JPH0948800A - Galanin receptor protein, its production and use - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new galanin receptor protein which has a specific amino acid sequence and is useful as a preventive or therapeutic agent for gastric ulcer as a galanin receptor agonist or in the development of a preventive or therapeutic agent for diabetes and Alzheimer's disease as an antagonist. SOLUTION: This new galanin receptor protein or its salt includes the same amino acid sequence as those represented by formulas I, II or III. It is useful for screening galanin receptor antagnists which inhibits the action of galanin to inhibit the liberation of neurotransmitter and to suppress the insulin secretion and in screening agonists which promote the actions of galanin thereby enabling the development of a preventive or therapeutic agent for diabetes, Alzheimer's syndrome, dementia or an insulin secretion accelerator as an antagonist and the development of a preventive or therapeutic agent for schizophrenia, gastric ulcer or a suppresser for insulin secretion as an agonist. This protein is prepared by culturing CHO cells transformed by the gene recombinant technology.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a novel galanin receptor protein or a partial peptide thereof or a salt thereof, a DNA containing a DNA encoding the galanin receptor protein or a partial peptide thereof, the galanin receptor protein or a partial peptide thereof, or a portion thereof. Method for producing salt, use of the galanin receptor protein (or its partial peptide) and its DNA, method for measuring physiological activity of galanin using the galanin receptor protein or its expressing cell, and the galanin receptor protein or its expressing cell Galanin receptor agonist or antagonist screening method, kit for the screening, agonist or antagonist obtained by the screening method, and further the agonist or antagonist Relates to a pharmaceutical containing the antagonist.

In one embodiment, the present invention comprises a novel mouse-derived galanin receptor protein derived from the mouse pancreatic β-cell line MIN6, a salt thereof, a partial peptide of the protein or a salt thereof, and a DNA encoding the mouse-derived galanin receptor protein. DNA, method for producing the mouse-derived galanin receptor protein, use of the galanin receptor protein and its DNA, method for measuring physiological activity of galanin using mouse-derived MIN6 cells or mouse-derived galanin receptor protein, and mouse-derived M
The present invention relates to a method for screening galanin receptor agonists or antagonists using IN6 cells or the mouse galanin receptor protein.

In a preferred embodiment, the present invention provides a human galanin receptor protein, a partial peptide of the human galanin receptor protein, a DNA encoding the human galanin receptor protein or its partial peptide, a vector containing the DNA, and a vector containing the vector. Transformant, method for producing human galanin receptor protein, screening method for galanin receptor agonist / antagonist using human galanin receptor protein or cells expressing human galanin receptor protein, screening kit, human obtained by the screening method・
Galanin receptor agonist or antagonist,
And a pharmaceutical composition containing the agonist or antagonist.

[0004]

2. Description of the Related Art Many hormones and neurotransmitters regulate the function of the living body through specific receptor proteins present in the cell membrane. Many of these receptor proteins are guanine nucleotide-binding proteins
(Hereinafter sometimes abbreviated as G protein) to signal intracellularly through activation and to have a common structure having seven transmembrane regions. Collectively referred to as transmembrane receptor proteins. G protein-coupled receptor proteins are present on the surface of various functional cells in living cells and organs,
They play a very important role as targets for molecules that regulate the functions of cells and organs of the living body, such as hormones, neurotransmitters, and physiologically active substances.

The pancreas plays an important role in glucose metabolism by secreting glucagon and insulin in addition to secreting digestive juice. Insulin is secreted by β-cells of the pancreas, but is promoted mainly by glucose. Various receptors exist in β cells of this pancreas, and many factors other than glucose, peptide hormones (galanin, somatostatin, gastric inhibitory polypeptide, glucagon, amylin, etc.), sugars (mannose, etc.), amino acids, It is known that insulin secretion is controlled by neurotransmitters and the like. However, for galanin and amylin, the receptor protein c
No knowledge on the structure of DNA has been reported so far. Furthermore, it was not known whether an unknown receptor protein or receptor protein subtype exists.

Clarifying the relationship between substances that regulate the complex functions of the pancreas and their specific receptors is a very important means for drug development. And an agonist for a receptor protein for regulating the function of the pancreas,
In order to efficiently screen antagonists and develop pharmaceuticals, it was necessary to elucidate the function of the gene of the receptor protein and express them in an appropriate expression system. In recent years, G protein-coupled receptor proteins have been
Taking advantage of the similarity of the amino acid sequence to a part of its structure, the polymerase chain reaction (Poly
merase chain reaction (hereinafter, abbreviated as PCR) method has been used to search for a novel receptor protein.

Galanin is a peptide existing in the central and peripheral parts, and in the central part, suppression of neurotransmitter (acetylcholine) release (European Journal of Pharmacology, 164: 355-360, 1989),
Antagonism with exogenous acetylcholine (Proceeding of National Academy of Science
USA, 85, 9841-9845, 1988.
Year), insulin secretion is suppressed in the pancreas (diabetes, 3
4, pp. 192-196, 1985) and the like. Galanin also suppresses learning behavior (Neuroscience Letters, Vol. 88, 331-335).
P., 1988), and the effect of suppressing a feeling of satiety after eating has been confirmed. These findings suggest that if a drug that inhibits the action of galanin is developed, it can be used as a nootropic drug, a drug for treating obesity, or a drug for treating diabetes.

The pharmacological actions of galanin are all mediated by specific galanin receptors present in the target tissue. Therefore, the most convenient method of inhibiting the action of galanin is to develop a drug that specifically inhibits the reaction of galanin acting on the receptor, that is, a galanin receptor antagonist. In general, it is necessary to perform receptor binding experiments to develop receptor antagonists. In the case of Galanin, the hippocampus (European Journal of Biochemistry, 181, 269-276, 1989) and stomach,
Duodenum (Peptize, Vol. 11, pp. 333-338, 1
990) and other experiments using galanin receptor binding have been reported.

Rin-m obtained from rat pancreas
-It has been reported that a specific galanin receptor also exists in 5F cells (endoclinology, 124
Vol., 2635-2641, 1989). According to these reports, it is possible to carry out galanin receptor binding experiments. However, the galanin receptor content in these membrane fractions was extremely low at around 50 fmol / mg, and it was necessary to use a large amount of membrane fraction for one measurement.

[0010] Galanin exerts the above-mentioned pharmacological actions in vivo, but if these actions can be easily measured in vitro, it will be significant in the process of developing a receptor antagonist. Regarding the insulin secretion inhibitory action of galanin, it has already been reported that it can be replaced by an in vitro assay method using Langerhans islets isolated from the pancreas (European Journal of Pharmacology, 203, 111-114,
1991). However, Langerhans islets need to be isolated each time the experiment is performed, and this method cannot be said to be a simple method.

As a simpler method, several methods using a pancreatic β cell line (Rin-m-5F cells) have been reported. For example, a method for measuring the effect of the galanin receptor on the second messenger system, that is, the activity of inhibiting adenylate cyclase (European Journal of Biochemistry, 177, 147-1).
52, 1988), and a method for measuring the activity of opening potassium channels (Proceeding of
National Academy of Sciences USA,
85, 1312-1316, 1988) and the like. In addition, a method for measuring the insulin secretion inhibitory activity of galanin using this cell line has been reported, but these are only for forskolin (adenylate cyclase activator) -dependent insulin secretion, No measurement for glucose-dependent insulin secretion was possible. Moreover, the amount of insulin secretion was small and the sensitivity was low.

Then, a method for producing a β cell line using the pancreas of a transgenic mouse was developed (Proceeding of National Academy of Science.
USA, 85, 9037-9041, 1988.
, ΒTC-1 cells (Proceeding of National Academy of Science USA, 85)
Vol. 9037-9041, 1988), IgSV1
95 cells (Diabates, 38, 1056-1062
P., 1989), and establishment of cell lines such as MIN6 cells (endoclinology, 127, 126-132, 1990). Among them, MIN6 cells secrete insulin depending on glucose concentration.
It best retains the original differentiation function of cells and has a high insulin secretion. However, it has not yet been known that the MIN6 cells express the galanin receptor protein. Further, there has not been proposed a system for evaluating the biological activity of galanin, or an efficient and specific method for screening galanin receptor agonists or antagonists using MIN6 cells.

Recently, a cDNA encoding a human-derived galanin receptor protein was cloned, and its nucleotide sequence and the amino acid sequence encoded by the cDNA were clarified (Proceeding National Academic Science USA (Proc. Natl. Aca
d. Sci. USA.) 91, 9780-983, October 11, 1994). However, no specific means for screening galanin receptor agonist / antagonist using the receptor is described. Therefore, it has been desired to develop a method for efficiently screening a galanin receptor agonist / antagonist.

Galanin is a polypeptide consisting of 29 amino acid residues isolated from porcine small intestine in 1983 [Ta
temoto, K. et al., FEBS Lett. 1
64,124-128 (1983)], and its primary structure is little similar to other cerebral intestinal hormones. Galanin immunoreactivity, along with its receptor, is widely distributed in the central and peripheral nervous systems [Scofitsch, G. and Jacobowit
z, DM Peptides, 6,509-54
6 (1985), Melander, T. et al., Journal of Comparative Neurology (J. Comp. Neuro.
l.), 248, 475-517 (1986), Rokaeus,
A., Trends in Neuroscience
Neurosci.), 10, 158-164 (1987)],
Since its distribution pattern coincides with the region containing classical neurotransmitters such as 5-HT, noradrenaline and acetylcholine, it is considered that they coexist with these neurotransmitters, and galanin is one of these neurotransmitters. It is thought that it regulates the actions of the anterior and posterior nerves.

Galanin has a wide variety of physiological actions, and strongly suppresses the monosynaptic reflex in the spinal nervous system in the central nervous system [Yanagisawa, M. et al., Neuroscience Letter (Neurosci. Lett.), 70. Two
78-282 (1986)], and its action was shown to be much more potent than somatostatin. In addition, stimulation of feeding behavior by administration to rat ventricle nuclei [Kyrokouli,
SE et al., European Journal of Pharmacology. 122, 159.
-160 (1986)], involvement in memory formation [Crawley,
JN and Wenk, GL, Trends Neurosci., 12, 278-282.
(1989)], suppression of dopamine secretion in median eminence [Nordstrom, O. et al., Neuroscience Letter (Neurosci. Lett.), 73, 21-26 (198).
7)], Inhibition of acetylcholine release on the hippocampal compound side [Fiso
ne, G. et al., Procedures of the National Academy of Sciences of USA (Proc. Natl. Acad. Sci. USA), 84, 733.
9-7343 (1987)], decreased 5-HT turnover [Fuxe, K. et al., Acta. Physiol. Acand., 13].
3, 579-581 (1988)], and activates ATP-sensitive K ⁺ channels to reduce glutamate release [Ben-Ari, Y., European Journal of Neuroscience (Eur. J. Neurosci.), 2, 6
2-68 (1990)], the physiological importance of the central role of galanin has been suggested.

[0016] In particular, galanin is the only neuropeptide with which choline acetyltransferase coexists in the medial septal nucleus, diagonal fascicle nucleus and basal nucleus [Melender,
T. et al., Brain Res., 36
0, 130-138 (1985), Melender, T. et a.
l., Neuroscience Letter (Neurosci. Lett.
), 19, 223-240 (1986), Chen-Palay,
V., Bran Res. Bull, 21,
465-472 (1988)], while an inhibitory effect on the cholinergic nerve has been shown, degeneration of the cholinergic nerve is observed at these sites in Alzheimer's disease. It is expected that it may prevent the degeneration of cholinergic nerves due to illness (Whitehouse, PJ et a
l., Science, 215, 1237-12
39 (1982), Chen-Palay, V., Journal of Comparative Neurology (J. Comp. Neuro
l.), 273, 543-557 (1988)). In the pituitary gland, the secretion stimulating action of growth hormone and prolactin is recognized [Tanoh, T. et al., Neuroendocrinology, 54, 83-].
88 (1991), Koshiyama, H. et al., Neuroscience Letter (Neurosci. Lett.), 75, 49-.
54 (1987)], and in particular, the involvement of cholinergic neurons in regulating growth hormone secretion via hypothalamic somatostatin secretion.

On the other hand, in the peripheral system, in the pancreas, galanin stimulates the basal secretion of insulin in vivo and in vitro.
Suppress both ro [McDnald, TJ et al., Diaabates, 34, 192-196 (1985), Ta
keda, Y. et al., Biomedical Research (Biom
ed. Res.), 8 (Suppl.), 117-125 (198).
7), Lindskog, S. et al., Acta. Physiol. Scand.,
129, 305-309 (1987)] and also suppresses glucose-stimulated insulin release [Dunn.
ing, BE and Taborsky GJ, Jr., Dia Bates (Di
Abates), 37, 1157-1162 (1988)].
Furthermore, gallanin is one of the neuroregulators of the secretion of pancreatic hormones, especially insulin, in combination with the immunohistological findings that a dense nerve fiber network containing galanin immunoreactivity is found around the β-cell Langerhans islets. It strongly suggests that there is. In the stomach, galanin also dose-dependently suppresses the basal secretion of somatostatin, or G
Inhibition of gastrin and somatostatin secretion by RP stimulation, and a nerve fiber network containing galanin immunoreactivity are found in the stomach, so galanin acts as one of the important neuroregulators of gastric endocrine regulation in the stomach as well. (Yanaihara, N. et al., Galanin (eds. By Hokfelt, T. et al.), M
acmillan Press, 185-196 (1991)].

From these facts, the galanin agonist is useful as a drug such as a growth hormone secretagogue and an insulin secretion inhibitor, while the galanin antagonist is useful as a drug such as a growth hormone secretagogue and an insulin secretagogue. I know there is. In general, when developing an agonist or antagonist of a physiologically active substance, a compound having a high affinity with a receptor to which the substance specifically binds is searched. As the galanin receptor, the hippocampal membrane fraction of bovine is currently used. However, since the animal species are different, the compound having a high affinity for the membrane fraction also affects the human galanin receptor. There is no guarantee of high affinity. Human
The galanin receptor cDNA has been cloned and its expression in COS cells has been reported [Habert-O.
rtoll, E. et al., Procedures of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA) 91, 9
780-9783 (1994)], and it is considered to be unsuitable for screening because of low expression level and transient expression.

[0019]

DISCLOSURE OF THE INVENTION The present invention provides a novel galanin receptor protein, a partial peptide thereof or a salt thereof, a DNA containing a DNA encoding the galanin receptor protein or a partial peptide thereof, and the DNA.
Containing a vector, a host transformed with the vector, a cell membrane fraction obtained from the transformant, a method for producing the galanin receptor protein or a partial peptide thereof or a salt thereof, the galanin receptor protein or an expression cell thereof ( (Including the transformant), a method for measuring a galanin physiological activity, a method for screening a galanin receptor agonist or antagonist using the galanin receptor protein or cells expressing the same, the screening kit, the agonist or antagonist obtained by the screening A drug containing an agonist or antagonist to the galanin receptor protein, an antibody to the galanin receptor protein,
The present invention provides an immunoassay technique using the galanin receptor protein or its antibody, and uses of the galanin receptor protein and its DNA.

The present invention also relates to the mouse pancreatic β cell line MIN.
6. A novel mouse-derived galanin receptor protein or a partial peptide thereof or a salt thereof, a DNA containing a DNA encoding the mouse-derived galanin receptor protein or a partial peptide thereof, a mouse-derived galanin receptor protein or a partial peptide thereof or a salt thereof Production method, method for measuring physiological activity of galanin using mouse-derived galanin receptor protein or mouse-derived MIN6 cells, screening method for mouse-derived galanin receptor protein or galanin receptor agonist or antagonist using mouse-derived MIN6 cells, and galanin receptor protein Antibody to
The present invention provides an immunoassay technique using the galanin receptor protein or its antibody, and uses of the galanin receptor protein and its DNA.

The human galanin receptor protein produced by the conventional method and the COS cells expressing the human galanin receptor protein were insufficient as a receptor preparation for use in screening for galanin receptor agonist / antagonist. .. Therefore, it has been desired to establish a more practical method for producing a human galanin receptor protein. If human galanin receptor proteins can be used to screen for galanin receptor agonists / antagonists, the disadvantages of using laboratory animals (eg, compounds that cannot exert effects on humans due to different species can be obtained) Therefore, it is expected that effective pharmaceuticals for humans can be efficiently developed.

Therefore, the present invention provides a novel human-derived galanin receptor protein, a partial peptide of the human-derived galanin receptor protein, or a salt thereof, a DNA containing the human-derived galanin receptor protein or a DNA encoding the partial peptide, A vector containing the DNA, a host transformed with the vector, a cell membrane fraction obtained from the transformant, a method for producing the human-derived galanin receptor protein or a partial peptide thereof or a salt thereof, and the human-derived galanin receptor Method for measuring physiological activity of galanin using protein, cells derived from human galanin receptor protein or cell membrane fraction obtained therefrom, galanin receptor protein derived from human, galanin receptor using cells derived from human galanin receptor protein, etc. Method for screening agonist or antagonist, kit for screening, agonist or antagonist obtained by the screening, further drug containing agonist or antagonist to human-derived galanin receptor protein, antibody to human-derived galanin receptor protein, human-derived It provides an immunoassay technique using a galanin receptor protein or an antibody thereof, and uses of the human galanin receptor protein and its DNA.

[0023]

Means for Solving the Problems The inventors of the present invention have conducted extensive studies in order to solve the above problems, and as a result, have been able to more efficiently isolate a DNA encoding a G protein-coupled receptor protein. Was successfully synthesized, cDNA was amplified from various cells using the primer, and its analysis was advanced. As a result, the inventors
CD encoding a novel G protein-coupled receptor protein
We successfully isolated the NA fragment and determined its partial structure. This G protein-coupled receptor protein was found to have DNA and amino acid homology with known G protein-coupled receptors, and was considered to encode a novel galanin receptor protein. Furthermore, as a result of repeated studies by the present inventors, a cDNA having a full-length translation frame
Was successfully cloned, and the entire amino acid sequence and entire base sequence of the galanin receptor protein were successfully analyzed.

When the present inventors use the receptor protein expressed by an appropriate means, the present inventors can use the receptor protein binding experiment or the measurement of intracellular second messenger as an index to obtain a compound from in vivo or natural / non-natural compounds. It has been found that it is possible to screen for agonists or antagonists for the receptor protein.
Furthermore, the present inventors have found that the agonist and antagonist can be developed as a prophylactic / therapeutic agent for diseases caused by galanin. Furthermore, the present inventors have obtained the first finding that glucose-dependent or forskolin-dependent insulin secretion in the cells expressing the galanin receptor protein is suppressed by galanin. Based on this finding, the present inventors have found a simple method for measuring galanin and galanin antagonist activity. At the same time, it was found that the cell membrane fraction of the cells expressing the galanin receptor protein contained a large amount of galanin receptor, and succeeded in establishing a screening method for a galanin receptor agonist / antagonist using the cell membrane fraction of the cells. .

For example, the present inventors have amplified a cDNA derived from the mouse pancreatic β cell line MIN6 using a DNA primer for more efficiently isolating a DNA encoding a G protein-coupled receptor protein, The analysis proceeded. As a result, the present inventors succeeded in isolating a mouse-derived cDNA fragment encoding a novel G protein-coupled receptor protein and determining the partial structure thereof.
This G protein-coupled receptor protein derived from mouse is
Since homology of known amino acids with G protein-coupled receptors was recognized, it was considered to encode a novel receptor protein which is expressed and functions in mouse pancreas. Furthermore, as a result of repeated studies, the present inventors have succeeded in cloning a cDNA having a full-length translation frame and in analyzing the entire amino acid sequence and the entire base sequence of the receptor protein. And
This mouse-derived G protein-coupled receptor protein
Galanin receptor protein of human origin (Proc. Natl. Acad. Sci. USA.) 91, pp. 9780-978
3, October 11, 1994), and the homology with the DNA and amino acid sequences was high, it was found that this mouse-derived G protein-coupled receptor protein is a mouse-derived galanin receptor protein.

Furthermore, the present inventors have for the first time found that glucose-dependent or forskolin-dependent insulin secretion in MIN6 cells is suppressed by galanin. Based on this finding, the present inventors have found a simple method for measuring galanin and galanin antagonist activity. In addition, at the same time, the cell membrane fraction of MIN6 cells was large (0.5-1.0 pmol / m2).
g) MIN6 was found to contain a galanin receptor.
We have succeeded in establishing a screening method for galanin receptor agonists / antagonists using cell membrane fractions of cells.

More specifically, the present inventors amplified and cloned the novel cDNA fragment derived from the mouse pancreatic β cell line MIN6 shown in FIG. 1 by the PCR method, and analyzed the sequence to obtain a novel cDNA fragment. It was clarified that it encodes a receptor protein. When this sequence was translated into an amino acid sequence, the third, fourth, fifth and sixth transmembrane regions were confirmed on the hydrophobicity plot [Fig. 2]. The size of the amplified DNA was about 400 bp, which was comparable to that of the known G protein-coupled receptor protein.

The present inventors searched the database using the nucleotide sequence of this cDNA as a template and found that the known G
Human-derived somatostatin receptor subtype 4 (JN0605), which is a protein-coupled receptor protein, human-derived somatostatin receptor subtype 2 (B417
95) and rat-derived ligand unknown receptor (A3
9297) and amino acids with homology of 36%, 30% and 30%, respectively (Fig. 3). The abbreviations in parentheses above are reference numbers when registered as data in NBRF-PIR / swiss-PROT, and are usually Accession Numb.
It is called er or entry name.

Furthermore, the present inventors prepared cDNA from the Poly (A) ⁺ RNA fraction extracted from MIN6 cells,
This cDNA was inserted into lambda gt22 phage to give a cDNA
An NA library was made. Furthermore, by screening a cDNA library using the G protein-coupled receptor protein cDNA fragment p3H2-34 obtained by PCR as a probe, it is possible to clone a cDNA that completely encodes the G protein-coupled receptor protein of the present invention. Successful. The nucleotide sequence of the cDNA and the amino acid sequence encoded by it are shown in FIG. When a hydrophobicity plot was made based on this amino acid sequence, the first, second, third, fourth, fifth and sixth
And the 7th transmembrane region was confirmed on the hydrophobicity plot [Fig. 5]. The G protein-coupled receptor protein of the present invention was found to have 92% homology in amino acid with a known human galanin receptor protein [Fig. 6].

In another embodiment, for example, the present inventors have succeeded in cloning a DNA encoding a novel human galanin receptor protein having an amino acid sequence different from the known human galanin receptor protein. The 15th amino acid in the amino acid sequence of the known human galanin receptor protein is Cys, while the 15th amino acid sequence of the human galanin receptor protein of the present invention (SEQ ID NO: 5 and FIGS. 11 and 12). The th amino acid is Trp. Of the known DNA sequences of human galanin receptor protein, the first sequence of the human galanin receptor protein
The base sequence encoding the 5th amino acid is ¹⁵ C each
In contrast to ys (TGT), of the nucleotide sequences of the DNA encoding the human galanin receptor protein of the present invention, the nucleotide sequence encoding the 15th amino acid of the human galanin receptor protein is ¹⁵ Trp ( TGG)
It is.

Furthermore, the present inventors have found that COS cells expressing a known human galanin receptor protein [Habe
rt-Ortoll, E. et al., Procedures of the
National Academy of Sciences of the USA (Proc.Natl. Acad. Sci. USA) 9
1, 9780-9783 (1994)], which expresses the human galanin receptor protein of the present invention in a much larger amount than that of CHO.
Succeeded in producing a cell line. It was found that the human galanin receptor agonist / antagonist can be screened efficiently and reliably by using the CHO cell line or the human galanin receptor protein of the present invention or its partial peptide. The present inventors have further studied based on these findings, and have completed the present invention.

That is, the present invention provides (1) a galanin receptor protein containing an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 5. Or a salt thereof, (2) a first (1) produced by a transformant CHO cell
Galanin receptor protein according to item (3), DNA containing a DNA having a nucleotide sequence encoding the galanin receptor protein according to item (1), and (4) containing the DNA according to item (3). (5) A transformant carrying the vector according to (4), (6) A transformant according to (5), wherein the host cell is a CHO cell. ) A method for producing a galanin receptor protein or salt thereof according to item (1), which comprises culturing the transformant according to item (5) to produce a galanin receptor protein or salt thereof, (8) (i) ) A case where galanin is contacted with the galanin receptor protein or its salt or its partial peptide or its salt described in (1), and (ii) the galanin receptor described in (1). -A method for screening a galanin receptor agonist or antagonist, which comprises comparing a protein or a salt thereof, a partial peptide thereof or a salt thereof with a galanin and a test sample, (9) (1) A kit for screening a galanin receptor agonist or antagonist, which comprises the galanin receptor protein or a salt thereof or a partial peptide thereof or a salt thereof, (10) the screening method according to (8) or (9) There is provided a galanin receptor agonist or antagonist obtained by using the screening kit according to the item.

More specifically, the present invention provides (11) a mouse-derived galanin receptor protein or a salt thereof, which comprises an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 1. (12) The mouse-derived galanin receptor protein or salt thereof according to the above (11), which contains an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 2, (13) the amino acid represented by SEQ ID NO: 5 A human galanin receptor protein or a salt thereof, which contains an amino acid sequence substantially identical to the sequence; (14) a partial peptide of the galanin receptor protein or a salt thereof according to (1), (15) (11) or the partial peptide of the mouse-derived galanin receptor protein according to (12) or a salt thereof, (1) ) The (13) a partial peptide, or a salt thereof human galanin receptor protein according to claim,

(17) A DNA containing a DNA having a nucleotide sequence encoding the mouse galanin receptor protein according to (11) or (12), and (18) human galanin according to (13). A DNA containing a DNA having a nucleotide sequence encoding a receptor protein, (19) The DNA according to item (17) having a nucleotide sequence represented by SEQ ID NO: 3, (20) A nucleotide sequence represented by SEQ ID NO: 4. (21) The DNA according to item (18), which has the nucleotide sequence represented by SEQ ID NO: 6, and (22) the DNA according to item (17). (23) A vector containing the DNA according to (18), and (24) A transformant carrying the vector according to (22). (25) A transformant carrying the vector according to (23),

(26) The transformant according to item (24) is cultured, and a mouse-derived galanin receptor protein is produced on the cell membrane of the transformant.
(1) A method for producing a mouse galanin receptor protein or a salt thereof according to item (1), (27) The transformant according to item (25) is cultured under conditions capable of expressing a DNA encoding a human galanin receptor protein. (28) A method for producing a human galanin receptor protein according to (13), (28) A cell containing the galanin receptor protein according to (1) or a cell membrane fraction thereof, (29) ( (11) or a cell containing the mouse galanin receptor protein according to (12) or a cell membrane fraction thereof, (30) a cell containing the human galanin receptor protein according to (13) or a cell membrane fraction thereof ,

(31) Use of the galanin receptor protein or salt thereof according to item (1), the partial peptide or salt thereof according to item (14), or the cell or cell membrane fraction thereof according to item (28). (32) A method for screening a galanin receptor agonist or antagonist, comprising: (32) the mouse galanin receptor protein or a salt thereof according to (11) or (12), (1)
5. A method for screening a galanin receptor agonist or antagonist, which comprises using the partial peptide or salt thereof according to item 5), or the cell or cell membrane fraction thereof according to item (29), (33) (13) Galanin receptor agonist or antagonist, characterized by using the human galanin receptor protein or salt thereof, the partial peptide or salt thereof according to item (16), or the cell or cell membrane fraction thereof according to item (30) Screening method,

(34) (i) The galanin receptor protein or salt thereof according to item (1), the partial peptide or salt thereof according to item (14), or the cell or cell membrane fraction thereof according to item (28), and When contacted with galanin, (ii) the galanin receptor protein or salt thereof according to item (1), the partial peptide or salt thereof according to item (14), or the cell or cell membrane drawing thereof according to item (28). Minute, galanin and a test compound, etc. are contacted with a sample, and a method for screening a galanin receptor agonist or antagonist, comprising: (35) (i) mouse-derived item (11) Galanin receptor protein or salt thereof or partial peptide or salt thereof according to the item (15), and When the sample was contacted with lanine, (ii) the mouse-derived galanin receptor protein or salt thereof described in (11) or the partial peptide or salt thereof described in (15), galanin and a test compound were contacted. A method for screening a galanin receptor agonist or antagonist, which is characterized by performing a comparison with a case, (36) (i) the human galanin receptor protein or a salt thereof or the portion according to (16). Peptides or salts thereof, cells containing the human galanin receptor protein described in (30) or cell membrane fractions thereof, and galanin, and (ii) human galanin receptor described in (13). Protein or salt thereof or partial peptide according to item (16) or It is characterized in that the salt thereof, or the cell containing the human galanin receptor protein described in (30) or a cell membrane fraction thereof, and a test sample such as galanin and a test compound are contacted with each other. Galanin receptor agonist or antagonist screening method,

(37) The galanin receptor protein or salt thereof according to item (1), the partial peptide or salt thereof according to item (14), or the cell or cell membrane fraction thereof according to item (28). (38) A kit for screening a galanin receptor agonist or antagonist, the mouse-derived galanin receptor protein or a salt thereof according to (38), (11) or (12),
(5) A kit for screening a galanin receptor agonist or antagonist, which comprises the partial peptide or salt thereof described in (5) or the cell or cell membrane fraction thereof described in (29), (39) (13) A galanin receptor agonist, which comprises the human galanin receptor protein or a salt thereof, the partial peptide or a salt thereof according to (16), or the cell or a cell membrane fraction thereof according to (30). Or an antagonist screening kit, (40) obtained using the screening method according to any one of (31) to (36) or the screening kit according to any one of (37) to (39) A galanin receptor agonist or antagonist, (41 Galanin receptor agonist or antagonist obtained by using the screening method according to (32) or (35) or the screening kit according to (38), (42) the screening according to (33) or (36) Galanin receptor agonist or antagonist obtained by using the method or the screening kit according to (39),

(43) A pharmaceutical composition comprising the galanin receptor agonist according to item (40), (44) A pharmaceutical composition comprising the galanin receptor agonist according to item (41). (45) A pharmaceutical composition comprising the galanin receptor agonist according to (42), and (46) a pharmaceutical composition comprising the galanin receptor antagonist according to (40). (47) A pharmaceutical composition comprising the galanin receptor antagonist according to (41), and (48) a pharmaceutical composition comprising the galanin receptor antagonist according to (42). Composition, (49) Acetylcholine release inhibitor, insulin secretion inhibitor, growth hormone secretagogue, learning The pharmaceutical composition according to item (43), which is an inhibitor or a satiety suppressor, (50) Acetylcholine release promoter, growth hormone secretion inhibitor, insulin secretion promoter, learning behavior promoter or satiety The pharmaceutical composition according to item (46), which is a sensitizer, (51) the galanin receptor protein or salt thereof according to item (1), or the partial peptide or salt thereof according to item (14). (52) A mouse galanin receptor protein or a salt thereof according to (52), (11) or (12), or an antibody against the partial peptide according to (15) or a salt thereof, and (53) (13). ) The human galanin receptor protein or a salt thereof, or the antibody against the partial peptide or a salt thereof according to (16), Subjected to.

More specifically, (54) labeled galanin is the galanin receptor protein or salt thereof according to item (1) (for example, (11))
The mouse-derived galanin receptor protein or a salt thereof, etc.) or the galanin receptor protein partial peptide or a salt thereof according to (14) (for example, the mouse galanin receptor protein partial peptide or a salt thereof according to (15)), etc. ), The labeled galanin and the test compound are added to the galanin receptor protein or salt thereof according to item (1) (for example, the mouse-derived galanin receptor protein or salt thereof according to item (11)) or When the galanin receptor protein partial peptide according to (14) or a salt thereof (for example, the mouse-derived galanin receptor protein partial peptide according to (15) or a salt thereof) is contacted, the labeled galanin (1) ) Galanin receptor White matter or a salt thereof (for example, a mouse-derived galanin receptor protein or a salt thereof described in (11)) or a galanin receptor protein partial peptide or a salt thereof described in (14) (for example, described in (15)) A method for screening a galanin receptor agonist or antagonist, which comprises measuring and comparing the amount of binding to a mouse-derived galanin receptor protein partial peptide or a salt thereof),

(55) A cell containing the labeled galanin containing the galanin receptor protein according to item (1) (for example, a cell containing the mouse-derived galanin receptor protein according to item (11) [provided that the mouse-derived MIN is present.
6 cells (excluding FERM BP-4954)], and labeled galanin and a test compound containing the galanin receptor protein of item (1) (eg, item (11). Of the mouse-derived galanin receptor protein, etc. (except mouse-derived MIN6 cells (FERM BP-4954), etc.), and the amount of labeled galanin bound to the cells was measured and compared. A method for screening a galanin receptor agonist or antagonist, comprising:

(56) A cell containing the labeled galanin containing the galanin receptor protein according to item (1) (for example, a cell containing the mouse-derived galanin receptor protein according to item (11) [provided that mouse-derived MIN.
6 cells (excluding FERM BP-4954)] and the case where the labeled galanin and the test compound are contacted with the cell membrane fraction of the cells (eg, the cells containing the galanin receptor protein described in (1) (for example, (( 11) A cell containing the mouse-derived galanin receptor protein or the like described in [11], provided that the mouse-derived MIN6 cell (FERM BP-
4954) except] and the like), the amount of labeled galanin bound to the membrane fraction of the cells is measured and compared, and a method for screening a galanin receptor agonist or antagonist is characterized. ,

(57) Galanin expressed on the cell membrane of the transformant by culturing the transformant described in (5) (eg, the transformant described in (24)) with the labeled galanin. When contacted with a receptor protein (for example, mouse-derived galanin receptor protein), labeled galanin and the test compound are transformed into the transformant described in (5) (eg, the transformant described in (24)). ) Is contacted with a galanin receptor protein expressed on the cell membrane of the transformant (for example, mouse-derived galanin receptor protein etc.) to measure the amount of labeled galanin bound to the mouse-derived galanin receptor protein. Of galanin receptor agonists or antagonists characterized by Ningu way,

(58) Galanin is a cell containing the galanin receptor protein according to item (1) (for example, (1)
1) A cell containing the mouse-derived galanin receptor protein or the like described in [1], provided that the mouse-derived MIN6 cell (F
ERM BP-4954), etc.)), and cells containing the galanin receptor protein according to item (1), and a galanin and a test compound (eg mouse-derived galanin receptor according to item (11)). To measure and compare the cell stimulating activity mediated by the mouse-derived galanin receptor protein when contacted with cells containing a protein or the like (except mouse-derived MIN6 cells (FERM BP-4954), etc.) A method for screening a galanin receptor agonist or antagonist, which comprises:

(59) Galanin is a transformant according to item (5) (for example, a transformant according to item (24))
When a galanin receptor protein expressed on the cell membrane of the transformant (for example, mouse-derived galanin receptor protein etc.) is brought into contact with the transformant by culturing, and the galanin and the test compound are added to the transformant ( For example, when the galanin receptor protein expressed in the cell membrane of the transformant (eg, the mouse-derived galanin receptor protein) is contacted by culturing the transformant described in (24), etc., the galanin receptor Measuring the cell stimulating activity through a protein (for example, mouse galanin receptor protein),
A method for screening a galanin receptor agonist or antagonist, which comprises comparing,

(60) Cell stimulating activities are arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular c
AMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-
Activities that promote or suppress fos activation, pH decrease, insulin secretion, etc. (in particular, intracellular cAMP
(58) or (59), which is the activity of promoting or suppressing production or insulin secretion, etc., (61) (31), (34) (for example, (3
2), (35) and the like), and a galanin receptor agonist or antagonist obtained by the screening method according to any one of (54) to (60),

(62) An acetylcholine release inhibitor, an insulin secretion inhibitor, a learning behavior inhibitor or a satiety inhibitor, which comprises the galanin receptor agonist according to (61), (63) (61) ) An acetylcholine release promoter, an insulin secretion promoter, a learning behavior promoter or a satiety promoter, which comprises the galanin receptor antagonist according to the item (64) (40) (for example, (41). Terms, etc.),
Or a cognitive enhancer, an agent for treating obesity or an agent for treating diabetes, which comprises the galanin receptor antagonist according to item (61), (65) a cell containing the galanin receptor protein according to item (1) (for example, Item (37) (eg, a cell containing the mouse-derived galanin receptor protein or the like according to Item (11)) (for example, (3)
8) and the like) screening kit

(66) It contains a membrane fraction of cells containing the galanin receptor protein according to item (1) (for example, cells containing the mouse-derived galanin receptor protein according to item (11)). Characteristic No. (37)
Item (eg, item (38) or the like), the screening kit according to item (67) item (37) (eg, item (38) or the like),
A galanin receptor agonist or antagonist obtained by using the screening kit according to item (65) or (66), and (68) an acetylcholine comprising the galanin receptor agonist according to item (67). Release inhibitors, insulin secretion inhibitors, learning behavior inhibitors or satiety inhibitors,

(69) An acetylcholine release promoter, insulin secretion promoter, learning behavior promoter or satiety promoter, which comprises the galanin receptor antagonist according to (67), (70) (40) ) (Eg, (41), etc.),
Or a nootropic agent, an agent for treating obesity or an agent for treating diabetes, which comprises the galanin receptor antagonist according to item (69), and (71) the antibody according to item (51) (for example, item (52))
And the galanin receptor protein or salt thereof according to item (1) (for example, the mouse-derived galanin receptor protein or salt thereof according to item (11)) or galanin according to item (14). Receptor protein partial peptide or its salt (for example, the first (1
The galanin receptor protein partial peptide derived from mouse or the salt thereof according to item 5) is brought into contact with the galanin receptor protein or salt thereof according to item (1) (for example, the mouse according to item 11). Derived galanin receptor protein or salt thereof, etc.) or Galanin receptor protein partial peptide or salt thereof according to item (14) (eg mouse-derived galanin receptor protein partial peptide or salt thereof according to item (15)) I will provide a.

Further, the present invention provides (72) mouse-derived MIN6 cells (FERM BP-4
954) or a method for measuring the physiological activity of galanin, which comprises measuring the biological activity of mouse MIN6 cells when galanin is contacted with the cell membrane fraction thereof, (73) (i) mouse-derived MIN6 cells ( FERM B
P-4954) or its cell membrane fraction with galanin, and (ii) mouse-derived MIN6 cells (FER
MBP-4954) or a cell membrane fraction thereof is compared with a case where galanin and a test compound are contacted, a method for screening a galanin receptor agonist or antagonist, (74) Mouse-derived MIN6 cells (FERM BP -4
954) or a cell membrane fraction thereof for screening a galanin receptor agonist or antagonist, (75) the screening method according to (73) or the screening kit according to (74) A galanin receptor agonist or antagonist obtained by

(76) An acetylcholine release inhibitor, an insulin secretion inhibitor, a learning behavior inhibitor or a satiety inhibitor, which comprises the galanin receptor agonist according to (75), (77) (75) ) Acetylcholine release promoter, insulin secretion promoter, learning behavior promoter or satiety promoter, which comprises the galanin receptor antagonist described in (7) above. (78) Labeled galanin in mouse-derived MIN6 cells (FERM BP- 4954), and labeled galanin and the test compound were added to mouse-derived MIN6.
Cell (FERM BP-4954) is contacted, the binding amount of labeled galanin to the mouse-derived MIN6 cells is measured and compared, a screening method for galanin receptor agonist or antagonist, (79) labeling When the galanin was contacted with the cell membrane fraction of mouse-derived MIN6 cells (FERM BP-4954), and when labeled galanin and the test compound were contacted with the cell membrane fraction of mouse-derived MIN6 cells (FERM BP-4954). (80) A method for screening a galanin receptor agonist or antagonist, which comprises measuring and comparing the amount of labeled galanin bound to a membrane fraction of the mouse-derived MIN6 cells (80) Galanin-derived mouse MIN6 cells (FERM
BP-4954) and galanin and test compound were added to mouse-derived MIN6 cells (FERM B).
P-4954), a cell-stimulating activity mediated by a mouse galanin receptor protein (particularly, insulin secretory activity or MI from MIN6 cells).
N6 intracellular cAMP production suppressing activity or promoting activity) is measured and compared, a method for screening a galanin receptor agonist or antagonist,

(81) Cell stimulating activities are arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular c
AMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-
Activities that promote or suppress fos activation, pH decrease, insulin secretion, etc. (in particular, intracellular cAMP
(80) an activity of promoting production or insulin secretion, or an activity of suppressing insulin secretion), (82) (73) and (78) to (81)
Item 7. A galanin receptor agonist or antagonist obtained by using the screening method according to any one of items (83) to (75) or (82), which comprises the galanin receptor agonist Agent, insulin secretion inhibitor, learning behavior inhibitor or satiety inhibitor, (84) Acetylcholine release accelerator comprising the galanin receptor antagonist according to (75) or (82), insulin Secretagogue,
Provide a learning behavior promoter or satiety promoter, (85) an agent for treating obesity, a therapeutic agent for obesity or a therapeutic agent for diabetes, which comprises the galanin receptor antagonist according to (75) or (82) To do.

More specifically, in the present invention, the (86) partial peptide is a partial peptide of the human galanin receptor protein molecule described in (13), which is exposed outside the cell membrane. (87) The vector is a human galanin receptor protein expression vector designated by pTS863 (87).
The vector of 3), (88) The transformant is a CHO cell, The transformant of (25), (89) The CHO cell is designated as CHO / pTS863-5 or CHO / pTS863-7. The CHO cell according to item (88), which is a CHO cell, (90) the cell is CHO / pTS863-5 or CHO.
The cell or cell membrane fraction thereof according to item (30), which is a CHO cell represented by / pTS863-7, (91) (i) the human galanin receptor protein or salt thereof according to item (13), or Galanin is contacted with the partial peptide or salt thereof according to item (16), and (ii) the human galanin receptor protein or salt thereof according to item (13), or the partial peptide according to item (16). Alternatively, a method for screening a galanin receptor agonist or antagonist according to item (33), which comprises performing a comparison with a case where galanin and a test compound are contacted with a salt thereof.

(92) (i) The labeled galanin is first (1)
The method of contacting the human galanin receptor protein according to item 3) or a salt thereof, or the partial peptide according to item (16) or a salt thereof, and (ii) labeled galanin and a test compound according to item (13). Human galanin receptor protein or a salt thereof, or binding of labeled galanin to the human galanin receptor protein, a partial peptide thereof or a salt thereof when contacted with the partial peptide or a salt thereof according to (16) The thirty-third (33) characterized by measuring and comparing quantities
The method for screening a galanin receptor agonist or antagonist according to the item (93) (i), wherein the labeled galanin is brought into contact with the cell or the cell membrane fraction thereof according to the item (30),
i) A galanin receptor agonist or antagonist according to item (33), which is characterized in that a labeled galanin and a test compound are contacted with the cell according to item (30) or a cell membrane fraction thereof. Screening method, (94) (i) A case where the labeled galanin is contacted with the cell or the cell membrane fraction thereof according to (30),
i) When the labeled galanin and the test compound are contacted with the cell or the cell membrane fraction thereof according to (30), the binding amount of the labeled galanin to the cell or the cell membrane fraction thereof is measured and compared. A method for screening a galanin receptor agonist or antagonist according to (33),

(95) (i) When galanin is contacted with the cell or the cell membrane fraction thereof described in (30),
(Ii) when galanin and a test compound are contacted with the cell or the cell membrane fraction thereof according to the item (30),
Cell stimulating activity via recombinant human galanin receptor (eg, K ⁺ channel opening, N-type Ca ⁺ channel closing, arachidonic acid release, acetylcholine release,
Fluctuation of intracellular Ca ²⁺ concentration, suppression of intracellular cAMP production,
Inositol phosphate production, cell membrane potential fluctuations, phosphorylation of intracellular proteins, c-fos activation, pH decrease, cell migration activity, hormone secretion, G protein activation, activity or suppression that promotes cell proliferation, etc. Activity, etc.) are measured and compared, (96) A method for screening a galanin receptor agonist or antagonist according to item (33), wherein the pharmaceutical composition is an acetylcholine release inhibitor, an insulin secretion inhibitor, growth hormone The pharmaceutical composition according to item (45), which is a secretion stimulant, a learning behavior inhibitor or a satiety inhibitor, (97) The pharmaceutical composition is a prophylactic / therapeutic drug or analgesic for schizophrenia or gastric ulcer (45) (98) The pharmaceutical composition according to (98), wherein the pharmaceutical composition is an acetylcholine release promoter, a growth hormone secretion inhibitor, and an insulin secretion promoter. The pharmaceutical composition according to item (48), which is an agent, a learning behavior promoting agent or a satiety promoting agent, (99) The pharmaceutical composition according to claim (48), which is a preventive / therapeutic agent for diabetes, Alzheimer's disease or dementia. (100) A prophylactic / therapeutic agent for galanin receptor protein deficiency, which comprises the DNA according to (100) (18), and (101) the galanin receptor protein deficiency is diabetes,
The preventive / therapeutic agent according to item (100), which is Alzheimer's disease or dementia.

In the present specification, "substantially the same" means that the activities of proteins, such as the binding activity of a ligand and the physiological properties, are substantially the same. Amino acid substitutions, deletions or insertions often do not result in a significant change in the physiological or chemical properties of the polypeptide, in which case the polypeptide with the substitutions, deletions or insertions, may have such substitutions, It would be substantially identical to the one without the deletion or insertion. Substantially identical substitutions of amino acids in the amino acid sequence can be selected from other amino acids of the class to which the amino acid belongs. Non-polar (hydrophobic) amino acids include alanine, leucine,
Isoleucine, valine, proline, phenylalanine,
Examples thereof include tryptophan and methionine. Examples of polar (neutral) amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, glutamine and the like. Examples of positively charged (basic) amino acids include arginine, lysine, and histidine. Examples of negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

The galanin receptor protein of the present invention includes warm-blooded animals (eg, guinea pig, rat, mouse,
Pigs, sheep, cows, horses, monkeys, humans, rabbits, cats, dogs, etc.) (eg amygdala, pituitary, pancreas, brain (whole brain, midbrain substantia nigra), kidney, liver, gonad , Thyroid, gallbladder, bone marrow, adrenal gland, skin, muscles, lungs,
Galanin receptor protein derived from gastrointestinal tract, stomach, blood vessel, heart, thymus, spleen, white blood cell, etc., and containing substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1. Anything may be used as long as it is. That is, the galanin receptor protein of the present invention has about 90 to 99.9% homology with the amino acid sequence represented by SEQ ID NO: 1 in addition to the protein containing the amino acid sequence represented by SEQ ID NO: 1. Examples thereof include a protein containing the amino acid sequence and having substantially the same activity as the protein containing the amino acid sequence represented by SEQ ID NO: 1. Examples of substantially the same activity include galanin binding activity and signal transduction. "Substantially the same quality" means that the galanin binding activity and the like are qualitatively the same. Therefore, strength and weakness such as strength of galanin binding activity and quantitative factors such as molecular weight of receptor protein may be different.

In one embodiment, the mouse galanin receptor protein of the present invention includes all mouse tissues (eg, amygdala, pituitary gland, pancreas, brain, kidney,
Galanin receptor protein derived from liver, gonad, thyroid gland, gallbladder, bone marrow, lung, gastrointestinal tract, blood vessel, heart, thymus, spleen, white blood cell, etc. May be any as long as they contain substantially the same amino acid sequence. That is, the mouse-derived galanin receptor protein of the present invention has a homology of about 90 to 99.9% with the amino acid sequence represented by SEQ ID NO: 1 in addition to the protein containing the amino acid sequence represented by SEQ ID NO: 1. And a protein having substantially the same activity as the protein containing the amino acid sequence represented by SEQ ID NO: 1.

Examples of substantially the same activity include galanin binding activity and signal transduction. "Substantially the same quality" means that the galanin binding activity and the like are qualitatively the same. Therefore, strength and weakness such as strength of galanin binding activity and quantitative factors such as molecular weight of receptor protein may be different. More specifically, the mouse-derived galanin receptor protein of the present invention includes, in addition to the galanin receptor protein derived from the mouse pancreatic β-cell line MIN6 (FERM BP-4954), which contains the amino acid sequence represented by SEQ ID NO: 1. , 1 or 2 or more amino acids in the amino acid sequence represented by SEQ ID NO: 1 (preferably 1 or more and 30 or less, more preferably 1 or more and 20 or less, more preferably 1 or more and 10 or less amino acids ) Deleted amino acid sequence, SEQ ID NO: 1
An amino acid sequence in which 1 or 2 or more amino acids (preferably 1 or more and 30 or less, more preferably 1 or more and 20 or less, more preferably 1 or more and 10 or less amino acid) are added to the amino acid sequence represented by Or 1 or 2 or more amino acids in the amino acid sequence represented by SEQ ID NO: 1 (preferably 1 or more and 30 or less, more preferably 1 or more and 20 or less, more preferably 1 or more and 10 or less) Examples thereof include a mouse-derived galanin receptor protein containing an amino acid sequence in which (amino acid) is replaced with another amino acid.

More specifically, the amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 2 (eg, about 90 to the amino acid sequence represented by SEQ ID NO: 2).
A galanin receptor protein derived from a mouse pancreatic β cell line MIN6 containing an amino acid sequence having 99.9% homology). Furthermore, 1 or 2 or more amino acids in the amino acid sequence represented by SEQ ID NO: 2 (preferably 1 or more and 30 or less, more preferably 1 or more and 20 or less, more preferably 1 or more and 10 or less) Amino acid) deleted amino acid sequence, SEQ ID NO: 2
An amino acid sequence in which 1 or 2 or more amino acids (preferably 1 or more and 30 or less, more preferably 1 or more and 20 or less, more preferably 1 or more and 10 or less amino acid) are added to the amino acid sequence represented by Alternatively, 1 or 2 or more amino acids in the amino acid sequence represented by SEQ ID NO: 2 (preferably 1 or more and 30 or less, more preferably 1 or more and 20 or less, more preferably 1 or more and 10 or less) A mouse-derived galanin receptor protein containing an amino acid sequence in which (amino acid) is replaced with another amino acid is also included.

In one embodiment, the human of the present invention
Galanin receptor protein includes all human tissues (for example, stomach, pituitary gland, pancreas, brain (whole brain, midbrain substantia nigra, etc.), kidney, liver, gonad, thyroid, gallbladder, bone marrow, adrenal gland, skin, muscle, Any human galanin receptor protein derived from lung, gastrointestinal tract, blood vessel, heart, etc.) or cells, etc., which contains substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 5. It may be one. That is, as the human galanin receptor protein of the present invention, in addition to the protein containing the amino acid sequence represented by SEQ ID NO: 5, the amino acid sequence represented by SEQ ID NO: 5 and about 90 to 99.9%
SEQ ID NO: 5 containing an amino acid sequence having homology of
And a protein having substantially the same activity as the protein containing the amino acid sequence represented by. Examples of substantially the same activity include ligand binding activity and signal transduction. "Substantially the same quality" means that the ligand binding activity and the like are qualitatively the same. Therefore, strength and weakness such as strength of ligand binding activity and quantitative factors such as molecular weight of receptor protein may be different.

More specifically, examples of the human galanin receptor protein of the present invention include human-derived human galanin receptor protein characterized by containing the amino acid sequence represented by SEQ ID NO: 5. The human galanin receptor protein of the present invention has an amino acid sequence or sequence in which 1 or 2 or more (preferably 1 or more and 20 or less) amino acids in the amino acid sequence represented by SEQ ID NO: 5 are deleted. An amino acid sequence in which 1 or 2 or more (preferably 1 or more and 20 or less) amino acids are added to the amino acid sequence represented by the number: 5,
1 or 2 in the amino acid sequence represented by SEQ ID NO: 5
Also included are proteins containing an amino acid sequence in which one or more (preferably one or more and 20 or less) amino acids are substituted with other amino acids.

Furthermore, in the galanin receptor protein of the present invention, the N-terminal Met has a protecting group (eg, formyl group,
That is protected by a C _1-6 acyl group such as an acetyl group), the N-terminal side of Glu is cleaved in vivo, and
Is pyroglutaminated, the side chain of amino acid in the molecule is protected by a suitable protecting group (eg, C _1-6 acyl group such as formyl group, acetyl group, etc.), or sugar chain is bound. Complex proteins such as so-called glycoproteins are also included. However, the known human galanin receptor protein having an amino acid sequence in which the 15th Trp of the amino acid sequence represented by SEQ ID NO: 5 is substituted with Cys is excluded from the range of the human galanin receptor protein of the present invention.

The salt of the galanin receptor protein of the present invention is preferably a physiologically acceptable acid addition salt. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) And tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid and benzenesulfonic acid). The galanin receptor protein of the present invention or a salt thereof can be produced from tissues or cells of warm-blooded animals by a method known per se for protein purification. It can also be produced by culturing. Further, it can also be produced according to the peptide synthesis method described later.

As the partial peptide of the galanin receptor protein of the present invention, for example, a portion of the galanin receptor protein molecule of the present invention that is exposed outside the cell membrane is used. Specifically, it is a peptide containing a portion analyzed to be an extracellular region (hydrophilic region) in the hydrophobicity plot analysis of the galanin receptor protein of the present invention. In addition, hydrophobic (Hydrophobic
) A peptide partially containing a site can be used as well. A peptide containing individual domains may be used, but a peptide containing a plurality of domains at the same time may be used. For example, the partial peptide of the mouse-derived galanin receptor protein of the present invention is specifically shown in [Fig. 2], such as the portion of the mouse-derived galanin receptor protein molecule of the present invention which is exposed outside the cell membrane. In the hydrophobic plot analysis of the mouse-derived galanin receptor protein of the present invention, the extracellular region (hydrophilic
Site)) is a partial peptide analyzed.

The salt of the partial peptide of the galanin receptor protein of the present invention is preferably a physiologically acceptable acid addition salt. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) And tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid and benzenesulfonic acid).

The partial peptide of the galanin receptor protein of the present invention or a salt thereof can be produced by a method known per se for peptide synthesis, or by cleaving the galanin receptor protein of the present invention with an appropriate peptidase. The peptide synthesis method may be either a solid phase synthesis method or a liquid phase synthesis method. That is, the target peptide can be produced by condensing a partial peptide or amino acid capable of constituting the protein of the present invention with the remaining portion and, when the product has a protecting group, removing the protecting group. Examples of known condensation methods and elimination of protective groups include the methods described in the following (1) to (3).

M. Bodanszky and MA Ondetti,
Peptide Synthesis, Intersci
ence Publishers, New York (1966) Schroeder and Luebke, The Peptid
e), Academic Press, New York (1965) Nobuo Izumiya et al., Fundamentals and experiments of peptide synthesis, Maruzen Co., Ltd.
(1975) Haruaki Yajima and Shunpei Sakakibara, Laboratory of Biochemistry 1, Protein Chemistry IV, 205, (1977) Supervised by Haruaki Yajima, Development of Pharmaceuticals Volume 14 Peptide Synthesis Hirokawa Shoten Also, after reaction, it is normal. The protein of the present invention can be purified and isolated by a combination of purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization and the like. When the protein obtained by the above method is a free form, it can be converted into an appropriate salt by a known method, and conversely, when it is obtained with a salt, it can be converted into a free form by a known method. it can.

The DNA encoding the galanin receptor protein of the present invention includes the above galanin containing an amino acid sequence substantially the same as the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 5 of the present invention. It contains a nucleotide sequence encoding a receptor protein (excluding the known human galanin receptor protein having an amino acid sequence in which the 15th Trp of the amino acid sequence represented by SEQ ID NO: 5 has been replaced by Cys). It may be any one. Further, it may be any of genomic DNA, tissue / cell-derived cDNA, and synthetic DNA.
The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, using the mRNA fraction prepared from tissues / cells, the Reverse Transcriptase Polyme
It can also be amplified by a rase chain reaction (hereinafter abbreviated as RT-PCR method).

In one embodiment, the DNA encoding the mouse galanin receptor protein of the present invention is derived from a mouse containing an amino acid sequence substantially the same as the amino acid sequence of SEQ ID NO: 1 of the present invention. Any one may be used as long as it contains a nucleotide sequence encoding a galanin receptor protein. More specifically, the DNA encoding the galanin receptor protein derived from the mouse pancreatic β-cell line MIN6 containing the amino acid sequence of SEQ ID NO: 1 is a DNA containing the DNA having the nucleotide sequence represented by SEQ ID NO: 3. Are used. Further, as the DNA encoding the galanin receptor protein derived from the mouse pancreatic β-cell line MIN6 containing the amino acid sequence of SEQ ID NO: 2, DNA containing the DNA having the nucleotide sequence represented by SEQ ID NO: 4 is used. .

Furthermore, as the DNA encoding the human galanin receptor protein of the present invention, the above-mentioned human galanin receptor protein containing an amino acid sequence substantially the same as the amino acid sequence of SEQ ID NO: 5 of the present invention ( However, except for a known human galanin receptor protein having an amino acid sequence in which the 15th Trp of the amino acid sequence represented by SEQ ID NO: 5 is replaced with Cys)
Any may be used as long as it contains a nucleotide sequence encoding More specifically, as the DNA encoding the human galanin receptor protein containing the amino acid sequence of SEQ ID NO: 5, DNA having the nucleotide sequence represented by SEQ ID NO: 6 or the like is used.

As a means for cloning the DNA which completely encodes the galanin receptor protein of the present invention, synthetic D having a partial base sequence of the galanin receptor protein is used.
Amplification by PCR method using NA primer,
Alternatively, the DNA incorporated into an appropriate vector is selected by hybridization with a DNA fragment having a part or the whole region of the galanin receptor protein or one labeled with a synthetic DNA. The hybridization method is, for example, Molecular Cloning 2nd (ed.
; J. Sambrook et al., Cold Spring Harbor Lab. Pre
ss, 1989). When a commercially available library is used, the procedure is performed according to the method described in the attached instruction manual. For example, D which completely encodes the mouse galanin receptor protein of the present invention
As a means for cloning NA, synthetic DNA having a partial base sequence of mouse galanin receptor protein
Hybridization with DNA amplified by the PCR method using primers or incorporated into an appropriate vector and labeled with a DNA fragment having a part or the whole region of human or mouse-derived galanin receptor protein or a synthetic DNA Select by.

The cloned DNA encoding the galanin receptor protein can be used as it is, or if desired, after digestion with a restriction enzyme or addition of a linker, depending on the purpose. The DNA has ATG as a translation initiation codon at its 5 'end and TAA, TGA or TGA as a translation stop codon at its 3' end.
It may have AG. These translation initiation codon and translation termination codon can also be added using a suitable synthetic DNA adapter.

Galanin receptor protein DNA of the present invention
(For example, an expression vector, in particular, an expression plasmid containing human galanin receptor protein DNA) can be prepared by, for example, (B) It can be produced by ligating the DNA fragment downstream of a promoter in an appropriate expression vector (for example, an expression plasmid in the case of human galanin receptor protein DNA). As the vector, a plasmid derived from E. coli (eg, pBR322, pB
R325, pUC12, pUC13), a Bacillus subtilis-derived plasmid (eg, pUB110, pTP5, pC19)
4), yeast-derived plasmids (eg, pSH19, pSH1
5), bacteriophage such as λ phage, animal viruses such as retrovirus, vaccinia virus, and baculovirus are used. The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression.

When the host for transformation is a bacterium of the genus Escherichia, the trp promoter, the lac promoter,
rec A promoter, λP _L promoter, lpp promoter, etc., when the host is Bacillus sp.
When the host is yeast, such as O1 promoter, SPO2 promoter and pen P promoter, PHO5 promoter, PGK promoter, GAP promoter,
The ADH promoter and the like are preferable. When the host is an animal cell, SV40-derived promoter, retrovirus promoter, metallothionein promoter, heat shock promoter, cytomegalovirus (CMV) promoter, SRα promoter and the like can be used. The use of enhancers for expression is also effective.

If necessary, a signal sequence suitable for the host is added to the N-terminal side of galanin receptor protein. When the host is a bacterium of the genus Escherichia, alkaline phosphatase signal sequence, OmpA signal sequence, etc., when the host is a bacterium of the genus Bacillus, α-amylase signal sequence, subtilisin signal sequence, etc., the host is yeast When the host is an animal cell, for example, an insulin signal sequence, an α-interferon signal sequence, an antibody molecule / signal sequence, etc., respectively. Available.

Further, among the vectors containing the human galanin receptor protein DNA of the present invention, a preferred method for constructing an expression plasmid is shown below. As the plasmid, pAKKO-111 (sometimes referred to as pA1-11), pRc / CMV, pRc / RSV, etc. are used. Among them, pAKKO-111 (pA1-11)
Are preferred. As the promoter, any promoter can be used so long as it functions efficiently in the host cell.
0 early promoter, CMV promoter, HSV-T
K promoter, SRα promoter, RSV promoter and the like, among which CMV promoter, S
The Rα promoter and the like are preferable, and the SRα promoter is particularly preferable. It is preferable to use an expression plasmid containing an enhancer, a splicing signal, a poly A addition signal, a selection marker and the like in addition to the above. Examples of the selectable marker include dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene, neomycin phosphotransferase (hereinafter sometimes referred to as neo gene), and the like. The dhfr gene confers methotrexate (MTX) resistance and the neo gene is G
Provides -418 resistance. In particular, when the dhfr gene is used as a selection marker using CHO cells deficient in the dhfr gene, selection can be performed using a thymidine-free medium.

The preferred expression plasmid carrying the DNA encoding the human galanin receptor protein of the present invention specifically includes the above promoters (especially SRα promoter) upstream of the DNA encoding the human galanin receptor protein. ) Is inserted, preferably the SV early gene poly A addition signal is inserted downstream of the DNA encoding the human galanin receptor protein, and the dhfr gene, ampicillin resistance gene, etc. are inserted downstream of the poly A addition signal. Are preferred. More specifically, for example, the SRα promoter is inserted upstream of the human galanin receptor protein DNA, the SV early gene poly A addition signal is inserted downstream of the DNA encoding the human galanin receptor protein, and the dhfr gene is inserted downstream thereof. And an expression plasmid (FIG. 13) designated by pTS863, in which an ampicillin resistance gene is inserted further downstream. Human galanin receptor protein DN produced in this manner
By introducing an expression plasmid containing A into a host cell, a cell capable of highly expressing the DNA encoding the human galanin receptor protein can be prepared.

Galanin receptor protein DNA of the present invention
As a host cell into which a vector containing is introduced, for example, Escherichia, Bacillus, yeast, insect cells, animal cells and the like are used. A transformant is produced using the vector containing the DNA encoding the galanin receptor protein thus constructed. Specific examples of the Escherichia bacterium and the Bacillus bacterium include Escherichia coli K12 DH1 [Procedures of the National Academy
Of Sciences of the USA (Pro
c. Natl. Acad. Sci. USA), 60 volumes, 160 (1
968)], JM103 [Nucleic Acids Research, Volume 9, 309 (
1981)], JA221 [Journal of Molecular Biolog (Journal of Molecular Biolog
y)], 120, 517 (1978)], HB101
[Journal of Molecular Biology, 4
1 volume, 459 (1969)], C600 [Genetics, 39 volumes, 440 (1954)] and the like.

Examples of the bacterium belonging to the genus Bacillus include Bacillus subtilis MI114 [Gene, 24, 255 (1983)], 207-21 [Journal of Biochemistry.
Chemistry), Vol. 95, 87 (1984)] and the like. Examples of yeast include Saccaromyces cerevisiae AH22 and AH2.
^{2R -, NA87-11A, DKD-5D} , 20B-1
2 or the like is used.

As the insects, for example, silkworm larvae are used [Maeda et al., Nature, 315].
Vol., 592 (1985)]. Examples of animal cells include monkey cells COS-7, Vero cells, Chinese hamster cells CHO, DHFR gene-deficient Chinese hamster cells CHO (dhfr ^- CHO cells), CH.
OK-1, human FL cells, 293 cells, L cells, myeloma cells, C127 cells, Balb / c3T3 cells,
Sp-2 / O cells and the like are used.

To transform the above-mentioned Escherichia bacterium, for example, Procedures of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 69.
Volume, 2110 (1972) and Gene, Volume 17,
107 (1982) and the like. To transform Bacillus, for example, Molecular and General Genetics (Mole
cular & General Genetics), 168, 111 (1
979) and the like. For transforming yeast, for example, Proceeds of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. US
A), Vol. 75, 1929 (1978).

For transforming insect cells, for example, Bio / Technology, 6, 47-55 (198)
8) It is performed according to the method described in). To transform animal cells, for example, Virolog
y), 52, 456 (1973). Thus, a transformant transformed with the expression vector containing the DNA encoding the galanin receptor protein can be obtained.

Among the above host cells, the human
As the host cell of the expression plasmid containing the galanin receptor protein DNA, animal cells are particularly preferable, and examples thereof include 293 cells, CHO cells, Vero cells, L
Cells, myeloma cells, C127 cells, Balb / c3
Examples thereof include T3 cells and Sp-2 / O cells, and among them, CHO cells or 293 cells are preferable, and particularly CH
O cells [Journal of Experiment of
Medison (J. EXP. Med.), 108, 945.
(1958)] and the like are preferable. Furthermore, among the CHO cells, CHO cells lacking the dhfr gene (hereinafter sometimes abbreviated as CHO (dhfr ⁻ ) cells) [Procedures of the National Academy of Science USA (Proc.
Natl. Acad. Sci. USA), 77, 421
6-4220 (1980)], CHO K-1 cells [Procedures of the National Academy.
Of Science USA (Proc. Nat
l. Acad. Sci. USA), 60, 1275 (1
968)] and the like are preferable. When the dhfr gene is inserted as a selectable marker in the expression plasmid,
CHO (dhfr ⁻ ) cells and the like are preferable.

As a combination of the expression plasmid and the host cell, a preferable combination can be appropriately selected. For example, as the host cell of the expression plasmid shown in pTS863 [FIG.
fr ⁻ ) cells and the like are preferable. As a method for introducing this expression plasmid into animal cells, a known method, for example, the calcium phosphate method [Graham, FL and van der Eb, A.
J. Virology 52, 456-467 (1973)],
Electroporation [Neumann, E. et al. Embo Journal
(EMBO J.) 1, 841-845 (1982)] and the like are used. As described above, human galanin receptor protein DNA
Thus, a transformant transformed with the vector containing is obtained. In addition, a transformant transformed with an expression plasmid containing human galanin receptor protein DNA can produce human galanin receptor protein.

A cell capable of highly expressing the human galanin receptor protein can be obtained by clonally selecting a cell in which the above-mentioned expression plasmid is integrated in the chromosome. Specifically, first, a transformant is selected using the above selection marker as an index. Furthermore, by repeatedly performing clonal selection on the transformant thus obtained using the selectable marker, it is possible to obtain a cell line that stably has a high expression level of the human galanin receptor protein. When the dhfr gene is used as a selection marker, methotrexate (MT
By gradually increasing the concentration of X) and culturing to select resistant cells, by amplifying the transgene in the cells,
It is also possible to obtain a cell line with high expression. Even when CHO (dhfr ⁻ ) cells are used as a host, the dhfr gene has been introduced into the expression plasmid designated by pTS863, for example (FIG. 13), p
CH containing the expression plasmid designated TS863
O (dhfr ⁻ ) cells will consequently carry the dhfr gene. In the present specification, dh
An expression plasmid containing the fr gene (eg pTS
863, etc.) CHO (dhfr ^-) CHO cells obtained for the additional inclusion in the cell "CHO (dhfr ⁺⁾ cells"
It may be written as.

In the present invention, as a transformant capable of highly expressing the human galanin receptor protein DNA, for example, an expression plasmid designated as pTS863 obtained in Example 11 described later may be contained in CHO (dhfr ⁻ ) cells. CHO (dhfr ⁺ ) cells and the like obtained by the above. Specifically, CHO (dhfr ⁺ ) cells designated by CHO / pTS863-5, CHO / pTS
Examples include CHO (dhfr ⁺ ) cells indicated by 863-7. These CHO (dhfr ⁺ ) cells are
CO expressing a known human galanin receptor protein
Compared to S cells, a large amount of human galanin receptor protein can be expressed, and furthermore, tissues containing natural human galanin receptor protein (eg, human melanin receptor protein) can be expressed.
lanoma Bowes cells), about 10 to 100 times,
Preferably, it has about 100 times the receptor activity (eg, ligand binding activity). Therefore,
These CHO (dhfr ⁺ ) cells are
It is effective for the screening method of galanin receptor agonist / antagonist.

The human galanin receptor protein of the present invention and the cells containing the human galanin receptor protein of the present invention are transformed with a vector (particularly an expression plasmid) containing the human galanin receptor protein DNA of the present invention. It can also be produced by culturing the body under conditions that allow expression of the DNA encoding the human galanin receptor protein. When culturing a transformant whose host is a genus Escherichia or Bacillus, a liquid medium is suitable as a medium used for the culturing, and a carbon source necessary for growth of the transformant is used therein. Nitrogen sources, inorganic substances, etc. are contained. Examples of the carbon source include glucose, dextrin, soluble starch,
Examples of the nitrogen source such as sucrose include ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal, potato extract and other inorganic or organic substances, and inorganic substances such as calcium chloride and phosphorus. Examples thereof include sodium dihydrogen acid and magnesium chloride. In addition, yeast, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5-8.

As a medium for culturing Escherichia, for example, M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journa
l of Experiments in Molecular Genetics), 431-
433, Cold Spring Harbor Laboratory, New York 1
972] is preferred. If necessary, in order to make the promoter work efficiently, for example, 3β-indolyl is used.
An agent such as acrylic acid can be added. When the host is a bacterium belonging to the genus Escherichia, the cultivation is usually carried out at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring can be applied. When the host is a bacterium belonging to the genus Bacillus, the cultivation is usually carried out at about 30 to 40 ° C. for about 6 to 24 hours, and if necessary, aeration and stirring can be applied.

When culturing a transformant in which the host is yeast, the medium is, for example, Burkholder.
lder) Minimal medium [Bostian, KL, et al., "Proc. Natl. Ac.
ad. Sci. USA), 77, 4505 (1980)]
Or SD medium containing 0.5% casamino acid [Bitter, G.
A. et al., "The Prossings of the National
Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), Vol. 81,
5330 (1984)]. Preferably, the pH of the medium is adjusted to about 5-8. Culturing is usually about 20 ℃ ~
It is performed at 35 ° C. for about 24 to 72 hours, and aeration and stirring are added if necessary. When culturing a transformant whose host is an insect cell, Grace's Insect Medium (Grace,
TCC, Nature, 195, 788 (1962)) to which an additive such as immobilized 10% bovine serum is appropriately added may be used. The pH of the medium is preferably adjusted to about 6.2 to 6.4. Culturing is usually performed at about 27 ° C. for about 3 to 5 days, and aeration and agitation are added if necessary.

When culturing a transformant whose host is an animal cell, the medium is, for example, MEM medium containing about 5 to 20% fetal bovine serum [Seience, 122].
Vol., 501 (1952)], DMEM medium [Virology, vol. 8, 396 (1959)], RPM
I 1640 medium (The Journal of the American Medical Association (The Jounal of the
American Medical Association), 199, 519 (
1967)], 199 medium [Proceeding of the Society for the Biological
Medicine), 73, 1 (1950)], α-MEM
A medium or the like is used. Particularly, when CHO (dhfr ⁻ ) cells and dhfr selectable marker gene are used, DM containing dialyzed fetal bovine serum containing almost no thymidine is used.
It is preferable to use EM medium. Preferably, the pH is between about 6-8. The culture is usually performed at about 30 ° C to 40 ° C for about 15 to
This is carried out for 72 hours, and medium replacement, aeration, stirring, etc. are added if necessary.

In this way, cells containing the galanin receptor protein can be produced from the transformants carrying the vector (particularly, the expression plasmid) containing the DNA encoding the galanin receptor protein. For example, as the cells containing the human galanin receptor protein of the present invention, specifically, CHO cells containing the human galanin receptor protein are preferable, and
CHO (dhf labeled with O / pTS863-5
r ⁺ ) cells, C labeled with CHO / pTS863-7
It can be produced by culturing HO (dhfr ⁺ ) cells and the like. The galanin receptor protein (for example, human galanin receptor protein) or its partial peptide can be separated and purified from the culture of cells containing the galanin receptor protein of the present invention described above, for example, by the following method.

When the galanin receptor protein is extracted from the cultured bacterial cells or cells, after the culture, the bacterial cells or cells are collected by a known method, suspended in an appropriate buffer, and then ultrasonically, lysozyme and / or frozen. A method of obtaining a crude extract of galanin receptor protein by disrupting cells or cells by thawing and then centrifuging or filtering can be appropriately used. The buffer may contain a protein denaturing agent such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 (registered trademark, hereinafter sometimes abbreviated as TM).

When the galanin receptor protein is secreted into the culture medium, after the completion of the culture, the bacterial cells or cells are separated from the supernatant by a method known per se, and the supernatant is collected. Purification of the galanin receptor protein contained in the thus obtained culture supernatant or the extract can be carried out by appropriately combining separation / purification methods known per se. These known separation and purification methods include methods utilizing solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis, and the like. Method using difference in charge, method using charge difference such as ion exchange chromatography, method using specific affinity such as affinity chromatography, and use of difference in hydrophobicity such as reverse phase high performance liquid chromatography A method utilizing a difference between isoelectric points, such as an isoelectric focusing method, is used. When the galanin receptor protein thus obtained is obtained as a free form, it can be converted into a salt by a method known per se or a method analogous thereto, and conversely when it is obtained as a salt, a method known per se or It can be converted into a free form or other salt by a similar method.

The galanin receptor protein produced by the recombinant can be optionally modified or partially removed by reacting it with an appropriate protein-modifying enzyme before or after purification. . Examples of the protein modifying enzyme include trypsin, chymotrypsin,
Arginyl endopeptidase, protein kinase,
Glycosidase and the like are used. The activity of the galanin receptor protein thus produced can be measured by a binding experiment with a labeled galanin or the like and an enzyme immunoassay using a specific antibody.

In the above method, a DNA encoding a known human galanin receptor protein is used in place of the DNA encoding the human galanin receptor protein of the present invention to obtain a recombinant human galanin receptor protein. Highly expressing cells and recombinant humans
The galanin receptor protein can also be isolated. The known human galanin receptor protein is expressed in COS cells, but the expression level in COS cells is generally low. However, according to the method for constructing the expression plasmid of the present invention, not only cells (in particular, CHO cells) highly expressing the human galanin receptor protein of the present invention but also cells highly expressing the known human galanin receptor protein ( In particular,
CHO cells) can be produced.

The cell membrane fraction of cells containing the galanin receptor protein of the present invention (for example, the cell membrane fraction of cells containing human galanin receptor protein or the cell membrane fraction of cells containing mouse galanin receptor protein) is Fraction containing a large amount of cell membrane obtained by a method known per se after crushing cells containing galanin receptor protein (eg, cells containing human galanin receptor protein or cells containing mouse galanin receptor protein) I mean. Examples of the cell crushing method include crushing the cells with a Potter-Elvehjem type homogenizer, crushing with a Waring blender or Polytron (manufactured by Kinematica), crushing with ultrasonic waves, from a fine nozzle while crushing cells with a French press, etc. Examples include crushing by jetting. For fractionation of cell membranes, fractionation by centrifugal force, such as fractionation centrifugation and density gradient centrifugation, is mainly used. For example, the cell lysate may be mixed at a low speed (500 rpm to 300 rpm).
0 rpm) for a short time (usually about 1 minute to 10 minutes),
Supernatant at even higher speed (15,000 rpm to 30,000 rp)
Centrifugation in m) is usually performed for 30 minutes to 2 hours, and the resulting precipitate is used as a membrane fraction. The membrane fraction contains a large amount of expressed galanin receptor protein (eg, human galanin receptor protein or mouse galanin receptor protein) and membrane components such as cell-derived phospholipids and membrane proteins.
The amount of the galanin receptor protein in the cell or the cell membrane fraction thereof containing the galanin receptor protein of the present invention (for example, the amount of the human galanin receptor protein in the cell or the cell membrane fraction of the human galanin receptor protein or mouse The amount of the mouse-derived galanin receptor protein in the cell containing the derived galanin receptor protein or the cell membrane fraction thereof is preferably 10 ³ to 10 ⁸ molecules per cell, and is preferably 10 ⁵ to 10 ⁷ molecules. It is suitable. The higher the expression level, the higher the ligand binding activity (specific activity) per membrane fraction, which makes it possible not only to construct a highly sensitive screening system, but also to measure a large number of samples in the same lot. .

For the galanin receptor protein of the present invention, the partial peptide of the galanin receptor protein and the DNA encoding the galanin receptor protein, antibodies and antisera were obtained, a recombinant receptor protein expression system was constructed, and the same expression system was used. Development of receptor binding assay system, screening of drug candidate compounds, implementation of drug design based on comparison with structurally similar ligands and receptors, probes for gene diagnosis,
It can be used for preparation of PCR primers, gene therapy, preparation of transgenic animals (eg, transgenic mice), preparation of pathological model animals due to gene deficiency, and the like. In particular, a receptor binding assay system using the recombinant galanin receptor protein expression system of the present invention can screen galanin receptor agonists or antagonists specific to warm-blooded animals such as humans. It can be used as a preventive / therapeutic agent for diseases. For example, for the DNA encoding the mouse galanin receptor protein of the present invention and the mouse galanin receptor protein, obtaining antibodies and antisera, constructing a recombinant receptor protein expression system,
Development of a receptor binding assay system using the same expression system, screening of drug candidate compounds, implementation of drug design based on comparison with structurally similar galanin receptors, preparation of probes for gene diagnosis, preparation of PCR primers, transgenic mice Production of
It can be used for production of pathological model animals due to gene deficiency.

Further, the human galanin receptor protein of the present invention, the partial peptide of the human galanin receptor protein and the DNA encoding the human galanin receptor protein can be used in the acquisition of antibodies and antisera and in the expression system of recombinant receptor protein. Construction, development of a receptor binding assay system using the same expression system, screening of drug candidate compounds, implementation of drug design based on comparison with structurally similar ligands / receptors, preparation of probes for gene diagnosis, PCR primers,
It can be used for gene therapy and the like. In particular, a galvanin receptor agonist or antagonist specific to warm-blooded animals (particularly human) can be screened by a receptor binding assay system using the human galanin receptor protein expression system of the present invention. Can be used as a prophylactic / therapeutic agent for various diseases caused by galanin.

The use of the galanin receptor protein, the galanin receptor protein partial peptide, the DNA encoding the galanin receptor protein and the antibody of the present invention will be described in more detail below. (1) Galanin quantification method The galanin receptor protein of the present invention (for example, human galanin receptor protein or mouse galanin receptor protein) or a salt thereof, or the partial peptide of the present invention or a salt thereof is used for a ligand galanin. Since it has a specific binding property, the concentration of galanin in the subject or the concentration of galanin in the living body can be quantified with high sensitivity.

That is, the test sample is a galanin receptor protein of the present invention (for example, human galanin receptor protein or mouse-derived galanin receptor protein) or a salt thereof, or a galanin receptor protein (for example, human galanin receptor protein or mouse-derived galanin receptor). The concentration of galanin in the test sample can be quantified by bringing it into contact with a partial peptide of (protein) or a salt thereof. The method for quantifying galanin of the present invention can be used, for example, in combination with a competitive method. Specifically, for example, it can be used according to the method described below or the like or a method analogous thereto. Edited by Hiro Irie "Radio Immunoassay" (Kodansha, Showa 4)
(Published in 1997) edited by Hiroshi Irie, "Continued Radioimmunoassay" (Kodansha, published in 1979) Furthermore, the method for quantifying galanin of the present invention is a disease caused by an increase or decrease in galanin concentration (for example, gastric ulcer, diabetes, Alzheimer's disease, etc.). It can also be used as a diagnostic method.

(2) Method for Screening Galanin Receptor Agonist or Antagonist The galanin receptor protein of the present invention (for example, mouse galanin receptor protein) or a salt thereof, or the partial peptide of the present invention or a salt thereof is used, or a recombinant type By constructing an expression system of a receptor protein and using a receptor binding assay system using the expression system, galanin and a galanin receptor protein (for example,
Compounds (eg, peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, etc.) or salts thereof that inhibit the binding to mouse galanin receptor protein) Can be screened.

Such compounds include cell stimulating activity (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP production, intracellular production) via a galanin receptor (eg mouse-derived galanin receptor). cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-fos activation, pH decrease, activity promoting or suppressing insulin secretion, etc., particularly intracellular cAMP production or insulin A compound (so-called galanin receptor agonist) having a secretion promoting activity or a suppressive activity) and a compound having no such cell stimulating activity (so-called galanin receptor antagonist) are included.

That is, the present invention includes (i) a case where galanin is contacted with the galanin receptor protein of the present invention or a salt thereof, or a partial peptide of the present invention or a salt thereof, and (ii) the galanin receptor protein of the present invention or a salt thereof. A salt or a partial peptide of the present invention or a salt thereof,
Provided is a method for screening a galanin receptor agonist or antagonist, which comprises performing a comparison with a case where galanin and a test compound are contacted.

In the screening method of the present invention,
(I) when the galanin receptor protein of the present invention (for example, mouse galanin receptor protein etc.) or a salt thereof or the partial peptide of the present invention or a salt thereof is contacted with galanin, and (ii) the galanin receptor protein of the present invention ( For example, when a galanin and a test compound are contacted with a mouse-derived galanin receptor protein or the like) or a salt thereof or a partial peptide of the present invention or a salt thereof, for example, the galanin receptor protein (for example, mouse-derived galanin receptor protein) or the It is characterized in that the amount of galanin bound to the salt or the partial peptide or the salt thereof, the cell stimulating activity and the like are measured and compared.

In the screening method for galanin receptor agonists or antagonists, it is also possible to use human hippocampus as the human galanin receptor protein. However, since human-derived tissues are extremely difficult to obtain, they are not suitable for use in screening. In fact, recombinant human Galanin receptor proteins are suitable. Furthermore, it is most preferable to use a cell line that continuously and stably expresses human galanin receptor protein. Therefore, the human galanin receptor protein of the present invention or a salt thereof, the partial peptide of the human galanin receptor protein of the present invention or a salt thereof, or the cell containing the human galanin receptor protein of the present invention or a cell membrane fraction thereof is a galanin It is useful as a reagent for screening receptor agonists or antagonists. That is, the present invention provides a human galanin receptor protein of the present invention or a salt thereof, a partial peptide of the human galanin receptor protein of the present invention or a salt thereof, or a cell containing the human galanin receptor protein of the present invention or a cell membrane thereof. The present invention provides a method for screening a galanin receptor agonist or antagonist, which comprises using a component.

More specifically, the present invention relates to (I) (i) the case where galanin is contacted with the human galanin receptor protein of the present invention, a partial peptide thereof or a salt thereof, and (ii) the present invention Human galanin receptor protein, a partial peptide thereof or a salt thereof is compared with a case where a sample such as galanin and a test compound is contacted, a method for screening a galanin receptor agonist or antagonist,
And (II) (i) when a cell containing the human galanin receptor protein of the present invention or a cell membrane fraction thereof is contacted with galanin, and (ii) a cell containing the human galanin receptor protein of the present invention or a cell thereof A method for screening a galanin receptor agonist or antagonist, which comprises performing a comparison with a case where a sample such as galanin and a test compound is contacted with a cell membrane fraction. Specifically, in the screening methods (I) and (II) of the present invention, in the cases of (i) and (ii), for example, the human galanin receptor protein,
It is characterized in that the binding amount of galanin to the cells containing the partial peptide or salts thereof, or the human galanin receptor protein or the cell membrane fraction thereof, the cell stimulating activity, etc. are measured and compared.

More specifically, the present invention relates to (i) the case where the labeled galanin is contacted with the galanin receptor protein of the present invention (eg, human galanin receptor protein) or a partial peptide thereof or a salt thereof. And (ii) a labeled galanin (eg, human galanin) and a test compound are contacted with the galanin receptor protein of the present invention (eg, human galanin receptor protein) or a partial peptide thereof or a salt thereof, The method for screening a galanin receptor agonist or antagonist, comprising measuring and comparing the amount of bound galanin to the receptor protein, its partial peptide or salts thereof, (a) (i) labeled galanin Galanin receptor protein (eg , A human galanin receptor protein or a mouse galanin receptor protein (eg mouse MIN6 cell (F
ERM BP-4954)) or the membrane fraction of the cells, and (ii) the labeled galanin and the test compound are added to the galanin receptor protein of the present invention (eg, human galanin receptor protein or mouse-derived galanin). Of a galanin receptor agonist or antagonist characterized by measuring and comparing the amount of labeled galanin bound to the cell or its cell membrane fraction when contacted with cells containing the receptor protein) or its cell membrane fraction. Screening method,
And (b) (i) galanin, cells containing the galanin receptor protein of the present invention (for example, human galanin receptor protein or mouse-derived galanin receptor protein) (for example, mouse MIN6 cells (FERM BP-
4954) or the like) or a cell membrane fraction thereof, and (ii) a galanin and a test compound are contacted with cells containing the galanin receptor protein of the present invention or a cell membrane fraction thereof ( For example, cell stimulating activity via human galanin receptor or mouse galanin receptor (for example, opening of K ⁺ channel, closing of N-type Ca ⁺ channel, arachidonic acid release, acetylcholine release, intracellular C)
a2 ⁺ concentration fluctuation, intracellular cAMP production (inhibition), intracellular cGMP production, insulin secretion, inositol phosphate production, cell membrane potential variation, intracellular protein phosphorylation, c-
Fos activation, pH decrease, cell migration activity, hormone secretion, G protein activation, activity promoting or suppressing cell proliferation, etc., especially activity promoting intracellular cAMP production or insulin secretion or Method for screening galanin receptor agonist or antagonist characterized by measuring and comparing inhibitory activity), labeled galanin containing DNA encoding the galanin receptor protein of the present invention (eg mouse galanin receptor protein) When the galanin receptor protein expressed on the cell membrane by culturing the transformant is contacted with the galanin receptor protein (for example, mouse-derived galanin receptor protein), labeled galanin and a test compound are added to the galanin receptor protein of the present invention (for example, mouse Origin Garani Galanin receptor protein of labeled galanin when it is contacted with a galanin receptor protein expressed on the cell membrane by culturing a transformant containing a DNA encoding the gallanin receptor protein (for example, mouse galanin receptor protein). (For example, a method for screening a galanin receptor agonist or antagonist, which comprises measuring and comparing the amount of binding to a mouse galanin receptor protein),

Galanin was expressed on the cell membrane by culturing a transformant containing a DNA encoding the galanin receptor protein of the present invention (for example, mouse-derived galanin receptor protein). Receptor protein) and galanin and test compound were expressed on cell membranes by culturing transformants containing DNA encoding the galanin receptor protein of the invention (eg, mouse galanin receptor protein). Cellular stimulatory activity (eg, arachidonic acid release, acetylcholine) mediated by a galanin receptor (eg, mouse-derived galanin receptor) when contacted with a galanin receptor protein (eg, mouse-derived galanin receptor protein) Release, intracellular Ca ²⁺ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-fos activation, pH decrease, insulin secretion, etc. The present invention provides a method for screening a galanin receptor agonist or antagonist, which comprises measuring and comparing an activity that promotes or suppresses, especially an activity that promotes or suppresses intracellular cAMP production or insulin secretion. .

In the screening method of the above or (a), it binds to a galanin receptor protein (eg, human galanin receptor protein) and inhibits the binding of galanin to the galanin receptor protein (eg, human galanin receptor protein). The compound can be selected as a galanin receptor agonist or antagonist. Furthermore, in the screening method of the above (b), it binds to a galanin receptor (for example, human galanin receptor), and cell stimulating activity (for example, opening of K ⁺ channel, closing of N-type Ca ⁺ channel) via the receptor, Arachidonic acid release, acetylcholine release, fluctuation of intracellular Ca ²⁺ concentration, suppression of intracellular cAMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-fos activation, pH decrease,
Cell migration activity, hormone secretion, G protein activation,
(Activities that promote or suppress cell proliferation, etc.)
A compound having a can be selected as a galanin receptor agonist. On the other hand, the above or (a)
In the screening method described above, a compound that does not have the cell stimulating activity is selected as a galanin receptor antagonist from among the test compounds that have been found to have an activity of inhibiting the binding between galanin and a galanin receptor protein (for example, human galanin receptor protein). can do.

Before the cells containing the galanin receptor protein (eg, human galanin receptor protein) of the present invention were obtained, there were no cells capable of highly expressing the galanin receptor protein (eg, human galanin receptor protein). It was not possible to efficiently screen for receptor agonists or antagonists. The specific description of the screening method of the present invention is as follows. First, as the galanin receptor protein used in the screening method of the present invention, for example, the mouse-derived galanin receptor protein, the galanin receptor protein of the present invention or a partial peptide of the galanin receptor protein, for example, the mouse-derived galanin receptor protein or the mouse-derived galanin receptor protein Any of them may be used as long as they contain the partial peptide of 1., but membrane fractions of organs such as mice, tissues, cells and the like are preferable. In addition, a galanin receptor protein (eg, recombinant mouse-derived galanin receptor protein) that is expressed in a large amount using a recombinant is also suitable.

The above-mentioned method is used for producing a galanin receptor protein, for example, a mouse-derived galanin receptor protein, which is carried out by expressing a DNA encoding the galanin receptor protein in mammalian cells or insect cells. You can D coding the target part
Although complementary DNA is used for the NA fragment, it is not necessarily limited thereto. For example, gene fragments and synthetic D
NA may be used. In order to efficiently introduce a galanin receptor protein, for example, a DNA fragment encoding a mouse galanin receptor protein into a host animal cell and to express them efficiently, a nuclear polyhedron belonging to a baculovirus using an insect host as the DNA fragment. Disease virus (nuclea
r polyhedrosis virus (NPV) polyhedrin promoter, SV40-derived promoter, retrovirus promoter, metallothionein promoter, human heat shock promoter, cytomegalovirus promoter, SRα promoter and the like are preferably incorporated downstream.

The quantity and quality of the expressed receptor can be examined by a method known per se. For example, the literature [Na
mbi, P. Et al., The Journal of Biological Chemistry (J. Biol. Chem.), Vol. 267, 19555-1955.
[Page 9, 1992]. Therefore, in the screening method of the present invention, a galanin receptor protein or a partial peptide of a galanin receptor protein, for example, a mouse-containing galanin receptor protein or a partial peptide of a mouse-derived galanin receptor protein is purified according to a method known per se. Galanin receptor protein or partial peptide of galanin receptor protein, for example, may be a mouse-derived galanin receptor protein or a partial peptide of the mouse-derived galanin receptor protein, or cells containing the galanin receptor protein or a cell membrane fraction thereof. You may use.

When cells containing a galanin receptor protein (eg, mouse-derived galanin receptor protein) are used in the screening method of the present invention, the cells may be immobilized with glutaraldehyde, formalin or the like. The immobilization method can be performed according to a method known per se. For example, cells containing the mouse-derived galanin receptor protein include host cells expressing the mouse-derived galanin receptor protein and natural cells containing the mouse-derived galanin receptor protein.
Examples of host cells expressing the mouse galanin receptor protein include Escherichia coli, Bacillus subtilis, yeast, insect cells, animal cells and the like. The host cell expressing the mouse-derived galanin receptor protein can be produced according to the method for producing the mouse-derived galanin receptor protein using the recombinant described above.

In order to carry out the above method (a) for screening a galanin receptor agonist or antagonist, an appropriate galanin receptor fraction (for example, mouse-derived galanin receptor fraction) and labeled galanin are required. Is. For example, as the mouse-derived galanin receptor fraction, a natural mouse-derived galanin receptor fraction, a recombinant mouse-derived galanin receptor fraction having an activity equivalent to that of the natural mouse-derived galanin receptor, a recombinant mouse-derived galanin A cell expressing the receptor, a natural cell containing a mouse galanin receptor and the like are preferable. here,
The equivalent activity indicates equivalent galanin binding activity and the like.
As the galanin used as a ligand, a commercially available product or the like can be used. Further, known galanin receptor agonists and antagonists can be used instead of galanin. As the labeled galanin, a labeled galanin, a labeled galanin analog compound or the like is used. As labeled galanin,
For example, galanin labeled with [ ³ H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S] and the like can be used, and further, [ ³ H], [ ¹²⁵ I], [ ¹⁴ C] Known galanin agonists, antagonists, and the like labeled with or the like can also be used. For example, galanin (Dupon / NEN) labeled with [ ¹²⁵ I] is suitable.

Specifically, to screen a galanin receptor agonist or antagonist, for example, first, a cell containing the galanin receptor protein of the present invention (eg, human galanin receptor protein or mouse-derived galanin receptor protein) or A receptor preparation is prepared by suspending a membrane fraction of cells, or a galanin receptor protein (eg, human galanin receptor protein or mouse galanin receptor protein) or a partial peptide thereof in a buffer suitable for screening. . Any buffer may be used as long as it does not inhibit the binding between galanin and a receptor, such as a phosphate buffer having a pH of 4 to 10 (preferably a pH of 6 to 8) and a Tris-hydrochloric acid buffer. For the purpose of reducing non-specific binding, a surfactant such as CHAPS, Tween-80 ^™ (Kao-Atlas), digitonin, and deoxycholate can be added to the buffer. In addition, protease inhibitors such as PMSF, leupeptin, bacitracin, aprotinin, E-64 (manufactured by Peptide Laboratories), pepstatin and the like can be added for the purpose of suppressing the decomposition of the receptor and galanin by protease. For example, a test compound suspended in the same buffer is 10 ⁻⁴ M to 1
A 0 ^-10 M test compound solution is placed in the reaction tube and 0.01 ml to ¹⁰ ml of the receptor solution is added.

Furthermore, a fixed amount (for example, 2000 Ci / mmo) was added to 0.01 ml to 10 ml of the receptor solution.
In case of 1, about 10,000 cpm to 1,000,000 cp
m, in another case 5000 cpm to 500,000 cp
Add the labeled galanin from m). A reaction tube containing a large excess of unlabeled galanin is also prepared in order to know the amount of non-specific binding (NSB). The reaction is from 0 ° C to 50 ° C,
The reaction is preferably performed at 4 ° C. to 37 ° C. for 20 minutes to 24 hours, preferably 30 minutes to 3 hours. After the reaction, the mixture is filtered through a glass fiber filter paper or the like, washed with an appropriate amount of the same buffer, and the radioactivity (for example, the amount of [ ¹²⁵ I]) remaining on the glass fiber filter paper is measured with a liquid scintillation counter or a γ-counter. For filtration, a manifold or a cell harvester can be used, but the use of a cell harvester is desirable for increasing efficiency. The count (B ₀ -NSB) obtained by subtracting the amount of non-specific binding (NSB) from the count (B ₀ ) when there is no substance to be antagonized is 100.
%, The specific binding amount (B-NSB) is, for example, 50% or less of the count (B ₀ -NSB), and the test compound is selected as a candidate substance, agonist or antagonist candidate compound having competitive inhibition ability. You can

For example, when the human galanin receptor protein is used, the procedure is specifically as follows. (I) 20 mM Tris-HCl, 1 mM EDT
A, 0.1% BSA, 0.05% CHAPS, 0.1%
5 mM PMSF, 40 μg / ml leupeptin, 2
Make a reaction buffer of 0 μg / ml E-64, 10 μg / ml pepstatin, pH 7.4. (Ii) 2 μl of a test compound solution prepared by suspending a test compound in a reaction buffer is put in a reaction tube on ice. The final concentration of test compound is adjusted to 100 μM. (Iii) The cell membrane fraction containing the human galanin receptor protein freeze-dried at −80 ° C. is returned to room temperature, gently vortexed, and then diluted to an appropriate concentration to prepare a cell membrane fraction solution (eg, 0.5 mg protein / ml
(Bovine hippocampal membrane fraction, CHO cell membrane fraction, etc.). After passing this cell membrane fraction solution through a cell strainer, 200 μl of the solution is placed in a reaction tube with a dispenser. (Iv) Add [ ¹²⁵ I] galanin diluted in the reaction buffer to the reaction tube in an amount of 2 μl on ice. (V) Perform the reaction at 25 ° C. for 60 minutes or 75 minutes. (Vi) Perform B / F separation using a manifold. Filter used at this time (GF / F, Whatman)
Is a PEI solution (20 mM Tris-HCl,
Soak for 1 hour or more in 0.3% polyethylene imide), pH 7.4). (Vii) Count the filter with a γ-counter. Compounds that inhibit specific binding by 40 to 50% or more are evaluated as ±, and compounds that inhibit 50% or more are evaluated as +.

In order to carry out the above-mentioned method (b) for screening a galanin receptor agonist or antagonist, a cell stimulating activity mediated by a galanin receptor protein (eg a cell stimulating activity mediated by a mouse-derived galanin receptor protein) (eg , Arachidonic acid release, acetylcholine release, intracellular Ca release,
Intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-fos activation, pH lowering, activity promoting or suppressing insulin secretion, etc.) Can be measured using a known method or a commercially available measurement kit. Further, in order to carry out the screening method of the above (b) in relation to human galanin receptor protein, cell stimulating activity mediated by human galanin receptor protein (for example, opening of K ⁺ channel, N type Ca ⁺ channel Closure, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ concentration fluctuation, suppression of intracellular cAMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-fos activation, pH decrease , Cell migration activity, hormone secretion, G protein activation, activity that promotes or suppresses cell proliferation, etc.) can be measured using known methods or commercially available measurement kits.

Specifically, first, cells containing the galanin receptor protein (eg, cells containing the human galanin receptor protein or cells containing the mouse galanin receptor protein) are cultured in a multiwell plate or the like. For screening, the medium was exchanged with a fresh medium or an appropriate buffer that did not show toxicity to cells in advance, and after adding a test compound or the like and incubating for a certain period of time, cells were extracted or supernatant was collected to generate The product is quantified according to the respective method. When the production of a substance that serves as an index of cell stimulating activity (for example, arachidonic acid) is difficult to assay with a degrading enzyme contained in cells, an inhibitor for the degrading enzyme may be added to the assay. Further, the activity of suppressing cAMP production and the like can be detected as a production suppressing action on cells in which the basic production amount of cells has been increased by forskolin or the like.

In order to measure the cell stimulating activity and perform screening, cells expressing an appropriate galanin receptor protein (for example, cells expressing an appropriate mouse galanin receptor protein) are required. The cells expressing the galanin receptor protein of the present invention, for example, the cells expressing the mouse-derived galanin receptor protein include cell lines having a natural mouse-derived galanin receptor protein (for example, mouse MIN6 (FERM BP-49
54) etc.), and the above-mentioned recombinant mouse-derived galanin receptor protein-expressing cell line and the like are preferable. Among these cells, MIN6 cells derived from mouse pancreas, which is a cell line having a naturally-occurring mouse galanin receptor protein, can secrete insulin from the cells when galanin binds to the galanin receptor on the cell membrane. . Therefore, mouse pancreas-derived MIN6 cells are the most preferable cells when insulin secretion is used as an index of cell stimulating activity.

Examples of test compounds include peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts and the like, and these compounds are novel compounds. Or a known compound may be used. A kit for screening a galanin receptor agonist or antagonist is, for example, the galanin receptor protein of the present invention or a salt thereof (for example, human galanin receptor protein or a salt thereof or mouse-derived galanin receptor protein or a salt thereof), the galanin receptor protein of the present invention. Or a salt thereof (for example, a partial peptide or a salt of a human galanin receptor protein or a partial peptide or a salt of a mouse galanin receptor protein), a cell containing the galanin receptor protein of the present invention (for example, human galanin Receptor protein-containing cells or mouse-derived galanin receptor protein-containing cells), or membrane fractions of cells containing the galanin receptor protein of the present invention (eg,
It contains a membrane fraction of cells containing the human galanin receptor protein or a membrane fraction of cells containing the mouse galanin receptor protein).

The following are examples of the screening kit of the present invention. 1. Screening reagent Measurement buffer and washing buffer Hanks' Balanced Salt Solution (manufactured by Gibco)
To which 0.05% bovine serum albumin (manufactured by Sigma) was added. Sterilize by filtration with a 0.45μm filter,
It may be stored at 4 ° C or may be prepared at the time of use. Mouse-derived galanin receptor preparation CH expressing mouse-derived galanin receptor protein
O cells subcultured to a 12-well plate at 5 × 10 ⁵ cells / well and cultured at 37 ° C., 5% CO ₂ , 95% air for 2 days.

Labeled Galanin Galanin labeled with [ ³ H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S] or the like is stored in an aqueous solution at 4 ° C. or -20 ° C. for measurement at the time of use. Dilute to 5 μM with buffer. Galanin standard solution Galanin 0.1% bovine serum albumin (manufactured by Sigma)
Dissolve to 100 μM in PBS containing
Store at ° C.

[0125] 2. Assay method CHO cells expressing mouse-derived galanin receptor protein cultured in a 12-well tissue culture plate are washed twice with 1 ml of assay buffer, and then 490 μl of assay buffer is added to each well. After adding 5 μl of a test compound solution of 10 ⁻³ to 10 ⁻¹⁰ M, 10 μl of labeled galanin is added, and the mixture is reacted at room temperature for 1 hour. In order to know the amount of non-specific binding, 5 μl of 10 ⁻⁴ M galanin was added in place of the test compound. Remove the reaction solution and wash 3 times with 1 ml of washing buffer. Labeled galanin bound to the cells was washed with 0.2 N NaOH.
1% SDS, 4 ml of liquid scintillator A
(Made by Wako Pure Chemical Industries). Radioactivity is measured using an auto gamma counter or a liquid scintillation counter (manufactured by Beckman), and Percent of Maximum Binding (PMB) is determined by the following formula [Equation 1].

[0126]

## EQU1 ## PMB = [(B-NSB) / (B ₀ -NS
B)] × 100 PMB: Percent of Maximum Binding B: Value when a sample is added NSB: Non-specific Binding (non-specific binding amount) B ₀ : Maximum binding amount

Another example of the screening kit of the present invention is as follows. [Screening Reagent] Measurement Buffer and Washing Buffer 0.01% bovine serum albumin, 0.05% CHA
Hanks buffer with PS. It may be sterilized by filtration with a filter having a pore size of 0.22 μm and stored at 4 ° C., or may be prepared before use. Human Galanin Receptor Protein Specimen 1 cell containing human Galanin receptor protein was prepared.
Passage into a 2-well plate at 5 × 10 ⁵ / well, 37 ° C, 5
Cultivated with% CO ₂ and 95% air until confluent. Labeled galanin Commercially available galanin solution labeled with [ ³ H], [ ¹²⁵ I], [ ¹⁴ C] or the like is stored at 4 ° C or -20 ° C,
When used, dilute to 1 μM with the measurement buffer. Galanin standard solution Dissolve galanin in sterile water to 10 ^-4 M, then -2
Store at 0 ° C.

[Measurement Method] Cells containing human galanin receptor protein cultured in a 12-well tissue culture plate were treated with measurement buffer 1
Wash with ml about twice. After sucking out the measurement buffer, cool it to 4 ℃ 10 ^-3
After adding 5 µl of a test compound solution of ^{-10 -10} M, 10
0.5 ml of a measurement buffer containing 0 pM labeled galanin is added, and the mixture is reacted at 37 ° C., 5% CO ₂ , 95% air for 1 hour. To know the amount of non-specific binding, use 1 with the test compound.
Add μM galanin in advance. Remove the reaction solution and wash with 1 ml of wash buffer at 37 ℃.
Wash twice. 0.5 ml of labeled galanin bound to cells
After peeling off with 0.2 N NaOH, the radioactivity was measured with a γ-counter, and the percent of maximum binding (PM
B) is obtained by the above equation [Equation 1].

In the above screening method and screening kit, instead of the human galanin receptor protein of the present invention, the partial peptide thereof and the cell containing the human galanin receptor protein of the present invention or the cell membrane fraction thereof, It is also possible to use a recombinant human galanin receptor protein produced from DNA such as a known human galanin receptor protein DNA, a partial peptide thereof or a cell containing the recombinant human galanin receptor protein or a cell membrane fraction thereof.

The compound or its salt obtained by using the screening method or the screening kit of the present invention is a compound that inhibits the binding between galanin and the galanin receptor, and specifically, it has a cell stimulating activity via the galanin receptor. A compound or a salt thereof (so-called,
Galanin receptor agonist) or a compound having no such stimulating activity (so-called galanin receptor antagonist). Examples of the agonist and antagonist include peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, etc. These compounds may be novel compounds or known compounds. Good. Further, the galanin receptor agonist or antagonist of the present invention is a test compound (for example, peptide, protein, non-peptide compound, synthetic compound, fermentation product, cell extract, using the screening method or screening kit of the present invention,
Examples include plant extracts and animal tissue extracts, and these test compounds may be novel compounds or known compounds. And a salt thereof, particularly preferably a compound that inhibits the binding between galanin and the recombinant human galanin receptor protein of the present invention. Among the compounds, the galanin receptor agonist is a compound having a cell stimulating activity via the human galanin receptor, and the galanin receptor antagonist is a compound having no such cell stimulating activity.

Further, the gallanin receptor agonist or antagonist obtained by using the screening method or the screening kit of the present invention is chemically modified or substituted, or is designed based on the structural formula of the compound. Compounds and the like are also included in the galanin receptor agonist or antagonist obtained using the screening method or screening kit of the present invention. The salt of the galanin receptor agonist or antagonist is preferably a physiologically acceptable acid addition salt. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) And tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid and benzenesulfonic acid).

Since the galanin receptor agonist has the same physiological activity as that of galanin, for example, all or a part thereof, it is useful as a safe and low-toxic pharmaceutical composition depending on the physiological activity. . On the other hand, a galanin receptor antagonist can suppress the physiological activity of galanin, for example, it can suppress all or part of the physiological activity of galanin,
It is useful as a safe and low-toxic pharmaceutical composition that suppresses the galanin activity. Specifically, a galanin receptor agonist is useful as an acetylcholine release inhibitor, an insulin secretion inhibitor, a growth hormone secretion stimulant, a learning behavior inhibitor or a satiety suppressant, and further, prevention of schizophrenia or gastric ulcer It is useful as a therapeutic agent or analgesic. On the other hand, galanin receptor antagonists are acetylcholine release promoters, insulin secretion promoters,
It is useful as a growth hormone secretion inhibitor, a learning behavior promoter or a satiety promoter, and further, an obesity therapeutic agent,
It is useful as a prophylactic / therapeutic agent for diabetes, nootropic agents, Alzheimer's disease or dementia.

When an agonist or antagonist obtained by using the screening method or the screening kit of the present invention is used as the above-mentioned pharmaceutical composition,
It can be carried out in a conventional manner. For example, orally as tablets, capsules, elixirs, microcapsules, etc., optionally sugar-coated, or aseptic solution with water or other pharmaceutically acceptable liquid, or suspension It can be used parenterally in the form of injections such as. For example, a physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative, or the like of the compound or a salt thereof,
It can be prepared by mixing with stabilizers, binders and the like in a unit dose form generally required for accepted pharmaceutical practice. The amount of the active ingredient in these preparations is such that an appropriate dose in the specified range can be obtained.

Examples of additives that can be mixed with tablets, capsules and the like include binders such as gelatin, corn starch, tragacanth and gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid and the like. Such as a leavening agent, a lubricant such as magnesium stearate, a sweetener such as sucrose, lactose or saccharin, and a flavoring agent such as peppermint, red oil or cherry. When the preparation unit form is a capsule, a liquid carrier such as oil and fat can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to conventional pharmaceutical practices such as dissolving or suspending the active substance in a vehicle such as water for injection, naturally occurring vegetable oils such as sesame oil, coconut oil, etc. .

Aqueous solutions for injection include, for example, isotonic solutions containing physiological saline, glucose and other adjuvants (for example,
D-sorbitol, D-mannitol, sodium chloride, etc., and suitable solubilizing agents such as alcohols (eg ethanol), polyalcohols (eg propylene glycol, polyethylene glycol), nonionic surfactants (eg polysorbate). You may use together with 80 (TM), HCO-50, etc.
Examples of the oily liquid include sesame oil and soybean oil, which may be used in combination with solubilizing agents such as benzyl benzoate and benzyl alcohol.

Also, a buffering agent (eg, phosphate buffer,
Sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), preservatives (eg, benzyl alcohol, phenol, etc.), antioxidants And the like. The prepared injection is usually filled in a suitable ampoule. Since the preparation thus obtained is safe and has low toxicity, it can be administered to, for example, warm-blooded mammals (eg, rat, rabbit, sheep, pig, cow, cat, dog, monkey, human, especially human). can do.

The dose of the agonist or antagonist varies depending on the type of animal to be administered, type of target organ, condition, type of compound, dosage form of preparation, administration method, etc. In adults (60 kg), about 0.1-100 mg per day,
Preferably about 1.0-50 mg, more preferably about 1.
It is 0 to 20 mg. When administered parenterally, the single dose varies depending on the subject animal, target organ type, symptoms, compound type, formulation form, administration method, etc. In an adult (as 60 kg), it is convenient to administer about 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg per day by intravenous injection. . In the case of other animals, the dose converted per 60 kg can be administered.

(3) Prophylactic / Therapeutic Agent for Galanin Receptor Protein Deficiency The galanin receptor protein of the present invention, for example, DNA encoding human galanin receptor protein can be used as a prophylactic / therapeutic agent for galanin receptor protein deficiency. . For example, when there is a patient in whom the physiological action of galanin cannot be expected because the galanin receptor protein of the present invention, for example, human galanin receptor protein is reduced in vivo, (a) the galanin receptor protein of the present invention, for example, Administering the DNA encoding the human galanin receptor protein to the patient and expressing the galanin receptor protein in vivo, for example, the human galanin receptor protein, or (b) the galanin receptor protein of the present invention in cells, For example, DN encoding the human galanin receptor protein
A is inserted into the patient to express the galanin receptor protein, for example, the human galanin receptor protein, and then the cells are transplanted into the patient. The amount can be increased and the action of galanin can be sufficiently exerted. Therefore, the galanin receptor protein of the present invention, for example, the DNA encoding the human galanin receptor protein, is a safe and low-toxicity prophylactic / therapeutic agent for the galanin receptor protein deficiency (eg, diabetes, Alzheimer's disease or dementia). It can be used as an agent or the like. When the DNA of the present invention is used as the above-mentioned prophylactic / therapeutic agent, the DNA is inserted alone or into an appropriate vector such as a retrovirus vector, an adenovirus vector or an adenovirus associated virus vector, and then the procedure is carried out according to a conventional method. can do. For example, orally as tablets, capsules, elixirs, microcapsules, etc., optionally sugar-coated, or aseptic solution with water or other pharmaceutically acceptable liquid, or suspension It can be used parenterally in the form of injections such as. For example,
The DNA of the present invention is a physiologically acceptable carrier, flavoring agent,
It can be manufactured by mixing with excipients, vehicles, preservatives, stabilizers, binders and the like in a unit dose form generally required for the practice of formulation. The amount of the active ingredient in these preparations is such that an appropriate dose in the specified range can be obtained.

Additives which can be mixed with tablets, capsules and the like include, for example, binders such as gelatin, corn starch, tragacanth and gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid and the like. Such as a leavening agent, a lubricant such as magnesium stearate, a sweetener such as sucrose, lactose or saccharin, and a flavoring agent such as peppermint, red oil or cherry. When the preparation unit form is a capsule, a liquid carrier such as oil and fat can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to conventional pharmaceutical practices such as dissolving or suspending the active substance in a vehicle such as water for injection, naturally occurring vegetable oils such as sesame oil, coconut oil, etc. . Examples of the aqueous solution for injection include physiological saline, isotonic solution containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.), and a suitable solubilizing agent such as alcohol. (Eg ethanol), polyalcohol (eg propylene glycol, polyethylene glycol), nonionic surfactant (eg polysorbate 80 (TM), HCO-50) and the like may be used in combination. Examples of the oily liquid include sesame oil and soybean oil, which may be used in combination with solubilizing agents such as benzyl benzoate and benzyl alcohol.

Also, a buffering agent (eg, phosphate buffer,
Sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), preservatives (eg, benzyl alcohol, phenol, etc.), antioxidants And the like. The prepared injection is usually filled in a suitable ampoule. Since the preparation thus obtained is safe and has low toxicity, it can be administered to, for example, warm-blooded mammals (eg, rat, rabbit, sheep, pig, cow, cat, dog, monkey, human, especially human). can do. Although the dose of the DNA varies depending on the symptoms and the like, in the case of oral administration, it is generally about 0.
1 mg to 100 mg, preferably about 1.0 to 50 mg,
More preferably, it is about 1.0 to 20 mg. In the case of parenteral administration, the single dose varies depending on the administration subject, target organs, symptoms, administration method, etc., but in the case of an injection, for example, in an adult (60 kg), the daily dose is about 1 day. 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 1
It is convenient to administer about 0 mg intravenously. In the case of other animals, the dose converted per 60 kg can be administered. In addition, the DNA of the present invention is inserted into a cell, and the galanin receptor protein, for example, human
As a method for expressing the galanin receptor protein and transplanting the cells into a patient, a method known per se or a method analogous thereto can be used.

(4) Production of an antibody or antiserum against the galanin receptor protein of the present invention or a salt thereof or a partial peptide of the galanin receptor protein of the present invention or a salt thereof: the galanin receptor protein of the present invention or a salt thereof or the galanin receptor of the present invention An antibody against a partial peptide of a protein or a salt thereof (for example, a polyclonal antibody, a monoclonal antibody) or an antiserum uses a galanin receptor protein of the present invention or a salt thereof or a partial peptide of a galanin receptor protein of the present invention or a salt thereof as an antigen, It can be produced according to a method for producing an antibody or antiserum known per se. For example, a monoclonal antibody can be produced according to the method described below.

[Preparation of Monoclonal Antibody] (a) Preparation of Monoclonal Antibody-Producing Cell Galanin receptor protein of the present invention (eg, human galanin receptor protein or mouse-derived galanin receptor protein) or a salt thereof or galanin receptor protein of the present invention The partial peptide or a salt thereof (hereinafter sometimes abbreviated as galanin receptor) is administered to a warm-blooded animal at a site where antibody production can be carried out by administration, or together with a carrier or diluent. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration is usually performed once every 2 to 6 weeks, about 2 to 10 times in total. Examples of warm-blooded animals used include monkeys, rabbits, dogs, guinea pigs, mice, rats, sheep, goats, horses, chickens, and hamsters, and mice, rats and hamsters are preferably used.

In preparing the monoclonal antibody-producing cells, warm-blooded animals immunized with the antigen, for example, individuals with recognized antibody titers were selected from mice, and spleens or lymph nodes were collected 2 to 5 days after the final immunization. By fusing the antibody-producing cells contained therein with myeloma cells, a monoclonal antibody-producing hybridoma can be prepared. The antibody titer in antiserum can be measured by, for example, the labeled galanin receptor described below (eg, labeled human galanin receptor or labeled mouse galanin receptor).
After the reaction with the antiserum, the activity of the labeling agent bound to the antibody is measured. The fusion operation can be carried out by a known method, for example, the method of Koehler and Milstein [Nature, 256, 495 (1975)]. Polyethylene glycol (PE
G) and Sendai virus can be mentioned, but PEG is preferably used.

Examples of myeloma cells include NS-1, P
3U1, SP2 / 0, AP-1 etc., but P
3U1 is preferably used. The preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is 1:
1 to 20: 1, and PEG (preferably PEG1
000 to PEG6000) at a concentration of about 10 to 80%, and added at 20 to 40 ° C, preferably 30 to 37 ° C.
By incubating for 10 minutes, cell fusion can be efficiently performed.

Various methods can be used to screen a galanin receptor antibody-producing hybridoma (for example, an anti-human galanin receptor antibody-producing hybridoma or an anti-mouse-derived galanin receptor antibody-producing hybridoma). Hybridoma culture supernatant is added to the adsorbed solid phase (eg, microplate), and then an anti-immunoglobulin antibody labeled with a radioactive substance or enzyme (when the cells used for cell fusion are mice, anti-mouse immunoglobulin Antibodies are used) or protein A
And detecting the anti-galanin receptor monoclonal antibody bound to the solid phase, the hybridoma culture supernatant is added to the solid phase to which the anti-immunoglobulin antibody or protein A is adsorbed, and the galanin receptor labeled with a radioactive substance or enzyme is added. And a method of detecting the anti-galanin receptor monoclonal antibody bound to the solid phase.

The anti-galanin receptor monoclonal antibody can be selected by a method known per se or a method analogous thereto. It is usually carried out in a medium for animal cells supplemented with HAT (hypoxanthine, aminopterin, thymidine). As a selection and breeding medium, any medium can be used as long as hybridomas can grow. For example, 1 to 20%, preferably 10 to 20%
RPMI 1640 medium containing 1 to 10 fetal bovine serum
% GIT medium (Wako Pure Chemical Industries, Ltd.) or serum-free medium for hybridoma culture (S
FM-101, Nissui Pharmaceutical Co., Ltd.) can be used. The culture temperature is usually 20 to 40 ° C, preferably about 3 ° C.
7 ° C. Cultivation time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks. Culturing is usually performed under 5% carbon dioxide gas. The antibody titer of the hybridoma culture supernatant can be measured in the same manner as the above-mentioned measurement of the anti-mouse galanin receptor antibody titer in the antiserum.

(B) Purification of monoclonal antibody The isolation and purification of the anti-galanin receptor monoclonal antibody is carried out in the same manner as the usual isolation and purification of a polyclonal antibody [eg, salting out, alcohol precipitation,
Isoelectric focusing method, electrophoresis method, ion exchanger (eg, DEA)
E) Adsorption / desorption method, ultracentrifugation method, gel filtration method, specific purification method in which only antibody is collected by an antigen-bonded solid phase or an active adsorbent such as protein A or protein G, and the bond is dissociated to obtain the antibody] Is done according to. Since the galanin receptor antibody of the present invention produced according to the above methods (1) and (2) is capable of specifically recognizing the galanin receptor, quantification of the galanin receptor in a test solution, particularly a sandwich immunoassay method It can be used for quantification, etc.

That is, the present invention provides, for example, (i) a labeled galanin receptor bound to the antibody by competitively reacting the antibody reacting with the galanin receptor of the present invention with the test solution and the labeled galanin receptor. Method for quantifying galanin receptor in test liquid, characterized by measuring the ratio of (ii) the test liquid and the antibody insolubilized on the carrier and the labeled antibody were reacted simultaneously or successively Then, in the method for quantifying the galanin receptor in a test solution, which comprises measuring the activity of the labeling agent on the insolubilized carrier, one antibody is an antibody that recognizes the N-terminal portion of the galanin receptor and the other antibody is Provided is a method for quantifying a galanin receptor in a test liquid, which is an antibody that reacts with the C-terminal portion of the galanin receptor.

The galanin receptor can be measured using the monoclonal antibody of the present invention that recognizes the galanin receptor (hereinafter sometimes referred to as anti-galanin receptor antibody), and detection by tissue staining or the like can also be performed. For these purposes, the antibody molecule itself may be used, or F (ab ') ₂ , Fab' or Fab fraction of the antibody molecule may be used.

The assay method using the antibody of the present invention is not particularly limited and corresponds to the amount of antigen (eg, the amount of human galanin receptor or the amount of galanin receptor such as mouse galanin receptor) in the solution to be measured. The amount of the antibody, the antigen or the antibody-antigen complex is detected by chemical or physical means, and any measurement method can be used if it is calculated from a standard curve prepared using a standard solution containing a known amount of the antigen. May be used. For example, nephelometry, a competitive method, an immunometric method, and a sandwich method are suitably used, but in terms of sensitivity and specificity, it is particularly preferable to use a sandwich method described later.

Examples of the labeling agent used in the measuring method using the labeling substance include radioisotopes, enzymes, fluorescent substances, luminescent substances and the like. Examples of radioisotopes include [ ¹²⁵ I], [ ¹³¹ I], [ ³ H], and [ ¹⁴ C],
The enzyme is preferably stable and has a large specific activity, for example, β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like, and as the fluorescent substance, fluorescamine, fluorescein iso Luminol, a luminol derivative, luciferin, lucigenin, etc. are mentioned as a luminescent substance, such as thiocyanate. Further, a biotin-avidin system can be used for binding the antibody or antigen to the labeling agent.

For the insolubilization of an antigen or an antibody, physical adsorption may be used, or a method using a chemical bond which is usually used for insolubilizing or immobilizing proteins or enzymes. Examples of the carrier include insoluble polysaccharides such as agarose, dextran, and cellulose; synthetic resins such as polystyrene, polyacrylamide, and silicon; and glass.

In the sandwich method, the insolubilized anti-galanin receptor antibody is reacted with the test solution (first reaction), and further the labeled anti-galanin receptor antibody is reacted (secondary reaction), and then the labeling agent on the insolubilized carrier is used. The amount of the galanin receptor in the test liquid can be quantified by measuring the activity of the. The primary reaction and the secondary reaction may be performed in the reverse order, may be performed simultaneously, or may be performed at staggered times. The labeling agent and the method of insolubilization can be in accordance with those described above. In the immunoassay by the sandwich method, the antibody used for the solid phase antibody or the labeling antibody is not necessarily one kind, and a mixture of two or more kinds of antibodies is used for the purpose of improving measurement sensitivity and the like. You may.

In the assay method of the galanin receptor by the sandwich method of the present invention, the anti-galanin receptor antibodies used in the primary reaction and the secondary reaction are preferably antibodies having different galanin receptor binding sites. That is, when the antibody used in the secondary reaction recognizes the C-terminal portion of the galanin receptor, the antibody used in the primary reaction and the secondary reaction is preferably the C-terminal. Other than the region, for example, an antibody that recognizes the N-terminal is used.

The galanin receptor antibody of the present invention can be used in a measuring system other than the sandwich method, such as a competitive method, an immunometric method or nephrometry. In the competitive method, the antigen in the test solution and the labeled antigen are reacted competitively with the antibody, and then the unreacted labeled antigen (F) and the labeled antigen (B) bound to the antibody are separated. (B / F separation), the labeled amount of either B or F is measured, and the amount of antigen in the test liquid is quantified. In this reaction method, a soluble antibody is used as the antibody, a liquid phase method using polyethylene glycol, a second antibody against the antibody is used for B / F separation, and a solid phase antibody is used as the first antibody, or The first antibody is soluble and the second antibody is a solid-phased antibody.

In the immunometric method, the antigen in the test solution and the solid-phased antigen are competitively reacted with a fixed amount of the labeled antibody, and then the solid phase and the liquid phase are separated, or After reacting the antigen therein with an excess amount of the labeled antibody and then adding the immobilized antigen to bind the unreacted labeled antibody to the solid phase, the solid phase and the liquid phase are separated. Next, the labeled amount of either phase is measured to quantify the amount of antigen in the test liquid. In nephelometry, the amount of insoluble precipitates generated as a result of an antigen-antibody reaction in a gel or in a solution is measured. Even when the amount of antigen in the test solution is small and only a small amount of sediment is obtained, laser nephelometry utilizing laser scattering is preferably used.

When applying each of these immunological assay methods to the assay method of the present invention, it is not necessary to set special conditions, operations and the like. The assay system for the galanin receptor may be constructed by adding ordinary technical consideration to those skilled in the art to the ordinary conditions and operating methods in each method. For details of these general technical means, reference can be made to reviews, books, and the like.

[0158] For example, Hiroshi Irie "Radioimmunoassay" (Kodansha, published in 1974), Hiroshi Irie "Radioimmunoassay" (Kodansha, published in 1979), Eiji Ishikawa et al. "Enzyme Immunoassay" (medicine) Shoin (published in 1978), Eiji Ishikawa et al., "Enzyme Immunoassay" (second edition) (medical study, Eiji Ishikawa, et al. "Enzyme Immunoassay" (3rd edition) (medical) Shoin (published in 1987), "Me
`` thods in ENZYMOLOGY '' Vol. 70 (Immunochemical Techni
ques (Part A)), ibid Vol. 73 (Immunochemical Techn
iques (Part B)), Vol. 74 (Immunochemical Techn)
iques (Part C)), Vol. 84 (Immunochemical Techn)
iques (Part D: Selected Immunoassays)), ibid. Vol. 9
2 (Immunochemical Techniques (Part E: Monoclonal Ant
ibodiesand General Immunoassay Methods)), ibid.
l. 121 (Immunochemical Techniques (Part I: Hybridoma
Technology and Monoclonal Antibodies)) (issued by Academic Press Co., Ltd.) and the like. As described above, by using the galanin receptor antibody of the present invention, the galanin receptor can be quantified with high sensitivity.

(5) Preparation of Animal Having DNA Encoding Galanin Receptor Protein of the Present Invention Using the DNA encoding the galanin receptor protein of the present invention (for example, mouse-derived galanin receptor protein), the galanin receptor protein of the present invention A transgenic animal that expresses can be produced. Examples of the animal include warm-blooded mammals (eg, rat, mouse, rabbit, sheep, pig, cow, cat, dog, monkey, etc.), and mouse and the like are particularly preferable.

In transferring the DNA encoding the galanin receptor protein of the present invention into a target animal, it is generally advantageous to use the DNA as a gene construct linked downstream of a promoter capable of being expressed in animal cells. For example, in the case of transferring the galanin receptor protein DNA of the present invention, the gene construct in which the galanin receptor protein DNA of the present invention is linked to the downstream of various promoters capable of expressing in animal cells is micronized into a fertilized egg of a target animal, for example, a fertilized egg of a rabbit. By injection, a DNA-transferred animal that highly produces the galanin receptor protein of the present invention can be produced. As this promoter, for example, a virus-derived promoter or a ubiquitous expression promoter such as metallothionein can be used, but preferably an NGF gene promoter or an enolase gene promoter which is specifically expressed in the brain is used.

The transfer of galanin receptor protein DNA at the fertilized egg cell stage is ensured to be present in all germinal cells and somatic cells of the target animal. The presence of the galanin receptor protein in the germinal cells of the producing animal after DNA transfer means that all the progeny of the producing animal have the galanin receptor protein in all of its germinal cells and somatic cells. The offspring of this type of animal that inherits the gene has the galanin receptor protein in all of its germ cells and somatic cells.

Galanin receptor protein DNA of the present invention
After confirming that the transgenic animal stably retains the gene by mating, it can be reared and bred in a normal breeding environment as the DNA-bearing animal. Further, by crossing male and female animals having the DNA of interest, homozygous animals having the transgene on both homologous chromosomes are obtained, and by crossing the male and female animals, all the offspring are
Breeding passages can be made to have NA. Since the animal to which the galanin receptor protein DNA of the present invention (for example, mouse-derived galanin receptor protein DNA etc.) is transferred has a high expression of the galanin receptor protein, an animal for screening an agonist or antagonist for the galanin receptor protein. It is useful as

The DNA-transferred animal of the present invention can also be used as a cell source for tissue culture. For example, DNA or RN in the tissue of the DNA-transferred mouse of the present invention
The galanin receptor protein can be analyzed by analyzing A directly or by analyzing the protein tissue expressed by the gene. Cells of tissues containing the galanin receptor protein can be cultured by standard tissue culture techniques and used to study the function of cells from generally difficult to culture tissues, such as those derived from brain or peripheral tissues. Further, by using the cells, it is possible to select a drug that enhances the functions of various tissues, for example. In addition, if there is a highly expressing cell line, the galanin receptor protein of the present invention can be isolated and purified from the cell line.

In the present specification and drawings, when abbreviations for bases and amino acids are used, IUPAC-IUB is used.
Abbreviations based on Commision on Biochemical Nomenclature or common abbreviations in the field,
An example is given below. When an amino acid can have an optical isomer, the L-form is indicated unless otherwise specified.

DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine RNA: ribonucleic acid mRNA: messenger ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: Deoxyguanosine triphosphate dCTP: Deoxycytidine triphosphate

ATP: Adenosine triphosphate EDTA: Ethylenediaminetetraacetic acid SDS: Sodium dodecyl sulfate EIA: Enzyme immunoassay Gly: Glycine Ala: Alanine Val: Valine Leu: Leucine Ile: Isoleucine Ser: Serine: Threon: Thr: Threon: Thr.

Met: Methionine Glu: Glutamic acid Asp: Aspartic acid Lys: Lysine Arg: Arginine His: Histidine Phe: Phenylalanine Tyr: Tyrosine Trp: Tryptophan Pro: Proline Asn: Asparagine Gln Gln

NVal: norvaline pGlu: pyroglutamic acid Blc: γ-butyrolactone-γ-carbonyl group Kpc: 2-ketopiperidine-6-carbonyl group Otc: 3-oxoperhydro-1,4-thiazine-5-carbonyl Group Me: Methyl group Et: Ethyl group Bu: Butyl group Ph: Phenyl group TC: Thiazolidine-4 (R) -carboxamide group

The transformant Escherichia coli JM109 / p3 obtained in Example 3 described later.
H2-34 has been deposited as deposit number FERM BP-4828 at the Institute of Biotechnology, National Institute of Advanced Industrial Science and Technology (NIBH) since October 12, 1994, and since October 12, 1994. IF to the Fermentation Research Institute
Deposited as O 15749. Example 4 described below
The transformant Escherichia coli obtained in
a coli) JM109 / pMGR20 has been deposited with the deposit number FERM BP-4937 at the Institute of Biotechnology, National Institute of Advanced Industrial Science and Technology (NIBH) from December 15, 1994, and December 1994. It has been deposited as IFO 15773 in the Fermentation Research Institute since 14th. The mouse pancreatic β-cell line MIN6 is 1994 12
Deposit number FERM BP-4954 from the Ministry of International Trade and Industry to the Institute of Biotechnology and Industrial Technology (NIBH) from 27th of March
Has been deposited as IFO 50454 in the Fermentation Research Institute since April 11, 1995. Plasmid pTS obtained in Example 12 described below
The transformant Escherichia coli harboring 863 (Esch
erichia coli) SURE / pTS863 is 5
Deposit number FERM BP-5110 from the Ministry of International Trade and Industry to the Institute of Biotechnology and Industrial Technology (NIBH) from 25th of March
It has also been deposited as IFO 15826 at the Fermentation Research Institute since June 1, 1995. In addition, the plasmid p obtained in Example 13 described later
Transformant CHO / pTS863 that retains TS863
-5 and CHO / pTS863-7 were deposited with the deposit number FERM BP-5 at the Institute of Biotechnology, National Institute of Advanced Industrial Science and Technology (NIBH) from May 25, 1995, respectively.
111 and FERM BP-5112, and IFO 50456 and IFO 5045 to the Fermentation Research Institute from June 1, 1995, respectively.
Deposited as 7.

The sequence numbers in the sequence listing in the present specification show the following sequences. [SEQ ID NO: 1] Mouse pancreatic β cell line MIN6-derived galanin receptor protein cDNA contained in p3H2-34
The partial amino acid sequence of the protein encoded by A is shown. [SEQ ID NO: 2] Mouse pancreatic β contained in pMGR20
Galanin receptor protein cDNA derived from cell line MIN6
The entire amino acid sequence of the protein encoded by [SEQ ID NO: 3] Mouse pancreatic β cell line MIN6-derived galanin receptor protein cDNA contained in p3H2-34
The partial basic acid sequence of A is shown. [SEQ ID NO: 4] Mouse pancreatic β contained in pMGR20
Galanin receptor protein cDNA derived from cell line MIN6
The basic acid sequence with the entire translation region is shown. [SEQ ID NO: 5] Human of the present invention obtained in Example 11
The amino acid sequence of the galanin receptor protein is shown. [SEQ ID NO: 6] Human of the present invention obtained in Example 11
1 shows the base sequence of DNA encoding galanin receptor protein.

[0171]

The present invention will be described in more detail with reference to the following Examples, which do not limit the scope of the present invention. The gene manipulation method using E. coli is described in the manuscript (Maniatis et al., Molecular cloning [Molecula
r Cloning], Cold Spring Harbor Laboratory, 1989
Year).

[0172]

Reference Example 1 Production of Synthetic DNA Primer for Amplifying DNA Encoding G Protein-Coupled Receptor Protein Known human-derived TRH receptor protein (HTRH
R), human-derived RANTES receptor protein (L10
918, HUMRANTES), human Burkitt lymphoma-derived ligand unknown receptor protein (X68149,
HSBLR1A), human-derived somatostatin receptor protein (L14856, HUMSOMAT), rat-derived μ-opioid receptor protein (U02083, R
NU02083), rat-derived κ-opioid receptor protein (U00442, U00442), human-derived neuromedin B receptor protein (M73482, HU)
MNMBR), human-derived muscarinic acetylcholine receptor protein (X15266, HSHM4), rat-derived adrenergic α ₁ B receptor protein (L08)
609, RATAADRE01), human somatostatin 3 receptor protein (M96738, HUMSST)
R3X), human-derived C ₅ a receptor protein (HUMC
5AAR), human-derived ligand unknown receptor protein (HUMRDC1A), human-derived ligand unknown receptor protein (M84605, HUMOPIODRE) and rat-derived adrenergic α ₂ B (M91466, RA).
The base sequence of the cDNA encoding the amino acid sequence in the vicinity of the first transmembrane region (TA2BAR) was compared, and a highly similar portion was found.

Known mouse-derived ligand unknown receptor proteins (M80481, MUSGIR), human-derived bombedin receptor proteins (L08893, HUM)
BOMB3S), human-derived adenosine A2 receptor protein (S46950, S46950), mouse-derived ligand unknown receptor protein (D21061, MUSGP)
CR), mouse-derived TRH receptor protein (S433
87, S43387), rat-derived neuromedin K receptor protein (J05189, RATNEURA),
Rat-derived adenosine A1 receptor protein (M690
45, RATA1ARA), human-derived neurokinin A
Receptor protein (M57414, HUMNEKA
R), rat-derived adenosine A3 receptor protein (M
94152, RATADENREC, human somatostatin 1 receptor protein (M81829, HUMS)
RI1A), human-derived neurokinin 3 receptor protein (S86390, S86371S4), rat-derived ligand unknown receptor protein (X61496, RNCG)
PCR), human somatostatin 4 receptor protein (L07061, HUMSSTR4Z) and rat GnRH receptor protein (M31670, RATG)
The nucleotide sequences of the cDNAs encoding the amino acid sequences in the vicinity of the sixth transmembrane region of (NRHA) were compared, and a highly similar portion was found.

The abbreviations in parentheses above are DNASIS Gene / Prot
GenBank / EMBL Da using the ein sequence database (CD019, Hitachi Software Engineering)
This is the reference number shown when you search for ta Bank, which are usually called the Accession Number and Entry Name, respectively. However, for HTRHR, Japanese Patent Application No. 5-2
The sequence is described in No. 86986 (EPA 638645). In particular, based on the base portion that coincides with many receptor cDNAs, introduction of mixed bases was planned in order to increase the coincidence of the sequence with as many receptor cDNAs as possible in other portions. Based on this sequence, SEQ ID NO: 7 or SEQ ID NO: 8 complementary to the common nucleotide sequence
Two synthetic DNAs having a base sequence represented by were prepared.

[Synthetic DNA] 5′-CGTGG (G or C) C (A or C) T (G or C) (G or C) TGGGCAAC (A, G, C or T) (C or T) CCTG- 3 '(SEQ ID NO: 7) 5'-GT (A, G, C or T) G (A or T) (A or G) (A or G) GGCA (A, G, C or T) CCAGCAGA (G Alternatively, T) GGCA AA-3 ′ (SEQ ID NO: 8) () is mixed with a plurality of bases during synthesis.

[0176]

Example 1 Poly (from mouse pancreatic β cell line MIN6
A) ⁺ Preparation of RNA fraction and synthesis of cDNA Mouse pancreatic β cell line MIN6 (Junichi Miyazaki et al.
Endocrinology, Vol.127, No.1, p126-132) was used to prepare Total RNA by the guanidine thiocyanate method (Kaplan BB et al., Biochem. J. 183, 181-184 (19
79)), and a mRNA purification kit (Pharmacia) were used to prepare a poly (A) ⁺ RNA fraction. Then poly (
A) ⁺ Random D as a primer to 5 μg of RNA fraction
NA hexamer (BRL) was added, and complementary DNA was synthesized using Moronii mouse leukemia virus reverse transcriptase (BRL) using the attached buffer. The product after the reaction was extracted with phenol: chloroform (1: 1) and precipitated with ethanol, and then 30 μl of TE (Tris-EDTA so was added.
lution; 10mM Tris-HCl (pH 8.0), 1mM EDTA (pH 8.0))
Was dissolved.

[0177]

Example 2 Amplification of Receptor cDNA by PCR Method Using MIN6-Derived cDNA and Determination of Nucleotide Sequence c
Amplification by PCR was performed using 5 μl of DNA as a template and the DNA primer synthesized in Reference Example 1. The composition of the reaction solution is 100 for each of the synthetic DNA primers.
pM, 0.25 mM dNTPs, Taq DNA polymer
1 μl of ase and 10μ of 10x buffer attached to the enzyme
The total reaction solution volume was 100 μl. The cycle for amplification uses a thermal cycler (Perkin Elmer), 96 ° C for 30 seconds, 45 ° C for 1 minute, 60 ° C.
The 3 minute cycle was repeated 30 times. Taq DNA p
Before adding olymerase, mix the remaining reaction mixture and
Heating was performed at 5 ° C for 5 minutes and 65 ° C for 5 minutes. The amplification product was confirmed by 1.2% agarose gel electrophoresis and ethidium bromide staining.

[0178]

Example 3 Subcloning of PCR Product into Plasmid Vector and Selection of Novel Receptor Candidate Clones by Decoding Nucleotide Sequence of Inserted cDNA Part The reaction product after PCR performed in Example 2 was 0.8% low melting point agarose gel. DNA was collected by separating the band using a razor and cutting out the band portion with a razor, followed by heat melting, phenol extraction and ethanol precipitation. The recovered DNA was subcloned into the plasmid vector pCR ^™ II (Invitrogen) according to the prescription of TA cloning kit (Invitrogen). E. coli JM10
9 competent cell (Takara Shuzo Co., Ltd.) and transformed, the clone having the cDNA insert fragment was cloned into ampicillin, isopropylthio-β-D-galactoside (IPTG) and 5-bromo-4-chloro-3-indolyl-. L containing β-D-galactoside (X-gal)
B clones were selected in agar medium, and only white-colored clones were isolated using a sterilized toothpick, and transformed into Escherichia coli JM109 / p3H2-34.
I got

Individual clones were labeled with LB containing ampicillin
After culturing overnight in a medium, plasmid DNA was prepared using an automatic plasmid extractor (Kurabo). Prepared D
A part of NA was used for digestion with EcoRI to confirm the size of the inserted cDNA fragment. The rest of D
A part of NA was further treated with RNase, extracted with phenol / chloroform, and concentrated by ethanol precipitation.
The reaction for determining the nucleotide sequence is DyeDeoxy Terminator C
Ycle Sequencing Kit (ABI) was used, and decoding was performed using a fluorescent automatic sequencer. The obtained nucleotide sequence information was obtained using DNASIS (Hitachi System Engineering Co., Ltd.).

As a result of a homology search based on the determined nucleotide sequence [FIG. 1], the cDNA fragment inserted into the plasmid carried by the transformant Escherichia coli JM109 / p3H2-34 was identified as a novel G fragment.
It was found to encode a protein-coupled receptor protein. In order to further confirm this, DNASIS (Hitachi System Engineering Co., Ltd.) was used to convert the nucleotide sequence into an amino acid sequence [FIG. 1], followed by a hydrophobicity plot [FIG. 2] and a homology search based on the amino acid sequence, Somatostatin receptor subtype 4 (JN
0605), human somatostatin receptor subtype 2 (B41795), and rat-derived ligand unknown receptor (A39297) were found to be homologous [Fig. 3].
The abbreviations in parentheses above are reference numbers when registered as data in NBRF-PIR / Swiss-PROT.
It is called Number or Entry Name.

[0181]

Example 4 Mouse pancreatic β cell line MIN6 derived cDNA
Cloning of cDNA containing the entire coding region of the receptor protein from the library For construction of a MIN6-derived cDNA library, BRL was used.
Superscript ^TM Lambda System (BRL, Cat.825
6) and Stratagene's Gigapack II Gold (Strat
agene, Cat. 200215) was used. Using 10 μg of MIN6 poly (A) ⁺ RNA using the above kit, 2.
A 2 × 10 ⁶ pfu (plaque forming unit) MIN6 cDNA library was constructed. The cDNA library of E. coli Y1090r treated with magnesium sulfate ^-. Mixed with, 37 ° C., after 15 minutes of incubation, 0 5% agarose (Pharmacia) L
B was added to 1.5% agar (Wako Pure Chemical Industries) LB plate (
50 μg / ml Ampicillin was included). A nitrocellulose filter was placed on the plaque-formed plate and the plaque was transferred onto the filter. After denaturing this filter by alkali treatment,
DNA was fixed by heating for a period of time.

This filter is treated with 50% formamide, 4
× SSPE (SSPE: 150 mM NaCl, 10 mM NaH ₂ PO ₄ ·
H ₂ O, 1.25 mM EDTA, pH7.4), 5 × Denhardt's solution,
0.1% SDS (sodium dodecyl sulfate), 100
Hybridization was carried out by incubating with the probe described below at 42 ° C. overnight in a buffer containing μg / ml salmon sperm DNA for hybridization. As the probe, the DNA fragment inserted into the plasmid p3H2-34 obtained in Example 2 was cleaved with EcoRI and recovered, and then a [ ³² P] dCTP (DuPont) was used using a random prime DNA labeling kit (Amersham). Was used by labeling. Washing is 2 x SSC, 0.1%
SDS was performed at 55 ° C for 1 hour, and then autoradiography was performed at -80 ° C to detect hybridizing plaques.

This screen revealed hybridization signals in two independent plaques. DNA was prepared from each of the two clones, digested with SalI and NotI, and analyzed by agarose gel electrophoresis. The results were about 2.0 kb and 3.0, respectively.
An insert fragment was confirmed at kb, of which about 3.0
The one that produced a kb band (λ No. 20) was selected. λ No. 20, about 3.0 kb NotI SalI
Fragment No. of plasmid pBluescript ^™ IISK (+)
After subcloning into the tI SalI site, Escherichia coli JM109 was transformed with this plasmid to obtain a transformant Escherichia coli JM109 / pMGR20. When a restriction enzyme map was prepared from this plasmid pMGR20 based on the restriction enzyme map predicted from the nucleotide sequence shown in Example 2, it is predicted from the DNA encoding the receptor protein shown in Example 2. It was found to retain the DNA encoding the entire length of the receptor protein.

[0184]

Example 5 MIN6-derived receptor protein full-length cDNA
Determination of the nucleotide sequence of A Of the NotI SalI fragment inserted into the plasmid pMGR20 obtained in Example 4, a region considered to encode the receptor protein and its peripheral region 160 in total.
The base sequence of 7 bp was determined. Specifically, NotI
Utilizing the restriction enzyme sites present in the SalI fragment,
A template plasmid for sequence analysis was prepared by removing unnecessary portions or subcloning required fragments.
Further, regarding the base sequence of a part of the region, a primer for base sequence determination was synthesized based on the base sequence already determined, and further confirmation was performed. Dye Deoxy Terminator Cycle Sequencing Kit
(ABI Co., Ltd.), and a fluorescent DNA sequencer (ABI Co., Ltd.) was used for decoding, and DNA was analyzed for data analysis.
SIS (Hitachi Software Engineering Co.) was used.

The nucleotide sequence around the translation region of the mouse galanin receptor protein encoded by the cDNA inserted into pMGR20 is shown in FIG. The base sequence of the DNA encoding the mouse galanin receptor protein corresponds to the 481st to 1525th bases in the base sequence shown in FIG. The amino acid sequence of the receptor protein encoded by this was the amino acid sequence represented by SEQ ID NO: 2 [Fig. 4]. This amino acid sequence has 92% homology in the amino acid sequence with human-derived galanin receptor protein, and therefore pMGR2
The cDNA inserted in 0 was found to be a cDNA encoding a mouse galanin receptor protein.

[0186]

Example 6 Galanin Receptor Binding Experiment Using MIN6 Cell Membrane Fraction (1) Method for Preparing Membrane Fraction from MIN6 Cell MIN6 cell is a known method (endoclinology, 12
7, 126-132, 1990). That is, 15% fetal bovine serum, 4.5 g / l glucose, 5 μl / l mercaptoethanol, 75 mg
The cells were cultured in Dulbecco's modified Eagle medium supplemented with 50 ml / ml penicillin and 50 mg / ml streptomycin in the presence of 5% carbon dioxide. The cultured main cells were washed with PBS containing EDTA and detached from the incubator. The detached cells were collected by centrifugation and used for the following membrane fraction preparation.

The collected cells (about 2.5 ml volume) were homogenized with a buffer for homogenization (10 mM NaHCO ₃ , 5 mM).
EDTA, 0.5 mM PMSF, 10 μg / ml
Pepstatin, 20 μg / ml leupeptin, 4 μg
/ Ml E-64, pH 7.2) suspended in 20 ml,
This was homogenized using a Polytron homogenizer (Kinematica) at 23,000 rpm for 1 minute. The obtained homogenate was centrifuged at 5,000 rpm for 10 minutes in a Hitachi RP24A rotor using a Hitachi high speed centrifuge (model: CR26H). The supernatant after centrifugation was collected and used in a Hitachi RP42 rotor using a Hitachi ultracentrifuge (model: SCP70H) at 30,000 rpm,
Ultracentrifugation was performed for 1 hour to obtain a pellet. The obtained pellet is resuspended in the buffer for mogenizing, and the suspension is kept at -70 ° C until use.
Saved in.

(2) Receptor Binding Experiment Using MIN6 Cell Membrane Fraction The MIN6 cell membrane fraction prepared by the method of (1) above was treated with a buffer for receptor binding experiment (20 mM Tris,
1 mM EDTA, 0.03% NaN ₃ , 0.1% B
SA, 0.05% CHAPS, 0.5 mM PMS
F, 10 μg / ml pepstatin, 20 μg / ml
Leupeptin, 4 μg / ml E-64, pH 7.4)
Was used to dilute the membrane protein to a concentration of 50 μg / ml. Dispense 100 μl each of the diluted membrane fractions into polypropylene test tubes (Falcon 2038),
It was subjected to the following receptor binding experiment. In addition, commercially available [
¹²⁵ I] Radioisotope-labeled porcine galanin (manufactured by New England Nuclear Co., Ltd.) was diluted to a concentration of 5 nM with a buffer solution for receptor binding experiment, and used in the following experiments.

3 μl of standard porcine galanin solution or galanin-related peptide solution with variable concentration, and 5 nM
2 μl of labeled galanin solution is mixed with 100 μl of the above membrane fraction. This was left standing in a water bath at 25 ° C for 75 minutes to promote the receptor binding reaction. After that, 1.5 ml of ice-cooled buffer for binding experiment was added to the reaction solution to stop the binding reaction, and immediately filtered with glass fiber filter paper (Whatman, GF / F), and the membrane fraction was filtered. To collect. Furthermore, after washing the filter paper with 1.5 ml of the same buffer, the amount of radioisotope in the filter paper was measured with a gamma ray detector. The amount of labeled galanin bound was determined by the following [Equation 2]: Percent of Maximum
It is represented by Binding (PMB).

[0190]

[Number 2] PMB = [(B-NSB) / (B 0 -NS
B)] × 100

PMB: Percent of Maximum Binding B: value when a sample was added NSB: non-specific binding amount (binding amount of labeled galanin in the presence of 1 μM standard galanin) B ₀ : maximum binding amount (standard pig-type galanin) (Binding amount of labeled galanin in the absence)

The bound amount (PMB) of labeled galanin measured by the above method was plotted against the concentration of standard porcine galanin, rat galanin, galanin (1-16) partial peptide or galanin antagonist (galantide). It is shown in FIG. Further, the concentration (IC ₅₀ ) giving PMB = 50% was determined from this result and is shown in [Table 1].

[0193]

[Table 1] ────────────────────────────── Peptide IC ₅₀ value ───────────── ────────────────── Porcine Galanin 0.12 nM Rat Galanin 0.13 nM Galanin (1-16) 3.3 nM Galantide 0.69 nM ─── ────────────────────────────

From Table 1, it was found that the receptor binding affinity of the ligand for the galanin receptor can be measured through the galanin receptor binding experiment by using the cell membrane fraction of MIN6 cells.

[0195]

Example 7 Screening for Galanin Receptor Agonists / Antagonists by Galanin Receptor Binding Experiments Galanin receptor agonists / antagonists can be screened by the method described in Example 6. That is, the test compound solution 1 μl, 5n
2 μl of M labeled galanin solution was treated with MI in the same manner as in Example 6.
Mix with 100 μl of N6 cell membrane fraction. Hereinafter, Example 6
The binding amount is determined in the same manner as described above, and a compound that reduces PMB to below a certain amount is screened as a galanin receptor agonist / antagonist.

[0196]

Example 8 Method for Detecting Galanin Biological Activity Using MIN6 Cells Galanin is known to have a biological activity that inhibits glucose-stimulated insulin secretion in pancreatic islets of Langerhans. This activity can be easily detected by the following method using MIN6 cells. Among these detection methods, the measurement of insulin secretion by glucose stimulation is basically a known method (Diabetrosia, vol. 36, 113).
9-1145, 1993). That is, M
3 × 10 ⁵ IN6 cells were seeded in a 24-well plate, 15% fetal bovine serum, 4.5 g / l glucose,
The cells were cultured in Dulbecco's modified Eagle medium supplemented with 5 μl / l mercaptoethanol, 75 mg / ml penicillin and 50 mg / ml streptomycin in the presence of 5% carbon dioxide for 3 days.

Cells were grown in Krebs-Ringer-Hepes buffer (119 mM NaCl, 4.74 mM KCl, 2.
54 mM CaCl ₂ , 1.19 mM MgSO ₄ ,
1. 19 mM KH ₂ PO ₄ , 25 mM NaHCO
₃ , washed with 10 mM Hepes, 0.5% BSA) three times, and incubated at 37 ° C. for 30 minutes in Krebs-Ringer-Hepes buffer supplemented with 5 mM glucose. In addition, cells were washed twice with Krebs-Ringer-Hepes buffer. Cells with variable concentrations of rat galanin and 2
The cells were incubated at 37 ° C. for 90 minutes in Krebs-Ringer-Hepes buffer supplemented with 5 mM glucose. The culture supernatant after culturing was collected, and the amount of insulin secreted in the culture supernatant was quantified using a commercially available radioimmunoassay (manufactured by Amersham).

FIG. 8 shows the results of plotting the amount of insulin secreted against the amount of galanin. From FIG. 8, it was found that by adding about 100 pM galanin, the insulin secretion amount increased by glucose stimulation was reduced to about half. This revealed that galanin activity can be easily detected using this method.

[0199]

Example 9 Method for Detecting Galanin Biological Activity Using MIN6 Cells When MIN6 cells were treated with forskolin, intracellular c
AMP concentration rises and insulin secretion increases. This phenomenon can be inhibited by the addition of galanin and can be used as a method for measuring the biological activity of galanin. Cells subjected to culture and pretreatment (washing, 5 mM glucose treatment, washing operation) as in Example 8 were treated with a variable concentration of rat galanin, 100 μM forskolin, 20.
0 μM isobutylmethylxanthine and 6.25 m
The cells were cultured in Krebs-Ringer-Hepes buffer supplemented with M glucose at 37 ° C. for 90 minutes.

After culturing, the culture supernatant was recovered, and the amount of insulin secreted into the culture supernatant was quantified using a commercially available radioimmunoassay (Amersham). In addition, cells were treated with perchloric acid to extract intracellular cAMP, and cAMP in the extract was quantified using a commercially available radioimmunoassay (manufactured by Amersham). The results of plotting the amount of insulin secreted against the amount of galanin are shown in FIG. Also,
The results of plotting intracellular cAMP amount are shown in FIG. 10. From FIG. 9 and FIG. 10, it was found that galanin activity can be easily detected by measuring insulin secretion from MIN6 cells or cAMP concentration in MIN6 cells.

[0201]

Example 10 Method for detecting biological activity of galanin agonist / antagonist using MIN6 cells By the method described in Example 8, galanin agonist / antagonist
The activity of the antagonist can be measured. That is, the same culture and pretreatment (washing, 5 mM as in Example 8).
Cells treated with glucose and washed) were treated with a test compound at an appropriate concentration, 100 pM rat galanin, 2
The cells were incubated at 37 ° C. for 90 minutes in Krebs-Ringer-Hepes buffer supplemented with 5 mM glucose.

After culturing, the culture supernatant was collected, and the amount of insulin secreted in the culture supernatant was quantified using a commercially available radioimmunoassay. As controls, in Krebs-Ringer-Hepes buffer containing only 25 mM glucose, and 100 pM rat galanin, 25 mM
Insulin was similarly quantified in the culture supernatant after culturing in Krebs-Ringer-Hepes buffer containing glucose. From this, it was found that the activity of galanin receptor agonist / antagonist can be easily measured using MIN6 cells.

[0203]

[Example 11] Cloning of cDNA encoding human galanin receptor protein Human melanoma Bowes cells were cultured in high glucose DMEM medium containing 10% fetal bovine serum at 37 ° C and 95% a.
cultured in ir / 5% CO ₂ under at became almost confluent, guanidine - total RNA was prepared by thiocyanate method. A poly A ⁺ RNA fraction was prepared from the total RNA obtained here by an oligo (dT) cellulose column. 10 μg of this poly A ⁺ RNA was used to synthesize single-stranded DNA using random hexamer and reverse transcriptase, and then Escherichia coli DNA polymerase I, RN
double-stranded DNA was synthesized using ase H and poly A ⁺ R
Double-stranded cDNA was obtained from NA. This double-stranded cDNA was treated with T4 DNA polymerase to blunt the ends, and then an EcoRI adapter was added. E at both ends
After removing the cDNA of about 1000 bp or less from the double-stranded cDNA to which the coRI adapter has been added by gel filtration, EcoRI using T4 polynucleotide kinase
A phosphate group was introduced into the adapter.

Next, this cDNA was cloned into λgt11 Eco.
After assembling into RI arm, in vitro packaging was performed, and the total amount of melanoma bowe was about 1.5 × 10 ⁶ pfu.
s cell cDNA library (average chain length of about 1.6 kb
p, insertion rate 98%). After infecting the E. coli Y1090r ⁻ strain with the λ phage of this cDNA library, about 1.8 × 10 ⁴ plaques were plated on a soft agar plate and incubated at 42 ° C. overnight to form plaques. After transferring the plaques onto a nitrocellulose filter, the denaturing solution [0.5N sodium hydroxide,
1.5M sodium chloride], neutralization solution [0.5M Tris-hydrochloric acid (pH 7.0), 1.5M sodium chloride], 3 × SSC [20 × SSC = 3M sodium chloride, 0.3M sodium citrate] The cells were sequentially treated, air-dried and then baked at 80 ° C. for 3 hours to immobilize the phage DNA on a nitrocellulose filter.

On the other hand, cDNA for use as a probe
To obtain the A fragment, the known human galanin receptor cDNA [Habert-Ortoll, E. et al., Proc. Nats. Academy of Sciences of the USA (Proc. Natl . Aca
d. Sci. USA) 91, 9780-9783 (1994)].

Is a synthetic oligonucleotide 5'TCCGTGGACCGCTACGTGGCCCATCGTG 3 '(SEQ ID NO: 9) and containing a +388 to +414 (translation initiation site is +1) sense sequence. Is 5'GACTTATCACACATGAGTACAATTGGTTGATGG 3 '(SEQ ID NO: 10), which is a synthetic oligonucleotide containing an antisense sequence from +1024 to +1053.

Using these two synthetic nucleotides as primers, poly A ⁺ RN of human melanoma Bowes cells was prepared.
RT-PCR was performed using A5 μg as a template, and 669b
A cDNA fragment containing the C-terminal side of the human galanin receptor protein of p was obtained. This cDNA fragment is called pUC119
At the HincII site of the plasmid pHGR54
-7 was obtained. pHGR54-7 was added to BamHI, Hinc
A cDNA fragment containing the C-terminal side of the human galanin receptor protein obtained by double digestion with II was labeled with human melanoma Bo
It was used as a probe for screening a cDNA library of wes cells.

The probe was labeled by labeling the above cDNA fragment with [α- ³² P] dCTP by the random prime method. Hybridization buffer containing labeled probe [5 x SSPE, 5 x Denhardt's solution, 10
Hybridization was carried out in 0 μg / l heat-denatured salmon sperm DNA, 0.1% SDS] at 65 ° C. The filter is finally 5x in 0.1 x SSC, 0.1% SDS solution.
After washing at 0 ° C., an autoradiogram was taken to search for plaques that hybridize with the probe. After extracting the phage DNA from the phage clone λHGR2 obtained by this method, the cDNA fragment was excised by digesting with the restriction enzyme EcoRI and inserted into the EcoRI site of the pUC118 plasmid to obtain pHGR2-3. The nucleotide sequence of the inserted cDNA fragment is [α- ³² P] d
This CD was determined by the usual method using CTP.
The NA fragment was found to consist of 1882 bp (Figures 11 and 12, SEQ ID NO: 6). Reported nucleotide sequence of human galanin receptor cDNA [Habert-Ort
oll, E. et al., Procedures of the National Academy of Sciences of the
USA (Proc. Natl. Acad. Sci. USA) 91, 9780
-9783 (1994)], one base substitution was observed. This base substitution is in the translation region and involves amino acid substitution ¹⁵ Cys (TGT) → ¹⁵ Trp (TGG)
(FIG. 11 and FIG. 12, SEQ ID NO: 6). As described above, the plasmid pHGR2-3 containing the human galanin receptor cDNA fragment was obtained.

[0209]

Example 12 Human galanin receptor protein cDNA
Construction of Expression Plasmid of A As an expression vector, pAKKO-111 (indicated as pA1-11 in FIG. 13) was used. pAKKO
-111 was constructed as follows. JP-A-5-076
From pTB1417 described in JP 385 by treating with HindIII and ClaI.
A 1.4 kb DNA fragment containing the olyaA addition signal was obtained. In addition, pTB348 (Naruo, K. et al. Biochemical and Biophysical Research Communications (Biochem. Biophys. Res. Commun.))
128, 256-264 (1985)) and a ClaI and SalI treatment to obtain a 4.5 kb DNA fragment containing the dihydrofolate reductase (dhfr) gene. After blunting the ends of these DNA fragments by T4 polymerase treatment,
The pAKKO-111 plasmid was constructed by ligating with T4 ligase.

Plasmids pHGR2-3 and p containing the human galanin receptor cDNA fragment obtained in Example 11
A human galanin receptor cDNA expression plasmid was prepared from HGR54-7 as shown in FIG. First, pHGR2-3 was double-digested with restriction enzymes BamHI and MunI, and the resulting DNA fragment of about 1190 bp was p-digested.
It was inserted into the BamHI and MunI sites of HGR54-7. PHGR at the XmaI and SacII sites of this plasmid
The 495 bp fragment obtained by digesting 2-3 with NcoI was used as D
20 obtained by double-digesting with AgeI and SacII after treatment with NA polymerase I Klenow fragment to make the ends blunt-ended and adding a SalI linker.
A plasmid pTS862 containing a 0 bp DNA fragment and containing only the translation region of human galanin receptor cDNA
I got Finally, SalI DNA containing a translation region of human galanin receptor protein cDNA of about 1.0 kbp obtained by digesting plasmid pTS862 with SalI.
The fragment was introduced into the SalI site of pAKKO-111 in the forward direction to obtain human galanin receptor protein cDNA expression plasmid pTS863. This expression plasmid pT
S863 was transformed into Escherichia coli, and transformant Escherichia coli SURE / pTS86
3 was obtained.

[0211]

Example 13 Human galanin receptor protein cd
NA CHO (dhfr ^-) Expression in cells CHO (dhfr^-) Cells 3 × 10^Four ~ 1 × 10⁶ cell
Change the number of cells stepwise and put 4 pieces on a petri dish with a diameter of 10 cm.
24 in Ham's F12 medium containing 10% fetal bovine serum
Incubated for hours. Human cells obtained in Example 12 were added to these cells.
Nin receptor cDNA expression plasmid pTS863
Transfect 1.5 μg using the calcium phosphate method
The action was done. 24 hours after transfection
The medium is added to DMEM medium containing 10% dialyzed fetal bovine serum.
Select cells that have exchanged and integrated the plasmid into the chromosome
did. Clone selected cell colonies and
Cell line CHO stably stably expressing the togaranin receptor
/ PTS863-5 and CHO / pTS863-7
Two clones were obtained.

[0212]

Example 14 Measurement of Human Galanin Receptor Activity of Human Galanin Receptor Expressing CHO Cells Human galanin receptor expressing CHO cells were plated on a 12-well plate at 37 ° C. using a DMEM medium containing 10% dialyzed fetal bovine serum. The cells were cultured until they became confluent under 95% air / 5% CO ₂ , and the medium was exchanged the day before the binding experiment to express the human galanin receptor having the amino acid sequence represented by SEQ ID NO: 5.

Next, a binding experiment for [ ¹²⁵ I] galanin (pig type) was carried out as follows. First, the binding assay buffer (0.1% BS) was prepared by warming the cells to 37 ° C.
A, HANKS solution containing 0.05% CHAPS) was washed twice with 1 ml, and the binding measurement buffer was sucked out, and then 1
0.5 ml of a binding assay buffer containing 00 pM [ ¹²⁵ I] galanin (pig type) was added, and the mixture was incubated at 37 ° C and 95% air / 5%.
The binding reaction was carried out under CO ₂ conditions for 1 hour. After the reaction,
The binding assay buffer was removed and washed 3 times with 1 ml of binding assay buffer warmed to 37 ° C. Bound to cells [ ¹²⁵ I]
The amount of galanin (porcine type) was measured with a γ-counter after peeling the cells with 0.2N sodium hydroxide, and this was taken as the total binding amount. In addition, at the time of the binding reaction, 1 μM unlabeled galanin was added and the same operation was performed to bind to the cells [
The amount of ¹²⁵ I] galanin (pig type) was defined as the amount of non-specific binding. The results are shown in [Table 2].

[0214]

[Table 2] ────────────────────────────── Total binding amount Nonspecific binding amount Cell line number (cpm) (cpm) ) ────────────────────────────── CHO / pTS863-5 50466.8 ± 502.9 1458 ± 100.1 CHO / pTS863-7 59 158.6 ± 209 5.1 1962.4 ± 56.3 ──────────────────────────────

From Table 2, cell line CHO / pT that stably and highly expresses the human galanin receptor protein of the present invention.
It was confirmed that S863-5 and CHO / pTS863-7 can specifically bind to the ligand galanin.

[0216]

Example 15 Saturation binding experiment using ¹²⁵ I-galanine (human type) in GAL5 cell membrane fraction and Scatchard plot analysis CHO cells expressing human galanin receptor (GA
L5 cells; CHO / pTS863 obtained in Example 13
-5) was cultured in DMEM medium containing 10% dialyzed serum, 2 mM glutamine, penicillin, and streptomycin at 37 ° C. in a 5% CO ₂ incubator. GAL5 cells in PBS containing 1 g / l EDTA
And then homogenize buffer (10 mM HEP
ES, 5 mM EDTA, 0.03% NaN ₃ , 10 μg
/ Ml pepstatin, 0.5 mM phenylmethylsulfonyl fluoride (PMSF), 20 μg / ml E-
64, 40 μg / ml leupeptin, pH 7.3) was suspended and homogenized with a Polytron homogenizer. Homogenize the sample with a high-speed centrifuge for 2,500
Centrifuged at 4 ° C. for 10 minutes at rpm. The supernatant is
Ultracentrifugation was performed at 00 rpm for 60 minutes at 4 ° C. to recover the pellet, which was suspended in homogenization buffer and GA
The L5 cell membrane fraction was used.

GAL5 cell membrane fraction was added to assay buffer (20 mM Tris, 1 mM EDTA, 0.08%).
NaN ₃ , 10 μg / ml pepstatin, 0.5 mM
PMSF, 20 μg / ml E-64, 40 μg / ml
Leupeptin, 0.1% BSA, 0.05% CHAP
S, pH 7.4) to dilute the membrane protein concentration to 2 μg / ml, and dispense into 100 μl / tube. This GAL5 membrane fraction, concentrations were varied from 15pM to 500pM ¹²⁵
After incubation with I-galanin (human type) at 25 ° C. for 75 minutes, filtration buffer (20 mM Tris,
1 mM EDTA, 0.03% NaN ₃ , 0.1% B
SA, 0.05% CHAPS, pH 7.4, 4 ° C) 1.
GF / F diluted with 5 ml and treated with polyethyleneimine
It filtered with the glass fiber filter paper (Whatman company). After washing the filter paper with 1.5 ml of the filter buffer, its radioactivity was measured by γ-counter (Beckman Instrument).
nts) to determine the amount of binding. The amount of non-specific binding was performed in the presence of 270 nM galanin (human type). As a result of Scatchard plot analysis of the binding data, the dissociation constant (Kd) was 20 pM and the expression level (Bma
x) was calculated to be 9.6 pmol / mg protein.

[0218]

Example 16 Northern blot analysis using mouse galanin receptor protein cDNA Obtained from mouse brain, thymus, spleen, lung, heart, liver, kidney, pancreas, testis, smooth muscle of small intestine, MIN6, and Neuro-2a cells After denaturing 5 μg of the obtained poly (A) ⁺ RNA with glyoxal and dimethyl sulfoxide, 1.2
Electrophoresis on a% agarose gel (Thomas, P.
S., Proc. Natl. Acad. Sci. USA, 77,5201-5205, 1
980). After electrophoresis, RNA was transferred onto a nitrocellulose filter (Schleicher & Schuell, Germany) and the filter was baked at 80 ° C. for 2 hours. As a probe, a cDNA insert of p3H2-34 digested with EcoRI and cut out was used as a Multiprime DNA labeling kit (Amersham InternationalPL).
C, UK) [α ³² P] dCTP (222TBq
/ Mmol, Dupout / NEN). Hybridization was performed at 42 ° C. with 50% formaldehyde, 5 × SSC, 50 mM NaHPO ₄ , p.
H6.5, 10 × Denhardt's solution and 100
Done in buffer containing salmon sperm DNA at μg / ml. The filter is then 5 × 2 × SSC, 0.1% SDS
It was washed at 0 ° C. and then autoradiographed on X-Omat film AR (Eastman Kodak Co., USA) for 12 days at −80 ° C. In the Northern blot analysis using poly (A) ⁺ RNA obtained from mouse tissues, a weak hybridization signal of mouse galanin receptor was detected only in the brain and small intestine [FIG. 14]. The results of this Northern blotting indicate that the expression level of galanin receptor mRNA is substantially low in normal mouse tissues.

[0219]

Example 17 (1) Expression of mouse-derived galanin receptor cDNA in CHO cells cDNA clone pMGR20 having a complete translation region
Was digested with NotI to give a blunt end, and ligated with XbaI linker (Takara Shuzo Co., Ltd.). Obtained c
The DNA fragment was digested with SalI and XbaI and cut out to obtain a mammalian cell expression vector, pAKKO-111.
It was inserted between the SalI-SpeI sites of H. pAK
KO-111H was prepared by introducing a multi-cloning site of SalI-ClaI-SpeI-NheI using synthetic DNA at the SalI site which is a cloning site of pAKKO-111 of Example 12. The mouse has a galanin receptor cDNA downstream of the SRα promoter, and dhf is used as a selectable marker.
The expression plasmid containing the r gene was cloned into pAKKOMGR2
0. Use this plasmid DNA as Cell Ph
ect Transfection Kit (Phar
CHO dhfr ⁻ cells attached to Macia) were transfected. Α-MEM medium lacking deoxyribonucleosides and ribonucleosides (GIBCO
Fetal bovine serum (FBS G) dialyzed into BRL
Transformants were selected among those supplemented with IBCO BRL).

(2) [ ¹²⁵ I] Porcine Galanin Binding Assay CHO cells transformed with pAKKOGRGR20 and CHO cells transformed with pAKKO-111H were treated as 2.0 × 10 ⁵ cells / well in a 12-well tissue. -Grow in culture plate and incubate for 1 day. Hanks' bal containing 0.1% BSA
After washing three times with an advanced salt solution (HBSS), at room temperature for 1 hour, 100 pM [presence or absence of unlabeled porcine galanin (final concentration of 1 μH)] was used.
Incubation was carried out with ¹²⁵ I] porcine galanin (Dupont / NEN). Then the cells are BS 3 times
Washed with HBSS containing A, 0.1N NaOH, 1
After lysing with% SDS, the remaining radioactively labeled ligands were analyzed by γ-counter (Beckman I).
nstruments, USA).

Cell membrane fractions were prepared from transformant CHO cells for competitive binding experiments and Scatchard plot analysis. Cells grown in a 225 cm ² tissue culture flask for 3 days were dispersed in phosphate buffered saline solution (PBS) containing 5 mM EDTA and then harvested by centrifugation. The cells were washed with the same buffer, then 1 mM EDTA, 0.5 mM phenylmethylsulfonylfluoride (PMSF), 2.0 μg /
ml leupeptin, 4 μg / ml E-64 and 0.
It was suspended in 10 mM sodium carbonate buffer (pH 7.5) containing 5 μg / ml pepstatin. Pol
After homogenizing the cells with a ytron homogenizer, the homogenate was reconstituted with Hitachi.
10 minutes in RR2A2 rotor (Hitachi) 3,0
It was centrifuged at 00 rpm. Beck the resulting supernatant
manType30 rotor (Beckman, US
Ultracentrifugation was performed in A) for 30 minutes at 30,000 rpm. The resulting pellet is then added to 20 mM Tris
-HCl (pH 7.5), 5 mM EDTA, 0.5 m
M PMSF, 20 μg / ml leupeptin, 4 μg
The cells were suspended in a buffer solution containing E-64 / ml of E-64 and 0.5 μg / ml of pepstatin and used as a cell membrane fraction.

Competitive binding assays and saturation binding assays
Ohtaki et al. (J, Biol. Chem., 268, 26650-26657, 1
993). That is, the cell membrane fraction was 20
mM Tris-HCl (pH 7.5), 0.05% C
HAPS, 0.1% BSA, 5 mM EDTA, 0.5
mMSF, 20 μg / ml leupeptin, 4 μ
Incubation with [ ¹²⁵ I] porcine galanin in a buffer containing g / ml E-64 and 0.5 μg / ml pepstatin at 25 ° C. for 75 minutes. Bound and free ligand were separated by filtration through glass fiber filters (GF / F, Whatman, UK) treated with 0.3% polyethyleneimine. The amount of non-specific binding was determined in the presence of 1 μM unlabeled porcine galanin. In the competitive binding assay, galanin and the galanin analog were added to the buffer simultaneously with [ ¹²⁵ I] porcine galanin. CHO cells transformed with an expression plasmid containing mouse galanin receptor cDNA bound significantly to [ ¹²⁵ I] galanin as compared to control cells (FIG. 15).

In Scatchard analysis, the cell membrane fraction (1 μg of protein) was treated with [ ¹²⁵ I] porcine galanin and 75
Incubation was performed at 25 ° C for minutes. Only one representative example of a triplicate assay is shown as the result. Each symbol is the average value ± S. E. FIG. M. Is shown. Kd and Bmax values are 45 pM and 5 p, respectively
It was mol / mg protein. B shows [ ¹²⁵ I] galanin-bound (pmol / mg protein), and B / F shows the ratio of free to bound (pmol / m protein · nM). Scatchard plot analysis has a dissociation constant of 45 pM and an additional 5 pmol / m
The presence of a single group of binding sites with high affinity with the maximum number of binding sites (Bmax) for the g protein was observed (Figure 17).

[ ¹²⁵ ] for the mouse galanin receptor [ ^125]
I] A competitive binding assay experiment of porcine galanin was performed.
[ ¹²⁵ I] Porcine galanin (△), rat galanin (●), human galanin (■), which does not label the competitive reaction to the binding of [ ¹²⁵ I] porcine galanin (final concentration 100 pM),
Galanin- (1-16) (◯) and M15 (▲) were examined. The cell membrane fraction (1 μg protein) was incubated with the ligand for 75 minutes at 25 ° C. The amount of [ ¹²⁵ I] galanin bound was expressed as a percentage of control. Each symbol is the mean value ± S. E. FIG. M. Represents IC ₅₀ of porcine galanin is 0.25 ± 0.03 M, IC ₅₀ of rat galanin are 0.25 ± 0.01 nM, IC ₅₀ of human galanin is 0.43 ± 0.03 nM, the IC ₅₀ of the M15 0. At 83 ± 0.01 nM, the IC ₅₀ of galanin- (1-16) was 3.6 ± 0.04 nM. [ ¹²⁵ I] Galanin binding was competitively inhibited by Galanin and Galanin-derived peptides. Porcine galanin and rat galanin showed almost the same high effect in binding inhibition of [ ¹²⁵ I] galanin, while human galanin was somewhat lower. Ki value of porcine galanin is 0.072
± 0.008 nM, Ki value of rat galanin is 0.0
69 ± 0.002 nM, the Ki value of human galanin was 0.
It was 12 ± 0.008 nM. The galanin receptor antagonist M15 and galanin (1-16) are also [
^It effectively inhibited the results of ¹²⁵ I] galanin. Their Ki values were 0.23 ± 0.003 nM for M15 and 1.0 ± 0.011 nM for galanin (1-16) (FIG. 18). These obtained values were almost comparable to those obtained with the cell membrane of MIN6 cells.

(3) cAMP Assay Transformed CHO cells were treated with 24-well tissue culture.
2.0 × 10 ⁵ cells / well were seeded in the plate and cultured for 2 days. The obtained cells are treated with 0.1% BSA
And twice with HBSS containing 1 mM IBMX,
The same buffer with test reagents was then added into the wells. After incubation at 37 ° C. for 30 minutes, the medium was scraped off and intracellular cAMP was extracted with ice-cold ethanol. Part of the extract was evaporated and c
The amount of AMP was measured by the cAMP EIA system (Amersh
am) was used according to the protocol of the reagent. A galanin receptor-mediated inhibition of foskolin-stimulated cAMP production was observed. MGR20
CHO cells mock-transformed and mock-transformed CHO cells were treated with foskolin (10 μM) and porcine galanin (0.1 μM) at 37 ° C. for 30 minutes. The reaction was stopped by extracting the cells with ice-cold ethanol. The amount of intracellular cAMP was quantified by EIA. Mean value ± S.D. E. FIG. M. Is shown.

The transfer induction of signals induced by galanin was evaluated to confirm that the mouse galanin receptor expressed in CHO cells was functional. The pancreatic galanin receptor releases insulin via a pathway involving a G protein negatively coupled to adenylate cyclase (Cormont, M., et al., Diabtes, 40,117.
0-1176, 1991; Gillison, S., et al., Diabtes, 43, 2
4-32, 1994) was shown to be inhibited. The foskolin-stimulated accumulation of cAMP in CHO cells into which the galanin receptor cDNA had been introduced was effectively suppressed by the treatment with porcine galanin. CHO cell transformants with the plasmid vector without the cDNA insert also showed foskolin-stimulated accumulation of cAMP,
It was not inhibited by porcine galanin treatment. Galanin treatment alone did not alter cAMP levels in CHO cell transformants (FIG. 19).

[0227]

INDUSTRIAL APPLICABILITY The galanin receptor protein of the present invention and the DNA encoding the protein can be used to obtain antibodies and antisera, construct a recombinant receptor protein expression system,
Development of receptor binding assay system using the same expression system and screening of drug candidate compounds, implementation of drug design based on comparison with structurally similar ligands / receptors, probes for genetic diagnosis, PC
It can be used for preparation of R primer, preparation of transgenic animal, preparation of pathological model animal by deletion of receptor protein DNA, and the like. In particular, elucidation of the structure and properties of mouse galanin receptors will lead to the development of unique drugs that act on these systems. further,
The human galanin receptor protein of the present invention is a novel protein having an amino acid sequence different from the amino acid sequence of the known human galanin receptor protein. The cells (in particular, CHO cells) carrying the expression vector containing the human galanin receptor protein of the present invention have a much larger amount of human galanin receptor protein than the known COS cells containing the human galanin receptor protein. Can be expressed.

The human galanin receptor protein of the present invention, a partial peptide thereof, or a cell containing the human galanin receptor protein or a cell membrane fraction thereof can be efficiently screened for a human galanin receptor agonist or antagonist. By using the screening method of the present invention, an agonist or an antagonist can be advantageously selected, so that a drug can be developed at an early stage. Agonists include, for example, acetylcholine release inhibitors, insulin secretion inhibitors, growth hormone secretion stimulants, learning behavior inhibitors or satiety inhibitors, and further as prophylactic / therapeutic agents or analgesics for schizophrenia or gastric ulcer. It is useful. On the other hand, the antagonist is, for example, an acetylcholine release promoter, an insulin secretion promoter, a growth hormone secretion inhibitor, a learning behavior promoter or a satiety promoter, and further a preventive / therapeutic agent for diabetes, Alzheimer's disease or dementia. It is useful as

[0229]

[Sequence list]

[SEQ ID NO: 1] Sequence length: 128 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Ala Ala Met Ser Val Asp Arg Tyr Val Ala Ile Val His Ser Arg Arg 1 5 10 15 Ser Ser Ser Leu Arg Val Ser Arg Asn Ala Leu Leu Gly Val Gly Phe 20 25 30 Ile Trp Ala Leu Ser Ile Ala Met Ala Ser Pro Val Ala Tyr His Gln 35 40 45 Arg Leu Phe His Arg Asp Ser Asn Gln Thr Phe Cys Trp Glu Gln Trp 50 55 60 Pro Asn Lys Leu His Lys Lys Ala Tyr Val Val Cys Thr Phe Val Phe 65 70 75 80 Gly Tyr Leu Leu Pro Leu Leu Leu Ile Cys Phe Cys Tyr Ala Lys Val 85 90 95 Leu Asn His Leu His Lys Lys Leu Lys Asn Met Ser Lys Lys Ser Glu 100 105 110 Ala Ser Lys Lys Lys Thr Ala Gln Thr Val Leu Val Val Val Val Val 115 120 125

[0230]

[SEQ ID NO: 2] Sequence length: 348 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Met Glu Leu Ala Met Val Asn Leu Ser Glu Gly Asn Gly Ser Asp Pro 1 5 10 15 Glu Pro Pro Ala Pro Glu Ser Arg Pro Leu Phe Gly Ile Gly Val Glu 20 25 30 Asn Phe Ile Thr Leu Val Val Phe Gly Leu Ile Phe Ala Met Gly Val 35 40 45 Leu Gly Asn Ser Leu Val Ile Thr Val Leu Ala Arg Ser Lys Pro Gly 50 55 60 Lys Pro Arg Ser Thr Thr Asn Leu Phe Ile Leu Asn Leu Ser Ile Ala 65 70 75 80 Asp Leu Ala Tyr Leu leu Phe Cys Ile Pro Phe Gln Ala Thr Val Tyr 85 90 95 Ala Leu Pro Thr Trp Val Leu Gly Ala Phe Ile Cys Lys Phe Ile His 100 105 110 Tyr Phe Phe Thr Val Ser Met Leu Val Ser Ile Phe Thr Leu Ala Ala 115 120 125 Met Ser Val Asp Arg Tyr Val Ala Ile Val His Ser Arg Arg Ser Ser 130 135 140 Ser Leu Arg Val Ser Arg Asn Ala Leu Leu Gly Val Gly Phe Ile Trp 145 150 155 160 Ala Leu Ser Ile Ala Met Ala Ser Pro Val Ala Tyr His Gln Arg Leu 165 170 175 Phe His Arg Asp Ser Asn Gl n Thr Phe Cys Trp Glu Gln Trp Pro Asn 180 185 190 Lys Leu His Lys Lys Ala Tyr Val Val Cys Thr Phe Val Phe Gly Tyr 195 200 205 Leu Leu Pro Leu Leu Leu Ile Cys Phe Cys Tyr Ala Lys Val Leu Asn 210 215 220 His Leu His Lys Lys Leu Lys Asn Met Ser Lys Lys Ser Glu Ala Ser 225 230 235 240 Lys Lys Lys Thr Ala Gln Thr Val Leu Val Val Val Val Val Phe Gly 245 250 255 Ile Ser Trp Leu Pro His His Val Val His Leu Trp Ala Glu Phe Gly 260 265 270 Ala Phe Pro Leu Thr Pro Ala Ser Phe Phe Phe Arg Ile Thr Ala His 275 280 285 Cys Leu Ala Tyr Ser Asn Ser Ser Val Asn Pro Ile Ile Tyr Ala Phe 290 295 300 Leu Ser Glu Asn Phe Arg Lys Ala Tyr Lys Gln Val Phe Lys Cys His 305 310 315 320 Val Cys Asp Glu Ser Pro Arg Ser Glu Thr Lys Glu Asn Lys Ser Arg 325 330 335 Met Asp Thr Pro Pro Ser Thr Asn Cys Thr His Val 340 345

[0231]

[SEQ ID NO: 3] Sequence length: 384 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA sequence GCCGCGATGT CTGTGGATCG CTACGTGGCC ATTGTGCACT CGCGGCGCTC CTCCTCCCTC 60 AGGGTGTCCC GCAACGCACT GCTGGGCGTG GGCTTTCCACTGCGCGCGCTCTCCTCGGGGCGC120C TGGCCTACCA CCAGCGTCTT TTCCATCGGG ACAGCAACCA GACCTTCTGC 180 TGGGAGCAGT GGCCCAACAA GCTCCACAAG AAGGCTTACG TGGTGTGCAC TTTCGTTCGCTCGACTGACTGCATCTAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAG

[0232]

[SEQ ID NO: 4] Sequence length: 1044 Sequence type: Nucleic acid Number of strands: Double-strand Topology: Linear Sequence type: cDNA Characterization method: S sequence ATGGAACTGG CTATGGTGAA CCTCAGTGAA GGGAATGGGA GCGACCCAGA GCCGCCAGCC 60 CCGGAGTCCA GGCCGCTCTT CGGCATTGGC GTGGAGAACT TCATTACGCT GGTAGTGTTT 120 GGCCTGATTT TCGCGATGGG CGTGCTGGGC AACAGCCTGG TGATCACCGT GCTGGCGCGC 180 AGCAAACCAG GCAACCCCCG CAGCACCACC AACCTGTTTA TCCTCAATCT GAGCATCGCA 240 GACCTGGCCT ACCTGCTCTT CTGCATCCCT TTTCAGGCCA CCGTGTATGC ACTGCCCACC 300 TGGGTGCTGG GCGCCTTCAT CTGCAAGTTT ATACACTACT TCTTCACCGT GTCCATGCTG 360 GTGAGCATCT TCACCCTGGC CGCGATGTCT GTGGATCGCT ACGTGGCCAT TGTGCACTCG 420 CGGCGCTCCT CCTCCCTCAG GGTGTCCCGC AACGCACTGC TGGGCGTGGG CTTCATCTGG 480 GCGCTGTCCA TCGCCATGGC CTCGCCGGTG GCCTACCACC AGCGTCTTTT CCATCGGGAC 540 AGCAACCAGA CCTTCTGCTG GGAGCAGTGG CCCAACAAGC TCCACAAGAA GGCTTACGTG 600 GTGTGCACTT TCGTCTTTGG GTACCTTCTG CCCTTACTGC TCATCTGCTT TTGCTATGCC 660 AAGGTCTATACACAG G AAAAACATGT CAAAAAAGTC TGAAGCATCC 720 AAGAAAAAGA CTGCACAGAC CGTCCTGGTG GTCGTTGTAG TATTTGGCAT ATCCTGGCTG 780 CCCCATCATG TCGTCCACCT CTGGGCTGAG TTTGGAGCCT TCCCACTGAC GCCAGCTTCC 840 TTCTTCTTCA GAATCACCGC CCATTGCCTG GCATACAGCA ACTCCTCAGT GAACCCCATC 900 ATATATGCCT TTCTCTCAGA AAACTTCCGG AAGGCGTACA AGCAAGTGTT CAAGTGTCAT 960 GTTTGCGATG AATCTCCACG CAGTGAAACT AAGGAAAACA AGAGCCGGAT GGACACCCCG 1020 CCATCCACCA ACTGCACCCA CGTG 1044

[0233]

[SEQ ID NO: 5] Sequence length: 349 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Met Glu Leu Ala Val Gly Asn Leu Ser Glu Gly Asn Ala Ser Trp Pro 1 5 10 15 Glu Pro Pro Ala Pro Glu Pro Gly Pro Leu Phe Gly Ile Gly Val Glu 20 25 30 Asn Phe Val Thr Leu Val Val Phe Gly Leu Ile Phe Ala Leu Gly Val 35 40 45 Leu Gly Asn Ser Leu Val Ile Thr Val Leu Ala Arg Ser Lys Pro Gly 50 55 60 Lys Pro Arg Ser Thr Thr Asn Leu Phe Ile Leu Asn Leu Ser Ile Ala 65 70 75 80 Asp Leu Ala Tyr Leu Leu Phe Cys Ile Pro Phe Gln Ala Thr Val Tyr 85 90 95 Ala Leu Pro Thr Trp Val Leu Gly Ala Phe Ile Cys Lys Phe Ile His 100 105 110 Tyr Phe Phe Thr Val Ser Met Leu Val Ser Ile Phe Thr Leu Ala Ala 115 120 125 Met Ser Val Asp Arg Tyr Val Ala Ile Val His Ser Arg Arg Ser Ser 130 135 140 Ser Leu Arg Val Ser Arg Asn Ala Leu Leu Gly Val Gly Cys Ile Trp 145 150 155 160 Ala Leu Ser Ile Ala Met Ala Ser Pro Val Ala Tyr His Gln Gly Leu 165 170 175 Phe His Pro Arg Ala Ser As n Gln Thr Phe Cys Trp Glu Gln Trp Pro 180 185 190 Asp Pro Arg His Lys Lys Ala Tyr Val Val Cys Thr Phe Val Phe Gly 195 200 205 Tyr Leu Leu Pro Leu Leu Leu Ile Cys Phe Cys Tyr Ala Lys Val Leu 210 215 220 Asn His Leu His Lys Lys Leu Lys Asn Met Ser Lys Lys Ser Glu Ala 225 230 235 240 Ser Lys Lys Lys Thr Ala Gln Thr Val Leu Val Val Val Val Val Phe 245 250 255 Gly Ile Ser Trp Leu Pro His His Ile Ile His Leu Trp Ala Glu Phe 260 265 270 Gly Val Phe Pro Leu Thr Pro Ala Ser Phe Leu Phe Arg Ile Thr Ala 275 280 285 His Cys Leu Ala Tyr Ser Asn Ser Ser Val Asn Pro Ile Ile Tyr Ala 290 295 300 Phe Leu Ser Glu Asn Phe Arg Lys Ala Tyr Lys Gln Val Phe Lys Cys 305 310 315 320 His Ile Arg Lys Asp Ser His Leu Ser Asp Thr Lys Glu Asn Lys Ser 325 330 335 Arg Ile Asp Thr Pro Pro Ser Thr Asn Cys Thr His Val 340 345

[0234]

[SEQ ID NO: 6] Sequence length: 1047 Sequence type: Nucleic acid Number of strands: Double stranded Topology: Linear Sequence type: cDNA Characterization method: S sequence ATGGAGCTGG CGGTCGGGAA CCTCAGCGAG GGCAACGCGA GCTGGCCGGA GCCCCCCGCC 60 CCGGAGCCCG GGCCGCTGTT CGGCATCGGC GTGGAGAACT TCGTCACGCT GGTGGTGTTC 120 GGCCTGATCT TCGCGCTGGG CGTGCTGGGC AACAGCCTAG TGATCACCGT GCTGGCGCGC 180 AGCAAGCCGG GCAAGCCGCG GAGCACCACC AACCTGTTCA TCCTCAACCT GAGCATCGCC 240 GACCTGGCCT ACCTGCTCTT CTGCATCCCC TTCCAGGCCA CCGTGTACGC GCTGCCCACC 300 TGGGTGCTGG GCGCCTTCAT CTGCAAGTTC ATCCACTACT TCTTCACCGT GTCCATGCTG 360 GTGAGCATCT TCACCCTGGC CGCGATGTCC GTGGACCGCT ACGTGGCCAT CGTGCACTCG 420 CGGCGCTCCT CCTCCCTCAG GGTGTCCCGC AACGCGCTGC TGGGCGTGGG CTGCATCTGG 480 GCGCTGTCCA TTGCCATGGC CTCGCCCGTG GCCTACCACC AGGGCCTCTT CCACCCGCGC 540 GCCAGCAACC AGACCTTCTG CTGGGAGCAG TGGCCCGACC CTCGCCACAA GAAGGCCTAC 600 GTGGTGTGTGCA CCTTCGTCTT CGGCTACCTG CTGCCGCTCC TGCTCATCTG CTTCTGCTAT 660 GCCAAGGTCC TAAATCACTTT G TTGAAGAACA TGTCAAAGAA GTCTGAAGCA 720 TCCAAGAAAA AGACTGCACA GACAGTTCTG GTGGTGGTTG TGGTGTTTGG AATCTCCTGG 780 CTGCCGCACC ACATCATCCA TCTCTGGGCT GAGTTTGGAG TTTTCCCGCT GACGCCGGCT 840 TCCTTCCTCT TCAGAATCAC CGCCCACTGC CTGGCGTACA GCAATTCCTC CGTGAATCCT 900 ATCATTTATG CATTTCTCTC TGAAAATTTC AGGAAGGCCT ATAAACAAGT GTTCAAGTGT 960 CACATTCGCA AAGATTCACA CCTGAGTGAT ACTAAAGAAA ATAAAAGTCG AATAGACACC 1020 CCACCATCAA CCAATTGTAC TCATGTG 1047

[0235]

[SEQ ID NO: 7] Sequence length: 25 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence characteristics: N is A, C, G or Indicates T. Sequence CGTGGSCMTS STGGGCAACN YCCTG 25

[0236]

[SEQ ID NO: 8] Sequence length: 27 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence characteristics: N is A, C, G or Indicates T. Array GTNGWRRGGC ANCCAGCAGA KGGCAAA 27

[0237]

[SEQ ID NO: 9] Sequence length: 27 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA Sequence TCCGTGGACC GCTACGTGGC CATCGTG 27

[0238]

[SEQ ID NO: 10] Sequence length: 33 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA Sequence GACTTATCAC ACATGAGTAC AATTGGTTGA TGG 33

[Brief description of drawings]

FIG. 1 is a novel receptor protein cDNA clone p3 obtained by PCR amplification from mouse pancreatic β cell line MIN6.
The partial base sequence of H2-34 and the amino acid sequence encoded thereby are shown. The underlined portion corresponds to the synthetic primer used for PCR amplification.

FIG. 2 shows a hydrophobicity plot prepared based on the amino acid sequence shown in FIG. The vertical axis represents the hydrophobicity index, and the horizontal axis represents the number of amino acids. Numbers 3-6 in the figure indicate the presence of hydrophobic domains.

FIG. 3 is a partial amino acid sequence of a novel receptor protein encoded by p3H2-34, human somatostatin receptor subtype 4 protein (JN0605), human somatostatin receptor subtype 2 protein (B4179).
5) is a diagram comparing the partial amino acid sequence of 5) and a rat-derived ligand unknown receptor protein (A39297). The black parts represent the corresponding amino acid residues.

FIG. 4 shows the nucleotide sequence of a mouse-derived galanin receptor protein cDNA clone pMGR20 cloned using the cDNA inserted in p3H2-34 as a probe, and the amino acid sequence encoded thereby.

FIG. 5 shows a hydrophobicity plot made based on the amino acid sequence shown in FIG. The vertical axis represents the hydrophobicity index, and the horizontal axis represents the number of amino acids. Numbers 1 to 7 in the figure indicate the presence of hydrophobic domains.

FIG. 6 shows the amino acid sequence of the mouse galanin receptor protein encoded by pMGR20 (MOUSEGAL).
It is the figure which compared the amino acid sequence (HUMAGALAMI) of the human origin galanin receptor protein. The black parts represent the corresponding amino acid residues.

FIG. 7 shows the amount of labeled galanin bound to MIN6 cells (PMB) as standard pig galanin, rat galanin,
The result plotted on the density | concentration of a galanin (1-16) partial peptide or a galanin receptor antagonist (galantide) is shown.

FIG. 8 shows the results of plotting the amount of insulin secreted from MIN6 cells against the amount of galanin.

FIG. 9 shows the results of plotting the amount of insulin secreted from MIN6 cells against the amount of galanin.

FIG. 10: MIN6 intracellular cAMP with respect to the amount of galanin
The results of plotting the amounts are shown.

FIG. 11 shows the nucleotide sequence of the DNA encoding the human galanin receptor protein of the present invention obtained in Example 11 and the amino acid sequence deduced therefrom (first to thirteenth).
5th).

FIG. 12 shows the nucleotide sequence of the DNA encoding the human galanin receptor protein of the present invention obtained in Example 11 and the amino acid sequence deduced therefrom (the 136th position to the 349th position).

FIG. 13: Expression plasmid pTS8 carrying the human galanin receptor protein cDNA obtained in Example 12
A construction drawing of 63 is shown. The hatched portion of the expression plasmid pTS863 represents the cDNA encoding the human galanin receptor protein, DHFR represents the dhfr gene,
Amp ^r indicates the ampicillin resistance gene, SRαprom
oter indicates the SRα promoter.

FIG. 14: Mouse tissue, Neuro-2a and MIN6
Each poly (A) ⁺ RNA and p3H2 obtained from cells
The result of Northern blotting analysis between -34 and -34 is a photograph of electrophoresis. poly (A) ⁺ R
NA (5 μg / lane) was treated with glyoxal, denatured, and electrophoresed on a 1.2% agarose gel. R
NA was transferred onto a nitrocellulose filter and labeled with ³² P, the cDNA insert, p3H2.
Hybridization was performed using -34 as a probe. Lane 1: Neuro-2a cells; Lane 2: MI
Lane 6: small intestinal smooth muscle; Lane 4: testis; Lane 5: pancreas; Lane 6: kidney; Lane 7: liver; Lane 8: heart; Lane 9: lung; Lane 10: spleen; Lane 11: thymus; Lane 12: Brain arrow indicates the position of the molecular weight marker.

FIG. 15: CHO cells transformed with mouse galanin receptor cDNA and mouse galanin receptor cDNA
2 shows the results of comparison of the binding activity of [ ¹²⁵ I] porcine galanin to CHO cells transformed with A-free one. CHO transformed with a full-length translation frame
-MGR20 cells and mock-transformed CHO cells (MOCK) were [ ¹²⁵ I] galanin (final concentration 100
pM) at 37 ° C. for 1 hour in the presence (black columns) or absence thereof (white columns) of unlabeled porcine galanin (1 μM final concentration). The amount of [ ¹²⁵ I] galanin bound was expressed as the percentage of radioactivity remaining on the cells after washing. 3
The mean value of the assay ± S. E. FIG. M. The values are shown as.

FIG. 16 shows a comparison of the primary structures of mouse galanin receptor and human galanin receptor. Matched residues are indicated by vertical dotted lines. The predicted transmembrane region I-VII is shown boxed.

FIG. 17 shows the results of Scatchard analysis of [ ¹²⁵ I] galanin bound to the cell membrane fraction obtained from CHO cells transformed with mouse galanin receptor cDNA. The cell membrane fraction (1 μg protein) was incubated with [ ¹²⁵ I] porcine galanin for 75 minutes at 25 ° C. A typical example of a set of 3 assays 1
Only one is shown as a result. Each symbol is the average value ± S. E. FIG. M. Is shown. Kd and Bmax values were 45 pM and 5 pmol / mg protein, respectively. B is
[ ¹²⁵ I] Galanin is bound (pmol / mg protein), and B / F is the ratio of bound to free (pmol / m protein · nM).

FIG. 18: Mouse mouse galanin receptor [
Fig. 3 shows the result of a competitive binding assay of ¹²⁵ I] porcine galanin. [ ¹²⁵ I] Porcine galanin (final concentration 1
Porcine galanin (△), rat galanin (●), human galanin (■), galanin- (1-16) (○) and M15 which do not label the competitive reaction to the binding of 00pM)
I checked (▲). Cell membrane fraction (1 μg protein)
Was incubated with the ligand for 75 minutes at 25 ° C. The amount of [ ²⁵ I] galanin bound was expressed as a percentage of control. Each symbol is the mean value ± S. E. FIG. M. Represents IC ₅₀ for porcine galanin is 0.25 ± 0.03
The IC ₅₀ of M and rat galanin is 0.25 ± 0.01n
M, human galanin has an IC ₅₀ of 0.43 ± 0.03 nM,
IC ₅₀ of the M15 is a 0.83 ± 0.01nM, galanin - IC ₅₀ of (1-16) was 3.6 ± 0.04nM.

FIG. 19 shows the results of galanin receptor-mediated inhibition of foskolin-stimulated cAMP production. CHO cells transformed with MGR20 (CH
O-MGR20) and mock-transformed CHO cells (MOCK) were treated with forskolin (10 μM) and porcine galanin (0.1 μM) at 37 ° C. for 30 minutes. The reaction was stopped by extracting the cells with ice-cold ethanol. The amount of intracellular cAMP was quantified by EIA. Mean value ± S.D. E. FIG. M. Is shown.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical display location G01N 33/566 9162-4B C12N 15/00 ZNAA // A61K 38/00 AAM A61K 37/02 AAM ACL ACL ADP ADP (C12P 21/02 C12R 1:91) (72) Inventor Tetsuya Otaki 9 7-1 Kasuga City, Tsukuba, Ibaraki Prefecture No. 802 Takeda Kasuga Heights (72) Inventor Masaki Hosoya 1 Itaya, Tsuchiura City, Ibaraki Prefecture 83, chome 711 (72) Inventor Kazuhiro Ogi 2-16, Umezono, Tsukuba-shi, Ibaraki No. 206, Lumbini Umezono (72) Inventor Haruo Onda 4-5-26, Shimotakatsu, Tsuchiura, Ibaraki Prefecture

Claims (10)

[Claims] 1. A galanin receptor protein or a salt thereof, which contains an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 5. 2. The galanin receptor protein according to claim 1, which is produced by a transformant CHO cell. 3. A DN containing a DNA having a nucleotide sequence encoding the galanin receptor protein according to claim 1.
A. 4. A vector containing the DNA according to claim 3. 5. A transformant carrying the vector according to claim 4. 6. The transformant according to claim 5, wherein the host cell is a CHO cell. 7. The method for producing a galanin receptor protein or a salt thereof according to claim 1, which comprises culturing the transformant according to claim 5 to produce a galanin receptor protein or a salt thereof. 8. (i) a case where galanin is contacted with the galanin receptor protein or its salt or its partial peptide or its salt according to claim 1, and (ii) the galanin receptor protein or its salt according to claim 1 or A method for screening a galanin receptor agonist or antagonist, which comprises performing a comparison with a case where galanin and a test sample are contacted with the partial peptide or the salt thereof. 9. A screening kit for a galanin receptor agonist or antagonist, which comprises the galanin receptor protein according to claim 1 or a salt thereof or a partial peptide thereof or a salt thereof. 10. A galanin receptor agonist or antagonist obtained by using the screening method according to claim 8 or the screening kit according to claim 9.