading buffer (95% formamide, 15 mM EDTA, & dye). It was then stopped and frozen on dry ice. Sample with 10% polyacrylamide ・ Dissolve in sequence gel, and use the obtained product as a PhosphorImager (Molecular Dynamic s, Sunnyvale, CA). Ribozyme self-cleavage rate Nonlinear least squares application (KaleidaGraph, Synergy Software, Reeding, PA) Met:             (Fraction non-cleavage transcription) = 1 / kt (1-e^-kt)   Where t is time and k is the unimolecular rate constant for cleavage (Long & Uhlenb eck, 1994Proc.Natl.Acad.Sci.USA 91, 6977).   The linear template is such that the transcript contains only 4-5 vector-derived nucleotides at the 3'end. It was prepared by digesting the plasmid with Hindlll (See Figure 23-25). For each structure HH is the most efficient at self-acting, by comparing the monomolecular rate constants (k) Is clear (Table 44). HH transcript is twice as fast as HDV and HP (GC) transcript Self-acting three times faster. HP (GU) RNA self-acts, but less than HP (GC) structure Both are 6 times slower. This means that the stability of helix 2 depends on the self of the hairpin ribozyme. Consistent with previous observations that are essential for action and trans-cleaving activity (Hampel et al., 1990 (the above); Chowrira & Burke, 1991 (the above)). This HH self-cleavage rate measured during transfer (1.2 min^-1) Are different stem I and stem Using HH with III, Long and Uhlenbeck 1994 (the above) And the rate measured by Similar. Transcriptional auto-action rates for HP and HDV have been previously reported. Not in. However, as transcribed here during transcription, HDV ribozyme self-made Use is significantly slower than when tested after separation from denaturing gels (Been et al., 1992). (the above)). This reduction is probably due to protocol differences as well as the HDV structure used here. 5'Hula It reflects the existence of a banking sequence.Example 24: Effect of downstream sequences on in vitro trans-cleavage   Including transribozymes with or without 3'flanking sequences Transcripts are related in their ability to cleave their target in trans Tested. To this end, the transcripts from the three templates were dissolved in a preliminary gel and HH-transferred. Both processed trans-acting ribozyme and full-length HH (mutant) from photoreactions The band corresponding to and the HDV transcript were separated. In all three transcripts, trans The sub-acting ribozyme moieties are identical except for their 3'terminal sequences. HH Tiger The non-acting ribozyme contains only an additional UC at its 3'end, while HH (mutant Body) and ΔHDV have 52 and 37 nucleotides at their 3'ends, respectively. . 622 nucleotides, the internally labeled target RNA, is a standard RNA under ribozyme excess conditions. Was incubated with the three ribozyme transcripts dissolved in the reaction buffer of.   To make an internally labeled substrate RNA for the trans-ribozyme cleavage reaction, 622 nt region (containing hammerhead site P), upstream of T7 RNA promoter amplification sequence It was synthesized using the primer placed on the side. The target RNA is [α^-32P] CTP (Chowrir a & Burke, 1991 (the above)) In the standard transfer buffer. The reaction The mixture was treated with 15 units of DNasel-free DNasel, followed by phenol followed by cleaving. Loloform: extracted with asoamyl alcohol (25: 1) and precipitated with isopropanol. And washed with 70% ethanol. Dry pellet with 20 μl DEPC-treated water. Resuspended and stored at -20 ° C.   Unlabeled ribozyme (1 μM) and internally labeled 622 nt substrate RNA (<10 nM) at 90 ° C-2 Standard cleavage buffer (50 mM T was added by heating for 10 min and slow cooling to 37 ° C for 10 min. ris.HCL pH 7.5 and 10 mM MgCl₂Denatured and restored separately in (containing). The reaction is ribozyme Starting by mixing the membrane with the substrate mixture, incubation was carried out at 37 ° C. 5 μl ants The coats are taken at regular time intervals and an equal volume of 2x formamide gel loading buffer is added. Quenched and frozen on dry ice. Sample with 5% polyacrylamide ・ Phosphorlmager^(R)(Molecular Dyna mics, Sunnyvale, CA) was used to quantitatively analyze the radioactivity image of the gel.   HH trans-acting ribozymes target RNA approximately 10 times faster than ΔHDV transcripts. Cleaves more than 20 times faster than HH (mutant) transcripts (Figure 28). HH (mutant ) Is an additional nucleotide at the 3'target binding arm of the trans-acting ribozyme. Form 7 base pairs with (Figure 23). This interaction leads to trans-acting ribozymes Must be disintegrated (at 6 kcal / mole consumption) to be used for target sequence binding . In contrast, the additional nucleotides at the ΔHDV terminus can be any nucleotide with trans-ribozyme. It was not designed to form strong alternative base pairings. Nevertheless, △ HD The V sequence is a 3'targeting target for trans-ribozymes with stability ranging from 1-2 kcal / mole. It is predicted to form multiple structures that include the mating arms. Therefore, △ HDV and HH The decrease in activation observed for the (mutant) structure is due to the prefolded structure. It is not inconsistent with the structure and it is either a ribozyme or a substrate or both. Flanking sequences reduce ribozyme catalytic efficiency through non-productive interactions with Emphasize the view that it can be reduced.Example 25: RNA self-action in vivo   The three structures (HH, HDV and HP (GC)) efficiently self-act in solution The effect of mammalian cellular environment on ribozyme self-action was examined next. One time In vivo ribozyme activity was investigated using a static expression system. This study consisted of cytoplasm A mouse cell line (OST7-1) that expresses T7 RNA polymerase was selected (Elroy-Ste in and Moss, 1990Proc.Natl.Acad.Sci.USA 87,6743). In these cells, T7 The plasmid containing the ribozyme cassette downstream of the promoter is It will be transcribed efficiently in quality (Elroy-Stein & Moss, 1990 (supra)).   A single mouse L9 fibroblast cell line (PST7-1; Elroy-Stein and Moss, 1990 (supra)) ~ 5 x 10 layers^Five6-well plates were grown at a cell / well rate. Cells with calcium phosphate The circular plasmid (5 μg / well) was transferred using the sium-DNA precipitation method (Maniatis et  a1., 1982 (above)). The cells are 4M guanadinium isothiocyanate, 25 mM Sodium phosphate (pH 7.0), 0.5% sarcosyl (Chomczynski and Sacchi, 1987Ana l.Biochem . 162, 156), and standard lysis buffer containing 50 mM EDTA pH 8.0 The solution (200 μl / well) was added and dissolved (4 hours post-transfection). Rye Zate once with water saturated phenol, followed by chloroform: isoamyl alcohol. Extracted once with (25: 1). Total cellular RNA was precipitated with an equal volume of isopropanol . RNA pellet resuspended in 0.2M ammonium acetate and reprecipitated with ethanol I let it. The pellet was then washed with 70% ethanol and resuspended in DEPC-treated water. did.   Purified cellular RNA (3 μg / reaction) was²⁺For 2 minutes, heat at 90 ° C for 2 minutes, then Add 5'end-labeled DNA primer by snap cooling on ice for at least 15 minutes. Was first denatured in the presence of-(100 pmol). This protocol uses its complementary RNA sequence Allows for efficient annealing of suitable primers for. The primer is 50 mM Tris.HCl pH 8.3; 10 mM DTT; 75 mM KCl; 1 mM MgCl₂1 mM including each dNTP Expanded with Superscript II reverse transcriptase (8 U / μl; BRL) in buffer . The extension reaction was performed at 42 ° C for 10 minutes. Reaction is packed with equal amount of 2x formamide gel It was terminated by adding a buffer solution and frozen on crushed dry ice. Sample is 10% poly It was dissolved in a krillamide sequence gel. The primer sequences are as follows: HH Primer, 5'-CTCCAGTTTCGAGCTTT-3 '; HDV primer, 5'-AAGTAGCCGAGGTCGG ACC-3 '; HP primer, 5'-ACCAGGTAATATACCACAAC-3'.   Figure 29As shown in, specific bands corresponding to the full-length RNA precursor and the 3'cleavage product are , Self-acting cassettes were detected in transfected cells. All three structures are transcriptionally In addition to being active, it appears to efficiently self-act in the cytoplasm of OST7-1 cells. You. In particular, the HH and HP (GC) structures self-act to more than 95%. OST7-1 Fine The overall range of self-acting in the cell is exactly similar to the range of self-acting in vitro. It seems that (Figure 29"In Vitro ＋ MgCl₂"vs." Cellular ").   Consistent with the results of in vitro self-action, HP (GU) cassettes were almost exclusively in OST7-1 cells. Self-acting up to 50%. As expected, contains the HH (mutant) cassette Full length without any detectable cleavage products due to the transfer of the A primer extension product corresponding to RNA was generated ((Fig. 29). Powerful by the latter result Suggests that the primer extension band corresponding to the 3'cleavage product It is not an artifact.   Applicants have found that RNA self-action is associated with RNA isolation and / or primer during cell lysis. -I was involved in the possibility that it might occur during the expansion test. Eliminate this possibility Two precautions have been taken to do so. First, 50 mM EDTA was included in the lysis buffer . EDTA is the Mg required for ribozyme activity²⁺And Ca²⁺Divalent metal ion such as Is a powerful chelating agent. Therefore, divalent metal ions are self-made following cell lysis. Not available for commercial RNA. The second preventive measure is the primer extension assay, Use primers designed to hybridize to essential regions of the zym. And are included. Binding of these primers results in a conformation that is essential for catalytic activity. The folding of the 3'cis-acting ribozyme will be prevented.   Auto-action may occur during RNA preparation or primer extension analysis Two experiments were performed to further eliminate potency. First experiment, cell lysis Then primer extension analysis on RNA precursors added to untransfected OST-7 lysate Is included. Therefore, the cleavage product can be generated only when self-action occurs at some point after dissolution. To be detected. Full-length RNA precursor is a free Mg required for autoreaction²⁺Eliminate Low concentration of Mg in an attempt²⁺(5 mM) and high concentration of NTP (12 mM in total). (Michel et al. 1992)Genes & Dev. 6, 1373). Full-length RNA precursor Gel-purified and known amount was added to untransfected OST-7 lysate. RNA for these Purified from zeto and at 37 ° C-1 hr in DEPC-treated water prior to standard primer extension analysis Incubated (Figure 29, In vitro "MgCl₂"Control). Detected in all cases The major RNA corresponds to the primer extension product of the full length RNA precursor. So Instead, if the purified RNA containing the full-length precursor is used for primer extension analysis, Prior to 10 mM MgCl₂ RNA detected by primer extension analysis if incubated in Most or all of theFigure 29, In vitro "MgCl₂"Control). These The results indicate that the standard RNA isolation and primer extension protocol used here was Even if the RNA in question is essentially self-reacting, it has a favorable ring for RNA self-reaction. It is shown that it does not bring a boundary.   In a second experiment demonstrating a lack of self-action during post-treatment, internal labeled RNA precursors were used. Created and added to the non-transfected OST-7 lysate as in the previous control. Internal standard The identified RNA precursor is used for RNA purification and primer extension (in the presence of unlabeled primer). The reaction was run and analyzed to determine the extent of self-action. In this analysis, A number of full length RNAs remained intact during all steps of RNA isolation and primer extension.   These two control experiments evaluated the protocol used, and tested HH, HDV and And HP (GC) cassette-catalyzed autoreactions occur in the cytoplasm of OST-7 cells. This is in support of the applicant's conclusion that the same is true.   The sequences in Figures 23-25 are intended as non-limiting examples. Those of ordinary skill in the art It will be appreciated that other aspects can be easily introduced if used.   In addition, one skilled in the art will, through the examples above, release ribonucleotides due to the secondary structure of mRNA. How to best design the vectors of this invention for efficient cleavage by zym It will be appreciated that the applicant has provided guidance on. Therefore, The particular structure is not limited to the invention. The structure has the structure described above. Computer-based folding algorithms, or by experience, It can be easily tested for construction. Moreover, the structure allows at least 80% ribozyme release can also be completed, which can be as described above or by known methods. Can be measured easily. That is, each of the secondary structures of RNA resulted in 20% ribozyme release. It does not decrease to the extent that it exceeds. IV. Ribozymes expressed by RNA polymerase III   Applicants have used a system based on RNA polymerase III (polIII). The production level of the foreign RNA used is such that the RNA is stable and the base pair is stable. Produced with 5'end and 3'region in RNA molecule forming intra-embryonic stem structure It was confirmed that it can be remarkably enhanced. This stem The structure consists of 3'nucleotides (at least 8 bases) in the same RNA molecule. And 5'terminal complementary nucleotide interaction by hydrogen bonding (Watson Click type or non-Watson Crick type).   Although the examples shown below relate to the type 2 pol III gene unit, a number of Other pol III promoter systems, such as tRNA (Hall et al., 1982 Cell 29, pp. 3-5), 5SRNA (Nielsen et al., 1993, Nuclei) Cook Acids Research 21: 3631-3636), adenovirus VA RNA (Faux and Schenck, 1980, Cell 22: 405-413) ), U6 snRNA (Gupta and Lady, 1990, Nucleic Reed) Zds Research Vol. 19, pp. 2073-2075), RNA of the fornix (Kickeffer et al., 19 1993, Journal of Biological Chemistry, Volume 268, 7863- 7873), telomerase RNA (Romelo and Blackburn, 1991). , Vol. 67, pp. 343-353).   The constructs described in this invention involve 5'and 3'termini in hairpin loops. Even those that accumulate RNA to significantly higher levels than other constructs It is possible. Using such a construct, the expression level of foreign RNA can be assessed in cells. It can be increased to 20,000 to 50,000 copies. this thing Decoy, treat such constructs and vectors encoding these constructs. For editing and use in antisense protocols, and for ribozyme production Keep it excellent. In addition, the molecule is capable of producing agonist or antagonist RNAs. (Affinity RNAs). Applicants generally Intramolecular interaction of the 5'end and the 3'region with base pairs achieves high RNA accumulation. Therefore, it should be a double-stranded structure.   Thus, in one preferred embodiment, the present invention provides tRNA sequences and A combination of chimeric RNA molecules (eg, tRNA-based molecules) containing the RNA of interest. Features a pol III promoter system (eg, type 2 system) used for synthesis And   The following describes the present invention using the type 2 polIII promoter and tRNA gene. Is illustrated. Specifically, in order to explain the invention in a broad sense, The RNA molecule is the A box and B box of the type 2 pol III promoter system. And at least 8 bases of the complementary 3'end or region of the same RNA molecule. It has a 5'end or region capable of forming base pairs with. This is also shown as an example Of. Those skilled in the art will appreciate that this is only an example and other pol III promoter systems System and techniques commonly known in the art to easily create other aspects. I understand.   The "terminus" ends with a 3'hydroxyl or 5'phosphate or 5'cap moiety. Means the terminal base of an RNA molecule. "Regions" are involved in base-pairing interactions Means a 3'or 5'base extension extending from the end of the base. This is not necessarily R It need not be adjacent to the end of NA. Applicants are more likely than any other end of the molecule At least one RNA molecule having a region of about 50 bases, preferably only 20 bases. Confirm that end base pairing provides useful molecules that can be expressed at high levels did.   The "3 'region" is divided between the complementary nucleotides at the 5'end of the same molecule. Means a 3'base extension extending from the terminus involved in the interaction that makes intra-base pairing . The 3'region can be designed to include the 3'end. Therefore, the 3'region Is> 0 nucleotides extending from the 3'end. For example, described in this invention (FIG. 40) In the S35 construct, the 3'region is ~ 43 nt from the 3'end. You. These examples are not meant to be limiting. Those of ordinary skill in the art are generally aware of It will be appreciated that other techniques can be readily created using the techniques described. In general, It is preferred to have a 3'region within 100 bases of the 3'end.   A "tRNA molecule" generally is derived from any approved tRNA gene. Type pol III-derived RNA molecule. Those skilled in the art will encode such molecules Is readily available, and the RNA molecule and / or the Modify one or more bases in the DNA encoding the motor system as desired It can be easily understood that it can be modified by Not always In general, such molecules are well known in the art (and examples are found in the literature). ) Includes A-box and B-box consisting of sequences. Such A and B boxes Cux has certain consensus sequences that are required for optimal transcription of pol III.   A “chimeric tRNA molecule” is an R containing a pol III promoter (type 2) region. Means NA molecule. For example, a chimeric tRNA molecule may interact with the 3'region of the molecule. A type 2 pol III promoter containing an intramolecular base pair structure formed between complementary 5'ends Box containing an exogenous RNA sequence at any intramolecular position that does not affect the activity of the box possible. That is, such an exogenous RNA is Move between the A and B boxes to a suitable position within the foreign RNA or elsewhere. A B-box, which may be effective for transcription of pol III . As one example, the RNA molecule is a type 2 polI within stem II of the ribozyme. It can be a hammerhead ribozyme with the B box of the II promoter. As a second example, the B box is in the stem IV region of the hairpin ribozyme. I obtain. Specific examples of such RNA molecules are shown below. Those of ordinary skill in the art Alternatively, other aspects can be readily created using techniques commonly known in the art. It can be understood.   A “RNA of interest” molecule is any molecule useful for therapeutic, diagnostic or other origin. By native RNA molecule. Such molecules include antisense RNA, decoy RN A, enzymatic RNA, therapeutic edited RNA and agonist and antagonist RNA.   “Antisense RNA” refers to other RNA (target RNA) means a non-enzymatic RNA molecule that binds to and modifies the activity of the target RNA (Eguchi et al., 1991, Annual Review of Biochemistry 6 0, 631-652). "Enzymatic RNA" means an RNA molecule with enzymatic activity (Chehe, 1988, Journal of American Medical Society 260, pp. 3030-3035). The enzyme nucleic acid (ribozyme) is , It acts by first binding to the target RNA. Such binding will result in the target RN Of the enzymatic nucleic acid held in close proximity to the enzymatic site of the molecule that acts to cleave A Caused by the target binding site. That is, the enzymatic nucleic acid must first recognize the target nucleic acid. When it binds to the target site by base pairing at Disconnect NA.   “Decoy RNA” is an RNA moiety that mimics the natural binding domain for a ligand. Means a child. Therefore, decoy RNA competes with the natural binding target for specific ligand binding. Combine. For example, over-expression of HIV transactivation response (TAR) RNA It acts as a decoy and can effectively bind to the HIV tat protein, which is It has been shown to prevent binding to TAR sequences encoded in RNA ( Suranger, 1990, Cell 63, 601-608). This is a concrete example Is shown. Those of ordinary skill in the art will appreciate that this is only an example and is generally known in the art. It is understood that the techniques can be used to easily create other aspects.   A "therapeutic editing RNA" is an RNA that can bind to a cellular target and mediate modification of a specific base. Means antisense RNA.   “Agonist RNA” binds to protein receptors with high affinity and Means an RNA molecule capable of causing the stimulation of   The “antagonist RNA” binds to cellular proteins and exerts its normal biological function. An RNA molecule that can prevent it from interfering with (eg, Tsai et al., 1992, Proc. Holdings of National Academy of Sciences US A. 89, pp. 8864-8868).   In another aspect, the invention provides a vector encoding the above RNA molecule, Cell containing such vector, method for producing desired RNA and production of this RNA Including the use of vectors in.   That is, the present invention provides a therapeutic RNA portion of interest and a 3'region of RNA. Caused by the base-pairing interaction between and complementary nucleotides at the 5'end It features transcribed, non-naturally occurring RNA that includes an intramolecular stem. Stem is preferred Or at least 8 base pairs and even more, eg 15 or 16 salts A base pair can be included.   In a preferred embodiment, the 5'end of the chimeric tRNA has its ≧ 8 nucleotides. Molecule of a primary tRNA molecule that is involved in the interaction that forms a base with the 3'region The chimeric tRNA contains the A and B boxes, and the The native sequence 3'is removed, thereby preventing endogenous RNA processing; The RNA molecule of interest is at the 3'end of the B box; the RNA molecule of interest is A And between the B box; the RNA molecule of interest comprises the B box; RNA molecules to be used are antisense RNA, decoy RNA, therapeutic RNA, yeast Selected from the group of elementary RNA and agonist and antagonist RNA; the molecule is RNA 5 Brought about by the interaction that makes base pairs between complementary 3'regions in the same RNA as the'end Has an intramolecular stem and contains at least 8 base pairs, and the 5'end is 3 'Can be base paired with at least 15 bases.   In the most preferred embodiment, the molecule is an RNA polymerase III-based prod Transcribed by a motor system, such as the type 2 pol III promoter system Of the type 2 pol III promoter separated by 0 to 300 bases It has A and B boxes.   In addition, as a related feature, the present invention provides an RNApol III promoter. The above RNA molecule having a part of the vector encoding RNA that functions as An encoding RNA or DNA vector; or a cell containing the vector; By introducing the molecule into a cell bearing the RNA molecule as described above, A method of supplying an RNA molecule of interest into a cell is characterized.   A sufficient amount of therapeutic RN to enable RNA-based gene therapy tools A must accumulate in the appropriate intracellular compartment of the treated cells Yes. The accumulation is due to the strength of the antiviral gene promoter and the antiviral RNA cells. It is a function of both internal stability. RNA polymerase II (polII) and R Both expression systems based on NA polymerase III (pol III) Has been used to express therapeutic RNAs in (server and Rossi , 1993, AIDS Research and Human Retroviruses, Volume 9 483-487; Yu et al., 1993, Proceedings of Nationala. Le Academy of Sciences USA 90 Volumes 6340-6344 page). However, expression cassettes based on pol III are antiviral for the following reasons: It was theoretically attractive for expression of SRNAs. polII is the cytoplasm Produces messenger RNAs that are exclusively present in polIII, while polIII It produces functional RNAs that are present in both the nucleus and cytoplasm. polII promoter Tend to be tissue-restricted, while the polIII gene contains tRNA and And other functional RNAs required for basic "home economic" functions in all cell types. Issue Therefore, the pol III promoter appears to be expressed in all tissue types. Looks like. Finally, pol III has a certain inheritance compared to the pol II gene. Transfer from child accumulation to a larger level.   The intracellular accumulation of therapeutic RNAs also depends on the gene transfer method used. An example For example, the retroviral vector currently used to obtain stable gene transfer. Randomly integrates into the genome of the target cell. This random embedding is Results in various transgene expression in large treated cell populations, including Therefore In order to maximize the effect, the transgene should be treated at all, regardless of the integration site. Must have the ability to express therapeutic amounts of antiviral RNA in cell populations I have to. pol III system   The following is a non-limiting example of the present invention. Human tRNA_i ^metHeredity A polIII-based genetic element derived from the offspring and called Δ3-5 (Fig. 33; Denney-Jones et al., 1984, supra) are suitable for the expression of antiviral RNAs. Adapted (Saranger et al., 1990, Molecular and Cellular). Biology 10: 6512-6523). This element is a stable gene transfer DC retrovirus vector for import (Suranger et al., 1990, Moleki). MULLER & CELLULAR BIOLOGY 10 vol. 6512-6523) And antisense RNAs and anti-HI against Moloney murine leukemia virus Used to express V decoy RNAs (Saranger et al., 1990, Molecular And Cellular Biology 10: 6512-6523; Salenja ー et al., 1990, Cell 63, 601-608; Salanger et al., 1991. , Journal of Birology, Vol. 65, pp. 6811-1816; Lee et al., 199. 2 years, The New Biologist 4 pages 66-74). Individuals in a large group Clonal lineage from normal cells, expressing similar amount of therapeutic RNA in the cells Was. A vector system that produces therapeutic levels of therapeutic RNA in all treated cells. Development represents a significant advance in RNA-based gene therapy modalities.   Applicants have used the Δ3-5 vector system to hammer in a human T cell line. Head (HHI) ribozyme (RNA with enzymatic activity) was tested for expression. These constructs are designated "Δ3-5 / HHI"; Figure 34). On average, revo Did Zyme accumulate less than 100 copies per cell in the large T cell population? Was. In an attempt to improve the expression level of the Δ3-5 chimera, Applicants have determined that the transcription rate A series of modified Δ3-5 gene units containing enhanced promoter elements to increase Constructed and inserted into the structural gene to improve the intracellular stability of the ribozyme transcript (Fig. 34). One such modified gene unit, designated S35, is the original Δ3-5 / Compared with the HHI vector system, 100-fold or more accumulation of ribozymes can be collected in large T cells. Brought to the party. Riboza in individual clonal lines from pooled T cell populations Im accumulation is less than that achieved by the original Δ3-5 / HHI type of this vector. It was over 100 times.   S35 gene units include, but are not limited to, ribozymes, antisense , For the expression of other therapeutic RNAs including decoys, therapeutic edits, agonists and antagonists Can be used. The application of S35 gene is limited to antiviral therapy But is also possible for other diseases in which therapeutic RNAs such as cans may be effective . S35 gene units include, but are not limited to, adeno-associated virus (AAV Carter, 1992, Current Opinion in Genetic Debe Retrospective, including other stable gene transfer systems such as Non-viral vector systems, as well as plasmid delivery and adenovirus Svector (Birkner, 1988, Biotechniques Vol. 6 618-12 It can also be used in the context of transition vector systems such as page 9).   As described above, in the S35 vector, the 3'region of RNA is usually a mature tRNA. A complementary nucleotide at the 5'end having a 5'precursor moiety that is cleaved during It encodes a truncated form of tRNA that forms a base pair. The ones that lead to the theory Although not, Applicants consider this feature to be important for the level of expression observed. That is, one of skill in the art will now construct similar RNA molecules with such high expression levels. It can be calculated. The following can make such vectors and tRNA molecules The following is an example of the method. Δ3-5 vector   A truncated human tRNA called Δ3-5_i ^metGene (Fig. 33; adenylation Jones et al., 1984, supra) using antisense RNAs and thereafter Promoting the expression of decoy RNAs (Saranger et al., 1990, supra) has recently been promoted. Was reported. Does the tRNA gene utilize the internal pol III promoter? Antisense and decoy RNA sequences are tRNA_i ^metAs a chimera containing sequences Expressed. The truncated tRNA gene is a Moloney murine leukemia virus vector. -Entered in the U3 area of the LTR (Suranger, 1990, ibid). Base pair structure   The combination of Δ3-5 vectors blocks both antisense and decoy RNA. Applicants have been able to address the expression of therapeutic ribozymes as they could be used for expression at the harmful level. Ribozyme coding sequence (referred to as "Δ3-5 / HHI") Cloned into this vector. However, it was stably transduced with this vector. Low ribozyme accumulation was observed in human T cell lines (Fig. 35). Ribozyme In an attempt to improve the accumulation of RNA, Applicants ribosome various RNA structural elements (FIG. 34). It was incorporated into one of the Zym chimeras (Δ3-5 / HHI).   For the attempt to protect the ends of the chimeric transcript from exonuclease degradation, 2 A seed strategy was used. One strategy is to add a stem-loop structure to the end of the transcript. It was inclusive. Two such constructs, a stem S3 containing a loop structure and S5 containing a stem / loop structure at both ends of the transcript Was cloned (FIG. 34). The second strategy is that the 5'end and 3'end sequences are stable. To modify the 3'terminal sequence so that a unique base pair stem can be formed. Was. Two such constructs, a 3'end with a 5'leader and a tRNA_i ^met S35 modified to hybridize with the acceptor stem of the domain , And S35, but with a greater increase in the ribozyme portion of the Δ3-5 chimera. S35 plus containing the structure of was prepared (FIG. 34). These stem loop structures The structure protects against interference by the catalytic activity of ribozymes in the structure and non-ribozyme sequences. It is also intended to isolate Such constructs have been cloned into production cell lines And stably transduced human MT2 (Harada et al., 1985, supra) and CEM (Nara and Fissinger, 1988, supra) established cell line ( Current Protocols in Molecular Biology, 1992, Usbel et al., New York, Wiley and Sons). RNA sequence The structures of S35 and S35 plus are shown in FIGS.   Figure 48 shows the general structure of the chimeric RNA molecule of the present invention. N is independent Indicates the presence or absence of bases that form a base pair or not. A and B boxes , As desired and illustrated in any known A and B box, or figure It can be a common array. The target nucleic acid to be expressed must be at any position on the molecule. But it is in the position adjacent to or between the A and B boxes Preferred (indicated by arrow). FIG. 49 shows that the RNA of interest provides intramolecular 3 '. An example of such a structure is shown. Specific examples of such constructs are shown in Figures 50 and 51. Show. Example 26: Cloning of a Δ3-5 ribozyme chimera   Oligonucleotides encoding S35 inserts that overlap by at least 15 nucleotides Designed Cleotide (5'GATCCCACTCTGCTGTTCTGTTTTT TGA 3'and 5'CGCGTCAAAAACAGAACAGCAGAGTG 3 '). Buffer with oligonucleotide containing 40 mM Tris HCl, pH 8 It was denatured by boiling for 5 minutes in the liquid. Quench the oligonucleotide with ice for 10-15 minutes And annealed.   The annealed oligonucleotide mixture was treated with 40 mM Tris HCl, pH 7. 5, 20 mM MgCl₂, 50 mM NaCl, 4 kinds of deoxyribonucleotides Enzyme Sycenease (trademark) in a buffer solution containing 0.5 mM and 10 mM DTT, respectively. ) (US Biochemicals). The reaction is Proceed for 30 minutes at 37 ° C. The reaction was stopped by heating at 70 ° C. for 15 minutes.   Appropriate restriction endonucleases (BamHI and MluI) for double-stranded DNA Digested with to create a terminal suitable for cloning Δ3-5.   Double-stranded DNA was inserted into 66 mM Tris HCl, pH 7.6, 6.6 mM MgC. l₂10 mM DTT, 0.066 μM ATP and 0.1 U / μl T4 DNA Room temperature (about 20 ℃) in a buffer solution containing ligase (US Biochemicals) Ligated to Δ3-5 vector DNA by incubating for 60 minutes at .   Transforming Escherichia coli bacterial strains capable of transformation into cells and DNA for 60 minutes on ice Was transformed with the recombinant vector DNA. Mixture at 37 ° C And heat shock treated for 1 minute. The reaction mixture was diluted with LB medium and the cells were incubated at 37 ° C. Collected for 60 minutes. Place cells on LB agar plates and incubate at 37 ° C for ~ 18 hours. I started.   Plasmid DNA was isolated from overnight cultures of recombinant clones by standard techniques (Ausbel et al., Current Protocols in Molecular Biology Wiley & Sons, New York, 1990).   The identity of the clones is determined by the Sequenase ™ DNA sequencing kit (Eu Bioplasms) to determine the plasmid DNA sequence. I accepted.   The resulting recombinant Δ3-5 vector contains the S35 sequence. Encrypt HHI The DNA to be converted into the Δ3-5 / S35 containing SacII and BamHI. Cloned into a vector. Example 27: Northern analysis   RNA was extracted from the transduced MT2 cells to determine the presence of the Δ3-5 chimeric transcript. Northern analysis (Current Protocols in Molecular Biology, 1992, edited by Ausbel et al., New York, Wiley and Sons) I searched. Northern analysis of RNA extracted from MT2 transductants showed appropriate size. It was shown that the Δ3-5 / ribozyme chimera of was expressed (FIGS. 35 and 36). Sa Moreover, these results revealed differences in the accumulation between the various constructs (Fig. 35, 36). The expression pattern seen from the Δ3-5 / HHI ribozyme chimera is Δ3 Similar to the other 12 ribozymes cloned into the -5 vector (not shown). No). In the MT2 cell line, the Δ3-5 / HHI ribozyme chimera, on average, Accumulated less than 100 copies per cell.   Addition of a stem loop to the 3'end of Δ3-5 / HHI resulted in No increase was led (S3 in Figures 35 and 36). Of the 5'and 3'stem loops The S5 construct containing both also did not lead to increased ribozyme levels (Fig. 35, 3). 6).   Interestingly, the expression of the S35 construct in MT2 cells was originally Δ3-5 /. It was about 100 times larger than the HHI vector transcript (Figs. 35, 36). this is , S35 transcripts may have increased stability. Example 28: Cleavage activity   To test whether the ribozyme transcribed in transduced cells contains cleavage activity For this purpose, the total RNA extract obtained from the transduced MT2T cells was digested with HHI cleavage sites. Incubated with labeled substrate containing (Figure 37). Other than S35 construct Total ribozyme activity was too low to be detected. However, ribozyme activity Could be detected with S35 transduced T cell RNA. Seen in S35 transduced MT2 RNA MT with different activities and different amounts of in vitro transcribed S5 ribozyme chimera In comparison with the activity seen with 2 RNA, 1-3 nM of S35 ribozyme is in S35 form. It was shown to be present in the transfected MT2 RNA. This activity level is Corresponds to the intracellular concentration of 5,000-15,000 ribozyme molecules. Example 29: Variation with clones   Variations in ribozyme expression levels between cells that make up the large population are associated with bulk S35 traits. Measured by making several clonal cell lines from the introduced CEM cell line (current ・ Protocols in Molecular Biology, 1992, Ausbel Et al., New York, Wiley and Sons), in individual clones. Bozyme expression and activity levels were measured (Figures 38 and 39). Individual black All of the clones were found to express active ribozyme. Detected in each clone Ribozyme activity correlates well with the relative amount of ribozyme observed in Northern analysis. Was. The constant ribozyme level between clones was about 100 per clone G cell. It ranged from 0 molecules to 11,000 molecules per cell of clone H (Fig. 38). Clone flatness calculated by averaging the ribozyme levels of the clones. The uniform accumulation was exactly equal to the level measured in the original large population. This is individual Suggest that the clones of C. are representative of the variations that were present in the large population.   The fact that all 14 clones expressed the ribozyme was due to the fact that It shows that the percentage of cells expressing the zym is very high. In addition, the clone The lowest expression level in is found in the dog cell population transduced with the original Δ3-5 vector It was 10 times more than what I had. Therefore, the S35 gene unit extracts large numbers of cells. , Gene transduction, and then reintroduction into the patient. It is effective. Example 30: Stability   Finally, a large amount of S35 transduction system resistant to G418 was used for long ribozyme expression. Propagated for 3 months (without G418) to see if it stabilized over time . This situation is due to the practice of clinics where large numbers of cells are transduced and then reintroduced into the patient and expanded. It mimics the situation. After 3 months, a modest 30% decrease in ribozyme expression was observed Was. This difference is probably due to different amounts of ribozyme expressed and different growth rates in culture. It may have been caused by cells which show a slight dominance in culture. However, Bozyme expression was at least clearly stable during this period. Example 31: Design and construction of TRZ tRNA chimera   A transcription unit designated TRZ containing the S35 factor is designed (FIG. 52). Purpose RNA (eg ribozyme) that inserts into the indicator region of the TRZtRNA chimera You can This construct may increase the stability of the RNA of interest . Without limitation, TRZ-A and TRZ-B are examples of TRZ.tRNA. It is.   53-54, a hammerhead ribozyme targeting site I (HH (ITRZ-A; FIG. 53) and hairpin ribozymes that also target site I (FIG. 53). HPITRZ-A; FIG. 54) was independently cloned into the indicator region of the TRZtRNA chimera. It has become The purified ribozyme transcript contains anti-RNA as well as total RNA ribozyme. Target RNAs such as sense, edited RNA for therapy, and decoy It retained the cleavage activity of the A chimera (eg, FIG. 55). Applicant has these TRZ It has been shown that effective expression of tRNA chimeras can be achieved in mammalian cells.   In addition to ribozyme, for purposes such as antisense, therapeutic editing RNA, and decoy RNA to be inserted into the indicator region of the TRZtRNA chimera for curing in mammalian cells. A therapeutic level of RNA expression can be achieved.   The sequences listed in Figures 40-47 and 50-54 are non-limiting examples as well. Of. One of ordinary skill in the art would use variations of the above example using techniques commonly known in the art. Differences, insertions and deletions), which are within the scope of this invention. Can understand. Example 32: Ribozyme expression in T cell lines   Ribozyme expression based on retrovirus or adeno-associated virus (AAV) Ribozyme expression in T cell lines stably transduced with the vector (FIG. 56). . The human T cell lines MT2 and CEM were tested for neomycin selection marker and pol. IIImet_iRibozyme expressed from a tRNA-inducible promoter (S35 / HHI) transduced with a retrovirus or AAV vector encoding . The cells stably transduced with the vector were treated with the neomycin antibiotic derivative G4. It was selectively grown in a medium containing 18 (0.7 mg / ml). In stable cell lines Ribozyme expression was analyzed by Northern analysis. The probe used to detect the ribozyme transcript. Robe is a person_iIt also cross-hybridized with the tRNA sequence. Smell in Figure 56 And S 35 / HHI RNA is M transduced with retrovirus or AAV vector Accumulated at a significant level in T2 and CEM.   These are non-limiting examples. Those of ordinary skill in the art are generally aware of Adenovirus vector (Figure 57), plasmid DNA using Other vectors such as vectors, alphavirus vectors and their other derivatives. It will be appreciated that the actors can be easily made and they are within the scope of this invention. Furthermore, the transcription unit uses pol II and / or pol III promoters And can be expressed individually or in multiples.   References cited here, as well as Draper's WO 93/23569, 94 / 02495, 94/06331, Suranger's WO 93/12657, Toms WO 93/04573 and Sullivan WO 94/04609, 93/11 253 describes, by reference, the usage of the vectors described herein. Include it here. In particular, these vectors contain antisense and decoy RNA components. Useful for offspring administration. Example 33: Linked ribozymes have catalytic activity   Of ribozymes made by the ligation method described in Draper WO93 / 23569 The ability to cleave the target RNA is either the corresponding substrate RNA (Figure 58) or long (622n t) Tested with RNA (Figures 59, 60 and 61).   The corresponding substrate RNA was chemically synthesized using this phase RNA synthesis technology (scalin JA et al., 1990, Nucleic Acids Research Vol. 18 5433-54. 41). Substitute the substrate RNA with [γ-³²P] ATP and polynucleotide kinase Rent Protocols in Molecular Biology, 1992, Au Svel et al., New York, Wiley and Sons) to label the 5'end. I knew it. The ribozyme reaction was performed under ribozyme excess conditions (k_cat/ K_M; Hell Schrac and Zech, 1990, Biochemistry 29, 10159- 10171). Briefly, ribozyme and substrate RNA were added to 50 mM Tris HC 1, pH 7.5, and 10 mM MgCl₂In a buffer solution containing They were denatured and reconstituted separately by rapid cooling on ice for 10 minutes. The cleavage reaction is ribo It was started by mixing the Zyme with the substrate at 37 ° C. 5 μl at regular time intervals of Remove the sample and set aside an equal volume of formamide gel loading buffer (current protocol Ruze in Molecular Biology, 1992, edited by Ausbel et al., New York, Wiley & Sons) to stop the reaction. Sample 2 Resolved on a 0% polyacrylamide urea gel. In FIG. 58, -ΔG is Free energy of binding calculated for base pairing interactions between bozymes and substrate RNA Rugie (Turner and Sugimoto, 1988, supra). RPIA is 6 It is an HH ribozyme having a / 6 bond. This ribozyme is a single ribozyme Chemically or as two fragments and then ligated into one Ribozyme. K for two ribozymes_cat/ K_MThe values were comparable.   622 nt long target sequence containing T7 RNA polymerase promoter upstream The template was PCR amplified from the DNA clone. Target RNA (HH ribozyme cleavage Sites B, C and D) from this PCR amplification template to the T7 RNA polymerase. Transcribed using ze. One of four ribonucleotide triphosphates during transcription of transcripts As [α-³²It was labeled by including P] CTP. After transfer at 37 ℃ for 2 hours , The transcription mixture is treated with DNase 1 to digest and remove the DNA template used for transcription did. RNA was precipitated with isopropanol and the pellet was diluted with 70% ethanol. It was washed twice to remove salts and nucleotides used in the transcription reaction. RNA is processed by DEPC It was resuspended in water and stored at 4 ° C. Ribozyme cleavage reaction is a ribozyme excess condition Went down [k_cat/ K_MHelshlac and Sech, 1990, supra]. Abbreviation In other words, 1000 nM ribozyme and 10 nM internal labeled target RNA were added to 50 mM Tris HCl, pH 75, and 10 mM MgCl₂2 to 90 ° C in the presence of Denatured separately by heating for minutes. Cool RNA to 37 ° C for 10-20 minutes I rejected it and restored it. The cleavage reaction involves mixing the ribozyme with the target RNA at 37 ° C. Started by. Remove 5 μl of sample at regular time intervals and set equal volume of stop buffer The liquid was added to stop the reaction. The sample was resolved on a sequencing gel. Example 34: Hammerhead ribozyme with ≧ 2 base pair stem II is catalytically active Have   In order to reduce the cost of RNA chemical synthesis, Applicants have found that a typical hammerhead The length of the stem II region of the ribozyme (≧ 4 bp stem II) was changed to HH ribozyme. I was interested in whether it could be shortened without reducing the catalytic effect of. Stem II length Were systematically shortened one base pair at a time. Also 3 and 2 base pair stem II HH ribozyme chemically synthesized using solid-phase RNA phosphoramidite technology (Scalinge et al., 1990, supra).   The corresponding and long substrate RNAs were synthesized and the ribozyme assay was performed as described in Example 33. So went. In Figures 62, 63 and 64, the data is for hammerhead reels. It is shown that shortening of Bozyme stem II does not significantly change the catalytic effect. Applicant's In my opinion, a hammerhead ribozyme with a ≧ 2 base pair stem II region is catalytically active. Have sex. Example 35 Synthesis of hairpin ribozyme having catalytic activity   R with the nucleotide base sequence shown in Figure 65 for both the 5'and 3'fragments The NA molecule was chemically synthesized. The 3'fragment is phosphorylated and is essentially as described in Example 37. It was ligated to the 5'fragment as listed. As is clear from FIG. 65, 3'and 5 ' The fragment is capable of hybridizing at helix 4 and co-expresses via the GAAA sequence. It was connected with a bond. When this structure hybridizes to the substrate, it becomes a ribozyme substrate. A complex structure is formed. Helix 4 is shown as 3 base pairs or 1 or 2 base pairs You can see and make it.   A 40 nM mixture of ligated ribozymes was added to 1-5 nM 5'terminal labeled corresponding substrate ( (Chemical synthesis by solid phase synthesis method using RNA phosphoramidite technology) and 50 mM Tri HCl, pH 7.5, 10 mM MgCl₂Incubate for various times in Showed that the substrate was efficiently cleaved (Fig. 66).   The target and ribozyme sequences shown in Figures 62 and 65 are non-limiting examples. It is shown. Those of skill in the art will use other sequences and techniques commonly known in the art. It can be understood that another mode can be easily created. V. Construction of hairpin ribozyme   Below, a new substrate was added to the ribozyme to form a base pair with the 5'region of another substrate nucleic acid. A new helix (ie, a sequence that can form a double-stranded region with another single-stranded nucleic acid) The improved trans-cleaved hairpin ribozyme is shown. This helix is shown in Figure 3. It is provided at the ribozyme 3'end behind the helix 3. In addition, at least 2 extra bases can be provided in helix 2 and correspond to helix 2 Is the substrate moiety directly linked to the 5'portion that can hydrogen bond to the 3'end of the hairpin? , Or may have a linker of at least one base. Trans-cleavage ribozyme Cleaves in trans another RNA molecule that is not covalently bound to the ribozyme itself Means that. That is, ribozymes can act on themselves in intramolecular cleavage reactions. I can not do such a thing.   "Base pairs" are conventional Watson Crick or other non-conventional (eg Hoog) Nucleic acid that can form hydrogen bonds with other RNA sequences by means.   Length of helix 2 of the hairpin ribozyme (which may have helix 5) Increase brings several advantages. This includes the ribozyme The stability of the target complex is included. In addition, an increase in the recognition sequence of hairpin ribozyme Improves the specificity of the ribozyme. This is also due to the adjacent secondary structure Allows targeting of potential hairpin ribozyme sites that would otherwise be impossible.   Length of helix 2 of the hairpin ribozyme (which may have helix 5) Increases the ribozyme-catalyzed trans-ligation reaction. Ordinary heparin rebosai Trans-ligation reaction catalyzed by a membrane (having a 4 bp helix 2) is extremely effective (Komatsu et al., 1993, Nucleic Acids Research, Vol. 1 1 P. 85). This is due to the weak base pairing interaction between the substrate RNA and the ribozyme. Can be Increasing the length of helix 2 (which may have helix 5) Results in a several-fold increase in ligation rate (in vitro and in vivo).   The experimental results show that the H2 long-chain activity was not significantly decreased without significantly reducing the activity of heparin ribozyme. Suggest that the length can be 6 bp. The change in arm length of H2 is sequence-dependent It doesn't seem to. HP ribozymes with 6 bp H2 were labeled with 5 different target RNs. When designed against A, all five ribozymes are effective against their homologous target RNA. It was severely cut. Furthermore, two of these ribozymes express genes in mammalian cells. (Eg TNF-α) could be inhibited. The results of this experiment are shown below.   HP ribozymes with 7 and 8 bp H2 cleave target RNA sequence-specifically. Although it can be cleaved, the rate of the cleavage reaction is the HP ribozyme with 6 bp H2. Slower than medium. Example 36: 4 and 6 base pair H2   67-72, HP ribozyme was synthesized as above and tested for activity. Was. Surprisingly, those with 6 base pairs in H2 have similar activity to those with 4 base pairs. there were. VI. Chemical modification Oligonucleotide having 5'-C-alkyl group   The introduction of an alkyl group at the 5'position of a nucleoside or nucleotide, etc. Introduce a new chiral center into the minute. FIG. 75 shows that D-allose 2 and L-talo. 1 shows the general structure of 5'-C-alkyl nucleotides belonging to the sucrose 3 family. Family name , Known sugars D-allose and L-talose (in FIG. 75, 2 and R of 3₁= CH_Three). Useful specific D-allose and L-talosene The cleotide derivative is shown in 29-32 of FIG. 76 and 58-61 of FIG. 77, respectively. Show.   This invention provides oligonuclides that are particularly useful for the enzymatic cleavage of RNA or single-stranded DNA. 5'-C in leotide and as an antisense oligonucleotide It relates to the use of alkyl nucleotides. As the terms used in this application, 5'-C-alkyl nucleotide-containing enzyme nucleic acids include, but are not limited to, A double-stranded stem, a single-stranded “catalytic core” sequence, a single-stranded loop or a single-stranded recognition sequence A catalytic nucleic acid molecule comprising a substituting 5'-C-alkyl nucleotide. this The molecule cleaves another RNA or DNA molecule in a nucleotide base sequence-specific manner ( Preferably, it can be repeatedly cut. Such catalytic nucleic acids are of interest Then there is the action of intramolecular cleavage. Such an enzyme molecule can convert almost all RNA The object can be targeted.   Also included in this invention is the presence in the enzyme nucleic acid or even in the antisense nucleotide. Possible 5'-C-alkyl nucleotides are included. Such nucleic acids are Positions that increase the stability of the sense or enzyme molecule and do not affect the activity of the molecule of interest It is useful because it can be used in. That is, the presence of a 5'-alkyl group indicates this modification May reduce the binding affinity of oligonucleotides containing Strong stability feeding the molecule is advantageous if it is not an essential base pairing region. Furthermore, decreased binding reduces enzyme activity, while increased stability is more important than decreased activity. Reduce the need. For example, a 5'-C-alkyl containing molecule has 10% activity of the modified molecule. It is useful in the present invention if it has sex and is 10 times more stable in vivo. As well The same applies to antisense oligonucleotides with this modification. The invention also includes such nucleotides and oligonucleotides, examples of which are: (Shown in the figure) and a novel intermediate useful in the synthesis thereof and a method for synthesizing the same.   That is, in one aspect, the present invention provides an alkyl moiety at the 5'position of a sugar molecule. A 5'-C-alkyl nucleoside which is a nucleotide base having . As a related feature, the present invention also features 5'-C-alkyl nucleotides. In a preferred embodiment, the nucleotide is not uridine or thymidine It is characterized by. That is, this invention is preferably described in the literature discussed above. Containing nucleotides useful for the production of non-enzymatic nucleic acids or antisense molecules . In a preferred embodiment, the nucleoside or nucleotide sugar is talose or a sugar. It is optically pure as the sugar of allose.   Examples of various alkyl groups useful in this invention are shown in Figure 75 where R1 is any alkyl Show as one. These examples do not limit the invention. In particular , "Alkyl" groups are saturated aliphatic hydrocarbons, including straight chain, branched chain and cyclic chain chains. Includes a rukyll group. Preferably, the alkyl group has 1-12 carbon atoms. Sa Furthermore, it is preferably a lower alkyl group having 1 to 7 carbon atoms, more preferably 1-4. Al The kill group may be substituted or unsubstituted. When substituted, the substituent (s) are More preferably, hydroxyl, cyano, alkoxy, = O, = S, NO₂Or N (C H_Three)₂, Amino or SH. This term also refers to at least one carbon Containing an alkenyl group which is an unsaturated hydrocarbon containing a double bond, straight chain, branched chain and Includes cyclic groups. Preferably, the alkenyl group has 1-12 carbon atoms. More preferably, it is a lower alkenyl group having 1 to 7 carbon atoms, and further 1-4. The alkenyl group may be substituted or unsubstituted. If substituted, the substituent (group ) Is preferably hydroxyl, cyano, alkoxy, ═O, ═S, NO₂,Halo Gen, N (CH_Three)₂, Amino or SH. The word "alkyl" also means At least 1 Containing an alkynyl group having an unsaturated hydrocarbon containing 3 carbon-carbon triple bonds, Includes chain, branched and cyclic groups. Preferably, the alkynyl group is 1-12 carbons. It has elementary atoms. More preferably, it is a lower alkyl group having 1-7 carbon atoms, more preferably 1-4 carbon atoms. It is a quinyl group. The alkynyl group may be substituted or unsubstituted. Replaced In this case, the substituent (s) are preferably hydroxyl, cyano, alkoxy, = O, = S, NO₂Or N (CH_Three)₂, Amino or SH.   Such alkyl groups also include aryl, alkylaryl, carbocyclic aryl. , Heterocyclic aryl, amide and ester groups can be included. "Aryl" The group has at least one ring having a conjugated π-electron system, carbocyclic aryl, heterocyclic Aromatic groups, including cyclic aryl and biaryl groups, all of which are optional. May be replaced. Preferred substituents on the allyl group are halogen and trihalogen. Chill, hydroxyl, SH, OH, cyano, alkoxy, alkyl, alkenyl , Alkynyl and amino groups. An “alkylaryl” group refers to It is an alkyl group (described above) covalently bonded to a reel group. Carbocyclic aryl groups are All the ring atoms of the aromatic ring are carbon atoms. Carbon atoms optionally substituted May be. Heterocyclic aryl groups have 1-3 heteroatoms as ring atoms in the aromatic ring. A group having and the remainder of the ring atoms are carbon atoms. Suitable heteroatoms include acids Includes elemental, sulfur and nitrogen, which are furanyl, thienyl, pyridyl, pyrrolyl , N-lower alkylpyrrolo, pyrimidyl, pyrazinyl, imidazolyl and the like, All of these may be optionally substituted. "Amide" is -C (O)- NH-R, where R is alkyl, aryl, alkylaryl or hydrogen. It is. "Ester" is -C (O) -OR, where R is alkyl, ari. , Alkylaryl or hydrogen.   In another aspect, related to the above discussion, the present invention relates to one or more 5'-C. Oligonucleotides with alkyl nucleotides, eg 5'-C-alkyl Enzyme nucleic acid having nucleotides and nucleotidies having an alkyl group at the 5'position RNA or single-stranded D by forming an enzyme molecule having at least one A method for producing an enzymatic nucleic acid molecule having a high activity of cleaving NA molecule is featured. Another related In another aspect, the invention features a 5'-C-alkyl nucleotide triphosphate. I do. These triphosphoric acids are prepared by standard methods using the useful oligonucleosides of this invention. Used to form tide.   The 5'-C-alkyl derivative of the present invention has a high concentration in the oligonucleotide containing it. Gives good stability. These have reduced absolute reducing activity in in vitro assays, It gives high total activity in vivo. Below we show that such molecules are useful. The assay method for crab is shown. Those skilled in the art will be able to easily devise an equivalent assay. I understand.   In another aspect, the invention converts a protected allosugar to a protected tallosugar. Method. In this method, protected allosaccharides are treated with triphenylphosphine. And diethyl azodicarboxylate and p-nitrobenzoic acid and reversal generation conditions Contact underneath to obtain the protected Taro sugar. An example of such a condition is shown below, Those skilled in the art will recognize other similar conditions. Applicant has shown that such conversion is illustrated in the figure Found to allow easy synthesis of all types of nucleotide bases did.   Although the present invention is applicable to all oligonucleotides, the applicant It has been discovered that the modified molecules of E. coli are particularly useful for enzymatic RNA molecules. Ie below Shown are examples of such molecules. Those skilled in the art will be free of other such enzyme activities. It will be appreciated that equivalent methods can be used to produce the molecule. Specifically, Figure 1 shows A hammerhead showing the numbering of various nucleotides in the trimer head ribozyme. It is the numbering of bases for the do type. This is a prior art figure to the claims Or that the technology considered is prior art to the claims. Should not be marked. In FIG. 1, the hammer in the 5'to 3'direction of the catalyst core The preferred sequence of the head ribozyme is CGAAA [base pair with] CUGAN. It is GAG. In the present invention, a 5'-C-alkyne that maintains or enhances catalytic activity. Nuclease Resistance of Ru-Substituted Nucleotides and / or Hammerhead Ribozymes Describe the sex. Any nucleotide with any modified nucleotides shown in Figure 75 Can be replaced.   Shown below is a nucleic acid using a 5'-C-alkyl substituted phosphoramidite Non-limiting examples of synthetic methods and synthetic methods for amidites. Example 37: Containing 5'-C-alkyl nucleotides and other modified nucleotides Muhammerhead ribozyme synthesis   This synthesis method is based on N. Usman, Kay Kay Ogilvie, and M.W. Ng, Earl J. Sederglen, Journal of American Chemica Le Society, 1987, Vol. 109, pages 7845-7854 and S.E. Lee Scalling, Sea Franklin, N Usman, Nucleic Assi Research, 1990, Vol. 18, 5433-5441, ordinary R According to the synthetic method of NA, 5'terminal dimethoxytrityl, 3'terminal It utilizes general nucleic acid protection and condensation groups such as formamidite ( Compounds 26-29 and 56-59). These 5'-C-alkyl substituted phosphos Not only hammerhead ribozymes, but also hairpins and hepaticis Delta virus, group 1 or group 2 intron catalytic nucleic acid or antisense origin It can also be incorporated into gonucleotides. Therefore, they can be incorporated into any nucleic acid structure. Commonly used. Example 38: Methyl-2,3-O-isopropylidene-6-deoxy-β-D- Alofuranoside (4)   L-rhamnose (100 g, 0.55 mol), CuSO_Four(120g) and Bino H₂SO_FourA suspension of (4.0 ml) in 1.0 L of dry acetone was added at room temperature for 24 hours. Stir for a while and filter. Concentrated NH_FourOH (5 ml) was added to the filtrate and a new precipitate formed Was filtered. The residue was concentrated in vacuo and coevaporated with pyridine (2 x 300 ml) , Pyridine (500 ml), and cooled to 0 ° C. p-toluenesulfonyl A solution of chloride (107 g, 0.56 mmol) in dry DCE (500 ml), It took 0.5 hours to add dropwise. The reaction mixture was left at room temperature for 16 hours. ice water( 0.5 L) was added to stop the reaction, and the mixture was stirred for 0.5 hours, and then chloroform (0.7 L) was added. 5 ml). Organic layer H₂O (2 x 500 ml), 10% H₂SO_Four(2 X 300 ml), water (2 x 300 ml), saturated NaHCO_Three(2 x 300 ml) , Washed with brine (2 x 300 ml), MgSO_FourAnd evaporated to dryness. The rest The distillate (115 g) was dissolved in dry MeOH (1 L) and NaOMe (23.2 g, 0.42 mmol) and treated in MeOH. Allow the reaction mixture to stand at 20 ° C. for 16 hours. Place and dry CO₂It was neutralized with and evaporated to dryness. Suspend the residue in chloroform (750 ml) , Filter, concentrate to 100 ml and flash chromatograph in chloroform Purification by HPLC gave 45 g (37%) of compound 4. Example 39: Methyl-2,3-O-isopropylidene-5-0-t-butyldiph Phenylsilyl-6-deoxy-β-D-alofuranoside (5)   Methylfuranoside 4 (12.5 g, 62.2 mmol) and AgNO_Three(2 1.25 g, 125.0 mmol) in dry DMF (300 ml) was added to t-bu Tyldiphenylsilyl chloride (22.2 g, 81 mmol) was added to Ar in 0.5 It took time to drop. The reaction mixture was stirred at room temperature for 4 hours, CHCl_Three(200 ml), filtered and evaporated to dryness (40 ° C or less, using high vacuum oil pump) . CH residue₂Cl₂(300ml), MgSO4_FourAnd then evaporated to dryness did. CH residue₂Cl₂Purified by flash chromatography in 20.0 g (75%) of compound 5 was obtained. Example 40: Methyl-5-0-t-butyldiphenylsilyl-6-deoxy-β -D-alofuranoside (6)   CF methyl furanoside 5 (13.5 g, 30.6 mmol)_ThreeCOOH: di Oxane: H₂Dissolve in O / 2: 1: 1 (v / v / v, 200 ml) at 24 ° C Stir for 45 minutes. The reaction mixture was cooled to -10 ° C and concentrated NH_FourOH (140 ml ) Neutralize with CH₂Cl₂It was extracted with (500 ml). The organic layer is separated and saturated Na HCO_Three(2 × 75 ml), washed with brine (2 × 75 ml), MgSO 4_FourDry And evaporated to dryness. CH the product 6₂Cl₂With a gradient of 0-10% MeOH in Purified by flash chromatography. Yield 9.0 g (76%). Example 41: Methyl-2,3-di-O-benzoyl-5-0-t-butyldiphe Nylsilyl-6-deoxy-β-D-alofuranoside (7)   Methylfuranoside 6 (7.0 g, 17.5 mmol) was added to pyridine (2 x 100 ml) and co-evaporated and dissolved in pyridine (100 ml). Benzoyl chloride ( 5.4 g, 38.5 mmol) was added and the reaction mixture was left at room temperature for 16 hours. Dry EtOH (50 ml) was added and after 0.5 h the reaction mixture was evaporated to dryness. The rest CH to distillate₂Cl₂(300 ml), melted, saturated NaHCO_Three(2 x 75 ml) , Wash with brine (2 x 75 ml), MgSO_FourAnd evaporated to dryness. Product To CH₂Cl₂Purified by flash chromatography in 9.5 g (8 9%) of compound 7 was obtained. Example 42: 1-O-Acetyl-2,3-di-O-benzoyl-5-Ot-bu Tyldiphenylsilyl-6-deoxy-β-D-alofuranose (8)   Dibenzoate 7 (4.7 g, 7.7 mmol) in AcOH (10.0 ml) , Ac₂Dissolve in a mixture of O (20.0 ml) and EtOAc (30 ml), The reaction mixture was cooled to 0 ° C. 98% H₂SO_Four(0.15 ml) was added. reaction The mixture was kept at 0 ° C. for 16 hours, saturated NaHCO 3_Three1: 1 cold mixture of water and EtOAc (150 ml) poured into. After stirring vigorously for 0.5 hours, the organic layer is separated, Saturated NaHCO_Three(2 × 75 ml), washed with brine (2 × 75 ml) and washed with MgS O_FourDried in vacuo, evaporated to dryness and co-evaporated with toluene (2 x 50 ml). Generate CH₂Cl₂Flash chromatography using a gradient of O-5% MeOH in Purified by Yield 4.0 g (82% as a mixture of α and β isomers). Example 43: 1- (2 ', 3'-di-O-benzoyl-5'-0-t-butyldi Phenylsilyl-6'-deoxy-β-D-alofuranosyl) uracil (9)   Uracil (1.44 g, 11.5 mmol) was added to hexamethyldisilazane (1 (00ml) and pyridine (50ml) until completely dissolved ( The mixture was heated under reflux for 3 hours) and further 1 hour. The reaction mixture is cooled to room temperature and evaporated to dryness. It was solidified and coevaporated with toluene (2 x 50 ml). Acetate 8 (6 . 36 g, 10.0 mmol) dry CH_ThreeCN (100 ml) solution, then C F_ThreeSO_ThreeSiMe_Three(2.8 g, 12.6 mmol) was added. 2 reaction mixtures Keep at 4 ° C for 16 hours, concentrate to 3/1 volume and add 100 ml of CH₂Cl₂Diluted with Saturated NaHCO_Three(2 x 50 ml), extracted with saline (2 x 50 ml), and MgS O_FourAnd evaporated to dryness. CH product 9₂Cl₂Gradient of 0-5% MeOH in Was purified by flash chromatography. Yield 5.7g (80% ). Example 44: N^Four-Benzoyl-1- (2 ', 3'-di-O-benzoyl-5' -0-t-butyldiphenylsilyl-6'-deoxy-β-D-alofuranosyl ) Cytosine (10)   N^Four-Benzoylcytosine (1.84 g, 8.56 mmol) in hexamethy Suspend in a mixture of ludisilazane (100 ml) and pyridine (50 ml) to complete Heat to reflux until all dissolved (3 hours) and an additional 1 hour. Reaction mixture at room temperature Cooled to dryness, evaporated to dryness and co-evaporated with toluene (2 × 50 ml). To residue Acetate 8 (3.6 g, 5.6 mmol) in dry CH_ThreeCN (100 ml) dissolved Liquid, CF_ThreeSO_ThreeSiMe_Three(4.76 g, 21.4 mmol) was added. The reaction mixture was heated to reflux for 5 hours, cooled to room temperature, concentrated to 3/1 volume and CH.₂C l₂Diluted with (100 ml) and saturated NaHCO 3._Three(2 x 50 ml), saline (2 x 50 ml) and extracted with MgSO 4._FourAnd evaporated to dryness. CH₂Cl₂Medium 0-5 Purify by flash chromatography using a gradient of% MeOH, 1.8. g (55%) of compound 10 was obtained. Example 45: N⁶-Benzoyl-9- (2 ', 3'-di-O-benzoyl-5' -0-t-butyldiphenylsilyl-6'-deoxy-β-D-alofuranosyl ) Adenine (11)   N⁶-Benzoyl adenine (2.86 g, 11.86 mmol) in hexame Suspended in a mixture of tildisilazane (100 ml) and pyridine (50 ml), Heat to reflux until complete dissolution (7 hours) and an additional 1 hour. Chamber the reaction mixture Cooled to warm, evaporated to dryness and co-evaporated with toluene (2 x 50 ml). Residue Acetate 8 (3.6 g, 5.6 mmol) in dry CH_ThreeCN (100 ml) Solution, then CF_ThreeSO_ThreeSiMe_Three(6.59 g, 29.7 mmol) was added. . The reaction mixture was heated to reflux for 8 hours, cooled to room temperature, concentrated to 3/1 volume and CH.₂ Cl₂Diluted with (100 ml) and saturated NaHCO 3._Three(2 x 50 ml), saline (2 X 50 ml) and extract with MgSO_FourAnd evaporated to dryness. CH the product 11₂ Cl₂By flash chromatography using a gradient of 0-5% MeOH in Purified. Yield 2.7 g (60%). Example 46: N²-Isobutyryl-9- (2 ', 3'-di-O-benzoyl-5 '-0-t-butyldiphenylsilyl-6'-deoxy-β-D-alofuranosi Le) guanine (12)   N²-Isobutyrylguanine (1.47 g, 11.2 mmol), H Suspend in a mixture of ludisilazane (100 ml) and pyridine (50 ml) to complete Heat to reflux until all dissolved (6 hours) and an additional 1 hour. Reaction mixture at room temperature Cooled to dryness, evaporated to dryness and co-evaporated with toluene (2 × 50 ml). To residue Acetate 8 (3.4 g, 5.3 mmol) in dry CH_ThreeCN (100 ml) dissolved Liquid, then CF_ThreeSO_ThreeSiMe_Three(6.22 g, 28.0 mmol) was added. The reaction mixture was heated to reflux for 8 hours, cooled to room temperature, concentrated to 3/1 volume and CH.₂C l₂Diluted with (100 ml) and saturated NaHCO 3._Three(2 x 50 ml), saline (2 x 50 ml) and extracted with MgSO 4._FourAnd evaporated to dryness. CH product 12₂C l₂Purify by flash chromatography using a gradient of 0-2% MeOH in Made. Yield 2.1 g (54%). Example 47: N⁶-Benzoyl-9- (2 ', 3'-di-O-benzoyl-6' -Deoxy-β-D-alofuranosyl) adenine (15)   Nucleoside 11 (1.65 g, 2.0 mmol) in THF (50 ml) However, a 1M solution of TBAF in THF (4 ml) was added. The reaction mixture was brought to room temperature 4 Hold for time, evaporate to dryness and CH₂Cl₂With a gradient of 0-5% MeOH in Purified by flash chromatography, 1.0 g (85%) of compound 15 I got Example 48: N⁶-Benzoyl-9- (2 ', 3'-di-O-benzoyl-5' -0-dimethoxytrityl-6'-deoxy-β-D-alofuranosyl) adeni N (19)   Nucleoside 15 (0.55 g, 0.92 mmol) in dry CH₂Cl₂(50 ml). AgNO_Three(0.34 g, 2.0 mmol), dimethoxide Lithyl chloride (0.68 g, 2.0 mmol) and cincholidine (0.48 g) was added in Ar. The reaction mixture is stirred for 2 hours, CH₂Cl₂(100 ml ), Filtered, evaporated to dryness and co-evaporated with toluene (2 × 50 ml). . CH residue₂Cl₂(300ml), MgSO4_FourAnd then evaporated to dryness did. CH residue₂Cl₂Flash chromatograph using a gradient of 0-5% MeOH in Purification by topography gave 0.8 g (97%) of compound 19. Example 49: N⁶-Benzoyl-9- (5'-0-dimethoxytrityl-6'- De Oxy-β-D-alofuranosyl) adenine (23)   Nucleoside 19 (1.8 g, 2 mmol) was dissolved in dioxane (50 ml). Then cooled to 0 ° C. and 2M NaOH (50 ml) was added. The reaction mixture is brought to 0 ° C. 4 Hold for 5 minutes, neutralize with Dowex 50 (Pyr + type), filter, resin to MeO Wash with H (2 x 50 ml). The filtrate was then evaporated to dryness. CH₂Cl₂Medium 0 Purified by flash chromatography using a gradient of -10% MeOH, 1.1 g (80%) of 23 was obtained. Example 50: N⁶-Benzoyl-9- (5'-0-dimethoxytrityl-2'- O-t-butyldimethylsilyl-6'-deoxy-β-D-alofuranosyl) a Denin (27)   Nucleoside 23 (1.2 g, 1.8 mmol) in dry THF (50 ml) Dissolved, pyridine (0.50 g, 8 mmol) and AgNO_Three(0.4g, 2 3 mmol) was added. AgNO_ThreeWas dissolved (1.5 hours), and then t-butyldi Methylcytyl chloride (0.35 g, 2.3 mmol) was added and the reaction mixture was stirred. Stirred at warm for 16 hours. CH the reaction mixture₂Cl₂Diluted with (100 ml) and saturated NaHCO_ThreeFilter into (50 ml) and wash the organic layer with brine (2 x 50 ml). And MgSO_FourAnd evaporated to dryness. Product 27 is hexane: EtOAc / Purified by flash chromatography using a 7: 3 gradient. Yield: 0. 7 g (50%). Example 51: N⁶-Benzoyl-9- (5'-0-dimethoxytrityl-2'- O-t-butyldimethylsilyl-6'-deoxy-β-D-alofuranosyl) a Denine-3 '-(2-cyanoethyl-N, N-diisopropyl phosphoramidite G) (31)   S.A.Scaringe, Sea Franklin, N. Usman, Nukurai Qu Acids Research, 1990, Vol. 18, 5433-5441 27 using the standard method to obtain 73% yield of phosphitylate and phosphoramidite 31. Got at a rate. Example 52: Methyl-5-Op-nitrobenzoyl-2,3-O-isopropylate Ridene-6-deoxy-β-L-talofuranoside (5)   Methylfuranoside 4 (3.1 g, 142 mmol) was added to dry dioxane (2 00 ml), p-nitrobenzoic acid (10.0 g, 60 mmol) and Triphenylphosphine (15.74g, 60.0mmol) followed by DEAD (10.45 g, 60.0 mmol) was added. Allow the reaction mixture to stand at room temperature for 16 hours. After standing, EtOH (5 ml) was added and after 0.5 h the reaction mixture was evaporated to dryness. The rest CH to distillate₂Cl₂(300 ml), melted, saturated NaHCO_Three(2 x 75 ml) Washed with brine (2 × 75 ml), MgSO 4._FourAnd evaporated to dryness. Heki Purify by flash chromatography using a Sun: EtOAc / 9: 1 gradient. Prepared to obtain 4.1 g (78%) of compound 33. Then debenzoyl (NaOMe / MeOH) and silylation (see Preparation Example 5) gives L-talofuranoside 3 4 was obtained in the same manner as described above for the D-alloisomers 29-32. Was converted to phosphoramidite 58-61.   The alkyl-substituted nucleotides of this invention have antisense positions as described above. Can be used to form stable oligonucleotides for the enzymatic cleavage of This Oligonucleotides such as It can be formed enzymatically. Administration of such oligonucleotides is standard Method. See Sullivan et al., PCT WO94 / 02595.   A ribozyme containing a site O and a target RNA were synthesized as described above, deprotected, Purified. RNA cleavage assay was performed using 10 mM MgCl 2 as described above.₂In the presence of Performed at 37 ° C.   Applicants used A6, A9 as shown in FIG. 78 (HH-01 to HH-05). , A9 + G10, C11.1 and C11.1 + G10 at 5'-Me-L -Taronucleotides were replaced. HH-O1, 2, 4 and 5 have activities close to wild type. (FIG. 79). However, HH-03 showed low catalytic activity. Ribozai HH-01, 2, 3, 4 and 5 are also susceptible to degradation by human serum nucleases. I was very resistant to it.Oligonucleotide containing 2'-deoxy-2'-alkyl nucleotide   The present invention provides a 2'-deoxy-2'-alkyl nucleoside within an oligonucleotide. This oligonucleotide contains RNA or single-stranded DNA, and And particularly useful for enzymatic cleavage of antisense oligonucleotides. This application When used in, the term "2'-deoxy-2'-alkyl nucleoti "Containing enzymatic nucleic acid" means a double-stranded stem, single-stranded "catalytic core" sequence, single-stranded Or single-strand recognition sequence, but not limited to A catalytic nucleic acid molecule containing a 2'-deoxy-2'-alkyl nucleotide component is there. These molecules are individual RNA or DNA molecules that It is possible to cleave (preferably iteratively cleave) in a specific manner. This Such catalytic nucleic acids may also act to effect intramolecular cleavage if desired. It is possible. Such enzymatic molecules actually target either RNA transcript. It is possible to   Present in enzymatic nucleic acids, or even in antisense oligonucleotides Also within the scope of the invention are 2'-deoxy-2'-alkyl nucleotides which are capable of included. In contrast to the findings of De Mesmaeker et al. We have found that such nucleotides are useful, Leotide enhances the stability of antisense or enzymatic molecules, and Can be used in positions that do not affect the desired activity of the molecule Because there is. This means that the presence of a 2'-alkyl group will include this modification. While it may reduce the binding affinity of lygonucleotides, that part is Increased stability provided to the molecule when it is not within the base pairing region Is to be an advantage. On top of that, reduced binding increases enzyme activity. Increase stability, but less loss of activity May result in Thus, for example, 2'-deoxy-2 ' -If the alkyl-containing molecule has 10% of the activity of the unmodified molecule, modify it. Decorated molecules are 10 times more stable in vivo, which is why Within the invention, it has utility. Similar analysis results show such modifications It has also been obtained for an antisense oligonucleotide containing The present invention is further , Such nucleotides and oligonucleotides (examples of which are shown in the figures). New intermediates useful in the synthesis of Also concerns.   Accordingly, in one aspect, the invention provides a 2'-deoxy-2'-alkyl nucleotide. (This alkyl nucleotide has an alkyl group at the 2'position of the sugar molecule. ), And in a preferred embodiment the nucleotide is uridine. Kuku is characterized by something that is not thymidine. This means that the invention is discussed earlier. Produced enzymatic nucleic acid or antisense molecules not described by It is preferred to include all nucleotides useful in making.   Examples of various alkyl groups useful in the present invention areFIG. 81This figure is shown in Wherein the R group is alkyl. The term "alkyl" refers to "-OHas an “alkyl” group It does not contain an alkoxy group, in which case "alkyl" is specified as above and O is Is close to the 2'position of the sugar molecule.   In other aspects related to those discussed above, the invention comprises one or more 2'-deoxy-2'-alkyl nucleotide (2'-alkyl-uridine Is preferably not thymidine). Enzymatic nucleic acids having 2'-deoxy-2'alkyl nucleotides; and part 2 thereof An enzymatic molecule containing at least one nucleotide having an alkyl group at the 'position. By being formed, the activity of cleaving RNA or single-stranded DNA molecule is enhanced. A method for making an enzymatic nucleic acid molecule. In other related aspects The present invention provides a triphosphate ester of a 2'-deoxy-2'-alkyl nucleotide. Features. These triphosphates are converted into useful oligonucleotides of the present invention. It can be used in standard protocols to form.   The 2'-alkyl derivatives of the present invention are directed to oligonucleotides containing them. Increase stability. They reduce absolute activity in in vitro assays Occasionally, they will increase total activity in vitro. After this The assay is provided to determine the usefulness of such molecules. . Those skilled in the art will recognize that equivalent assays can be devised easily. There will be.   In another aspect, the invention has enzymatic activity at positions 5, 6, 8 shown in FIG. , 12 and 15.1 with ribonucleotides and if desired A and ribonucleotides substituted at other positions within the binding arm It features a hammerhead motif. (The term "core" Means the position between bases 3 and 14 of Figure 80, and the "binding arm" is 3'-end to base 15.1 and 5'-end to base 2 bases). Book Applicants have found that by using ribonucleotides at these five positions in the core, Assuming that nucleotides with motifs exist in other parts of the motif Have also found that a molecule with sufficient enzymatic activity is provided. Useful Ribonuk Other such combinations of Leotide are described by Usman et al. To (above) It is possible to make the determination in the manner described in more detail.   FIG. 80 shows the nucleotide numbers of hammerhead shark (hammerhead) motifs, In this figure, various nuclei within the hammerhead ribozyme are shown. Ochid numbering is done. This figure is subject to co-pending claims The technologies that are conventional or are discussed are those described in the claims. It should not be construed as a conventional technology. See FIG. 80. And the hammerhead shark (5) in the 5'- to 3'-direction of the catalytic core. d) The preferred sequence of ribozyme is CUGANGAG [base pair forming base] C It is GAAA. In the present invention, 2'-C-Where the use of alkyl-substituted nucleotides This nucleotide is desired, and this nucleotide is a hammerhead ribozyme. Maintains or enhances the catalytic activity and / or nuclease resistance of. 81 Any nucleotide having any of the motif nucleotides shown in Can be replaced, and although they are actually synthesized, they are mainly selected. 2'- having a substituted substituentO-The highest base structure consisting of Me nucleotides Maintain activity (Yang et al., Biochemistry 199). 2, 31, 5005-5009, and Paolella et al. , EM BOJ. 1992, 11, 1913-1919) and facilitates synthesis. (But this is not a limitation of the present invention).   The ribozymes from Figure 80 and Table 45 were synthesized and analyzed for catalytic activity and nucleotide Assayed for ase resistance. entry 8and17With the exception of Modified ribozyme retained at least 1/10 of the wild-type catalytic activity. table From 45, all 2'-modified ribozymes were stable in human serum (data published) ) And other liquids described below (Example 55, data non-public) Open) showed a very large and significant increase. Highest nuclease activity From the results, fetal bovine serum> human serum> human plasma> human joint fluid. Stability And the ratio β is calculated as a general measure of the effect of these 2'-substitutions on activity. (Table 45). This β-value depends on the overall stability of all modified ribozymes tested. And had a significant increase in activity (> 100 to> 1700 fold) . These increases in β are associated with significant longevity of these modified ribozymes in vivo. , Which results in a more pronounced biological effect. Should be done.   Also obtained by the more general substitution of the 2'-modified nucleotide from Figure 81. T of modified ribozyme_1/2Has occurred. However, these ribozymes The catalytic activity of the membrane showed a> 10-fold decrease.   In Figure 86 the compound37Is derivatized 2'-C-Alkyl phosphoramidite Then X is CH_Three, Or alkyl, or another group described above] Can be used as a general intermediate.   The following is 2'-C-The combination of nucleic acids with alkyl-substituted phosphoramidites The method of shaving, its method of synthesizing amidites, its enzymatic activity and nuclease resistance It is a non-limiting example showing these test methods.Example 53: 2'-deoxy-2'-alkyl nucleotides & other 2'-modifications Combination of hammerhead ribozymes containing decorated nucleotides Success   Commonly used synthetic methods are described in Usman, N .; Ogilvie, K .; K . Jiang, M .; -Y. Cedergren, R .; J. J. Am. Ch em. Soc. 1987, 109, 7845-7854, and Scarin. ge, S.H. A. : Franklyn, C.I. Usman, N .; Nucleic Acids Res. 1990, 18, 5433-5441, According to the usual methods for RNA synthesis, and for example at the 5'-end of dimethoxytri And general nucleic acid protection such as chill and 3'-terminal phosphoramidites. And a coupling group (compound10,12,17,22,31,18 ,26,32,36,and38). Other 2'-modified phosphoramidites are:3   &4Eckstein et al. WO 92/07065; and5, Kois et al. Nucleosides & Nucle otides 1993, 12, 1093-1109. average The stepwise coupling yield was about 98%. 2'-substituted phosphoramidite In the hammerhead ribozyme as shown in FIG. I took it in. However, these 2'-alkyl substituted phosphoramidites Are only incorporated into hammerhead ribozymes Not a group I or group of hepatitis delta virus with a hairpin structure II in the catalytic nucleic acid of the intron or in the antisense oligonucleotide May also be captured. They are therefore common in any nucleic acid structure. Is used for.Example 54: Ribozyme activity assay   Purified 5'-end labeled RNA substrate (15-25mer) and purified Both of the 5'-end labeled ribozymes (approximately 36-mer) were individually heated to 95 ° C. Heated, quenched in ice, and equilibrated at 37 ° C. Ribozai Stock solutions of 1 mM, 200 nM, 40 nM, or 80 nM The final substrate RNA concentration was about 1 nM. The total reaction volume was 50 mL. Assay buffer is 50 mM Tris-Cl, pH 7.5 and 10 mM M. gCl₂Met. The reaction is to mix the substrate and ribozyme solution at t = 0 Started by. Aliquots of 5 mL were added to 1, 5, 15, 30, 60, and Set aside at 120 minutes. Queti in formamide overlay buffer at each time point And run on a 15% denaturing polyacrylamide gel for analysis Was. Quantitative analysis is based on a phosphorimager (Mo It was carried out using a regular Dynamics company.Example 55: Stability Assay   500 pmol of gel purified 5'-end labeled ribozyme was precipitated in ethanol. And pelleted by centrifugation. 20 seconds at room temperature for each pellet 20 mL of appropriate solution (human serum, human plasma, human Resuspension in synovial fluid or fetal calf serum). These samples were aged at 37 ° C. Place it in the incubator and add 2 mL aliquots to 0, 15, 30, 45 Collected after incubation for 60, 120, 240, and 480 minutes Was. For each aliquot, 95% formamide and 0.5 x TBE (50 mM   Tris, 50 mM borate, 1 mM EDTA) is added to proceed further Quench nuclease activity and freeze each sample until gel loaded did. Ribozymes for electrophoresis in 20% acrylamide / 8M urea gel More size fractionation. The amount of native ribozyme at each time point was measured by the phosphor imager. -(Phosphorimager) (Molecular Dynamics) Quantified by scanning the band with each ribozyme in each liquid The half-life of is the percentage of native ribozyme versus incubation time. Was determined by plotting and then extrapolating from the graph.Example 56: 3 ', 5'-O- (tetraisopropyl-disiloxane-1,3- Diyl) -2'-O-phenoxythiocarbonyl-uridine (7)   3 ', 5'-O-(Tetraisopropyl-disiloxane-1,3-diyl)- Uridine,6, (15.1 g, 31 mmol, Nucleic Acld Che mistry, ed. Leroy Townsend, 1986, pp. 22 9-231) and dimethylaminopyridine (7.57 g) , 62 mmol) in a stirred solution of phenylchlorothiophene in 50 mL of acetonitrile. A solution of oformate (5.15 mL, 37.2 mmol) was added dropwise, The reaction was then stirred for 8 hours. TLC (EtOAc: hexane / 1: 1) Showed disappearance of starting material. The reaction mixture is evaporated and the residue is washed with chloroform. Le Dissolved in water, washed with water, then brine, and the organic layer is passed through sodium sulfate to remove the residue. Watered, filtered and evaporated to dryness. This residue was taken as EtOAc as eluent: By flash chromatography on silica gel with hexane / 2: 1. Purified to 16.44 g (85%)7I gotExample 57: 3 ', 5'-O- (tetraisopropyl-disiloxane-1,3- Diyl) -2'-C-allyl-uridine (8)   3 ', 5'-in anhydrous toluene under argonO-(Tetraisopropyl-di Siloxane-1,3-diyl) -2'-O-Phenoxythiocarbonyl-uridi The7(5 g, 8.03 mmol) and allyltributyltin (12.3 mL, Benzoyl peroxide (0.5 g) was added to a refluxing solution of 40.15 mmol over 1 hour. It was added by a method of adding in several times. Add the resulting mixture under argon It was refluxed for 7-8 hours. The reaction is then evaporated and the product8 On silica gel with EtOAc: hexane / 1: 3 as eluent. Purified by chromatography. The yield was 2.82 g (68.7%). Was.Example 58: 5'-O-dimethoxytrityl-2'-C-allyl-uridine (9 )   In 10 mL anhydrous tetrahydrofuran (THF)8(1.25 g, 2.45 solution of tetrabutylammonium fluoride in THF (3.7 mL). Treated with 1M solution at room temperature. The resulting mixture is evaporated and the residue is washed with silica gel. Lamb, wash with 1 L of chloroform, and remove the desired deprotected compound. Was eluted with chloroform: methanol / 9: 1. Combine the appropriate fractions and remove the solvent. It was evaporated and the residue was dried by coevaporation with anhydrous pyridine. No oily residue Redissolve in water pyridine, add dimethoxytrityl chloride (1.2 eq.), The reaction mixture was then left under anhydrous conditions overnight. Reaction quenching Solution (20 mL), evaporated, dissolved in chloroform and concentrated with 5% bicarbonate. It was washed with aqueous sodium solution and then with brine. Pass the organic layer through sodium sulfate Dehydrated and evaporated. EtOAc: hexane / 1: 1 with the residue as eluent Purified by flash chromatography on silica gel using 0.8. 5g (57%)9Was obtained as a white foam.Example 59: 5'-O-dimethoxytrityl-2'-C-allyl-uridine 3 '-(2-cyanoethyl N, N-diisopropylphosphoramidite) (10 )   5'-O-Dimethoxytrityl-2'-C-Allyl-uridine (0.64 g, 1.12 mmol) was dissolved in anhydrous dichloromethane under anhydrous argon.N,N -Add diisopropylethylamine (0.39 mL, 2.24 mmol) and add The solution was cooled with ice. 2-cyanoethylN,N-Diisopropylchloropho Sphoramidite (0.35 mL, 1.57 mmol) was added dropwise to the stirred reaction solution. And stirring was continued for 2 hours at room temperature. Then the reaction mixture Cooled on ice and quenched with 12 mL anhydrous methanol. 5 minutes After stirring, the mixture was concentrated under reduced pressure (40 ° C.), and 1% trie as eluent. Using a gradient of 10-60% EtOAc in a hexane mixture containing tilamine Purified by flash chromatography on silica gel. Yield: 0 . 78 g (90%), white foam.Example 60: 3 ', 5'-O- (tetraisopropyl-disiloxane-1,3- Diyl) -2'-C-allyl -N ⁴ - acetyl - cytidine (11)   Triethylamine (6.35 mL, 45.55 mmol) was added to 50 mL of anhydrous ethyl acetate. 1,2,4-triazole in cetonitrile (5.66 g, 81.99 mmol) And drop into a stirred ice-cooled mixture of phosphorus oxychloride (0.86 mL, 9.11 mmol). Added below. To the resulting suspension was added 3 ', 5 in 30 mL acetonitrile. ’-O-(Tetraisopropyl-disiloxane-1,3-diyl) -2'-C− A solution of allyluridine (2.32 g, 4.55 mmol) was added dropwise and The reaction mixture was then stirred for 4 hours at room temperature. The reaction mixture was concentrated under reduced pressure and reconstituted. The volume was reduced to a small volume (a state in which vacuum drying was not achieved). This residue in chloroform , And washed with water, saturated aqueous sodium bicarbonate, then brine. The organic layer was dried over sodium sulfate and the solvent removed under reduced pressure. can get The foam was dissolved in 50 mL 1,4-dioxane and 29% NH_FourOH Treated with aqueous solution overnight at room temperature. TLC (chloroform: methanol / 9: 1) A complete transition of the starting material was observed by. The solution was evaporated to dry pyridine Dehydrated by co-evaporation with and acetic anhydride in pyridine (0.52 mL, 5.4 Acetylation was performed overnight (6 mmol). The quenching of this reaction mixture Done with nol, evaporated and the residue dissolved in chloroform, sodium bicarbonate Then washed with brine. The organic layer was dried over sodium sulfate and evaporated to dryness. And flash on silica gel (3% MeOH in chloroform). Purified by chromatography. Yield: 2.3 g (90%), white foam.Example 61: 5'-O-dimethoxytrityl -2'-O-allyl -N ⁴ - acetyl Lucytidine   This compound is a uridine derivative9Obtained in 55% yield in a manner similar to.Example 62: 5'-O-dimethoxytrityl -2'-O-allyl -N ⁴ - acetyl Lu-cytidine 3 '-(2-cyanoethyl N, N-diisopropylphosphor Midite) (12)   2'-O-Dimethoxytrityl-2'-C-Allyl-N ⁴ -Acetyl cytidine (0.8 g, 1.31 mmol) was dissolved in anhydrous dichloromethane under argon .N,N-Add diisopropylethylamine (0.46 mL, 2.62 mmol) And the solution was cooled on ice. 2-cyanoethylN,N-Diisopropyl Add chlorophosphoramidite (0.38 mL, 1.7 mmol) to the stirred reaction solution. Was added below and stirring was continued for 2 hours at room temperature. Then this reaction mix The product was ice-cooled and quenched with 12 mL anhydrous methanol. 5 minutes After stirring for a period of time, the mixture was concentrated under reduced pressure (40 ° C.) and 2% toluene as eluent. Siri using a mixture of chloroform: ethanol / 98: 2 containing lyethylamine Purified by flash chromatography on kagel. Yield: 0.91g (85%), white foam.Example 63: 2'-deoxy-2'-methylene-uridine   2'-deoxy-2'-methylene-3 ', dissolved in THF (20 mL), 5'-O-(Tetraisopropyldisiloxane-1,3-diyl) -uridine1 4 (Hanske, F .; Madej, D .; Robins, MJ Te. trahedron 1984, 40, 125, and Matsuda, A .; ; Takenuki, K .; Tanaka, S .; Sasaki, T .; ; Ueda , T .; J. Med. Chem. 1991, 34, 812) (2.2 g, 4. 55 mmol) was treated with 1M TBAF in THF (10 mL) for 20 minutes, And concentrated under reduced pressure. The residue is triturated with petroleum ether and a silica gel column. Chromatography on. 2'-deoxy-2'-methylene-uridi CH (1.0 g, 3.3 mmol, 72.5%)₂Cl₂20% MeOH in Eluted at.Example 64: 5'-O-DMT-2'-deoxy-2'-methylene-uridine ( 15)   2'-deoxy-2'-methylene-uridine (0.91 g, 3.79 mmol) In pyridine (10 mL) and DMT- in pyridine (10 mL). A solution of Cl was added dropwise over 15 minutes. The resulting mixture at room temperature Stir for 12 h and quench the reaction by adding MeOH (2 mL). Was done. The mixture was concentrated under reduced pressure and the residue was CH.₂Cl₂In (100 mL) , And saturated NaHCO 3._ThreeWashed with water, then brine. Organic extract To MgSO_FourThrough a column, concentrated under reduced pressure, and EtOH: hex as eluent. Purify by passing through a silica gel column with Sun15(0.43g, 0.79m Mol, 22%).Example 65: 5'-O-DMT-2'-deoxy-2'-methylene-uridine 3 '-(2-cyanoethyl N, N-diisopropylphosphoramidite) (1 7)   Anhydrous CH₂Cl₂1- (2'-deoxy-2'-me dissolved in (15 mL) Chilen-5'-O-Dimethoxytrityl-β-D-ribofuranosyl) -uracil (0.43 g, 0.8 mmol) was placed in a round bottom flask under Ar. Diisopro Pyrethylamine (0.28 mL, 1.6 mmol) was added, followed by 2-sia. NoethylN,N-Diisopropylchlorophosphoramidite (0.25 mL, 1.12 mmol) was added dropwise. The reaction mixture was stirred for 2 hours at room temperature , And quenching with ethanol (1 mL). Mixing after 10 minutes The material was evaporated under reduced pressure to a syrup (40 ° C). This product (0.3 g , 0.4 mmol, 50%) with 1% triethylamine as eluent. Flush through silica gel with a 25-70% EtOAc gradient in Sun. Purified by Shu-column chromatography. R_f  0.42 (CH₂Cl₂: MeOH / 15: 1).Example 66: 2'-deoxy-2'-difluoromethylene-3 ', 5'-O- ( Tetraisopropyldisiloxane-1,3-diyl) -uridine   2'-keto-3 ', 5'-O-(Tetripropyldisiloxane-1,3-di Il) Uridine14(1.92 g, 12.6 mmol) and triphenylphos Dissolve fins (2.5 g, 9.25 mmol) in diglyme (20 mL) and And heated to a bath temperature of 160 ° C. Chlorodiflu in diglyme (50 mL) A warm solution of sodium oroacetate (60 ° C) was added over a period of about 1 hour. (By dropping from a balanced dropping funnel). The resulting mixture is stirred for an additional 2 hours and then And concentrated under reduced pressure. CH residue₂Cl₂, And dissolve on silica gel. It was subjected to mattography. 2'-deoxy-2'-difluoromethylene-3 ', 5'-O-(Tetraisopropyldisiloxane-1,3-diyl) -uridine ( 3.1 g, 5.9 mmol, 70%) was eluted with 25% hexane in EtOAc. I let you.Example 67: 2'-deoxy-2'-difluoromethylene-uridine   2'-deoxy-2'-methylene-3 ', dissolved in THF (20 mL), 5'-O-(Tetraisopropyldisiloxane-1,3-diyl) -uridine ( 3.1 g, 5.9 mmol) in 1M TBAF in THF (10 mL) for 20 minutes And then concentrated in vacuo. The residue was triturated with petroleum ether and Chromatography on a kagel. 2'-deoxy-2'-difluoro Methylene-uridine (1.1 g, 4.0 mmol, 68%) in CH₂Cl₂20 inside Elute with% MeOH.Example 68: 5'-O-DMT-2'-deoxy-2'-difluoromethylene- Uridine (16)   2'-deoxy-2'-difluoromethylene-uridine (1.1 g, 4.0 m Mol) in pyridine (10 mL) and D in pyridine (10 mL) A solution of MT-Cl (1.42 g, 4.18 mmol) was added dropwise over 15 minutes. Was added. The resulting mixture was stirred at room temperature for 12 hours, and MeOH (2 mL ) Was added to quench the reaction. The mixture was concentrated under reduced pressure and the residue CH residue₂Cl₂Dissolved in (100 mL) and saturated NaHCO 3._Three, Water, next Washed with brine. The organic extract was extracted with MgSO_FourDehydrated through a tube, concentrated under reduced pressure, and And pass through a silica gel column using 40% EtOAc: hexane as eluent. And then refine it to 5'-O-DMT-2'-deoxy-2'-difluoromethylene- Uridine16(1.05 g, 1.8 mmol, 45%) was obtained.Example 69: 5'-O-DMT-2'-deoxy-2'-difluoromethylene- Uridine 3 '-(2-cyanoethyl N, N-diisopropylphosphoramida Ito) (18)   Anhydrous CH₂Cl₂1- (2'-deoxy-2'-di dissolved in (15 mL) Fluoromethylene-5'-O-Dimethoxytrityl-β-D-ribofuranosyl) Uracil (0.577 g, 1 mmol) was placed in a round bottom flask under Ar. Jii Sopropylethylamine (0.36 mL, 2 mmol) was added, followed by the 2-si AnoethylN,N-Diisopropylchlorophosphoramidite (0.44 mL , 1.4 mmol) was added dropwise. The reaction mixture was stirred at room temperature for 2 hours, Then, quenching with ethanol (1 mL) was performed. After 10 minutes, this mixture The material was evaporated under reduced pressure to a syrup (40 ° C). This product (0.40 4 g, 0.52 mmol, 52%) containing 1% triethylamine as eluent. Silica gel using a 20-50% gradient of EtOH in hexane. Purified by lash chromatography. R_f  0.48 (CH₂Cl₂: M OH / 15: 1).Example 70: 2'-deoxy-2'-methylene-3 ', 5'-O- (tetraiso Propyldisiloxane-1,3-diyl) -4-N-acetyl-cytidine 20   Triethylamine (4.8 mL, 34 mmol) was added to acetonitrile (20 mL). ) POCl_Three(0.65 mL, 6.8 mmol) and 1,2,4-triazo Solution (2.1 g, 30.6 mmol) at 0 ° C. Acetonitrile 2'-deoxy-2'-methylene-3 ', 5'- in (20 mL)O-(Tetra Isopropyldisiloxane-1,3-diyl) uridine19(1.65g, 3 . 4 mmol) solution was added dropwise to the above reaction mixture and for 4 hours at room temperature. It was left to stir. The mixture was concentrated under reduced pressure, CH₂Cl₂(2 x 100 mL ), And 5% NaHCO 3_Three(1 × 100 mL). this The organic extract is Na₂SO_FourThrough water, concentrated under reduced pressure, and dioxane (10 mL). And dissolved in aqueous ammonia solution (20 mL). Stir this mixture for 12 hours And concentrated under reduced pressure. The residue was azeotroped with anhydrous pyridine (2 x 20 mL). Acetic anhydride (3 mL) was added to the residue dissolved in pyridine and stirred for 4 hours at room temperature. Stir and sat. NaHCO_ThreeQuenching with (5 mL) was performed. Reduce this mixture Pressure concentration, CH₂Cl₂Dissolve in (2 x 100 mL) and 5% NaHCO_Three (1 × 100 mL). The organic extract is Na₂SO_FourDehydrated through It was concentrated under pressure and the residue was chromatographed through silica gel. 2'- Deoxy-2'-methylene-3 ', 5'-O-(Tetraisopropyldisiloxa 1,3-diyl) -4-N-Acetyl-Cytidine20(1.3g, 2.5 (mMole, 73%) was eluted with 20% EtOAc in hexane.Example 71: 1- (2'-deoxy-2'-methylene 5'-O-dimethoxytri Cyl-β-D-ribofuranosyl) -4-N-acetyl-cytosine 21   2'-deoxy-2'-methylene-3 ', dissolved in THF (20 mL), 5'-O-(Tetraisopropyldisiloxane-1,3-diyl) -4-N-A Cetyl-cytidine20(1.3 g, 2.5 mmol) in THF (3 mL) Treated with 1M TBAF for 20 minutes and concentrated under reduced pressure. This residue is petroleum ether Triturated and chromatographed on a silica gel column. 2 ' -Deoxy-2'-methylene-4-N-acetyl-cytidine (0.56 g, 1. 99 mmol, 80%), CH₂Cl₂Elute with 10% MeOH in. 2'- Deoxy-2'-methylene-4-N-acetyl-cytidine (0.56g, 1.9 9 mmol) in pyridine (10 mL) and in pyridine (10 mL) Of DMT-Cl (0.81 g, 2.4 mmol) was added dropwise over 15 minutes. More added. The resulting mixture was stirred at room temperature for 12 hours, and MeOH (2 m L) was added to quench the reaction. The mixture was concentrated under reduced pressure and Then the residue is CH₂Cl₂Dissolved in (100 mL) and saturated NaHCO 3._Three(5 0 mL), water (50 mL), then brine (50 mL). Organic extract To MgSO_FourThrough a column, concentrated in vacuo, and eluted with EtOAc: hexane as eluent. Purified by passing through a silica gel column using Xanthan / 60: 4021Got (0.88 g, 1.5 mmol, 75%).Example 72: 1- (2'-deoxy-2'-methylene-5'-O-dimethoxide Lytyl-β-D-ribofuranosyl) -4-N-acetyl-cytosine 3 ′-(2 -Cyanoethyl-N, N-diisopropylphosphoramidite) (22)   Anhydrous CH₂Cl₂1- (2'-deoxy-2'-me dissolved in (10 mL) Chilen-5'-O-Dimethoxytrityl-β-D-ribofuranosyl) -4-N− Acetyl-cytosine21(0.88 g, 1.5 mmol) under Ar in a round bottom frass I put it inside. Add diisopropylethylamine (0.8 mL, 4.5 mmol) 2-cyanoethyl-N,N-Diisopropylchlorophosphoramy Dite (0.4 mL, 1.8 mmol) was added dropwise. This reaction mixture Stir for 2 hours at room temperature and quench with ethanol (1 mL). After 10 minutes, the mixture was concentrated under reduced pressure to a syrup (40 ° C). Living Adult22(0.82 g, 1.04 mmol, 69%) as an eluent containing 1% of Using 50-70% EtOAc in hexanes gradient containing lytylamine Purified by flash chromatography through silica gel. R_f  0.3 6 (CH₂Cl₂: MeOH / 20: 1).Example 73: 2'-deoxy-2'-difluoromethylene-3 ', 5'-O- ( Tetraisopropyldisiloxane-1,3-diyl) -4-N-acetyl-cyti Gin (24)   Et_ThreeN (6.9 mL, 50 mmol) was added to P in acetonitrile (20 mL). OCI_Three(0.94 mL, 10 mmol) and 1,2,4-triazole (3. 1 g, 45 mmol) was added at 0 ° C. In acetonitrile (20 mL) 2'-deoxy-2'-fluoromethylene-3 ', 5'-O-(Tetraisopro Pyrdisiloxane-1,3-diyl) uridine23([Described in Example 14 Solution of 2.6 g, 5 mmol) is added dropwise to the above reaction mixture, and It was left stirring at room temperature for 4 hours. The mixture was concentrated under reduced pressure, CH₂Cl₂(2 X 100 mL) and 5% NaHCO._ThreeWash with (1 x 100 mL) Clean The organic extract is Na₂SO_FourThrough water, concentrated under reduced pressure, and dioxane (2 0 mL) and aqueous ammonium solution (30 mL). This mixture is Stir for 2 hours and concentrate under reduced pressure. The residue was combined with anhydrous pyrimidine (2 x 20 mL) Azeotroped together. Acetic anhydride (5 mL) was added to the residue dissolved in pyridine. Addition, stirring at room temperature for 4 hours and saturated NaHCO 3._ThreeQuentin in (5 mL) Performed. The mixture was concentrated under reduced pressure, CH₂Cl₂Dissolved in (2 x 100 mL) And 5% NaHCO_Three(1 × 100 mL). N organic extract a₂SO_FourDried over silica gel, concentrated under reduced pressure, and the residue filtered through silica gel. It was subjected to mattography. 2'-deoxy-2'-difluoromethylene-3 ', 5'-O-(Tetraisopropyldisiloxane-1,3-diyl) -4-N-a Cetyl-cytidine24(2.2 g, 3.9 mmol, 78%) in hexane Elute with 20% EtOAc.Example 74: 1- (2'-deoxy-2'-difluoromethylene-5'-O-di Methoxytrityl-β-D-ribofuranosyl) -4-N-acetyl-cytosine ( 25)   2'-deoxy-2'-difluoromethyle dissolved in THF (20 mL) 3 ', 5'-O-(Tetraisopropyldisiloxane-1,3-diyl)- 4-N-Acetyl-Cytidine24(2.2 g, 3.9 mmol) was added to THF (3 (1 mL) in 1M TBAF for 20 minutes and concentrated in vacuo. The residue Triturate with petroleum ether and chromatograph on a silica gel column. I did. 2'-deoxy-2'-difluoromethylene-4-N-Acetyl-cytidi CH (0.89 g, 2.8 mmol, 72%)₂Cl₂10% MeOH in Eluted at. 2'-deoxy-2'-difluoromethylene-4-N-Acetyl- Cytidine (0.89 g, 2.8 mmol) was dissolved in pyridine (10 mL) and Then the solution of DMT-C1 (1.03 g, 3.1 mmol) in pyridine (10 mL). The solution was added dropwise over 15 minutes. The resulting mixture is stirred at room temperature for 12 hours. The reaction was quenched by stirring and adding MeOH (2 mL). this The mixture is concentrated under reduced pressure and the residue is CH₂Cl₂Dissolve in (100 mL) and then Saturated NaHCO_Three(50 mL), water (50 mL), then saline (50 mL) And washed. The organic extract was extracted with MgSO_FourDehydrated through, concentrated under reduced pressure, and eluted Pass through a silica gel column using EtOAc: hexane / 60: 40 as the liquid. Purify25Was obtained (1.2 g, 1.9 mmol, 68%).Example 75: 1- (2'-deoxy-2'-difluoromethylene-5'-O-di Methoxytrityl-β-D-ribofuranosyl) -4-N-acetylcytosine 3 '-(2-Cyanoethyl-N, N-diisopropylphosphoramidite) (26 )   Anhydrous CH₂Cl₂1- (2'-deoxy-2'-di dissolved in (10 mL) Fluoromethylene-5'-O-Dimethoxytrityl-β-D-ribofuranosyl) -4-N-Acetylcytosine25(0.6 g, 0.97 mmol) circled under Ar Place in bottom flask. Diisopropylethylamine (0.5 mL, 2.9 m model ) Is added, followed by 2-cyanoethylN,N-Diisopropylchlorophos Foramidite (0.4 mL, 1.8 mmol) was added dropwise. This reaction The mixture was stirred for 2 hours at room temperature and quenched with ethanol (1 mL). went. After 10 minutes, the mixture was concentrated under reduced pressure to a syrup (40 ° C). The product is a white foam26(0.52 g, 0.63 mmol, 65%) To 30-70% Et in hexane containing 1% tritylamine as eluent. By flash chromatography through silica gel with an OAc gradient. Refined. R_f0.48 (CH₂Cl₂: MeOH / 20: 1).Example 76: 2'-keto-3 ', 5'-O- (tetraisopropyldisiloxane -1,3-Diyl) -6-N- (4-t-butylbenzoyl) -adenosine (2 8)   Acetic anhydride (4.6 mL) was added to 3 ', 5'- in DMSO (37 mL).O-( Traisopropyldisiloxane-1,3-diyl) -6-N-(4-t-butyl Benzoyl) -adenosine (Brown, J .; Christodolou, C . Jones, S .; Modak, A .; Reese, C .; ; Sibanda , S .; Ubasana, A .; J. Chem. Soc. Perkin Tra ns. 1 1989, 1735) (6.2 g, 9.2 mmol), The resulting mixture was then stirred at room temperature for 24 hours. The mixture was concentrated under reduced pressure. The residue was dissolved in EtOAc and washed with water. Organic layer_FourThrough It was then dehydrated and concentrated under reduced pressure. The residue was purified on a silica gel column to give 2'-ketone. To-3 ', 5'-O-(Tetraisopropyldisiloxane-1,3-diyl)- 6-N− (4-t-Butylbenzoyl) -adenosine28(4.8 g, 7.2 (mMole, 78%).Example 77: 2'-deoxy-2'-methylene-3 ', 5'-O- (tetraiso Propyldisiloxane-1,3-diyl) -6-N- (4-t-butylbenzoi Le) -adenosine (29)   Secondary-butyllithium in hexane under argon pressure (11.2 mL, 14 . 6 mmol) was added to triiodide iodide in THF (25 mL) cooled to -78 ° C. Nylmethylphosphonium (7.07 g, 17.5 mmol) was added to a suspension. The homogeneous organic solution was warmed to -30 ° C and 2'- in THF (25 mL). Keto-3 ', 5'-O-(Tetraisopropyldisiloxane-1,3-diyl) -6N− (4-t-Butylbenzoyl) -adenosine28(4.87g, 7 . Solution (3 mmol) was transferred to this mixture under argon pressure. Warmed to room temperature After that, stirring was continued for 24 hours. THF is evaporated and CH₂Cl₂(250m L), add water (20 mL), and cool the solution with 2% HCl. Neutralized with the solution. Organic layer H₂O (20 mL), 5% NaHCO_ThreeAqueous solution (20 mL), H₂Wash with O until neutral, then with brine (10 mL). . After dehydration (Na₂SO_Four) And the solvent was evaporated under reduced pressure to obtain the crude product compound. Chromatography on a silica gel column. Light oil ether: EtOA Pure 2'-deoxy-2'-methylene-3 ', 5' by elution with c / 7: 3. −O-(Tetraisopropyldisiloxane-1,3-diyl) -6-N− (4-t -Butylbenzoyl) -adenosine29(3.86 g, 5.8 mmol, 79 %) Has been obtained.Example 78: 2'-deoxy-2'-methylene-6-N- (4-t-butylben Zoyl) -adenosine   2'-deoxy 2'-methylene-3 ', 5 dissolved in THF (30 mL) ’-O-(Tetraisopropyldisiloxane-1,3-diyl) -6-N− (4 −t-Butylbenzoyl) -adenosine (3.86 g, 5.8 mmol), TH Treated with 1M TBAF in F (15 mL) for 20 minutes and concentrated in vacuo. This Triturate the residue with petroleum ether and chromatograph on silica gel. I took it. 2'-deoxy 2'-methylene-6-N− (4-t-Butylbenzoyl ) -Adenosine (1.8 g, 4.3 mmol, 74%) in CH₂Cl₂10% of E Elute with tOH.Example 79: 5'-O-DMT-2'-deoxy-2'-methylene-6-N- ( 4-t-butylbenzoyl) -adenosine (29)   2'-deoxy 2'-methylene-6-N− (4-t-Butylbenzoyl) -a Denosine (0.75 g, 1.77 mmol) was dissolved in pyridine (10 mL), And DMT-C1 (0.66 g, 1.98 mmol) in pyridine (10 mL). Was added dropwise over 15 minutes. The resulting mixture is at room temperature for 12:00 Stir for 30 min and add MeOH (2 mL) to quench the reaction. The mixture was concentrated under reduced pressure and the residue was CH.₂Cl₂Dissolved in (100 mL) And saturated NaHCO_ThreeWashed with water, then brine. Organic extract Mg SO_FourThrough and concentrated in vacuo, and 50% EtOAc as eluent: Purify through a silica gel column with hexane29(0.81 g, 1.1 (mMole, 62%).Example 80: 5'-O-DMT-2'-deoxy-2'-methylene-6-N- ( 4-t-butylbenzoyl) -adenosine 3 '-(2-cyanoethyl N, N -Diisopropylphosphoramidite) (31)   Anhydrous CH₂Cl₂1- (2'-deoxy-2'-me dissolved in (15 mL) Chilen-5'-O-Dimethoxytrityl-β-D-ribofuranosyl) -6-N− (4-t-Butylbenzoyl) -adenine29In a round bottom flask under Ar Was. Diisopropylethylamine was added, followed by 2-cyanoethylN,N -Diisopropylchlorophosphoramidite was added dropwise. This reaction mixture The mixture was stirred at room temperature for 2 hours and quenched with ethanol (1 mL). Was. After 10 minutes, the mixture was evaporated under reduced pressure to a syrup (40 ° C). ). This product was taken up in 3% hexanes with 1% triethylamine as eluent. Flash chromatography through silica gel with a gradient of 0-50% EtOAc. Purified by chromatography (0.7 g, 0.76 mmol, 68%). R_f   0.45 (CH₂Cl₂: MeOH / 20: 1).Example 81: 2'-deoxy-2'-difluoromethylene-3 ', 5'-O- ( Tetraisopropyldisiloxane-1,3-diyl) -6-N- (4-t-butyl Rubenzoyl) -adenosine   2'-keto-3 ', 5'-O-(Tetraisopropyldisiloxane-1,3- Jill) -6-N− (4-t-Butylbenzoyl) -adenosine28(6.7 g, 10 mmol) and triphenylphosphine (2.9 g, 11 mmol) in diamine. Dissolved in Grimm (20 mL) and heated to a bath temperature of 160 ° C. The Sodium chlorodifluoroacetate (2.3 g, 15 mM) in glyme (50 mL). Solution) (60 ° C.) was added over a period of about 1 hour (balanced dropping funnel). From the drop). The resulting mixture was stirred for a further 2 hours and concentrated under reduced pressure. . CH this residue₂Cl₂Chromatography in which is dissolved and passed through silica gel - 2'-deoxy-2'-difluoromethylene-3 ', 5'-O-( Tetraisopropyldisiloxane-1,3-diyl) -6-N− (4-t-Buchi Rubenzoyl) -adenosine (4.1 g, 6.4 mmol, 64%) with EtOA. Elute with 15% hexane in c.Example 82: 2'-deoxy-2'-difluoromethylene-6-N- (4-t- Butylbenzoyl) -adenosine   2'-deoxy-2'-difluoromethyle dissolved in THF (20 mL) 3 ', 5'-O-(Tetraisopropyldisiloxane-1,3-diyl)- 6-N− (4-t-Butylbenzoyl) -adenosine (4.1 g, 6.4 mmol) ) Was treated with 1M TBAF in THF (10 mL) for 20 minutes and concentrated under reduced pressure. Shrunk. The residue was triturated with petroleum ether and chromatographed on a silica gel column. It was subjected to mattography. 2'-deoxy-2'-difluoromethylene-6-N − (4-t-Butylbenzoyl) -adenosine (2.3 g, 4.9 mmol, 77 %), CH₂Cl₂Elute with 20% MeOH in.Example 83: 5'-O-DMT-2'-deoxy-2'-difluoromethylene- 6-N- (4-t-butylbenzoyl) -adenosine (30)   2'-deoxy-2'-difluoromethylene-6-N− (4-t-Butylben Zoyl) -adenosine (2.3 g, 4.9 mmol) in pyridine (10 mL). Dissolve and a solution of DMT-Cl in pyridine (10 mL) over 15 minutes It was added dropwise. The resulting mixture was stirred at room temperature for 12 hours and MeO The reaction was quenched by the addition of H (2 mL). The mixture was concentrated under reduced pressure , And CH the residue₂Cl₂Dissolved in (100 mL) and saturated NaHCO 3._Three Washed with water, then brine. The organic eluate is MgSO_FourDewatering and depressurizing Concentrate and silica gel using 50% EtOAc: hexane as eluent. Pass through the column and purify30(2.6 g, 3.41 mmol, 69%) Was.Example 84: 5'-O-DMT-2'-deoxy-2'-difluoromethylene- 6-N- (4-t-butylbenzoyl) -adenosine 3 '-(2-cyanoethyl Le N, N-diisopropylphosphoramidite) (32)   Anhydrous CH₂Cl₂1- (2'-deoxy-2'-di dissolved in (25 mL) Fluoromethylene-5'-O-Dimethoxytrityl-β-D-ribofuranosyl) -6N− (4-t-Butylbenzoyl) -adenine30(2.6 g, 3.4 (mmol) was placed in a round bottom flask under Ar. Diisopropylethylamine (1. 2 mL, 6.8 mmol) was added, followed by 2-cyanoethyl.N,N-Diiso Propylchlorophosphoramidite (1.06 mL, 4.76 mmol) was added dropwise. More added. The reaction mixture was stirred at room temperature for 2 hours, and ethanol (1 m Quenching in L) was performed. After 10 minutes, the mixture becomes a syrup Evaporated under reduced pressure to (40 ° C.).32(2.3 g, 2.4 mmol, 70%) 20-50% EtO in hexane with 1% triethylamine as eluent Flash column chromatography through silica gel with an Ac gradient. Purified by. R_f  0.52 (CH₂Cl₂: MeOH / 15: 1).Example 85: 2'-deoxy-2'-methoxycarbonylmethylidine-3 ', 5 '-O- (tetraisopropyldisiloxane-1,3-diyl) -uridine (3 3)   Methyl acetate (triphenylphosphoranilidine) (5.4 g, 16 mmol) CH under argon₂Cl₂2'-keto-3 ', 5'-O-(Tetraisopro Pyrdisiloxane-1,3-diyl) -uridine14Was added to the solution. this The mixture was left stirring at room temperature for 30 hours. CH₂Cl₂(100 mL) and Water (20 mL) was added and the solution was neutralized with a cold solution of 2% HCl. I let you. Organic layer H₂O (20 mL), 5% NaHCO_ThreeAqueous solution (20 mL), H₂ Wash with O to neutralize, then wash with brine (10 mL). After dehydration (Na₂ SO_Four), The solvent is evaporated under reduced pressure and the crude product is obtained, which is purified by silica gel filtration. Chromatography on a ram. Light oil ether: EtOAc / 7: 3 Elution of pure 2'-deoxy-2'-methoxycarbonylmethylidine- 3 ', 5'-O-(Tetraisopropyldisiloxane-1,3-diyl) -uri gin 33(5.8 g, 10.8 mmol, 67.5%) was obtained.Example 86: 2'-Deoxy-2'-methoxycarbonylmethylidine-uridine (34)   Et_ThreeN.3HF (3 mL), CH₂Cl₂(20 mL) and Et_ThreeN (15 2'-deoxy-2'-methoxycarbonylmethylidine-dissolved in 3 ', 5'-O-(Tetraisopropyldisiloxane-1,3-diyl) -uri gin 33(5 g, 9.3 mmol) was added to the solution. 1 hour for the resulting mixture Afterwards evaporated under reduced pressure and chromatographed on a silica gel column, THF: CH₂Cl₂2'-deoxy-2'-methoxycarbonyl with / 4: 1 Lumetirizine-uridine34(2.4 g, 8 mmol, 86%) was eluted.Example 87: 5'-O-DMT-2'-deoxy-2'-methoxycarbonylme Tyridine-uridine (35)   2'-deoxy-2'-methoxycarbonylmethylidine-uridine34(1 . 2 g, 4.02 mmol) was dissolved in pyridine (20 mL). Pyridine (1 A solution of DMT-Cl (1.5 g, 4.42 mmol) in 0 mL) over 15 min. It was added dropwise. The resulting mixture was stirred at room temperature for 12 hours and Me The reaction was quenched by the addition of OH (2 mL). Concentrate this mixture under reduced pressure And the residue is CH₂Cl₂Dissolved in (100 mL) and saturated NaH CO_ThreeWashed with water, then brine. The organic extract was extracted with MgSO_FourDehydrate through Concentrate under reduced pressure and CH as eluent₂Cl₂With 2-5% MeOH in Purified by passing through a Rica gel column and 5'-O-DMT-2'-deoxy-2'-me Toxylcarbonylmityridine-uridine35(2.03 g, 3.46 mmol, 86%).Example 88: 5'-O-DMT-2'-deoxy-2'-methoxycarbonylme Tyridine-uridine 3 '-(2-cyanoethyl-N, N-diisopropylphosphine Holamidite) (36)   Anhydrous CH₂Cl₂1- (2'-deoxy-2 ', 2 dissolved in (10 mL) '-Methoxycarbonylmethylidine-5'-O-Dimethoxytrityl-β-D- Ribofuranosyl) -uridine35Round bottom (2.0 g, 3.4 mmol) under Ar Placed in flask. Diisopropylethylamine (1.2 mL, 6.8 mmol) And then 2-cyanoethylN,N-Diisopropylchlorophosphole Amidite (0.91 mL, 4.08 mmol) was added dropwise. This reaction The mixture was stirred at room temperature for 2 hours and quenched with ethanol (1 mL). went. After 10 minutes, the mixture was evaporated under reduced pressure to a syrup (4 0 ° C). 5'-O-DMT-2'-deoxy-2'-methoxycarbonylmethyl Gin-uridine 3 '-(2-cyanoethyl-N,N-Diisopropylphosphole Amidite)36(1.8 g, 2.3 mmol, 67%) with 1% as eluent Of a 30-60% EtOAc in hexanes gradient containing triethylamine. It was purified by flash column chromatography through the silica gel used. R_f  0.44 (CH₂Cl₂: MeOH / 9.5: 0.5).Example 89: 2'-deoxy-2'-carboxymethylidine-3 ', 5'-O- (Tetraisopropyldisiloxane-1,3-diyl) -uridine 37   2'-deoxy-2'-methoxycarbonylmethylidine-3 ', 5'-O-( Tetraisopropyldisiloxane-1,3-diyl) -uridine33(5.0 g, 10.8 mL) in MeOH (50 mL) and 1N NaOH The solution (50 mL) was added to the stirred solution at room temperature. The mixture is stirred for 2 hours , And MeOH was removed under reduced pressure. Adjust the pH of the aqueous layer to 4.5 with 1N HCl solution. Section, extract with EtOAc (2 x 100 mL), wash with brine and wash with MgS. O_FourIt was dehydrated through and concentrated in vacuo to obtain the crude acid. 2'-deoki Ci-2'-carboxymethylidine-3 ', 5'-O-(Tetraisopropyldisi Roxan-1,3-diyl) -uridine37(4.2 g, 7.8 mmol, 73 %), CH₂Cl₂Silica gel using a gradient of 10-15% MeOH in Purified on a column.   The alkyl-substituted nucleotides of the present invention are referred to as enzymatically cleaved or antisense. To form the stable oligonucleotides discussed previously for use in It can be used to Such oligonucleotides are standard It is possible to form enzymatically using the more triphosphate form. Such ori Administration of gonucleotides is by standard methods. Sullivan et al. Country See Jpn. Publication No. 94/02595.Oligonucleotide containing 3'and / or 5'dihalophosphonate   The present invention also includes 3'and / or 5'dihalophosphonate- (eg, 3'- 5'-CF₂-Phosphonate-) substituted nucleotides (which have enzymatic Maintains enzymatic activity and / or nuclease resistance of offspring or antisense molecules Or pitting) is synthesized and used.   As used in this application, the term "5'- and / or 3'-dihalo. Phosphonate nucleotide-containing ribozyme, deoxyribozyme (Usman   et al. U.S. Patent No. 94/11649, which is incorporated herein by reference. Incorporated)), and nucleotide chimeras "refer to double-stranded strands. System, single-stranded "catalytic core" sequence, single-stranded loop, or single-stranded recognition sequence ( (But not limited to) 5'- and / or 3'-dihalo A catalytic nucleic acid molecule containing a phosphonate nucleotide component. These molecules Cleaves individual RNA or DNA molecules in a nucleotide sequence-specific manner ( Preferably, it can be cleaved repeatedly. Such catalytic nucleic acids are In particular, it can also act to effect intramolecular cleavage if desired. This Enzymatic molecules such as actually target any RNA or DNA transcript. It is possible to The present invention provides standard nucleotides or modified nucleosides. With respect to the nucleic acid that constitutes the tide, these nucleotides are further labeled with at least one 5 ' Containing a dihalophosphonate and / or one 3'-dihalophosphonate group .   1-O-Methyl-2,3-O-Isopropylidene-β-D-ribofuranose 5-deoxy-5-dihalomethylphosphonate 1-in 3 stepsO-Ac- 2,3-di-O-Bz-D-ribofuranose 5-d-5 + dihalomethylphospho The synthesis of nates is described (eg for difluoro in Figure 87). Appropriate The condensation of this derivatized sugar with silylated pyrimidines and purines produces new The silica nucleoside 5'-deoxy-5'-dihalomethylphosphonate was obtained. It is. These intermediates were prepared by chemical methods (nucleoside 5'-deoxy-5'- Phosphoramidites with appropriate protection of dihalomethylphosphonates12a Or solid support12b(For example, conversion to FIG. 88), or fermentation Elementary procedure (nucleoside 5'-deoxy-5'-dihalome for T7 transcription Conversion of tylphosphonates to their triphosphonates (see, eg, FIG. 8814 )) For incorporation into catalytic or antisense nucleic acids. Can be.   Accordingly, in one aspect, the invention provides 5'and / or 3'-dihalonucleosides. And nucleic acids containing 5'- and / or 3'-dihalonucleotides. Sign. The general structure of such molecules is shown below. [Wherein, R₁Is H, OH, or R, where R is a hydroxyl protecting group (eg, , Acyl, alkylsilyl, or carbonate; each R₂Are H and O individually H or R; each R_ThreeAre individually phosphonate protecting groups (eg methyl, Ethyl, cyanoethyl, p-nitrophenyl, or chlorophenyl) Each X is individually any halogen; and each B is any nucleoti De base].   The invention is particularly directed to such modified nucleotides and nucleic acid moieties having enzymatic activity. Characterized by a child. In a related aspect, the invention provides a dihalophosphonate-containing sugar pyri. Nucleoside 5'-deoxy-5'-dihalophos with midine or purine Form honate and / or 3'-deoxy-3'-dihalophosphonate Such nucleoside 5'-deoxy-5 by condensation under conditions suitable for Of the synthesis of'-dihalo and / or 3'-deoxy-3'-dihalophosphonate The method is characterized by:   Phosphonic acids are important biological features because they are similar to phosphate esters. May be exhibited (Engel, Chem. Rev. 1977, 77, 3). 46-367). Blackburn and Kent (J. Chem. Soc. , Perkin Trans. 1986, 913-917). And based on stereochemical considerations, _-fluoro and _, _- difluoromethyl Phosphonates are more similar to phosphonate esters than the corresponding phosphonates. It is shown that. Pyro- and triphosphate1Analog of [in this case, combined Substituent oxygen atom is replaced by difluoromethylene group] is a substrate in the enzymatic process (Blackburn et al., Nucleosi des & Nucleotides 1985, 4, 165-167; Bla ckburn et al. Chem. Scr. 1986, 26, 21-2 4). 9- (5,5-difluoro-5-phosphonopentyl) guanine (2)But, Use as a multiple substrate analog inhibitor of purine nucleoside phosphorylase (Halazy et al., J. Am. Chem. Soc. 1). 991, 113, 315-317). Phosphodiester 5'-instead of oxygen Oligonucleotides containing a methylene group in the phosphodinucleotide between the phosphorus and the 5'-oxygen Resistant to nucleases that cleave ester bonds (Breaker et al. , Biochemistry 1993, 32, 9125-912. 8) It is still possible to form stable complexes with complementary sequences. He inemann et al. (Nucleic Acids Res. 1991, 19, 427-433) is a DNA decamer with a single 3'-methylenephosphonate bond. We have found that it has a subtle effect on the conformation of the double helix.   One general synthetic approach to lead to α, α-difluoro-alkylphosphonates The plachi is diethyl (lithiodifluoromethyl) phosphonate (3) By It is characterized by the displacement of free radicals from fragile reactive substrates (Obayashi et al. l. , Tetrahedron Lett. 1982, 23, 2323-23 26). However,35'-deoxy-5'-iodonucleoside From the nucleoside 5'-deoxy-5'-difluoro-methylphosphonate Our attempt at synthesis was unsuccessful, that is, the starting compound was quantitatively It has been recovered. Of the nucleoside 5'-aldehyde3The reaction with , Martin et al. (Martin et al., Tetrahedron L. ett. 1992, 33, 1839-1842). It is said that it will bring a compound. recently,3Primary triglyceride using H The synthesis of sugar α, α-difluoroalkylphosphonates from lats has been described ( Berkowitz et al. J. Org. Chem. 1993, 58 , 6174-6176). Unfortunately, in our experience, the nucleoside 5'- Triflates are too unstable to be used in their synthesis.   The following are the nucleosides 5'-deoxy-5'-difluoromethyl-phosphine: 1 is a non-limiting example showing a method for synthesizing suphonate. Those skilled in the art can use these equivalent methods. It will be appreciated that it can be easily devised based on the embodiment of. These examples show that the 5'-deoxy-5'-difluoro derivative was obtained in good yield. It is possible to achieve a synthesis and thus guide the person skilled in the art to such an equivalent method. Indicates that there is. These examples further provide the useful oligonucleotides described above. The availability of synthetic methods to provide is also shown.   Those skilled in the art will appreciate that useful modified enzymatic nucleic acids (many of which are Drapers et al. , US Patent No. 94/13129, which is hereby incorporated by reference. Is incorporated herein by reference, including the drawings) can now be designed You will recognize thatExample 90: Nucleoside 5'-deoxy-5'-difluoromethylphosphone Synthesis   Fig. 87As a reference, we have found that the nucleoside 5'-difluoromethylene phosphone Of known D-ribose α, α-diones that act as key intermediates for the synthesis of Fluoro-methylphosphonate (4) (Martin et al., Tetr ahedron Lett. 1992, 33, 1839-1842) A variety of glycosylation reagents were synthesized.   Methyl 2,3-O-Isopropylidene-β-D-ribofuranose α, α- Difluoro-methylphosphonate (4), Martin et al. (Tetrahed ron Lett. 1992, 33, 1839-1842) 5 -Synthesized from aldehyde (Figure 87). Removal of isopropylidene group is mild Bottom (I₂-MeOH, reflux 18 h (Szarek et al., Tetra hdr Lett. 1986, 27, 3827) or Dowex 5 0 WX8 (H +), MeOH, room temperature (about 20-25 ° C.), 3 days) Achieved and yield of 72% was obtained. Chlorination of the anomer mixture thus obtained Benzoylated with benzoyl / pyridine to give 2,3-di-O-Benzoyl derivative And the mild acetolysis conditions (Walczac et al., S synthesis, 1993, 790-792) (Ac₂O, AcOH, H₂SO_Four , EtOAc, 0 ° C.). Desired 1-O-Acetyl-2,3-di-O -Benzoyl-D-ribofuranose difluoromethylphosphonate (5) Is , Was obtained in quantitative yield as an anomeric mixture. These derivatives are r ogs. Chemistry, Biology and Medical Ap applications, NATO ASI Series A, 26, Plen um Press, New York, London, 1980; pp. 35- 69) under silylated uracil and N^Four-Selective glucosylation of acetylcytosine It was used for conversion. For the purpose of obtaining β-nucleosides (62%6a, 75%6b ) F as a glycosylation catalyst_ThreeCSO₂Si (CH_Three)_ThreeUse of is excluded Which is undesired by its use 1-ethyluracil or 9-ethyl This is because it is expected that a luadenine by-product will be produced: Podyuko va, et al. , Tetrahedron Lett. 1987, 28, 3623-3626, and references cited herein (S as catalyst) nCl_Four, Boiling acetonitrile). Silylation under the same conditions N⁶-Benzoylurea N-9 isomers due to glycosylation of denine6cAnd N-7 isomer7Mixed with The product was obtained in yields of 34% and 15% respectively. The previous nucleotide is et With trimethylsilyl bromide for cleavage of the ru group, followed by removal of the acyl protecting group It was successfully deprotected by the intended treatment with ammonia-methanol. Was. Nucleoside 5'-deoxy-5'-difluoromethylphosphonate8 Finally uses 0.01-0.25M TEAB gradient for elution DEAE Sephadex A-25 (HCO_Three ^-) On the column , And were obtained as their sodium salt (82%8a87 %8b82%8c).   Selected analytical data:³¹P-NMR (³¹P) and¹H-NMR (¹H) to V Recorded on an Arian Gemini 400. Each chemical shift in ppm is H_ThreePO_FourAnd TMS are referenced. Solvents have no special mention As long as CDCl_ThreeMet.   Compound 7Is deacylated with ammonia in methanol to give λ_max(H₂O ) 271 nm and λ_minA product showing 233 nm was obtained, which It was established that the lycosylation site is N-7.Example 91: Synthesis of nucleic acids containing modified nucleotides containing the core   The synthetic method used is described by Usman et al. J. Am. Chem. S oc. 1987, 109, 7845-7854 in and Scaringe e. t al. , Nucleic Acids Res. 1990, 18, 543 3-5441, according to the usual methods for RNA synthesis described in Nucleic acid protecting and coupling groups (eg 5'-terminal dimethoxytriti And a 3'-terminal phosphoramidite) (Fig. 88, and Ja nda et al. , Science 1989, 244: 437-440). . These nucleosides 5'-deoxy-5'-difluoromethylphosphone G Not only in the ribozyme of hammerhead shark (hammerhead) but also in hair Introducing a hepatitis delta virus with a pin structure, group 1 or group 2 May also be incorporated into the antisense oligonucleotide or . Therefore, they are commonly used in any nucleic acid structure.Example 92: Synthesis of modified triphosphate   The triphosphate derivative of the preceding nucleotide isFig. 89In the procedure shown in It can be formed according to known methods. Nucleic Acid Ch em. Leroy B .; Townsend, John Wiley & So ns, New York 1991, pp 337-340; Nucleotid. e Analogs, Karl Heinz Scheit; John Wil ey & Sons, New York 1980, pp. 221-218.   An equivalent synthetic scheme for the 3'dihalophosphonate is90 and 91Shown in And uses nomenclature recognized by those of skill in the art. These conditions are It is possible to optimize by a quasi method.   The nucleoside dihalophosphonates described herein include any nucleic acid construct. Advantageous as a modified nucleotide during construction (eg, catalytic or antisense) Exo, which degrades normally unmodified nucleic acids in vivo. -And to show resistance to endonucleases. They are even that Do not destabilize the normal structure of the nucleic acid into which they are incorporated, and therefore Any activity associated with the structure is maintained. These compounds are also antiviral It is sometimes used as a monomer and / or an antitumor agent.Oligonucleotides with amide or peptide modifications   The present invention provides for the 2'-hydroxyl group of the ribonucleotide moiety to Or a 2'-peptide moiety. In another embodiment, the 3'or the sugar of the nucleotide is And the 5'moiety may be substituted, or if the phosphate group is an amide Or it may be replaced by a peptide moiety. Generally such nucleotides Has the general structure shown in Formula I below:   Base (B) is any one of the standard bases or is known to those of skill in the art. Can be a modified nucleotide base or can be a hydrogen group . Additionally, R₁Or R₂Either is H, or between 2 and 10 carbon atoms Or alkyl containing hydrogen, alkene, or alkyne group, amine (primary , Secondary or tertiary amines (eg R_ThreeNR_Four[Wherein each R_ThreeAnd R_FourIs Independently hydrogen, or an alkyl or alkene having between 2 and 10 carbon atoms, Preferably an alkyne or an amino acid residue (ie, an amide)] , An alkyl group, or an amino acid (D or L form) or between 2 and 5 It is a peptide containing amino acids. Zigzag lines are hydrogen, or known to those skilled in the art. Represents a bond to another base or other chemical moiety. R₁, R₂, And R_Threeof One of which is H and the other is an amino acid or peptide preferable.   Applicants have found that RNA adopts an even more complex structural form when compared to DNA. Of the presence of the 2'-hydroxyl group in RNA. This is because. This group is the other hydrogen donor, acceptor, contained within the RNA molecule. It is possible to provide additional hydrogen bonds to the metal ion and the metal ion. This application Humans now provide a molecule with a modified amine group at the 2'position, which As a result of the presence of the nucleoside group, a significantly more complex structure is attributed to the modified oligonucleotide. Can be formed. Thus with a 2'-amide or peptide group Such modifications result in the expansion and enrichment of side chain hydrogen bonding networks. This Their amide and peptide moieties are responsible for the complex structure formation of oligonucleotides And forms strong complexes with other bases and is a standard base pairing phase. It is possible to interfere with the interaction. Such interference can lead to complex nucleic acids and proteins. The formation of white matter complexes will be possible.   The oligonucleotides of the present invention have significant significance when compared to existing oligonucleotides. It is more stable, and due to its oligonucleotide It is possible to form biologically active biological complexes that were not possible for Cido. It is likely to become Noh. In addition to these, a unique aptamer, That is, it is incorporated into an effective ligand for the target protein, nucleic acid, or polysaccharide. In vitro of randomly generated oligonucleotides that can be entrapped It can also be used for selection.   Accordingly, in one aspect, the invention provides oligos that include the modified bases shown in Formula I above. Characterized by nucleotides.   In another aspect, the oligonucleotide also comprises an amino acid located at the 3'or 5 '. Or may contain a 3'or 5'nucleotide having an aminoacyl group . All of these aspects, as well as the 2'-modified nucleotides, have various standard modifications. It will be appreciated that it is possible to make a decoration. For example, "O Can be replaced with "S" and the sugar may have no base (abasic ( abasic)), and the phosphonate moiety is modified to include other substituents (See Sproat, supra).Example 93: 2'-Aminoacyl-2'-deoxy-2'-aminonucleoside General method for the production of composites   FIG. 92With reference to methanol [dimethylformamide (DMF) and the Trahydrofuran (THF) can also be used] in 2'-deoxy- 2'-amino nucleoside (1 mmol), as well as N-Fmoc L- (if To a solution of D-) amino acid (1 mmol), 1-ethoxycarbonyl-2-eth Xy-1,2-dihydroquinoline (EEDQ) [or 1-isobutyloxy Cycarbonyl-2-isobutyloxy-1,2-dihydroquinoline (IIDQ) ] (2 mmol) and the reaction mixture at room temperature or up to 50 ° C. Stir for 3 to 48 hours. The solvent was removed under reduced pressure and the residual syrup Column on silica gel with 1-10% methanol in dichloromethane. Chromatography on. Fractions containing product are concentrated to 85-95 White foam was obtained with yields ranging from%. Structure of complex¹H NMR The spectrum confirms that the nucleosides of the molecule are And the correct chemical shifts for the aminoacyl moieties are shown. Further progress in structure Confirms that the aminoacyl protecting group is cleaved under appropriate conditions and is completely deprotected. Made for a complex¹Obtained by assigning 1 H NMR resonance values.   The partially protected complexes described above are their 5'- using standard methods.O− Converted to dimethoxytrityl derivative and 3'-phosphoramidite (Ol Ionucleotide Synthesis: A Practical Approach, M .; J. Gait ed. ; IRL Press, Oxfo rd, 1984). Incorporation of these phosphoramidites into RNA is standard Conventional method (Usman et al., 1987, supra).   A general deprotection protocol for the oligonucleotides of the invention isFigure 93 Is shown in.   The scheme shows the synthesis of a complex of 2'-d-2'-aminouridine. . This is meant to be a non-limiting example, and one skilled in the art will appreciate that this synthetic protocol To other nucleotides (eg, adenosine, (Tidine, guanosine) and / or abasic moieties can be synthesized. You will recognizeExample 94: Hammerhead with 2'-aminoacyl modifying group RNA cleavage by ribozyme   Hammer sharks (hammerh) targeting site N (see Figure 94) The ead) ribozyme is synthesized using solid phase synthesis as described above. U4 and U 7 positions individually or together, 2'-NH-alanine or 2'-N It is modified with H-lysine.   In vitro RNA cleavage assay: Substrate RNA [γ-³²P] -ATP and And T4 polynucleotide kinase (US Biochemicals) 5'-label. The cleavage reaction was performed under ribozyme "excess" conditions. Very small amount (≦ 1 nM) of 5′-end labeled substrate and 40 nM unlabeled ribozyme Individually by heating to 90 ° C for 2 minutes and quenching on ice for 10 to 15 minutes. Denature and regenerate. The ribozyme and the substrate were individually added to 50 mM Tr is-HCl and 10 mM MgCl₂Buffer for 10 minutes at 37 ° C. Incubate. The reaction is carried out by mixing the ribozyme solution with the substrate solution and at 37 ° C. Start by incubating. Aliquot 5 μl at regular time intervals And sample the reaction in the same volume of 2 × formamide stop mixture. Quenched by mixing with coix. 20% denaturation of sample Separate on dogel. The results were quantified and the target RNA that had undergone cleavage was analyzed for -Plot the centage as a function of time.   Fig. 95With reference to 2'-NH-alanine at the U4 and U7 positions. Is a hammerhead ribozyme containing a 2'-NH-lysine modification Im efficiently cleaves the target RNA.   Fig. 94The sequences listed inFig. 95The modified products described in 1. Means an example. Those skilled in the art will appreciate that other 2'-hydroxy group modifying groups Include, but are not limited to, amino acids, peptides, and cholesterol. Ribozymes and RNA variants (including base substitutions, deletions, insertions, Mutant, chemically modified) using techniques known in the art. It will be appreciated that it is possible to make, and they are within the scope of the invention. Included in the box.Example 95: Aminoacylation of the 3'-end of RNA I.Fig. 96, The 3'-OH group of the nucleotide is modified by Gait (supra). Are converted to the succinates described. Amino-alkyl solid support It is possible to bind to the body (eg: CpG). Zigzag line is 3'-O The bond between the H group and its solid support is shown.II .Preparation of aminoacyl-derivatized solid support A) Synthesis of O-dimethoxytrityl (O-DMT) amino acid   Fig. 97See L- (or D-) serine in anhydrous pyridine (15 ml). Solution of 4,4'-dimethoxychloride in a solution of benzene, tyrosine, or threonine (2 mmol). Citrictyl (3 mmol) was added and the reaction mixture was allowed to come to room temperature (20-25 ° C). ) Was stirred for 16 hours. Then methanol (10 mL) was added, and the The solution was distilled under reduced pressure. The residue, a syrup, was washed with 5% NaHCO 3._ThreeAqueous solution And dichloromethane and the organic layer is washed with brine, dried (Na₂S O_Four), And concentrated under reduced pressure. This residue was added to dichloromethane (0.5% pyridinium). Silica gel column chromatography with 2-10% methanol in Purify by chromatography. Fractions containing product were combined and concentrated under reduced pressure. To obtain a white foam (yield 75-85%).B) Preparation of a solid support and its derivatization with amino acids   Referring to FIG. 97, a modified solid support (standard NH₂OH group instead of terminal group ), According to Haralambidis et al. , Tetrahedr on Lett. 1987, 28, 5199 (P is aminop Represents Ropil CPG or polystyrene type support). O-DMT Is an NH-monomethoxytrityl (NH-MMT) amino acid on the above solid support, The standard method for derivatization of this solid support (Gait, 1984, supra) is used to Coupling creates a base-labile ester bond between the amino acid and its support did. This support is a suitably protected nucleoside phosphoramidite. Suitable for the construction of RNA / DNA strands usingExample 96: Aminoacylation of the 5'-end of RNA I.Fig. 985'-Amino-containing sugar moiety was synthesized as described above. (Mag and Engels, 1989 Nucleic Acids R es. 17, 5973). Aminoacylation of the 5'-end of the monomer is as previously described. And a 5'-aminoacylated monomeric RNA phosphoramidite To Usman et al. , 1987 (supra). Was. This phosphoramidite is then subjected to the standard solid phase synthesis protocol described above. Used to incorporate at the 5'-end of the oligonucleotide. II.Fig. 99To the aminoacyl group (s) as described above. The quasi method is used to ligate to the phosphate group at the 5'-end of RNA.VII. Reversion mutation   Modification of existing nucleic acid sequences can be accomplished by homologous recombination. During this process The transfected sequences recombine with homologous chromosomal sequences and It may replace the causative cell sequence. Boggs, 8Internet onal J. Cell Cloning   80, 1990, target gene modification The decoration is described. It uses the use of homologous DNA recombination to correct genetic defects. Is commenting on. Banga and Boyd, 89P rc. Natl. Acad. Sci. U. S. A. In 1735, 50 bases A specific example of in vivo site-directed mutagenesis with lygonucleotides It has been described. In this methodology, a gene or gene segment is not used Essentially replaced by the oligonucleotide.   The present invention uses complementary oligonucleotides to achieve wild-type nucleotide modification activity. Inheritance to alter (or revert to) a mutation to or equivalent to Nucleotide change activity at a specific site on the offspring (RNA or genomic DNA) Deploy. By reverting or altering the mutation, the inventor has the opportunity to develop a wild type phenotype. Reversion in a broad sense, as in the case of mutations at the second site that result in reversion Means In addition, due to the degeneracy of the genetic code, revertants have three codons. Can be achieved by changing any one of the positions. Furthermore, harmful genetics Generation of stop codons in the offspring (or transcripts) is now characterized by the mutant phenotype of wild type. Is defined as a return to. An example of this type of reversion is the human critical HIV Generation of a stop codon in the loose gene.   100 and 101The general rule is that the mutation is reverted to the wild type. There are two ways to make a specific site change. In one (Figure 100), specifically targeting RNA with oligonucleotides. RNA is , A complementary (Watson-Crick) oligonucleotide sequence to that in the target molecule Is given with In this case, the sequence-modified oligonucleotide is (antisense It is made by the cell (similar to a oligonucleotide or ribozyme) Occasionally it should be present to restore RNA. like this Reversion is considered transient, and more sequence-modified oligonucleotides To It is thought that it may be necessary to add them continuously. The temporary nature of this method is , Simply remove sequence-modified oligonucleotides (as with traditional drugs) This has the advantage that the treatment can be stopped.   The second method targets DNA (FIG.), Changed in the genetic code of the target cell Has the advantage that it can be permanently coded. Therefore, one process of treatment ( Or some process) may result in a permanent reversion of the genetic disease. Wrong dye If a chromophoric mutation is introduced, it can cause cancer and other genetics. May mutate offspring or (in patients of childbearing age) germline May cause genetic changes in. However, the base change activity is If it is a specific methylation that can regulate expression, it also does not necessarily have germline transmission. I won't let you down Lewin,Genes  John 1983 ・ Willie and Sons Incorporated (John Willel y & Sons. Inc. ) NY 493-496.   Complementary base pairing to single-stranded DNA or RNA requires the oligonucleotide It is one method of directing to a specific site of DNA. This is because DNA is single-stranded In some cases it occurs by a strand displacement mechanism or by targeting DNA (Eg, during replication or transcription). Another method is for double-stranded DNA The use of a triple-chain bond (triple helix formation) to produce a polypyrimidine moiety. Is a well-established technique for ligating Can be expanded. Povsic, T.M. , Strobel ), S.P. And Dervan, P .; (1992), triple helix formation Sequence-specific double-stranded alkylation and cleavage of DNA mediated byJ. Am . Chem. Soc. 114 . 5934-5944 (1992) . Knorre, D.M. G. FIG. Valentin, V .; V. Valentina, F .; Z. , Lebedeve v), A. V. And Federova, O .; S. ,Design n and targeted reactions of oligonucleotide leotide deriveive   1-366 (CRC press, Novoshi (Birsk, 1993) describes the use of reactive groups or enzymes for oligonucleotides. Join Described and can be used in the methods described herein.   Recently, antisense oligonucleotides have been spliced in vitro. Incorrect splicing to obtain correct splicing of naturally mutated globin gene Used to control the. Dominski Z; Cole ( Kole) R (1993), thalassemia with antisense oligonucleotides Restoration of correct splicing in pre-mRNA,Proc Natl Acad Sci USA   90: 867-7. Similarly, one preferred embodiment of the present invention In some cases, antisense is used to correct existing mutant RNAs. Complementary oligomers are used as an alternative to the traditional method of inhibiting RNA of.   To a specific site on RNA or DNA in either RNA or DNA format After ligation, the oligonucleotide modifies the nucleic acid sequence. It activates the endogenous enzyme By sexualizing (FIG.), For oligonucleotides Bound (or activated by double helix) enzyme (or ribozyme) Of the chemical mutagen, or of the chemical mutagen sell. Most useful are certain mutagens, such as denitrifying C to U However, other can be used if inactivation of harmful RNA is desired. .   RNA modification is naturally occurring in mammalian cells, where And the sequence-modifying activity corrects the RNA to its proper sequence after transcription. Higuchi (H Iguchi), M, Single (F), Kohler (Kohler) ), M, Sommer, B.I. And Seeburg, P. (1993), RNA modification of AMPA receptor subunit GluR-B: salt The group-paired intron-exon structure determines position and efficiency,Cell  75 : 1361-1370. Mechanisms involved in RNA modification drive chemical modification Can be selected by an appropriate oligonucleotide.   The base changes produced by the methods of the invention can be either directly or in normal cell machinery. Causes changes in the nucleotide sequence after ordinal DNA repair. These changes , Functionally correct the genetic defect or introduce a stop codon. Therefore, The present invention allows for the activation of active chemical groups (eg, alkylating agents) with antisense or triple-stranded oligonucleotides. Binds to lygonucleotides to chemically inactivate target RNA or DNA To Different from technique.   Therefore, the present invention alters existing bases in nucleic acid molecules, Is read as another base in vivo. This inactivates the gene Instead, it involves correcting the sequence, but also inactivating harmful genes. May be included.   Accordingly, in one aspect, the invention provides a naturally occurring mutant nucleic acid fraction. A method for altering the nucleotide base sequence of the offspring in vivo is characterized. The method comprises: A nucleic acid molecule in vivo, together with the nucleic acid molecule, a double or triple helix Oligonucleotides or peptide nucleic acids or others capable of producing molecules Contacting with the sequence-specific binding molecule of. Double or triple helix After generation of the offspring, the base modification activity directly or chemically targets the target base, either chemically or enzymatically. Or modified after nucleic acid repair in vivo. This causes a functional alteration of the nucleic acid sequence. Wake up.   As used in this context, "altering" means that in one or more target bases Altering one or more chemical moieties so that the mutant nucleic acid is functionally different Means to do. Therefore, this is a conventional method of correcting DNA defects. , A complete segment of the target sequence is transfected with a nucleic acid Unlike homologous recombination, which is replaced by a segment of DNA from this Also, this method does not damage the target sequence, but instead It makes it functional by making it read as a base different from the original base. Deactivate RNA or DNA targets with reactive groups in terms of Different from other methods. As mentioned above, naturally occurring enzymes in cells It can be used to cause a geometric change, an example of which is given below.   "Functionally altering" means the ability of a target nucleic acid to perform its normal function (ie, (I.e., transcription or translation control). For example, RNA molecules , It can be modified to cause the desired protein production, or Or DNA molecules can be altered such that DNA sequences change during DNA repair .   A "mutant" is one that is similarly modified as compared to an equivalent molecule present in a normal individual. Nucleic acid molecule. Such mutants are well known in the art. And in known genetic deficiencies, for example in individuals with muscular dystrophy or diabetes There are molecules that exist. It is also a disease or disease characterized by aberrant expression of genes. Are symptoms of, for example, cancer, thalassemia and sickle cell anemia, and individuals with cystic fibrosis. Includes the body. It is a lipid metabolism that reduces arterial disease, an integrated AIDS gene. Allows treatment of nom and AID RNA and regulation of Alzheimer's disease. Thus, the present invention provides a "wild-type" phenotype and / or genotype. Naturally, it relates to alteration of the base in the mutant. For harmful symptoms, this can be It involves altering the bases to allow or prevent expression. H When treating an infection such as IV, it may be a mutant (ie a non-human gene ) To wild type (ie non-production of non-human proteins) HIV   It relates to the inactivation of genes in RNA. Such adjustments are as in conventional methods Achieved in trans rather than in cis.   In a preferred embodiment, the oligonucleotide has an adenine base at inosine. Sufficient to activate the dsRNA deaminase in vivo to convert The length (at least 12 bases, preferably 17-22 bases); Leotide is an enzymatic nucleic acid molecule that is active to chemically modify bases (see below The nucleic acid molecule is DNA or RNA; Include a chemical mutagen, eg, the mutagen is nitrite; and The oligonucleotide deaminates 5-methylcytosine to thymidine, Change syn to uracil or adenine to inosine, or cytosine Methylate to 5-methylcytosine.   In a most preferred embodiment, the invention is by causing a mutation It features mutation correction, rather than target inactivation.   Using in vitro dominated development, it has a different catalytic activity than RNA cleavage. It is possible to screen for ribozymes. Bartel, D . And Szostak, J .; (1993), large random array Isolation of a novel ribozyme fromScience  261: 1411-141 8. Using these methods of controlled and in vitro development, phosphodiester Ribozymes that mutate enzymatic nucleic acid molecules or bases instead of cleaving the backbone Im Can be selected. This is a suitable base sequence for use in the present invention. It is a convenient way to obtain enzymes with modifying activity.   Sequence modification activity can change one nucleotide into another ( Alternatively, the nucleotide may be replaced by another nucleotide so that the nucleotide is repaired by the cellular mechanism. Modify to cleotide). Sequence-modifying activity also refers to one or more nucleosides The tide may be deleted or added to the sequence. A specific embodiment of the additional sequence is Ranger and Cech, PCT / US94 / 12976 (incorporated herein by reference). Here, the complete exon with the wild-type sequence is spliced and abruptly altered. Become a foreign transcript. The invention is characterized by the addition of only a few bases (1-3) .   Therefore, in another embodiment, the present invention provides for preexisting nucleic acid molecules that are already present. Features an active ribozyme or enzymatic nucleic acid molecule that alters the chemical structure of a base You. Applicants have for the first time determined that such molecules may be useful and It describes how such molecules can be isolated.   The molecules used to achieve in-situ reversion are liposomes and cationic lipid complexes. Antisense molecules and ribozymes used to induce ribozymes, including It can be induced using existing means. When the on-site return molecule consists of RNA only , The expression vector is similar to the antisense or ribozyme expression vector. It can be used in gene therapy protocols that produce the molecule endogenously. like this For easy expression vector replacement, simply replace the gene with standard gene therapy. Rather, there are some advantages. First, this approach was corrected Production of the gene will be restricted to cells already expressing the gene. Change In addition, the corrected gene is properly regulated by its natural transcriptional promoter. Will Finally, the reversion is that the mutant RNA preferentially acquires the functional protein. Can be used (for example, in the case of sickle cell anemia), in which case Correction of mutant RNAs halts and corrects the production of harmful mutant proteins Is required to produce the expressed protein.Endogenous mammalian RNA correction system   In the mid-1980s, sequences of certain cellular RNAs encoded them. Was observed to differ from the DNA sequence. By the process called RNA modification, The vesicular RNA is post-translationally modified to produce (a) translation initiation and termination codons, ( b) that tRNAs and rRNAs fold into functional conformations Yes (for comment, Bass BL (1993),The RNA World   R. Gesterland, R.A. and Atkins, J. et al. Supervision (Cold Spring Harbor, Ni Yu York; CSH Love Press, pp. 383-418. See). The RNA correction process involves the modification, deletion and insertion of nucleotides. Include.   RNA modification processes are widespread among lower eukaryotes, but very few Only four (4) RNAs are reported to be modified in mammals ( Bus, above). Base modification is an RNA modification mode that exists preferentially in mammalian systems. (C → U and A → G). RNA modification mechanism in mammalian system is C → U It is hypothesized that the conversion is catalyzed by cytidine deaminase. A to G conversion machine Introduces the glutamate receptor B subunit (gluR- in rat PC12 cells). B) recently reported (Higuchi, M et al. (1993)Cell  75,13 61-1370). According to Higuchi, the gluR-B mRNA precursor A structure such that Ron 11 and exon 11 can form a stable stem-loop structure. It is built. This stem-loop structure is a double-strand specific adenosine It is a substrate for the minase enzyme. Deamination causes an A → I conversion. Reverse transcription The following double-stranded synthesis causes the incorporation of G instead of A.   In the present invention, endogenous deaminase activity or other such activity is used. The target base modification can be achieved.   The following is a book illustrating different ways in which in vivo conversion of bases can be achieved. It is an example of the invention. These are intended to clarify specific embodiments of the invention. It is given solely and is not intended to limit the invention. Those skilled in the art It will be appreciated that within the scope of the claims, they can be readily devised.Example 97: Utilization of cellular dsRNA-dependent adenine for inosine converting substances   Endogenous activity in most mammalian cells and Xenopus oocytes Converts approximately 50% of adenosine to inosine in double-stranded RNA (bass , B. L. And Weintraub, H .; (1988), Unwinding activity to covalently modify double-stranded RNA substrates,Cell, 55, 1089-1098). This activity triggers site reversion of mutations at the RNA level. Can be used to wake up. 102 and 104 are discussed for demonstration Then, the stop codon is integrated into the coding part of dystrophin, which accepts it. It is fused to the somatic gene luciferase. This stop codon replaces adenine with inosine Long enough to activate dsRNA deaminase It can be reverted by targeting RNA. AI transition Is read by the ribosome in some cases similar to the AG transition, Thereby, the stop codon is functionally restored. The other A in this part is converted to I Can be read as G and the conversion of AI (G) produces a stop codon. I can't twiddle. The AI transition around the target mutation has some A point mutation occurs, however, the function of the dystrophin protein is Mutations rarely deactivate.   Next, the reverted mRNA is translated into cell lysates and luciferase activity is Tested for Illuminated by a dramatic increase in luciferase count in the graph of FIG. As is clear, the AI transition is similar to the AG transition in ribosome. Read by the chromosome and the stop codon is treated with the lysate complex Successfully recovered by the body. As a control, an irrelevant non-complementary RNA oligonucleotide Reotide was added to the dystrophin / luciferase mRNA. As expected, this In case no translation (luciferase activity) is seen due to the stop codon. Yet another As a control, the hybrids were not treated with the extract but retranslated (luciferase). Ferrase activity) is not seen (Fig. 103).   The other A of the targeting moiety can be converted to I and read as G, but A- Ribosomes are still less likely because the conversion of I (G) cannot yield a stop codon. Read by the part of. If the reading frame is maintained Fins are not sensitive to point mutations, so m restored by this method The dystrophin protein produced from RNA retains sufficient activity. It is.   The following detailed description of the methodology: RNA oligonucleotides 394 (ABI ) Was synthesized using phosphoramidite chemistry on a synthesizer. Mutant dystro The sequence of the synthetic complementary RNA that binds to the fin sequence is as follows (5 ' ~ 3 ').   FIG. 104The human dystrophin mutant sequence containing a stop codon. Of 54 base pairs are standard within the frame for the luciferase coding region. Fusion using various cloning techniques to obtain pRC-CMV (Invitrogen (I nvitrogen), San Diego, CA) HindIII and Not I site. The AUG of luciferase was deleted. From HindIII site The sequence of the insert (5'-3 ') up to the start of the luciferase coding region is , It is.   This is a normal dystrophin with a SacII site at the 3'end (Entrez) corresponding to base pairs 3649-3708 of ID # 311627) . This plasmid was added to the manufacturer's protocol (Promega, Madi Son, WI) for the in vitro transcription of mRNA using T7 polymerase. It was used as a casting mold.   Xenopus nuclear extract was added to 0.5X TGKED buffer (0.5X = 2 5 mM Tris (pH 7.9), 12.5% glycerol, 25 mM KCl 0 . Stir nuclei in 25 mM DTT and 0.05 mM EDTA) 0.5X TGK prepared by and in an amount equal to the total cytoplasmic volume of the oocyte Resuspended in ED. Bus, B. L. And Rawine Traub, H .; ,Cel l   55, 1089-1098 (1988).   Heat 500 ng / μl of target mRNA to 70 ° C. and gradually increase it to 37 1 micromolar complementary or by cooling to 0 ° C. for 30 minutes Pre-annealed to irrelevant RNA oligonucleotides. RNA orientation 50 nanograms of mRNA preannealed to gonucleotides 1 mM ATP, 15 mM EDTA, 1600 un / ml RN acin and Add to 7 μl of nuclear extract containing 12.5 mM Tris, pH 8 and bring the total volume to 12 μl. bus. B. L. And Rawine Traub, H .; ,the above. dsRNA This mixture with deaminase activity was incubated for 30 minutes at 25 ° C. . 1.5 μl of this mixture was then added to the rabbit reticulocyte lysate in vitro translation mix. The nuclear extract, with the addition of 1.3 mM magnesium acetate. From manufacturer protocol (Life Tech Life Technologies, Gaithersburg, MD ) And translated for 2 hours. Luciferase assay, Promega Lucifer 15 μl of extract using the ZE assay system (Promega, Madison, WI) And detected the luminescence using a 96-well luminometer, The result is shown in the graph of FIG.Example 98: Base changing activity   Chemical chemistry of antisense and triplex-forming oligomers attached to reactive groups Adults have been well studied and characterized (Nore, DG, Valentin, V .; V. Valentina, F.M. Z. Lebedev, A .; V. And Federova, O .; S. ,Design and targeted reactions of ol ignoletide derivatives   1-366 (CRC Les, Novosibirsk, 1993) and Povsik, T .; , Strawbell, S . And Durban, P.C. , DNA sequence specificity mediated by triple helix formation Double-chain alkylation and cleavage,J. Am. Chem. Soc. 114, 593 4-5944 (1992)). The nucleotide bases in the target RNA or DNA Reactive groups, such as modifiable alkylating agents, are attached to the oligonucleotide. Was. In addition, the enzyme that modifies the nucleic acid was attached to the oligonucleotide (no Reh, D. G. FIG. Valentin, V .; V. Valentina, F.M. Z. , Rebedev, A . V. And Federova, O .; S. ,Design and targeted reactions of oligonucleotide derivat ives   1-366 (CRC Press, Novosibirsk, 1993)). Conventional , These attached chemical groups or enzymes are responsible for antisense or triple-strand interactions. Thus has been used to inactivate specifically targeted DNA or RNA Was. The following is as described herein (see Figures 100-104). In order to achieve in situ reversion of mutations, antisense or triple-strand interactions are used. Useful nucleotide changes that can be used to alter the sequence of targeted DNA or RNA It is a list of further activity.   1. Deamination of 5-methylcytosine to produce thymidine (enzyme cytidine Aminase (Bass, BL,The RNA World( Cold Spring Harbor Laboratory Press (Cold Spri ng Harbor Laboratory Press), Cold Spring Ning Harbor, 1993)). Furthermore, nitrous acid or related compounds are read at T. Promotes oxidative deamination of the captured C (Microbial Genet ics , David Freifelder , Jones and Bartlett Publishers, Inc. De (Jones and Bartlett Publishers, Inc. ), Boston, 1987, 226-230). In addition, hydroxylamine Or related compounds may convert C read at T (Microbial G enetics ， David Fryfelder, Jones and Burt Let Publishers, Inc., Boston, 1987, 2. 26-230).   2. Deamination of cytosine to produce uracil (enzyme cytidine deaminase By (Bus.BL.,The RNA World(Cold Spring Gu Harbor Laboratory Press, Cold Spring Harbor, 19 1993) or by a chemical group similar to nitrite that promotes oxidative deamination. (Microbiological Genetics， David Fryfelder, The Jones and Bartlett Publishers, Inc., Boston, 1987, 226-230)).   3. Deamination of adenine (adenosine) read like G (inosine) Undeaminase, AMP deaminase or dsRNA deamination activity (Bus, BL,The RNA World(Cold Spring Gu Harbor Laboratory Press, Cold Spring Harbor, 19 1993)))).   4. Methylation of cytosine to 5-methylcytosine   5. O read as cytosine by alkynnitrosoureas²-Methyl Thymidine (or O²-Change of thymidine (or uracil) to methyluracil) Exchange (Su (Xu) and Swan (Swann),Tetrahedron Le tters   35: 303-306 (1994)).   6. Can be performed with the mutagenized ethyl methanesulfonate (EMS) (Microbiological Genetics， David Fryfelder, Jones and Bartlett Publishers, Inc. , Boston, 1987, 226-230), read as adenine 6 Conversion of guanine to -O-methyl (or other alkyl) (meter (Mehta ) And Ludlum,Biochimica et Bioph ysica Acta , 521: 770-778 (1978)).   7. Amination of uracil to cytosine (by the cellular enzyme CTP synthetase (Bus, BL,The RNA World(Cold Spree Ning Harbor Laboratory Press, Cold Spring Harbor, 1 In 993)))).   The following are examples of useful chemical modifications that can be used in the present invention. one There are a few preferred simple chemical modifications that can change one base to another. suitable Mutagenic chemicals, such as nitrite or suitable compounds having such activity. The protein is placed on the target oligonucleotide. Such chemicals and Proteins can be bound by standard methods. These are specific technical Molecules that introduce fundamental chemical changes that may be useful regardless of approach including. Levin,Genes, 1983, John Willley and Sa See N.S. Incorporated, NY, pp. 42-48.   The matrix below shows that the described chemical modifications are in RNA or DNA. Subtract transversion reversion (pyrimidine vs. pyrimidine or purine vs. purine) Show that it can happen. Transversion (pyrimidine vs. purine Purines vs. pyrimidines) are preferred because these are the more difficult chemical transformations. Yes. Footnotes indicate certain desirable chemical transformations. Bold typeface footnote is the opposite DN The reaction to the A chain is shown. For example, if it is desired to change A to G By using reaction # 5, which changes the T of the opposite strand to a C at the DNA level. Can be achieved. In this example, the A / T base pair becomes A / C and the DNA If it is replicated or mismatch repair occurs, this can be G / C , So the original A was converted to G.                             ISR matrix                                 Return base   1 Deamination of 5-methylcytosine to produce thymidine.   2 Deamination of cytosine to produce uracil.   Deamination of adenine read like 3 G (inosine).   4 Methylation of cytosine to 5-methylcytosine.   5 O read as cytosine²-Methylthymidine (or O²-Methyl Conversion of thymidine (or uracil) to racil (su and swan,Tetr ahedron Letters   35: 303-306 (1994)).   6 To 6-O-methyl (or other alkyl) read as adenine Conversion of guanine (Meter and Rudolm,Biochimica et Bio phsica Acta , 521: 770-778 (1978)).   7 Amination of uracil to cytosine. Bus, above, FIG. 6c.In vitro selection plan   FIG. 105The ribozyme having such a base changing activity A diagram is provided that describes how to select. Design RNA that turns back on its own (This is similar to the method already used to select for RNA ligase. A. Bartel, D.A. And Zostak, J. et al. (1993), large random array Isolation of a novel ribozyme fromScience  261: 1411-141 8). The degenerate loop on the opposite side of the modified base confers diversity. Smell in buffer After incubating this library of molecules, RNA is reverse transcribed into DNA (Ie, using the standard in the in vitro deployment protocol), and then Select DNA with base changes. Restriction enzyme digestion and size selection or the same Etc. are used to isolate the portion of the DNA with the appropriate base changes. Then, Uccle can be repeated many times.   The in vitro selection (deployment) plan is based on Joyce (Beaudry (Bea). udry), A.A. A. And Joyce, G .; F. (1992),Science   257, 635-641; Joyce, G .; F. (1992),Scienti fic American   267, 90-97) and Zostak (Bartelle, D. And Zostak, J. et al. (1993),Science  261: 1411- 1418; Zostak, J .; W. (1993),TIBS  17, 89-93) Therefore, it is similar to the method developed. Simply put, a random pool of nucleic acids is combined. Where each member contains two domains, (a) A domain consists of a part with a defined (known) nucleotide sequence; ( b) The second domain consists of parts with degenerate (random) sequences. Known Nuku The leotide sequence domain is (1) a nucleic acid that binds to the target (mutant nucleotide (Adjacent to octido), (2) complementary DNA (cDNA) synthesis and their PCR amplification of molecules selected for base modification activity, (3) Purpose of cloning Allows the introduction of restriction endonuclease sites for The degenerate domain is Totally random (4 nucleotides shown at every position in the random part) Each of them can be generated or degeneracy can be partial (Baudoli, A. A. And Joyce, G .; F. (1992),Science  257,6 35-641). In the present invention, the degenerate domain is a mutation salt of the degenerate domain. A known sequence so that it is placed on the opposite side of the group (base targeted for modification) Adjacent to the part including (see FIG. 105). This random la of nucleic acids Fold ibary into a conformation that promotes catalysis of nucleic acid base modifications Incubate under conditions that ensure foldability (reaction protocol is In order to make the selection more stringent, ATP or GTP or S-adenylme Include certain cofactors such as thionine (if methylation is desired) No). After incubation, the nucleic acid is converted into complementary DNA (the starting nucleic acid Is the RNA). A nucleic acid having a base modification (at a mutated base position) is It can be separated from the rest of the nucleic acid population by various methods. For example, Endonuclease cleavage sites can be created as a result of base modifications or abolished. Can be done. When a restriction endonuclease site is created as a result of base modification , The library can be digested with a restriction endonuclease (RE). RE The part of the population that is cleaved by is the population that was able to catalyze the base modification reaction. (Active pool). Novel part of DNA (oligonucleotide primer for PCR Including the imer binding site and the RE site for cloning) Tie to ends to facilitate PCR amplification and subsequent selection cycles (if required) I do. The final pool of nucleic acids with the best base modification activity in the plasmid vector Cloned into and transformed into a bacterial host. Next, form the recombinant plasmid. It can be isolated from a transforming bacterium and the identification of the clone is carried out by DNA sequencing techniques. Can be determined using surgery.   Base modification enzyme nucleic acid (identified by in vitro selection) Can be used to cause biological modification.   In addition, ribozymes specifically bind proteins with enzymatic base-altering activity. Can be deployed to   Using such a ribozyme to cause the above chemical modification in vivo Can be. Ribozymes or the above antisense molecules can be produced by the techniques mentioned above. Can be administered by the methods discussed in.VIII. Nucleic acid administration   Applicants have determined that a double-stranded nucleic acid lacking a transcription termination signal may be encoded with an encoded R It was confirmed that it can be used for continuous expression of NA. This is the R loop, That is, it is an RNA molecule that is non-covalently bound to a double-stranded nucleic acid and is denatured and localized in the double-stranded nucleic acid Achieved by the use of what causes ("bubble" formation) (Thomas (T homes) et al., 1976,Proc. Natl. Acad. Sci. USA   76, 2294). In addition, Applicants have used the RNA portion of the R loop to Centering the entire complex in a desired cell or cell site, and cells of the complex It was confirmed that it could help internal uptake. In addition, the applicant is enzymatically active RNA or ribozyme expression by the use of such R-loop complexes It shows that it can be significantly promoted.   Thus, in one aspect, the invention provides an enzymatic nucleic acid into a cell or tissue. It features a method for the introduction of. A first nucleic acid encoding an enzymatic nucleic acid and a second nucleus Provides a complex with an acid molecule. The second nucleic acid molecule has an R loop base under physiological conditions. It has sufficient complementarity with the first nucleic acid to be able to form a paired structure. R Is a first nucleic acid molecule that promotes expression of RNA from the first nucleic acid under physiological conditions. Is formed in the part of. The method further comprises combining the complex and the cell or tissue with an enzymatic nucleic acid. Contacting under conditions that are produced in the cell or tissue.   A "complex" is simply the division of two nucleic acid molecules between two complementary base pairing sequences. Means interact by forming intermolecular bonds (eg, by hydrogen bonding) You. Generally, the complex allows it to initiate transcription from the first nucleic acid molecule. It is stable under such physiological conditions.   The first and second nucleic acid molecules can be any desired nucleotide base, naturally occurring. (Eg adenine, guanine, thymine and cytosine) or the technique It may be produced from other bases well known in the art or is more stable Modifications to sugar or phosphate residues to achieve complex or greater complex formation. You may have. Furthermore, such molecules are nonnucleotidic instead of nucleotides. It may have a tide. Such modifications are well known in the art and include For example, various chemical modifications that can be made to sugar residues of enzymatic RNA molecules. Described Eckstein et al., International Publication No. WO 92/07 065; Perrault et al., 1990,Nature   344, 565; Pieken et al., 1991,Science, 253,314; Usman and Cedagre. n), 1992,Trends in Biochem. Sci.17,33 4; Asman et al., International Publication No. WO93 / 15187; and Rossi (R ossi) et al., International Publication No. WO91 / 03162, and Sprout ( Sproat), B.I. , European Patent Application No. 92110298.4. I want to be All of these publications are incorporated herein by reference.   "Sufficient complementarity" means that the R loop base pair structure causes transcription of the enzymatic nucleic acid. It means that sufficient base pairing occurs so that it can be formed under suitable conditions. This Those of skill in the art will recognize routine tests that can thus determine sufficient base pairs. There will be. Generally, about 15-80 bases are sufficient in the present invention.   "Physiological condition" means in a cell or tissue targeted by a first nucleic acid molecule. However, the R-loop complex can be formed under many other conditions. One An example of is the use of standard saline at 37 ° C, which is not desired in the present invention. The R loop structure is present at the site of action so that expression of the nucleic acid of It is simply desirable to exist to some extent. R loop structure is stable under those conditions However, the minimum amount of R loop structure formation that causes expression is sufficient. is there. The person skilled in the art will especially be interested in the promoter or leader sequences on the first nucleic acid molecule. Recognize that such measurement of expression is easily achieved in the absence of any shift Will (Daube and von Hippel) , 1992,Science  258, 1320). So, like this Expression can be achieved if the R loop structure is correctly formed by the second nucleic acid To Only. Given a promoter or leader sequence, the R loop structure is , It is preferable that they be formed at a site distant from those parts so as to promote transcription. New   In a related aspect, the invention provides that once expression is initiated, the first nucleic acid is isolated. Either the promoter part or the transcription termination signal, so that it continues until Form an R-loop base pairing structure (above) with a first nucleic acid molecule lacking it A method for the optional introduction of ribonucleic acid into a cell or tissue is featured.   In another related aspect, the present invention relates to a desired cell or tissue. Localization factors such as proteins that will help concentrate the R-loop complex , For example, an antibody, transferrin, a nuclear localization peptide or folate or Providing a second nucleic acid with other such compounds known in the art Features the law.   In a preferred embodiment, the first nucleic acid is a plasmid, such as a promoter. Or the second nucleic acid has a length of about 40-20. 0 bases and generated from ribonucleotides at most positions; and The second nucleic acid is a ligand, such as a nucleic acid, protein, peptide, lipid, carbohydrate , Covalently linked to cellular receptors, nuclear localization factors or to maleimides or Bound to a thiol group; the first nucleic acid expresses the desired gene Is an expression plasmid lacking a promoter capable of Is a double-stranded molecule produced by the deoxyribonucleic acid of; RNA / DNA heteroduplex; promoter part is also a leader in the first nucleic acid -Part also not given; and R-loop prevents nucleosome assembly Modified and designed to help recruit intracellular transcriptional mechanisms .   In another preferred embodiment, the first nucleic acid is one or more enzymatic nucleic acids. For example, it allows the release of therapeutic enzymatic nucleic acids in vivo. Produced by multiple intramolecular and intermolecular cleavage enzyme nucleic acids.   In yet another related aspect, the invention provides the above-described first nucleic acid molecule and a first nucleic acid molecule. Characterized by a complex of two nucleic acid molecules.R-loop complex   When RNA polymerase binds to the plasmid, the plasmid is degraded. To provide a non-integrated plasmid in which transcription occurs continuously in , R-loop complex is designed. It has a length of 40 to 200 nucleotides The RNA molecule is hybridized with a DNA expression plasmid to form an R-loop structure. (See FIG. 106). This RNA is When conjugated with a ligand that binds to the scepter, plasmid / RNA- Trigger internalization of the ligand complex. The formation of R-loops is generally DeWe t, 1987 Methods in Enzymol. 145, 235; Ne uwald et al. , 1977 J .; Virol. 21, 1019; and And Meyer et al. , 1986 J. Ult. Mol. Str. Res . 96,187. Accordingly, those of ordinary skill in the art will appreciate the teachings in the art. Accordingly, the composite of the present invention can be easily designed.   A promoter placed in the retroviral genome is terminated by another promoter. Always acts as a stop signal or reverses the direction of the polymerase, Does not behave as planned. R between the promoter and the reporter gene -The formation of loops is said to increase transfection efficiency . Incubating RNA molecules with double-stranded DNA molecules containing regions complementary to RNA Then, a stable RNA-DNA heteroduplex is formed, which is the same as RNA. The DNA strand with one sequence is replaced in a loop-like structure called the R-loop. available. This replacement of the DNA chain is carried out when the RNA-DNA duplex is DNA. -Because it is more stable than the DNA duplex. Also, 80 nucleoti In a plasmid encoding the β-galactosidase gene using RNA It is said that the R-loop structure was generated in. R-loop is the promoter region Started either in the region or in the leader sequence. R-loop structure containing Microinjection of rasmid into the cytoplasm of COS cells for gene expression Assayed. R-loop formation in the promoter region of the plasmid is inherited It inhibited the expression of offspring. In the leader sequence between the promoter and the gene, or mR RNA that directly hybridizes to the first 80 nucleotides of NA has expression levels To 8-10 fold increase. The proposed mechanism is that R-loop formation is Interferes with the assembly of the osome, which makes the DNA more accessible for transcription It is to be Noh. Alternatively, the R-loop is not involved in DNA replication or transcription. It may resemble an RNA primer that promotes displacement (Daube an d von Hippel, 1992, supra).   One of the salient features of the present invention is the generation of R-loops in selected expression vectors. And introduce them into cells to achieve enhanced expression from the expression vector That is. The presence of the R-loop will help recruit the cellular transcription machinery. R Once NA polymerase binds to the plasmid and initiates transcription, this Process continues until the termination signal is reached or the plasmid is degraded .   The present invention will increase the expression of ribozymes in cells. This intent is transcription Transcription termination signals so that multiple ribozyme units containing products can be generated. Is to construct a plasmid that does not have Listed in Draper (above) In order to release the unit length ribozyme, the The enzyme can be cloned downstream of each therapeutic ribozyme ( See Figure 107).Ligand targeting   Another salient feature of the invention is the R used to generate the R-loop structure. NA is covalently bound to a ligand (nucleic acid, protein, peptide, lipid, carbohydrate, etc.) Is to do. Specific ligands are those that select for the desired cell surface receptor. It can be selected such that it can be selectively combined. This ligand-receptor mutual The action will help internalize the plasmid containing the R-loop. Ie , RNA is used to localize the gene to a specific region of the cell. Bind the DNA to the DNA. The ligand can be attached to RNA using one of several methods. Can be combined. This is a 6 carbon spacer with a terminal primary amine Incorporation of deoxythymidine containing RNA into RNA (see FIG. 108). I want to). This amino group can be directly derivatized with a ligand such as folate. (Lee and Low, 1994 J. Biol. Chem. 269, 31. 98-3204). RNA containing a 6-carbon spacer having a terminal primary amine group Is mixed with folate and the mixture is 1- (3-dimethylaminopropyl) -3-ethyl. React with an activator such as carbodiimide hydrochloride (EDC). This reaction is desired 1-Hydroxybenzotriazole hydrate (H It should be carried out in the presence of OBT).   RNA can also be succinimidyl-4- (p-maleimidophenyl) butyrate. Derivatization with a heterobifunctional cross-linking agent (or linker) such as SMPB You can also SMPB introduces maleimide into RNA. Next, this maleimide React with the thiol moiety in the peptide or protein. Also, succinyl ace Tylthioacetate was used to denature naturally occurring thiol-deficient proteins or peptides. It is also possible to introduce a thiol into the peptide. Amino linker is added to the 5'end of RNA It can be attached to the end or to the 3'end. RNA also hybridizes with DNA. A series of Nukus that extend the linker away from the RNA / DNA complex without soybeans May contain leotide, which interferes with hybridization Can increase the accessibility of a ligand to its receptor without . This is done to facilitate uptake and localization of the R-loop-DNA complex. Using these techniques, nuclear localization signal peptide (NLS) (Landford e t al. , 1984 Cell 37, 801-813; Kalderon. et al. , 1984 Cell 39, 499-509; Goldfarb.   et al. , 1986 Nature 322, 641-644) and the like. Cide and / or transferrin (Curie et al., 199 1 Proc. Natl. Acad. Sci. USA 88, 8850-885 4; Wagner et al. , 1992 Proc. Natl. Acad. Sci. USA 89, 6099-6103; Giulio et al. , 19 94 Cell. Signal. 6,83-90) and other proteins to form R-loops It can be bound to RNA. A protein is attached to the end of the R loop forming RNA. To react with the maleimide using a unique thiol, or imino Thiolate or succinimidyl acetylthioacetate (SATA: Dun can et al. , 1983 Anal. Biochem. 132, 68) Can be used to introduce thiols into the protein itself. SATA is 0. 5 Requires an additional deprotection step with M hydroxylamine.   Further, liposomes can be used to form R- by a technique well known in the art. The loop complex can be delivered to an appropriate intracellular site. For example, pH-sensitive Liposomes (Connor and Huang, 1986 Cancer Res. 46, 3431-3435). I can.   Calcium phosphate mediated or electroporation of R-loop complex into desired cells Poration-mediated delivery can also be easily accomplished.In vitro selection   In vitro selection strategies can be used to a) form stable R-loops Nucleic acids, b) select nucleic acids that can selectively bind to specific cell surface receptors. You can choose. Next, these nucleic acids are covalently linked to each other. This is , R-loop containing plasmids using receptor-mediated endocytosis Helps internalize efficiently. In vitro selection (evolution (evolutio n)) Strategy is based on Joyce (Beaudry and Joyce, 1992). Science 257, 635-641; Joyce, 1992 Science. tific American 267, 90-97) and Szostak ( Bartel and Szostak, 1993 Science 261: 1411-1418; Szostak, 1993 TIBS 17, 89-93. ) Is similar to the method developed by. Easy for each member Two domains, ie, a) one domain, is defined by a defined (known) The second domain is a degenerate (random) sequence. , A random pool of nucleic acids containing is synthesized. Known nucleotides Sequence domains are: 1) binding the nucleic acid to its target (a specific region of double-stranded DNA) 2) its affinity to form R-loops and / or specific receptors Complementary DNA (cDNA) synthesis of a molecule selected for its ability to bind to And PCR amplification, 3) introduction of restriction endonuclease sites for cloning , Is possible. Degenerate domains are completely random (everything in the random There are 4 nucleotides each at position Partial Moyo (Beaudry and Joyce, 1992 Science 2 57,635-641). In the present invention, the degenerate domain comprises a known sequence. It is flanked by the empty area. The random library of this nucleic acid is double-stranded D Make sure to bind equally to either NA or cell surface receptors Incubate under such conditions. After incubation, convert nucleic acid to complementary DNA (If the starting pool of nucleic acids is RNA). The desired sex can be obtained using various methods. Nucleic acids with pages can be separated from the rest of the population of nucleic acids (Joyce, 1 992 (supra). The next round of selection is then performed on the desired pool of nucleic acids. Perform to enrich the population with the most desirable characteristics. Next, these molecules are suitable Clone into the correct vector. Then recombine from the transformed bacteria Isolate the plasmid and determine the identity of the clone using DNA sequencing techniques be able to.   Other embodiments are within the scope of the claims.

[Procedure of Amendment] Article 184-7, Paragraph 1 of the Patent Act [Submission date] December 27, 1995 [Correction contents] 21. 5'-C-alkyl nucleotide, 2'-deoxy-2'-alkyl nu Cleotide, 5'-deoxy-5'-dihalo-methyl nucleotide, 5'-deo Xy-5'-difluoro-methyl nucleotide, 3'-deoxy-3'-dihalo -Methyl nucleotide, and 5 ', 3'-dideoxy-5', 3'-bis (di A nucleoside comprising a nucleotide selected from the group consisting of halo) -methylphosphonate Leotide triphosphate. 22. 20. The 5 of claim 19, wherein the sugar moiety is a taro configuration. A'-C-alkyl nucleoside. 23. 20. The method of claim 19, wherein the sugar moiety is an allo configuration. A'-C-alkyl nucleoside. 24. 5'-C-alkyl nucleotide, 2'-deoxy-2'-alkyl nu Cleotide, 5'-deoxy-5'-dihalo-methyl nucleotide, 5'-deo Xy-5'-difluoro-methyl nucleotide, 3'-deoxy-3'-dihalo -Methyl nucleotide, and 5 ', 3'-dideoxy-5', 3'-bis (di Ori containing a nucleotide selected from the group consisting of halo) -methylphosphonate. Gonucleotide. 25. Equation 1: [Wherein B is a nucleotide base or hydrogen; R1, R2 and R3 are independently , Hydrogen, alkyl groups containing 2-10 carbon atoms, amines, amino acids, And a peptide containing 2-5 amino acids; the zigzag line is , Independently, is hydrogen or a bond] An oligonucleotide comprising a moiety having. 26. An oligonucleotide containing a 3'-amide or peptide group. 27. An oligonucleotide containing a 5'-amide or peptide group. 28. An oligo according to claim 24, 25, 26 or 27 having enzymatic activity. nucleotide. 29. Enzymatic nucleic acid molecule having the activity of cleaving RNA or single-stranded DNA molecule A method for producing a compound having an alkyl group at the 5'-position or 2'-position. A method comprising forming said enzymatic molecule comprising at least one nucleotide.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁶ Identification code Internal reference number FI A61K 35/76 ADY 9283-4C A61K 35/76 ADY ADZ 9283-4C ADZ 38/00 ADU 9051-4C 48/00 ABX 38/16 ABG 8615-4C C07H 21/04 B 48/00 ABX 9359-4B C12N 9/00 C07H 21/04 9282-4B 5/00 B C12N 5/10 9051-4C A61K 37/02 ADU 9/00 9051-4C 37/04 ABG (31) Priority claim number 08 / 222,795 (32) Priority date April 4, 1994 (33) Priority claiming country United States (US) (31) Priority claim number 08 / 227,958 (32) Priority date April 15, 1994 (33) Priority claiming country United States (US) (31) Priority claim number 08 / 228,041 (32) Priority date April 15, 1994 (33) ) Country of priority claim United States US) (31) Priority claim number 08 / 245,736 (32) Priority date May 18, 1994 (33) Priority claim country United States (US) (31) Priority claim number 08 / 271,280 (32) ) Priority date July 6, 1994 (33) Priority claiming country United States (US) (31) Priority claim number 08/291, 932 (32) Priority date August 15, 1994 (33) Priority claiming country United States (US) (31) Priority Claim Number 08 / 291,433 (32) Priority Date August 16, 1994 (33) Priority Claim Country United States (US) (31) Priority Claim Number 08 / 292,620 (32) Priority date August 17, 1994 (33) Priority claiming country United States (US) (31) Priority claim number 08 / 293,520 (32) Priority date August 19, 1994 (33) Priority right Claiming country United States (US) (31) Priority claim number 08 / 300,000 (32) Priority date September 2, 1994 (33) Priority claiming country United States (US) (31) Priority claim number 08/311 , 486 (32) priority September 23, 1994 (33) Priority claim United States (US) (31) Priority claim number 08 / 311,749 (32) Priority date September 23, 1994 (33) Priority claim United States (US) ) (31) Priority claim number 08 / 314,397 (32) Priority date September 28, 1994 (33) Priority claim country United States (US) (31) Priority claim number 08/316, 771 (32) Priority date October 3, 1994 (33) Priority claiming United States (US) (31) Priority claim number 08 / 319,492 (32) Priority date October 7, 1994 (33) Priority claiming United States (US) (31) Priority claim number 08 / 321,993 (32) Priority date October 11, 1994 (33) Priority claim country United States (US) (31) Priority claim number 08 / 334,847 ( 32) Priority date November 4, 1994 (33) Priority claiming country United States (US) (31) Priority claim number 08 / 337,608 (32) Priority date November 10, 1994 (33) Priority claim Country United States (US) (31) Priority claim number 08 / 345,516 (32) Priority date November 28, 1994 (33) Priority claiming country United States (US) (31) Priority claim number 08 / 357,577 (32) Priority date December 16, 1994 (33) Priority claiming United States (US) (31) Priority claim number 08 / 363,233 (32) Priority date December 23, 1994 (33) Priority claiming United States (US) (31) Priority Claim number 08 / 380,734 (32) Priority date January 30, 1995 (33) Priority claiming country United States (US) (81) Designated country EP (AT, BE, CH, DE, DK, ES, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), AU, CA, JP, KR, MX (72) Inventor Direnzo, Anthony 80303, Colorado, USA, Boulder, Ravenwood Road 1197 (72) Inventor Draper, Kenneth G. 80301, Colorado, Boulder, Cloud Co. 4619 (72) Inventor Dudichu, Leff Vu 01603, Worcester, Gates Road, 24603, Worcester, USA 24 (72) Inventor Grim, Susan 80303, Colorado, United States, Boulder, Half South Boulder Road 6968 (72) ) Inventor Karpayski, Alexander 80301, Colorado, United States, Boulder, Williams Fork Trail 5121, number 209 (72) Inventor Kishichi, Kevin, Colorado 80026, Rafayette, John Quill Circle 2451 (72) Inventor Maturic-Adamic, Jasenka 80303, Colorado, United States, Boulder, South Forty Second Street 760 (72) Inventor Maxwigen, James A. 80301, Boulder, Franklin, USA・ Drive 4866 (72) Inventor Modduk, Anil 80301, Colorado, USA United States Boulder, Hopeman Court 3855 (72) Inventor Pavco, Pamela 80026, Colorado, Rafayette, Barberry Circle 705 (72) Inventor Bejell 5803 (72) Inventor Sullivan, Sheen M United States California 94501, Alameda, Marina Village Parkway 850 (72) Inventor Swedler, David United States Colorado State 80027, Louisville, St Andrews Lane 956 (72) Inventor Thompson, James Dee Colorado 80301, United States, Boulder, Glenwood Drive 2925, Number 301 (72) Inventor Truck , Danuta, USA 80301, Boulder, Habitat 6200, number 3029 (72) Inventor Asman, Nasime, USA 80304, Boulder, Karmia 2954, number 37 (72) Inventor Wincot, Francine Y, Colorado USA 80501, Longmont, North 9th Fifth Street 7920 (72) Inventor Wooluf, Todd 02172, Watertown, Fairview Avenue 18 Watertown, USA [Continued Summary].

Claims (1)

[Claims] 1. ICAM-1 mRNA, IL-5 mRNA, relA mRNA, TNF-α mRNA site shown in Table 23, 25, 27 or 28, CML-related mRNA selected from those identified as SEQ ID NOs: 1-25, or 1C. , An enzymatic nucleic acid molecule that cleaves RSV mRNA or RSV genomic RNA in a region selected from the group consisting of 1B and N. 2. The binding arm is complementary to any of the sequences defined in any of Tables 2, 3, 6-9, 11, 13, 15-23, 27, 28, 31, 33, 34, 36, and 37. 2. The enzymatic nucleic acid molecule of claim 1, which comprises a unique sequence. 3. The enzymatic nucleic acid molecule according to claim 1, wherein the nucleic acid molecule has a hammerhead motif. 4. The enzymatic nucleic acid molecule according to claim 1 or 2, wherein the RNA molecule is of hairpin, hepatitis delta virus, group I intron, Neurospora VS RNA or RNaseP RNA motif. 5. The enzymatic nucleic acid molecule according to claim 1 or 2, comprising 12-100 bases complementary to the mRNA or genomic RNA. 6. The enzymatic nucleic acid molecule according to claim 5, comprising 14-24 bases complementary to the mRNA or genomic RNA. 7. The enzymatic nucleic acid molecule according to claim 1 or 2, comprising 5-23 bases complementary to the mRNA or genomic RNA. 8. The enzymatic nucleic acid molecule according to claim 7, comprising 10-18 bases complementary to the mRNA or genomic RNA. 9. An enzyme essentially comprising a sequence selected from the group of sequences shown in Tables 4-8, 10, 12, 14-16, 19-22, 24, 26-28, 30, 32, 34 and 36-38. Nucleic acid molecule. 10. A mammalian cell comprising the enzymatic nucleic acid molecule of claim 1 or 2. 11. The cell according to claim 10, wherein the cell is a human cell. 12. An expression vector comprising one or many nucleic acids encoding the enzymatic nucleic acid molecule of claim 1 or 2 in a manner such that the enzymatic RNA molecule can be expressed in mammalian cells. 13. A mammalian cell containing the expression vector according to claim 12. 14． 14. The cell according to claim 13, wherein the cell is a human cell. 15. A method of treating an etiological condition associated with ICAM-1, IL-5, relA, TNF-α, or RSV mRNA levels by administering to a patient the enzymatic nucleic acid molecule of claim 1 or 2. . 16. A method of treating an etiological condition associated with mRNA levels of ICA M-1, IL-5, relA, TNF-α, or RSV by administering to a patient the expression vector of claim 12. 17． 17. The method of claim 15 or 16, wherein the patient is a human. 18. The condition is atherosclerosis, myocardial infarction, stroke, restenosis, heart disease, cancer, rheumatoid arthritis, asthma, reperfusion injury, inflammatory or autoimmune disease, transplant rejection, myocardial dysfunction. 18. The method of claim 17, selected from the group consisting of blood, stroke, psoriasis, Kawasaki disease, HIV and AIDS, and septic shock. 19. 5'-C-alkyl nucleoside, 2'-deoxy-2'-alkyl nucleoside, nucleoside 5'-deoxy-5'-dihalo-methylphosphonate, nucleoside 5'-deoxy-5'-difluoro-methylphosphonate, nucleoside 3 ' A nucleoside selected from the group consisting of: deoxy-3'-dihalo-methylphosphonate, and 5 ', 3'-dideoxy-5', 3'-bis (dihalo) -methylphosphonate. 20. 5'-C-alkyl nucleotide, 2'-deoxy-2'-alkyl nucleotide, 5'-deoxy-5'-dihalo-methyl nucleotide, 5'-deoxy-5'-difluoro-methyl nucleotide, 3'-deoxy- A nucleotide selected from the group consisting of 3'-dihalo-methyl nucleotides and 5 ', 3'-dideoxy-5', 3'-bis (dihalo) -methylphosphonates. 21. 5'-C-alkyl nucleotide, 2'-deoxy-2'-alkyl nucleotide, 5'-deoxy-5'-dihalo-methyl nucleotide, 5'-deoxy-5'-difluoro-methyl nucleotide, 3'-deoxy- A nucleotide triphosphate comprising a 3'-dihalo-methyl nucleotide and a nucleotide selected from the group consisting of 5 ', 3'-dideoxy-5', 3'-bis (dihalo) -methylphosphonate. 22. 20. The 5'-C-alkyl nucleoside of claim 19, wherein the sugar moiety is in talo configuration. 23. 20. The 5'-C-alkyl nucleoside of claim 19, wherein the sugar moiety is an allo configuration. 24. 5'-C-alkyl nucleotide, 2'-deoxy-2'-alkyl nucleotide, 5'-deoxy-5'-dihalo-methyl nucleotide, 5'-deoxy-5'-difluoro-methyl nucleotide, 3'-deoxy- An oligonucleotide comprising a 3'-dihalo-methyl nucleotide and a nucleotide selected from the group consisting of 5 ', 3'-dideoxy-5', 3'-bis (dihalo) -methylphosphonate. 25. Wherein B is a nucleotide base or hydrogen: R1, R2 and R3 are independently hydrogen, an alkyl group containing 2-10 carbon atoms, an amine, an amino acid, and 2-5 Selected from the group consisting of peptides containing amino acids; the zigzag lines are independently hydrogen or bonds]. 26. An oligonucleotide containing a 3'-amide or peptide group. 27. An oligonucleotide containing a 5'-amide or peptide group. 28. 28. The oligonucleotide according to claim 24, 25, 26 or 27 having enzymatic activity. 29. A method for producing an enzymatic nucleic acid molecule having the activity of cleaving RNA or single-stranded DNA molecule, said enzymatic molecule comprising at least one nucleotide having an alkyl group at its 5'-position or 2'-position. A method comprising forming a. 30. A method for converting a protected allo sugar to a protected taro sugar, which comprises contacting said protected allo sugar with triphenylphosphine, diethylazodicarboxylate, p-nitrobenzoic acid under conditions in which inversion occurs. And a step of obtaining the protected taro sugar. 31. A method of synthesizing a nucleoside-5'- or 3'-dihalo-methylphosphonate, wherein a sugar containing a difluoromethylphosphonate is prepared under suitable conditions to form a nucleoside-5'- or 3'-difluoromethylphosphonate. And a step of condensing with pyrimidine or purine. 32. The oligonucleotide according to claim 3, wherein the U4 and / or U7 positions of a normal hammerhead are substituted with 2'-NH-amino acids. 33. A method of synthesizing RNA, wherein during the coupling step, 5-S-alkyltetrazole is provided at a delivery concentration of 0.1-1.0M for a time of 10 minutes or less for activation of the RNA amidite. A method that includes that. 34. A method for synthesizing RNA, wherein 5-S-alkyltetrazole is added at an effective concentration of 0.15-0.35 M or a final concentration for 10 minutes or less for activation of RNA amidite during the coupling step. The method including providing time. 35. A method for deprotecting RNA, which comprises providing alkylamine (MA) or NH ₄ OH / alkylamine (AMA) at 60 ° C.-70 ° C. for 5-15 minutes to remove the exocyclic amino protecting group from the protected RNA. Is removed, wherein said alkyl is selected from the group consisting of methyl, ethyl, propyl and butyl. 36. A method for deprotecting an RNA alkylsilyl protecting group, said group being contacted with anhydrous triethylamine.hydrogen fluoride (aHF.TEA) trimethylamine or diisopropylethylamine for 0.25-24 hours at 60-70 ° C. A method that includes that. 37. A method of purifying said RNA molecule by passing the enzymatic RNA molecule through an HPLC column, characterized in that said HPLC column is an anion exchange chromatography column. 38. A one pot deprotection method for RNA comprising contacting a protected base with anhydrous methylamine at 60 ° C-70 ° C for at least 5 minutes, cooling the resulting mixture, and adding the mixture to the 2'-hydroxyl position. Contacting with a TEA-3HF reagent under conditions that remove the protecting groups of. 39. A method for synthesizing RNA containing a phosphorothioate bond, which comprises growing 6-10 equivalents of 3H-1,2-benzodithiol-3-one 1,1-dioxide (Beaucauge reagent) And contacting for 5 seconds with a reaction time of at least 300 seconds. 40. A method of synthesizing RNA containing a phosphorothioate bond, comprising the step of performing coupling with 5-S-ethyltetrazole or 5-S-methyltetrazole prior to sulfurization. 41. 41. The method of claim 38, 39 or 40, wherein the RNA is enzymatically active. 42. A method for synthesizing a 2'-deoxy-2'-amino-nucleoside phosphoramidite, which comprises a step of protecting a 2'-amino group with an N-phthaloyl group. 43. 43. The method of claim 42, wherein the nucleoside is base deleted. 44. A method for synthesizing RNA, comprising the step of protecting the 2'-position of a nucleotide with a (trimethylsilyl) ethoxymethyl (SEM) group during the synthesis. 45. A method of covalently attaching an SEM group to the 2'-position of a nucleotide, comprising the step of contacting a nucleoside with an SEM-containing molecule under SEM binding conditions. 46. 46. The method of claim 45, wherein the conditions include dibutyltin oxide and tetrabutylammonium fluoride and SEM-Cl. 47. A method of removing SEM group from a nucleoside molecule or oligonucleotide, the method comprising the step of contacting the molecules or oligonucleotides, in SEM removed under boron trifluoride etherate and (BF ₃ · OEt _2). 48. Wherein (BF ₃ · OEt ₂₎ is provided in acetonitrile The method of claim 57. 49. A first nucleic acid sequence encoding a first ribozyme having intramolecular or intermolecular cleavage activity, wherein the first ribozyme comprises hammerhead, hairpin, hepatitis delta virus, Neurospora VS RNA, Group I, and RNaseP motifs. A second nucleic acid sequence encoding a second ribozyme having intermolecular cleavage activity, wherein the second ribozyme is a hammerhead, hairpin, hepatitis delta virus, Neurospora VS RNA, One or more vectors selected from the group consisting of Group 1 and an RNaseP motif; wherein the second nucleic acid is cleaved by the first ribozyme to form an RNA encoded by the vector. Release the second ribozyme from Flanked by another nucleic acid sequence encoding NA; said first and second nucleic acid sequences may be on the same or different nucleic acid molecules, and said vector is A vector encoding an mRNA having no secondary structure that reduces the release of the second ribozyme by more than 20% or comprising RNA; 50. A cell comprising the vector of claim 49. 51. A transcribed non-naturally occurring RNA molecule comprising a desired therapeutic RNA portion, said molecule being formed by a base pairing interaction between a 3'region and a 5'complementary nucleotide in said RNA. An RNA molecule comprising an intramolecular stem, said stem comprising at least 8 base pairs. 52. 52. The RNA molecule of claim 51, wherein the molecule is transcribed by an RNA polymerase III based promoter system. 53. 52. The RNA molecule of claim 51, wherein said molecule is transcribed by the type 2 pol III promoter system. 54. 52. The RNA molecule of claim 51, wherein the molecule is a chimeric tRNA. 55. 54. The RNA molecule of claim 53, wherein said RNA has A and B boxes separated by 0-300 bases of the type 2 pol III promoter. 56. 54. The RNA molecule of claim 53, wherein the desired RNA molecule is at the 3'end of the B box. 57. 54. The RNA molecule of claim 53, wherein the desired RNA molecule is between the A and B boxes. 58. 54. The RNA molecule of claim 53, wherein the desired RNA molecule comprises the B box. 59. 52. The RNA of claim 51, wherein the desired RNA molecule is selected from the group consisting of antisense RNA, decoy RNA, therapeutic editing RNA, enzymatic RNA, agonist RNA and antagonist RNA. molecule. 60. 52. An RNA molecule according to claim 51, wherein the 5'end is capable of base pairing with at least 12 bases of the 3'region. 61. 52. The RNA molecule of claim 51, wherein the 5'end is capable of base pairing with at least 15 bases of the 3'region. 62. A DNA vector encoding the RNA molecule according to claim 51. 63. 63. The vector according to claim 62, wherein the vector is derived from AAV or adenovirus. 64. An RNA vector encoding the RNA molecule according to claim 51. 65. 66. The vector of claim 64, wherein the vector is from an alphavirus or a retrovirus. 66. 63. The vector of claim 62, wherein a portion of the RNA encoding vector functions as an RNApol III promoter. 67. A cell comprising the vector of claim 62. 68. A cell comprising the vector of claim 53. 69. A cell containing the RNA according to claim 51. 70. A method for providing a desired RNA molecule in a cell, comprising the desired RNA molecule, wherein RNA having a 5'terminal capable of base pairing with at least 8 bases of the 3'region of the RNA molecule is introduced into the cell. A method that includes introducing. 71. 71. The method of claim 70, wherein said introducing comprises providing a vector encoding said RNA molecule. 72. A hammerhead ribozyme having 2 or 3 base pairs in stem II and having an interconnecting loop of 4 or more bases between said base pairs. 73. A hairpin ribozyme lacking a substrate portion, which contains at least 6 bases in helix 2 and can form a base pair with another substrate RNA, wherein the ribozyme is at the 3'side of helix 3 A ribozyme comprising one or more bases capable of base pairing with a substrate RNA to form helix 5, wherein said ribozyme is capable of cleaving and / or ligating said another RNA in trans. 74. 74. The ribozyme of claim 73, wherein the ribozyme comprises 6 bases in helix 2. 75. The structure of Figure 3 [wherein each N and N'is independently any base, its dash represents a hydrogen bond, r is 1-20, q is 2-20. , 0 is 0-20, n is 1-4, and m is 1-20]. 76. A method for increasing the activity of a hairpin ribozyme substrate by providing one or more bases on the 3'side of helix 3 that can base pair with the substrate RNA to form helix 5. 77. A trans-cleaving hairpin ribozyme containing at least 6 base pairs in helix 2 and lacking the substrate RNA portion. 78. A transligation hairpin ribozyme containing at least 6 base pairs in helix 2 and lacking the substrate RNA portion. 79. 74. The ribozyme of claim 73 having the structure of FIG. 80. 74. The ribozyme of claim 73 having the structure of FIG. 81. A cell comprising the ribozyme according to any of claims 73-80. 82. An expression vector comprising a nucleic acid encoding the ribozyme of any of claims 73-80 in a manner such that the ribozyme can be expressed intracellularly. 83. A cell containing the expression vector according to claim 82. 84. A method of altering the nucleotide base sequence of a naturally occurring variant nucleic acid molecule in vivo, comprising the step of contacting said nucleic acid molecule with an oligonucleotide or peptide nucleic acid capable of forming a duplex or triplex molecule with said nucleic acid molecule in vivo. Wherein the formation of said duplex or triplex molecule comprises chemically modifying at least one base in said nucleic acid molecule directly or after in vivo repair of the nucleic acid to function the nucleotide base sequence of said nucleic acid sequence. A method characterized by causing a change to occur. 85. 85. The method of claim 84, wherein the oligonucleotide is of sufficient length to activate the dsRNA deaminase in vivo resulting in the conversion of the adenine base in the RNA molecule to inosine. 86. 85. The method of claim 84, wherein the oligonucleotide comprises an enzymatic nucleic acid molecule having the activity of chemically modifying a base. 87. 85. The method of claim 84, wherein the nucleic acid molecule is DNA or RNA. 88. 85. The method of claim 84, wherein the oligonucleotide comprises a chemical mutagen. 89. 89. The method of claim 88, wherein the mutagen is nitrous acid. 90. 85. The method of claim 84, wherein the oligonucleotide causes 5-methylcytosine to thymidine, cytosine to uracil, or adenine to inosine deamination, or cytosine to 5-methylcytosine methylation. 91. 85. The method of claim 84, wherein the endogenous mammalian editing system co-opts to produce the chemical modification. 92. A method for introducing an enzymatic nucleic acid into a cell or tissue, comprising preparing a complex of a first nucleic acid molecule encoding the enzymatic nucleic acid, the complex being associated with a second nucleic acid molecule, the second nucleic acid molecule being provided. Has sufficient complementarity with said first nucleic acid molecule to be capable of forming an R-loop base pair structure with said first nucleic acid molecule under physiological conditions, wherein said R-loop Is formed at a position in the region of the first nucleic acid molecule that promotes expression of RNA from the first nucleic acid under the conditions; and the complex is formed by the enzymatic nucleic acid molecule in the cell or tissue. Contacting with the cell or tissue under the conditions produced therein. 93. A method of introducing a desired nucleic acid into a cell or tissue, comprising preparing a complex of a first nucleic acid molecule encoding the desired nucleic acid, the complex being associated with a second nucleic acid molecule, the second nucleic acid molecule being provided. Has sufficient complementarity with said first nucleic acid molecule to be able to form an R-loop base pair structure with said first nucleic acid molecule under physiological conditions, wherein said first nucleic acid The molecule lacks a promoter region and the R-loop is formed at a position in the region of the first nucleic acid molecule that promotes expression of RNA from the first nucleic acid under the conditions; Contacting the complex with the cell or tissue under conditions in which the desired nucleic acid molecule is produced in the cell or tissue. 94. A method for introducing a desired nucleic acid into a cell or a tissue, comprising preparing a complex of a first nucleic acid molecule encoding the enzymatic nucleic acid, the complex being associated with a second nucleic acid molecule, the second nucleic acid molecule being provided. Has sufficient complementarity with said first nucleic acid molecule to be capable of forming an R-loop base pair structure with said first nucleic acid molecule under physiological conditions, wherein said R-loop is Formed at a position in the region of said first nucleic acid molecule that promotes expression of RNA from said first nucleic acid under said conditions, said second nucleic acid further comprising a localization factor; and said complex Is contacted with the cell or tissue under conditions in which the desired nucleic acid molecule is produced in the cell or tissue. 95. A complex of a first nucleic acid molecule encoding an enzymatic nucleic acid associated with a second nucleic acid molecule, said second nucleic acid molecule being under physiological conditions and said R-loop base. Has sufficient complementarity with the first nucleic acid molecule to form a paired structure, wherein the R-loop is in the region of the first nucleic acid molecule under the conditions described above. A complex, which is formed at a position that promotes expression of RNA from the first nucleic acid. 96. A complex of a first nucleic acid molecule encoding a desired nucleic acid, wherein the second nucleic acid molecule is associated with the second nucleic acid molecule, wherein the second nucleic acid molecule and the R-loop base under physiological conditions. Having sufficient complementarity with said first nucleic acid molecule to be capable of forming a paired structure, wherein said first nucleic acid molecule lacks a promoter region, said R-loop Is formed at a position in the region of the first nucleic acid molecule that promotes expression of RNA from the first nucleic acid under the conditions described above. 97. A complex of a first nucleic acid molecule encoding an enzymatic nucleic acid associated with a second nucleic acid molecule, said second nucleic acid molecule being under physiological conditions and said R-loop base. Has sufficient complementarity with the first nucleic acid molecule to be capable of forming a paired structure, wherein the R-loop is under the conditions in a region of the first nucleic acid molecule. A complex formed at a position that promotes expression of RNA from the first nucleic acid, wherein the second nucleic acid further comprises a localization factor.