JPH09327292A - Modified protein of protein kinase n - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new peptide (derivative), having a modified amino acid sequence of a protein kinase N having the ability to bond to an active type Rho protein without any protein kinase activities and capable of suppressing tumorigenesis or metastasis. SOLUTION: This modified protein of a protein kinase N is a new peptide having a modified amino acid sequence of the protein kinase N having the ability to bond to an active type Rho protein without any protein kinase activities or its derivative and is useful as a suppressant, etc., for tumorigenesis or metastasis. The peptide or its derivative is obtained by adding a buffer for homogenization containing 4M NaCl in an amount equal to that of a bovine cerebral cinerea thereto, extracting the cinerea, then dialyzing the extracted solution, adding ammonium sulfate to the resultant dialyzate so as to provide a concentration of 40% saturation, separating the formed precipitate, dissolving the separated precipitate in a buffer solution, passing the resultant solution through an immobilized glutathione column, treating a fraction passing therethrough without adsorbing with an immobilized glutathione column containing a glutathione S-transferase-low molecular weight G protein treated with a guanine nucleotide and purifying the resultant eluate.

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a modified amino acid sequence of protein kinase N, and more particularly to a modified amino acid sequence of PKN capable of binding to activated Rho protein.

2. Description of the Related Art In vivo, a molecular weight of 2 to 3 having no subunit structure
There are an enormous group of low molecular weight GTP binding proteins (G proteins). At present, more than 50 members have been found in the superfamily of low molecular weight G proteins, from yeast to mammals. The low-molecular-weight G protein has Ras, R
ho, Rab, and other four families. It has been revealed that this low-molecular-weight G protein controls various cell functions. For example, Ras protein regulates cell growth and differentiation by Rho.
Proteins are thought to control morphological changes of cells, cell adhesion, cell motility, and the like, respectively.

[0003] Among them, Rho protein is GDP / G
It exhibits TP binding capacity and endogenous GTPase activity and has been implicated in the cytoskeletal response to extracellular signals such as lysophosphatidic acid (LPA) and certain growth factors. GDP-bound Rho that is inactive
When a certain stimulus is given to a protein, Smg GD
By the action of a GDP / GTP converting protein such as S, Dbl or Ost, it is converted into an active GTP-binding Rho protein (hereinafter referred to as “active Rho protein”). It is considered that the activated Rho protein acts on the target protein to form stress fibers and adhesion spots, thereby inducing cell adhesion and cell movement (Experimental Medicine vol.12, No.8, 97-10
2 (1994), Takai, Y. et al. Trends Biochem. Sci., 2
0, 227-231 (1995)). On the other hand, the active Rho protein is converted into a GDP-bound Rho protein by the Rho protein endogenous GTPase. This endogenous GTPa
GTPase activating protein (GAP) (Lamarche, N. & Hall, A. eta)
l., TIG, 10, 436-440 (1994)).

[0004] RhoA protein, RhoB protein, RhoC protein, Rac1 protein, Rac
The amino acid sequences of Rho family proteins, such as the two proteins, Cdc42 protein, are 50
% Or more similarity. This Rho family of proteins responds to extracellular signals such as lysophosphatidylic acid (LPA) and growth factors to respond to stress fibers (st
ress fiber) and focal contact
It is thought to be involved in the reaction that causes the formation of A. (AJ Ridley & A. Hall, Cell, 70,389-399 (1992)
, AJ Ridley & A. Hall, EMBO J., 1353,2600-2610 (19
94)). In addition, a subfamily of Rho proteins is associated with changes in cell morphology (HFParterson et al., J. Cell B).
iol., 111,1001-1007 (1990)), cell adhesion (Morii, N. e.
t al., J. Biol. Chem. 267, 20921-20926 (1992), T. T.
ominaga et al., J. Cell Biol., 120, 1529-1537 (1993)
, Nusrat, A. et al., Proc, Natl. Acad. Sci. USA, 9
2, 10629-10633 (1995) ^* , Landanna, C. et al., Scie
nce 271, 981-983 (1996) ^* ), cell motility (K. Takaishi
et al., Oncogene, 9,273-279 (1994)), cytokinesis (c
ytokinesis) (K. Kishi et al., J. Cell Biol., 120,1
187-1195 (1993), I. Mabuchi et al., Zygote, 1,325-33.
1 (1993)), which is also considered to be related to physiological functions involving reorganization of the cytoskeleton (see publications issued after the first application on which the priority of the present application is based) ^.
Marked. same as below. ). In addition, Rho protein is associated with smooth muscle contraction (K. Hirata et al., J. Biol. Chem., 26.
7,8719-8722 (1992), M. Noda et al., FEBS Lett., 36.
7, 246-250 (1995), M. Gong et al., Proc. Natl. Acad.
Sci. USA, 93, 1340 to 1345 (1996) ^* . K. Kimura et a
l., Science 273, 245-248 (1996) ^* ) Phosphatidylinositol 3-kinase (PI 3-kinase) (J.
Zhang et al., J. Biol. Chem., 268, 22251-22254 (1993).
), Phosphatidylinositol 4-phosphate 5
-Kinase (PI 4,5-kinase) (LD Chong et
al., Cell, 79, 507-513 (1994)) and expression of c-fos (C.
It is suggested that it is also involved in the regulation of S. Hill et al., Cell, 81, 1159-1170 (1995)).

[0005] Recently, it has been discovered that when a Rho protein partially substituted with an amino acid sequence is introduced into cells, Ras-dependent tumor formation is suppressed.
Proteins have been shown to play an important role in Ras cell transformation, ie, tumorigenesis (GC Prendergast et al., Oncogene, 1).
0,2289-2296 (1995), Khosravi-Far, R., et al., Mol. Cel
l.Biol., 15,6443-6453 (1995) ^* and R.Qiu et al., Pr.
oc.Natl.Acad.Sci.USA, 92,11781-11785 (1995) ^* , Lebo
witz, P. et al., Mol. Cell. Biol., 15, 6613-6622 (1995).
^* ).

[0006] Also, GDP / GTP of Rho protein
Mutations in the conversion protein have been shown to transform cells (Collard, J., Int. J. Oncol., 8, 13).
1-138 (1996) ^* , Hart, M. et al., J. Biol Chem., 269,
62-65 (1994), Horii, Y. et al., EMBO J., 13,4776-478.
6 (1994)).

[0007] Furthermore, it has been clarified that the Rho protein is involved in cancer cell invasion, that is, cancer metastasis (Yoshioka, K. et al., FEBS Lett., 372, 25-28).
(1995)). Invasion of cancer cells is closely related to changes in cell adhesion of cancer cells, but it has been revealed that Rho protein is involved in cell adhesion (Mo above).
rii, N. et al. (1992), Tominaga, T. et al. (1993), Nusr
at, A. et al. (1995), Landanna, C. et al. (1996) ^* ).

On the other hand, recently, a new protein kinase having a molecular weight of about 120 kDa (hereinafter referred to as "PKN" or "protein kinase N") was isolated and its entire amino acid sequence was determined. Moreover, it was revealed that PKN has a catalytic region having high homology with the protein kinase catalytic region of protein kinase C, and actually has serine / threonine kinase activity (Mukai, H.
& Ono, Y, Biochem.Biophys.Res.Commun.199,897-904 (19
94), Mukai, H. et al., Biochem. Biophys. Res. Commun. 20.
4,348-356 (1994) and Mukai, H. et al., Biochem. Bioph.
ys.Acta 1261,296-300 (1995)). Also, PKN 644
Replacement of the second Lys with Arg results in loss of protein kinase activity (Mukai, H. et al., Supra).

This protein kinase activity is enhanced by unsaturated fatty acids such as arachidonic acid (Mukai, H. et a
l., Biochem. Biophys. Res. Commun., 204, 348-356
(1994); Kitagawa, M. et al., Biochem. J., 310, 65.
7-664 (1994)). Human, rat and Xenopus PKN cDNAs have been cloned and their amino acid sequences determined (Mukai, H. & Ono, Y.,
Biochem. Biophys. Res. Commun., 199, 897-904 (199
4); Mukai, H. et al., Biochim. Biophys. Acta., 12
61, 296-300 (1995)). Human PKN is a protein consisting of 942 amino acid residues, and the amino acid sequence of its carboxyl-terminal catalytic region shows high homology with the amino acid sequence of the catalytic region of protein kinase C. Therefore, PKN is sometimes called protein kinase C-related kinase 1 (Palmer, RH & Parker, PJ, FEBS Le.
tt., 356, 5-8 (1994)).

A plurality of leucine-zipper sequences are present in the amino-terminal regulatory region of PKN, and a polybasic region is present on the amino-terminal side of the leucine-zipper sequence which is most amino-terminal. It has been reported that PKN has at least two types of isozymes (protein kinase C-related kinases 2 and 3) (Palmer, RH & Parker, PJ, FEBS Lett. 356,
5-8 (1994)).

Only recently (after the first application on which the present application is claimed), Citron (Madaule, P., et al.) Has been identified as a mammalian Rho target protein different from PKN.
et al., FEBS Lett. 377, 243-248 (1995) ^* ), loafylline (Watanabe, G. et al., Nature 271, 645-648).
(1996) ^* ), p160ROCK (Ishizaki, T. et a
l., EMBO J. 15, 1885-1893 (1996) ^* ), Rho-binding kinase (Matsui, T. et al., EMBO J. 15, 2208-2216).
(1996) ^* ), ROKα (Leung, T. et al., J. Biol.
Chem. 270, 29051-29054 (1995) ^* ), Rotekin (Rei
d, T. et al., J. Biol. Chem. 271, 13556-13560 (199
6) ^* ), myosin-binding subunit (K. Kimura et a
l., Science 273, 245-248 (1996) ^* ) was identified. Also, as a Rho target protein of yeast (Saccharomyces serevisiae), protein kinase C1 (PKC
1) (Nonaka, H. et al., EMBO J. 14, 5931-5938 (19
95) ^* ), 1,3-β-glucan synthase (Drgonova,
J. et al., Scinece 272, 277-279 (1996) ^* ; Qadota,
H. et al., Scinece 272, 279-281 (1996) ^* ) was identified.

[0012] The main fiber components constituting the cytoskeleton include microtubules, actin filaments, and intermediate filaments, and the cytoskeleton is controlled by phosphorylation of these. Known (N. Inagaki et al., Trend. Biochem. Sci., 19,
448-452 (1994)). The structure of the intermediate filament has been elucidated at the amino acid sequence level (Julien, J. et al., Biochim. Biophys. Acta 909, 1
0-20 (1987) (human-neurofilament-L), Myer
s, M. et al., EMBO J., 6, 1617-1626 (1987) (human-
Neurofilament-M), Lees, J., et al., EMBO
J., 7, 1947-1955 (1988) (human-neurofilament-H), Honore ', B., et al., Nucl. Acid.Res., 1
8, 6692 (1990) (human-vimentin)). However, the interaction between the intermediate filament and PKN has not been reported to the present inventors.

In addition, a number of different isoforms of the cytoskeletal protein α-actinin have been characterized which encompass skeletal muscle, smooth muscle and non-muscle α-actinin from various cells and tissues. In humans, skeletal muscle α-actinin (Beggs, A., et al., J. Biol.
Chem. 267, 9281-9288 (1992) in HuActSk.
1) and a strong sequence homology (89% homology and 80% identity) with HuActSk1 (Beggs, A., et al.,).
Hu in J. Biol. Chem. 267, 9281-9288 (1992).
Only the clone (called ActNm) has been isolated (Millake, DB, et al., Nucleic Acids Re
s. 17, 6725 (1989), and Youssoufian, H., et a.
L., Am. J. Hum. Genet. 47, 62-71 (1990)). Various α
-The functional differences reported between actinins are F-
Binding of muscle isoforms to actin is inhibited by Ca ^{2+, whereas} binding of non-muscle isoforms is Ca.
²⁺ is insensitive (Burridge, K. & Feram
iscoo, JR Nature 294, 565-567 (1981), Bennett,
JP, et al., Biochemistry 23, 5081-5086 (1984)
, Duhaiman, AS & Bamburg, JR Biochemistry
23, 1600-1608 (1984), and Landon, F., et al.,
Eur. J. Biochem. 153, 231-237 (1985)).

Α-actinin is a member of the spectrin superfamily including spectrin and dystrophin (Blanhard, A., et al., J. M.
uscle Res. Cell Motil. 10,280-289 (1989), Dubreui
l, RR Bioessays 13, 219-226 (1991), and Benn
ett, V, Physiol. Rev. 70, 1029-1065 (1990)). Members of the family are the N-terminal actin-binding domain, the central rod-shaped spectrin-like repeat, and C.
Characterized by a terminal EF-hand-like domain. α-Spectrin contains 21 rod-shaped repeats at the N-terminus instead of the EF-hand-like domain. The C-terminus of α-spectrin is clearly in agreement with α-actinin, and in particular α-spectrin repeat 20 shows a very high homology to α-actinin repeat 3 (Wassenius, VM, et al., J. Cell Bi
ol. 108, 79-93 (1989), and Hong, WJ & Doyl.
e, DJBiol. Chem. 264, 12758-12764 (1989)), and the positions of repeats among the proteins are almost the same.

Alpha-actinin is composed of three domains: an N-terminal actin-binding domain, an internal rod-shaped domain with four 122-amino acid repeats (spectrin-like repeats), and a pair of domains. C-terminal region (often called the EF-hand) containing a putative helix-loop-helix Ca ²⁺ binding motif ((Blanchard, A., et al., J. Muscle Res. Cell
Motil. 10, 280-289 (1989)). However, the interaction between α-actinin and PKN has not been reported to the best of our knowledge.

Furthermore, recently, many data have shown that the signal pathways induced by growth factors and the signal transduction pathways induced by stress overlap. Rho family low molecular weight GTPas
Other members of e, Rac and Cdc42, are involved in the activation of stress-activated MAP kinase, which is activated by stress such as pro-inflammatory cytokines and ultraviolet rays as well as growth factors ( Mi
nden, A. Cell 81, 1147-1157 (1995), Coso, O. et a
L., Cell 81, 1137-1146 (1995), and Zhang, S. et.
al., J. Biol. Chem. 270, 23934-23936 (1995)). Recently, lysophosphatidylic acid (LPA), serum, and stress (eg, arsenite and osmotic shock) have
Serum response element (SRF) by serum response factor (SRF)
RE) regulates c-fos transcription via activation of
It has been reported that this requires functional Rho (Hill, CS et al., Cell 81. 1159-1170 (199).
Five)). SRF activation is not mediated by other Rho family proteins (Rac and Cdc42) (Hill, C.
S. et al., Cell 81. 1159-1170 (1995)). The above findings suggest the existence of an unknown pathway responsible for signal transduction to the cell nucleus downstream of the Rho protein (Vojtek,
A. & Cooper, J., Cell 82, 527-529 (1995)).

Note that the publications issued after the first application which forms the basis of the priority claim of the present application are marked with *.

[0018]

SUMMARY OF THE INVENTION The present inventors have now found that activated RhoA protein binds to the amino terminal region of PKN,
It was found that the protein kinase activity of PKN is enhanced in an activated Rho protein-dependent manner. Also, PK
It has been found that a specific region at the amino terminus of N inhibits the binding between PKN and activated Rho protein.

The present inventors have also found that PKN binds to and / or phosphorylates cytoskeletal proteins (intermediate filaments and α-actinin) that control cell morphology. . Neuron-L, which is one subunit of neuron-specific intermediate filaments, binds to PKN. The N-terminal regulatory region of PKN is not only NFL but also other intermediate filaments. Binding to head-rod domains of proteins (other subunits of NF (M and H) and vimentin of NF) or spectrin-like repeats of α-actinin and EF motif hand, purified rat PKN was extracted from bovine spinal cord. Phospholipase NF, and the head-rod domain of bacterially synthesized intermediate filament protein (each subunit of NF and vimentin), phosphorylation of NFL by PKN blocks NFL polymerization in vitro, etc. I found it.

Further, the amino-terminal region of PKN binds to the carboxyl-terminal region of PKN, and the amino-terminal specific region of PKN acts as a pseudo substrate for PKN protein kinase (inhibits PKN protein kinase activity). I found out that. Further, the present inventors have found that PKN reversibly moves from the cytoplasm into the nucleus when cells are exposed to stress such as heat shock, sodium arsenite, or serum starvation.

The present invention is based on the above findings.
That is, the present invention provides a peptide having a modified amino acid sequence of protein kinase N, which has an active Rho protein-binding ability and does not have protein kinase activity, and P
It is an object of the present invention to provide a peptide that inhibits the binding between KN and Rho protein.

Further, the present invention inhibits the activity of a peptide having a cytoskeletal protein (intermediate filament and / or α-actinin) binding ability, a peptide having a PKN protein kinase catalytic domain binding ability, and a PKN protein kinase activity. The object is to provide a peptide, a peptide that inhibits PKN translocation from the cytoplasm to the nucleus, and a peptide that is phosphorylated by PKN.

Further, the present invention includes a nucleotide sequence encoding the peptide, a vector comprising the nucleotide sequence, a host cell transformed with the vector, a method for producing the peptide or protein, the protein and the like. An object of the present invention is to provide a method for screening a tumor formation or metastasis suppressor, a substance that inhibits the binding between activated Rho protein and PKN, and the like.

The present inventors have found that the protein according to the present invention is the Rho protein-binding protein (citron, lofillin, p160ROCK, Rho) described above.
Binding kinase, ROKα, rotekin, myosin binding subunit, protein kinase C1 (PKC1),
And 1,3-β-glucan synthase). It should be noted that all of these Rho protein-binding proteins were identified after the first application which forms the basis of the priority claim of the present application.

[0025]

DETAILED DESCRIPTION OF THE INVENTION Definitions In the present invention, the term "amino acid" is used to include both optical isomers, that is, L-form and D-form. Therefore, in the present invention, the term “peptide” means not only a peptide composed of only L-form amino acids but also a peptide containing some or all of D-form amino acids.

In the present invention, the term "amino acid" means not only the 20 kinds of α-amino acids constituting natural proteins, but also other α-amino acids and β-,
γ- and δ-amino acids, unnatural amino acids and the like are used. Thus, amino acids that are substituted in a peptide or inserted into a peptide as described below include the 20
It is not limited only to species α-amino acids, but may be other α-amino acids and β-, γ-, δ-amino acids and unnatural amino acids. Such β
-, Γ- or δ-amino acids, β-alanine,
γ-aminobutyric acid or ornithine; and amino acids other than those constituting natural proteins or unnatural amino acids include 3,4-dihydroxyphenylalanine, phenylglycine, cyclohexylglycine, 1,2,3,4-tetraethyl Hydroisoquinoline-3
-Carboxylic acid, dipecotic acid and the like can be mentioned.

Active Rho Protein-Binding Protein The active Rho protein-binding protein according to the present invention is a peptide having a modified amino acid sequence of protein kinase N, which has an active Rho protein-binding ability and has no protein kinase activity. Or a derivative thereof. Here, the "modified amino acid sequence" refers to an amino acid sequence modified by adding and / or inserting one or more amino acid sequences and / or substituting and / or deleting one or more amino acids. Therefore, the partial amino acid sequence of PKN (PK that has an active Rho protein binding ability and does not have protein kinase activity)
It is also one aspect of the modified amino acid sequence). In addition, in the present specification, the term “protein” is used to include a peptide. Furthermore, in the present specification, the term “peptide” may be used to include a peptide derivative.

The entire amino acid sequence of PKN is known to have a human origin, for example, and its sequence is as shown in SEQ ID NO: 1. The entire amino acid sequence of PKN of species other than human (eg, rat, bovine, Xenopus, etc.) having homology with the sequence of human PKN is also included in the entire amino acid sequence of PKN.

PKN can be obtained, for example, by expressing its cDNA sequence in bacteria and the like according to a conventional method. For the cDNA sequence, a nucleotide sequence encoding a part of the amino acid sequence is used as a probe and commercially available c
It can be obtained by screening a DNA library. Isolation of the PKN sequence of human origin
Mukai, H. & Ono, Y. Biochem. Biophys. Res. Commu
n. 199. 897-904 (1994).

There is an isozyme in PKN. Such isozymes include protein kinase C
Related kinase 2 and protein kinase C related kinase 3 are mentioned (Palmer, R. et al., Supra). When the term "protein kinase N" is used herein, PK
It is meant to include the N isozyme.

The origin of PKN is not particularly limited, and it may be derived from mammals including humans, or may be derived from other sources. PKN is, for example, H. Mukai et a
l., Biochem. Biophys. Res. Commun., 204, 348-356
(1994) or according to the method described in Example 1.

Examples of the Rho protein include RhoA protein, RhoB protein, RhoC protein and RhoG protein. In the present specification, Rho protein means Rho protein and PK.
Rh modified so that the bond with N is not substantially impaired
o protein is also included. Such modified Rh
^{Examples of the} o protein include a RhoA mutant in which the 14th amino acid is replaced with valine (RhoA ^Val14 ), and a RhoA mutant in which the C-terminal lipid modification site is deleted (CLVL).
^-), and the 14 th amino acid was replaced with valine, and the RhoA mutant lipid modification site deleted from the C-terminus (RhoA ^Val14 CLVL ^-) and the like.

In the present invention, the term "amino acid sequence capable of binding to active Rho protein" refers to an amino acid sequence evaluated to have been found to be bound to active Rho protein by a person skilled in the art, for example, Example 1, When tested under conditions similar to 4, 5, and 16-18,
It means an amino acid sequence which is evaluated to be bound to the active Rho protein.

The activated Rho protein-binding protein has no protein kinase activity. In the present invention, “having no protein kinase activity” means PK
N having no serine / threonine protein kinase catalytic activity, more specifically, the amino acid sequence of 541 or 112 of the amino acid sequence set forth in SEQ ID NO: 1 and having one or more amino acid sequences. Is added and / or inserted, and / or one or more amino acids are replaced and / or deleted to thereby add a sequence having no serine / threonine protein kinase catalytic activity to a non-human sequence. A corresponding array is meant. The active Rho protein-binding protein is also a peptide that binds to a cytoskeletal protein (intermediate filament and / or α-actinin) or a peptide that inhibits the translocation of this PKN from the cytoplasm to the nucleus under stress conditions. (See Examples below).

As used herein, "peptide derivative"
Is a part or all of the amino group at the amino terminus (N terminus) of the peptide or the side chain of each amino acid, and / or the carboxyl group at the carboxy terminus (C terminus) of the peptide or the side chain of each amino acid. Part or all of the carboxyl group and / or part or all of the functional groups other than the amino group and the carboxyl group of the side chain of each amino acid of the peptide (eg, hydrogen group, thiol group, amide group, etc.) are suitable. And those modified by other substituents. Modification with an appropriate other substituent is performed, for example, for the purpose of protecting a functional group present in the peptide, improving safety and tissue transferability, or enhancing activity.

Specific examples of the peptide derivative include:
(1) A part or all of the hydrogen atoms of the amino group at the amino terminus (N terminus) of the peptide or the amino group of the side chain of each amino acid is substituted or unsubstituted alkyl group (straight chain, branched chain or cyclic May be present) (for example, methyl group, ethyl group, propyl group, isopropyl group, isobutyl group,
Butyl group, t-butyl group, cyclopropyl group, cyclohexyl group, benzyl group), substituted or unsubstituted acyl group (eg, formyl group, acetyl group, caproyl group, cyclohexylcarbonyl group, benzoyl group, phthaloyl group, tosyl group) , Nicotinoyl group, piperidine carbonyl group), urethane type protecting group (for example, p-nitrobenzyloxycarbonyl group, p-methoxybenzyloxycarbonyl group, p-biphenylisopropyloxycarbonyl group, t-butoxycarbonyl group) or urea type substitution Substituted with a group (for example, a methylaminocarbonyl group, a phenylcarbonyl group, a cyclohexylaminocarbonyl group) and the like, and

(2) Some or all of the carboxyl group at the carboxyl terminal (C-terminal) of the peptide or the carboxyl group at the side chain of each amino acid is ester-type modified (for example, its hydrogen atom is methyl). , Ethyl, isopropyl, cyclohexyl, phenyl, benzyl, t-butyl, 4-picolyl substituted), amide-type modified (eg, unsubstituted amide, C1-C6 alkylamide (eg, methylamide) , Ethylamide, isopropylamide), and

(3) Some or all of functional groups (eg, hydrogen group, thiol group, amino group, etc.) other than amino group and carboxyl group of the side chain of each amino acid of the peptide,
Examples thereof include those modified with the same substituents as the above-mentioned amino groups or trityl groups. Specific examples of the activated Rho protein-binding protein include activated Rho protein
Those having a modified amino acid sequence of human-PKN, which has A protein binding ability and does not have serine / threonine protein kinase activity, can be mentioned. More specifically, those consisting of the 7-540th amino acid sequence of SEQ ID NO: 1, those consisting of the 7-155th amino acid sequence, 1-
Those consisting of the 538th amino acid sequence, those consisting of the 3rd to 135th amino acid sequences, and those consisting of the 33rd to 111st amino acid sequences, and these modified amino acid sequences having active Rho protein binding ability (for example,
Partial sequence).

The active Rho protein-binding protein further comprises those consisting of the amino acid sequences 74 to 93 of SEQ ID NO: 1, those consisting of the amino acid sequences 94 to 113, and the amino acid sequences of 82 to 103. And those consisting of these modified amino acid sequences (for example, partial sequences) capable of binding to activated Rho protein. The peptides consisting of the amino acid sequences 82 to 103 of SEQ ID NO: 1 are excellent in the ability to inhibit the binding between Rho protein and PKN (that is, the ability to bind to active Rho protein), as shown in the Examples below. .

Activated Rh that binds to cytoskeletal proteins (eg, intermediate filament and α-actinin)
Examples of the o protein-binding protein include amino acid sequences 1 to 474 and 136 to 189 of SEQ ID NO: 1.

As an active Rho protein-binding protein that inhibits the transfer of protein kinase N from the cytoplasm to the nucleus, for example, the amino acid sequence of SEQ ID NO: 1 in which Lys at the 644th position is replaced with Arg (PK
N-PK-).

The activated Rho protein-binding protein can bind to the activated Rho protein.
In addition, Rho protein is closely involved in the functional expression of cells such as tumor formation, metastasis, cell morphology, cell motility, cell adhesion, cytokinesis, and gene transcription activation (Takai, Y., et al., Supra). ., Above GCPrendergast.et
al., Khosravi-Far, R., et al. , R. Qiu et al.,
Lebowitz, P., et al., And Yoshioka, K. et al.
). Therefore, the active Rho protein-binding protein is considered to be useful for elucidating the mechanism of tumor formation and metastasis. In addition, the active Rho protein-binding protein is considered to be useful for elucidating the function of cells.

Inhibition of active Rho protein-PKN binding
Protein The active Rho protein-PKN binding inhibitory protein according to the present invention comprises a peptide having a modified amino acid sequence of protein kinase N that inhibits the binding between active Rho protein and protein kinase N, or a derivative thereof. Here, the "modified amino acid sequence" has the same meaning as described above. Therefore, the partial amino acid sequence of PKN (composed of a part of the entire amino acid sequence of PKN) that inhibits the binding between the activated Rho protein and protein kinase N is also one aspect of the modified amino acid sequence.

In the present invention, "an amino acid sequence which inhibits the binding between the activated Rho protein and the protein kinase N" means the activated Rho protein and P
An amino acid sequence that is evaluated to have inhibition of binding to KN. For example, it was evaluated that inhibition of binding of active Rho protein to PKN was observed when tested under the same conditions as in Example 17. It means the amino acid sequence.

Specific examples of the activated Rho protein-PKN binding inhibitory protein include 7 to 540 of SEQ ID NO: 1.
No. 1 consisting of the amino acid sequence, No. 7 to 155 amino acid sequence, No. 1 to 540 amino acid sequence, No. 3 to 135 amino acid sequence,
And amino acid sequences 33 to 111, and modified amino acid sequences thereof (eg, partial sequences) having the ability to inhibit the binding of activated Rho protein and PKN
It is made of.

The active Rho protein-PKN binding inhibitory proteins further include those consisting of the amino acid sequences 74-93 of SEQ ID NO: 1, those consisting of the amino acid sequences 94-113, and amino acids 82-103. Sequence, as well as activated Rho protein and P
It is composed of these modified amino acid sequences (for example, partial sequences) capable of inhibiting the binding to KN. Peptides consisting of the amino acid sequences 82 to 103 of SEQ ID NO: 1 are active Rho as shown in Examples below.
It is excellent in the ability to inhibit the binding between protein and PKN.

Activated Rho protein-P according to the invention
The KN binding inhibitory protein can be composed of a modified amino acid sequence of protein kinase N which has an active Rho protein binding ability and does not have protein kinase activity.

The activated Rho protein-binding protein may have the property of inhibiting the binding between the activated Rho protein and protein kinase N.

Therefore, according to the present invention, a modified amino acid of protein kinase N which has an active Rho protein binding ability, does not have protein kinase activity, and inhibits the binding of protein kinase N and active Rho protein. A peptide having a sequence or derivative thereof is provided.

The active Rho protein-PKN binding inhibitory protein can inhibit the binding between the active Rho protein and PKN. In addition, Rho protein is involved in tumor formation, metastasis, cell morphology, cell adhesion,
It is closely involved in the functional expression of cells such as cell motility and activation of cytokinesis gene transcription (Takai, Y., et al., Supra).
, Ibid., GCPrendergast. Et al., Khosravi-Far, R., e.
t al. R. Qiu et al. And Lebowitz, P., et al
). Therefore, the activated Rho protein-PKN binding inhibitory protein is considered to be useful for elucidating the mechanism of tumor formation and metastasis. In addition, the activated Rho protein-PKN binding inhibitory protein is considered to be useful for elucidating cell functions.

Intermediate Filament Binding Protein The intermediate filament binding protein according to the present invention is
It comprises a peptide having a modified amino acid sequence of protein kinase N, which has an intermediate filament binding ability and does not have protein kinase activity, or a derivative thereof. Here, the "modified amino acid sequence" has the same meaning as described above. Therefore, the partial amino acid sequence of PKN having intermediate filament-binding ability and not having protein kinase activity (consisting of a part of the entire amino acid sequence of PKN) is also an aspect of the modified amino acid sequence.

In the present invention, "intermediate filament" means vimentin, neurofilament-L (NF
L), neurofilament-M (NFM), neurofilament-H (NFH), acidic keratin, neutral keratin, basic keratin, desmin, glial fibrillary acidic protein (GFAP), lamin, and nestin.

In the present invention, the "amino acid sequence having the ability to bind to intermediate filament" means an amino acid sequence which is evaluated by a person skilled in the art as having been recognized to be bound to the intermediate filament or the head / rod domain of the intermediate filament. , For example, intermediate filament, human NFL 1
~ 349 amino acid sequence, or 1-4 of human NFM
It means an amino acid sequence which is evaluated to be bound to the 11th amino acid sequence.

The intermediate filament-binding protein is
It has no protein kinase activity. In the present invention,
The phrase “does not have protein kinase activity” means that PKN does not have serine / threonine protein kinase catalytic activity, and more specifically, it is the amino acid sequence of 475th or 541st or more of SEQ ID NO: 1. One or more amino acid sequences added and / or inserted, and / or
Alternatively, it means a sequence having no serine / threonine protein kinase catalytic ability by substitution and / or deletion of one or more amino acids, and a sequence corresponding to these in a sequence other than human. .

Specific examples of the intermediate filament-binding protein include those having a modified human-PKN amino acid sequence having an intermediate filament-binding ability and no serine / threonine protein kinase activity. More specifically, the 1-474th amino acid sequence of SEQ ID NO: 1, the 1-540th amino acid sequence, 1-3
No. 2 amino acid sequence, 112 to 540 amino acid sequence or 112 to 474 amino acid sequence,
And those comprising these modified amino acid sequences (for example, partial sequences) having the ability to bind to intermediate filaments.

The intermediate filament-binding protein is
It has the ability to bind intermediate filaments. In addition, intermediate filaments are known to play an important role in cytoskeleton signal transduction (N. Inagaki et al., Tren.
d. Biochem. Sci., 19, 448-452 (1994)). Therefore, the intermediate filament-binding protein is considered to be useful for elucidating the mechanism of tumor formation and metastasis. Also,
The intermediate filament-binding protein is considered to be useful for elucidating such a signal transduction mechanism.

Α-Actinin Binding Protein The α-actinin binding protein according to the present invention is α-actinin binding protein.
It comprises a peptide having a modified amino acid sequence of protein kinase N, which has an actinin-binding ability and does not have protein kinase activity, or a derivative thereof. here,
The “modified amino acid sequence” has the same meaning as described above.
Therefore, a partial amino acid sequence of PKN (P-N having the ability to bind α-actinin and no protein kinase activity (P
(Consisting of a part of the entire amino acid sequence of KN) is also an aspect of the modified amino acid sequence.

In the present invention, "α-actinin" includes skeletal muscle type α-actinin and non-skeletal muscle type α-actinin.

In the present invention, the term "amino acid sequence having an α-actinin-binding ability" is defined by those skilled in the art as α-actinin or an intermediate portion of α-actinin (for example, a spectrin-like repeat of α-actinin and an EF motif hand, And human skeletal muscle α-actinin 423-65
No. 3, 653-837, 486-607, 333-
The amino acid sequence of 894th amino acid or the amino acid sequence of human non-skeletal muscle α-actinin 479 to 600th, 712 to 843th amino acid sequence) evaluated to have been found to be bound.

The α-actinin binding protein has no protein kinase activity. In the present invention, “having no protein kinase activity” means that PKN does not have serine / threonine protein kinase catalytic activity, and more specifically, SEQ ID NO: 475 or 541 Amino acid sequence having no serine / threonine protein kinase catalytic activity due to addition and / or insertion of one or more amino acid sequences and / or substitution and / or deletion of one or more amino acids Furthermore, in non-human sequences, the sequences corresponding thereto are meant.

Specific examples of the α-actinin-binding protein include human-having an α-actinin-binding ability and not having serine / threonine protein kinase activity.
Examples thereof include those having a modified amino acid sequence of PKN.
More specifically, SEQ ID NO: 1 to 540, 3 to 13
Examples thereof include those consisting of the amino acid sequences of Nos. 5, 136 to 540, or 136 to 189, and those consisting of these modified amino acid sequences (for example, partial sequences) having an α-actinin binding ability.

The α-actinin binding protein is α-actinin.
It has the ability to bind actinin. Further, α-actinin is a cytoskeletal protein that cross-links actin / filament or actin / filament and cell adhesion apparatus, and is known to play an important role in cell morphology, cell adhesion, cell motility, etc. (See the above-mentioned prior art). Therefore, the α-actinin-binding protein is considered to be useful for elucidating the mechanism of control of cell morphology and cell adhesion by Rho and PKN. Further, α-actinin binding protein is considered to be useful for elucidating such a signal transduction mechanism.

PKN catalytic domain-binding protein The PKN catalytic domain-binding protein according to the present invention is PKN.
It consists of a peptide having a modified amino acid sequence of PKN or a derivative thereof, which has the ability to bind to the N catalytic domain and does not have the protein kinase activity. Here, the "modified amino acid sequence" has the same meaning as described above. Therefore, the partial amino acid sequence of PKN having the PKN catalytic domain binding ability and not having the protein kinase activity (consisting of a part of the entire amino acid sequence of PKN) is also an aspect of the modified amino acid sequence.

In the present invention, "protein kinase N
The "amino acid sequence having the ability to bind to the protein kinase catalytic domain" means an amino acid sequence evaluated to be bound to the protein kinase catalytic domain of PKN by a person skilled in the art, for example, under the same conditions as in Example 11 or 12. It means an amino acid sequence which is evaluated to have been found to bind to the protein kinase catalytic region of PKN when the experiment was carried out in.

Here, the protein kinase catalytic region of protein kinase N to which the PKN catalytic region-binding protein according to the present invention binds is, for example, the amino acid sequence of 511 to 942 or the amino acid sequence of 614 to 942 of SEQ ID NO: 1. , And 634 to 942 amino acid sequences.

The PKN catalytic domain-binding protein has no protein kinase activity. In the present invention, “not having protein kinase activity” means that PKN does not have serine / threonine protein kinase catalytic ability, and more specifically, SEQ ID NO: 1 of 541 or 475 or later. Amino acid sequence having no serine / threonine protein kinase catalytic activity due to addition and / or insertion of one or more amino acid sequences and / or substitution and / or deletion of one or more amino acids Furthermore, in non-human sequences, the sequences corresponding thereto are meant.

As a specific example of the PKN catalytic domain-binding protein, a human-having PKN catalytic domain binding ability and no serine / threonine protein kinase activity is used.
Examples thereof include those having a modified amino acid sequence of PKN.
More specifically, those consisting of the 1-540th amino acid sequence and 1-474th amino acid sequence described in SEQ ID NO: 1 and those modified amino acid sequences having PKN catalytic region binding ability (for example, Partial sequence).

PKN catalytic domain binding protein is PK
It has the ability to bind the protein kinase catalytic domain of N. Therefore, the PKN catalytic domain-binding protein is considered to be useful for elucidating the mechanism of tumor formation and metastasis. It is also considered to be useful for elucidating cell signal transduction by PKN.

Peptides that inhibit PKN protein kinase activity
The PKN protein kinase activity-inhibiting peptide according to the present invention is a peptide having a modified amino acid sequence of protein kinase N, which inhibits the protein kinase activity of protein kinase N and has no protein kinase activity, or a derivative thereof. Here, the "modified amino acid sequence" has the same meaning as described above. Therefore, the partial amino acid sequence of PKN that inhibits the activity of PKN protein kinase and does not have the protein kinase activity (PK
It is also one aspect of the modified amino acid sequence).

In the present invention, "protein kinase N
The term "inhibits the protein kinase activity of" refers to an amino acid sequence evaluated to have been found by a person skilled in the art to inhibit the activity of PKN protein kinase. For example, when the experiment is performed under the same conditions as in Example 14 or 15. Means an amino acid sequence evaluated to have been found to inhibit the activity of PKN protein kinase.

The peptide inhibiting PKN protein kinase activity has no protein kinase activity. In the present invention, “having no protein kinase activity” means P
It means that KN does not have the ability to catalyze serine / threonine protein kinases. More specifically, 5 of SEQ ID NO: 1
41 or 475 or subsequent amino acid sequences,
The above amino acid sequences are added and / or inserted, and / or one or more amino acids are substituted and / or deleted, thereby providing a sequence having no serine / threonine protein kinase catalytic activity, and a non-human sequence. In, the sequences corresponding to these are meant.

Specific examples of the PKN protein kinase activity-inhibiting peptide include those which inhibit the activity of protein kinase N of protein kinase N and which are serine / threonine.
Those having a modified amino acid sequence of human-PKN that does not have protein kinase activity can be mentioned. More specifically, there may be mentioned those consisting of the amino acid sequences 39 to 53 of SEQ ID NO: 1 and those consisting of this modified amino acid sequence (for example, partial sequence) having the ability to inhibit protein kinase activity.

The PKN protein kinase activity-inhibiting peptide inhibits the activity of PKN protein kinase.
Therefore, the PKN protein kinase activity inhibitory peptide is considered to be useful for elucidating the mechanism of tumor formation and metastasis. It is also considered to be useful for elucidating cell signal transduction by PKN.

The PKN catalytic domain-binding protein of the present invention may have the ability to inhibit PKN protein kinase activity. The PKN protein kinase activity-inhibiting peptide may have the ability to bind to the protein kinase catalytic domain of PKN.

Therefore, according to the present invention, a modified amino acid of protein kinase N which has the ability to bind the protein kinase catalytic domain of protein kinase N, inhibits the protein kinase activity of protein kinase N, and does not have the protein kinase activity. A peptide having a sequence or derivative thereof is provided. The modified amino acid sequence is
SEQ ID NO: 1 to 540th amino acid sequence, 1 to 474
It may be the amino acid sequence No. 39 or the amino acid sequence Nos. 39 to 53, or a partial sequence thereof having the ability to bind the protein kinase catalytic domain of PKN and the ability to inhibit the protein kinase activity of PKN. Therefore, PK
Peptides that inhibit N protein kinase activity are thought to be useful for elucidating the mechanism of tumor formation and metastasis. In addition, the PKN protein kinase activity inhibitory peptide is P
It is considered to be useful for elucidating cell signal transduction by KN.

Phosphorylated peptide The phosphorylated peptide according to the present invention is a peptide or derivative having a modified amino acid sequence of protein kinase N that is phosphorylated by protein kinase N. Here, the "modified amino acid sequence" has the same meaning as described above. Therefore, the partial amino acid sequence of PKN phosphorylated by protein kinase N (consisting of a part of the entire amino acid sequence of PKN) is also an aspect of the modified amino acid sequence.

In the present invention, "protein kinase N
The "amino acid sequence phosphorylated by" means an amino acid sequence evaluated to be phosphorylated by PKN by a person skilled in the art, for example, PKN when tested under the same conditions as in Example 9, 10 or 13. It means the amino acid sequence evaluated to be phosphorylated by the.

The phosphorylated peptide has no protein kinase activity. In the present invention, “having no protein kinase activity” means that PKN does not have serine / threonine protein kinase catalytic ability,
More specifically, it is the amino acid sequence from 541 of SEQ ID NO: 1 or more, wherein one or more amino acid sequences are added and / or inserted, and / or one or more amino acids are substituted and / or deleted. A sequence having no catalytic ability for serine / threonine protein kinase is meant to mean a sequence corresponding to those sequences other than human.

Specific examples of the phosphorylated peptide according to the present invention include those having a modified human-PKN amino acid sequence which is phosphorylated by PKN and has no protein kinase activity. More specifically, the amino acid sequences of the 39th to 53rd amino acids of SEQ ID NO: 1 in which Ile of the 46th amino acid has been replaced by Ser, and the amino acid sequence of SEQ ID NO: 2 and those phosphorylated by PKN Modified amino acid sequences (eg, partial sequences) can be mentioned.

The phosphorylated peptide according to the present invention is also a peptide having an intermediate filament phosphorylated by protein kinase N and a modified amino acid sequence thereof, or a derivative thereof.

The intermediate filaments include vimentin, neurofilament-L, neurofilament-M, neurofilament-H, acidic keratin, neutral keratin, basic keratin, desmin, glial fibrillary acidic protein (GFAP), lamin, and Nestin etc. are mentioned.

Here, the "modified amino acid sequence" has the same meaning as described above. Therefore, the partial amino acid sequence of the intermediate filament that is phosphorylated by PKN (composed of a part of the entire amino acid sequence of the intermediate filament) is also an aspect of the modified amino acid sequence.

As the partial amino acid sequence of the intermediate filament, the head / rod domain of vimentin, the head / rod domain of neurofilament-L, the head / rod domain of neurofilament-M, and the head / rod domain of neurofilament-H are included. Can be mentioned.

The entire amino acid sequences of the intermediate filaments exemplified above are known to have human origin, for example, and the sequences are Julien, J. et al., Bio
chim. Biophys. Acta 909, 10-20 (1987) (Neurofilament-L), Myers, M. et al., EMBO J., 6, 1617-
1626 (1987) (Neurofilament-M), Lees, J.,
et al., EMBO J., 7, 1947-1955 (1988) (Neurofilament-H), Honore ', B., et al., Nucl. Acid.Re.
s., 18, 6692 (1990) (Vimentin).

The entire amino acid sequence of intermediate filaments of non-human species having homology with the sequence of human intermediate filaments (for example, rat, bovine, Xenopus, etc.) is also the entire amino acid sequence of intermediate filaments referred to herein. Shall be included in.

The phosphorylated peptide according to the present invention is also a peptide having a cytoskeletal protein other than intermediate filaments (for example, G-actin and caldesmon) and a modified amino acid sequence thereof or a derivative thereof.

The origins of the intermediate filaments, G-actin and caldesmon are not particularly limited, and they may be derived from mammals including humans or may be derived from other sources.

The phosphorylated peptide according to the present invention is considered to be useful for elucidating the mechanism of tumor formation and metastasis. It is also considered to be useful for elucidating cell signal transduction by PKN.

[0089]PKN-binding cytoskeletal protein  The PKN-binding protein according to the present invention has a PKN-binding ability.
A cytoskeletal protein having an
And α-actinin) modified amino acid sequences
Peptide or its derivative. Here, "Modify
The “amino acid sequence” has the same meaning as described above. Follow
A partial cytoskeletal protein having PKN-binding ability.
Minoic acid sequence (intermediate filament or α-actinin
Is composed of part of the entire amino acid sequence of
It is one aspect of an amino acid sequence.

In the present invention, as the "intermediate filament", vimentin, neurofilament-L (NF
L), neurofilament-M (NFM), neurofilament-H (NFH), acidic keratin, neutral keratin, basic keratin, desmin, glial fibrillary acidic protein (GFAP), lamin, and nestin.

In the present invention, “α-actinin” includes skeletal muscle type and non-skeletal muscle type. In the present invention, the “amino acid sequence capable of binding PKN” refers to an amino acid sequence evaluated to be PKN binding by a person skilled in the art.

Examples of PKN-binding cytoskeletal proteins include the intermediate rod head-rod domain, α-actinin spectrin-like repeats and E.
An example is the F motif hand. More specifically, amino acid sequences 1 to 349 of human neurofilament L, amino acid sequences 1 to 411 of human neurofilament M, and 423 of human skeletal muscle α-actinin.
653, 653-837, 486-607 amino acid sequences, human non-skeletal muscle α-actinin 479-600 and 712-843 amino acid sequences, and PKN binding ability Those comprising these modified amino acid sequences (for example, partial sequences) can be mentioned.

PKN-binding cytoskeletal proteins are PK
It has N-bonding ability. Therefore, PKN-binding proteins are considered to be useful for elucidating the mechanism of tumor formation and metastasis. In addition, PKN-binding cytoskeletal proteins are considered to be useful for elucidating the cell signal transduction mechanism.

Base Sequence According to the present invention, a base sequence encoding the above peptide is provided. A typical nucleotide sequence of PKN is:
It has part or all of the DNA sequence of SEQ ID NO: 1. In addition, in the present specification, the base sequence means DNA.
It is intended to mean both sequences and RNA sequences.

Given the modified amino acid sequence, the nucleotide sequence encoding it can be easily determined, and various nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO: 1 or 2 can be selected. Therefore, the nucleotide sequence encoding the peptide according to the present invention means a DNA sequence encoding the same amino acid in addition to a part or all of the DNA sequence shown in SEQ ID NO: 1 or 2 and a degenerate codon. Is also meant to mean a sequence having as a DNA sequence, and further includes RNA sequences corresponding thereto.

The base sequence according to the present invention may be of natural origin or wholly synthesized. In addition, it may be synthesized by using a part of a naturally-derived material. A typical method for obtaining DNA is a method commonly used in the field of genetic engineering from a chromosomal library or a cDNA library, for example, screening using an appropriate DNA probe prepared based on the information on the partial amino acid sequence. The method of performing, etc.

The nucleotide sequences encoding the active Rho protein-binding protein and the active Rho protein-PKN binding inhibitory protein include, for example, 55 to 1656, 55 to 501 and 37 to 165 of SEQ ID NO: 1.
0, 43-441, 133-369, 256-3
DNA Nos. 15, 316-375 and 280-345
Sequences are included.

The base sequence encoding the intermediate filament-binding protein is, for example, 37 of SEQ ID NO: 1.
~ 1656, 373 to 1656, and 373 to 1
The 458th DNA sequence can be mentioned.

The nucleotide sequence encoding the α-actinin monthly protein is, for example, 37 to 1 of the sequence Iizou 1.
656, 43-441, 442-1656, and 442-603 DNA sequences.

The nucleotide sequence encoding the PKN catalytic domain-binding protein is, for example, 37 to 1 of SEQ ID NO: 1.
656 and 37-1458 DNA sequences are included. The nucleotide sequence encoding the PKN protein kinase activity-inhibiting peptide is, for example, 15 of SEQ ID NO: 1.
The DNA sequences numbered 1 to 195 can be mentioned.

Vector and Transformed Host Cell According to the present invention, the above-mentioned base sequence according to the present invention is contained in a state capable of replicating in a host cell and expressing a protein encoded by the base sequence. A vector is provided. Further, according to the present invention, there is provided a host cell transformed with the vector. The host-vector system is not particularly limited, and a fusion protein expression system with another protein can be used. Examples of the fusion protein expression system include MBP (maltose binding protein), GST (glutathione S transferase), HA (hemagglutinin), and histidine (His).
-The thing using repeat, myc, Fas etc. is mentioned.

As the vector, a plasmid vector (for example, expression vector in prokaryotic cell, yeast, insect cell animal cell, etc.), a viral vector (for example, retrovirus vector, adenovirus vector, adeno-associated virus vector, herpesvirus vector, Examples include Sendai virus vector, HIV vector), liposome vector (eg, cationic liposome vector), and the like.

In order to actually introduce the vector of the present invention into a host cell to express a desired amino acid sequence, in addition to the above-mentioned nucleotide sequence of the present invention, a sequence for controlling the expression or a microorganism or It may contain a gene marker or the like for selecting animal cultured cells and the like. In addition, this vector may contain the nucleotide sequence according to the present invention in a repeated form (for example, tandem). These may be present in a vector according to a conventional method, and a method for transforming a microorganism or an animal cultured cell with the vector may be one commonly used in this field.

The procedure and method for constructing a vector according to the present invention can be those conventionally used in the field of genetic engineering. Examples of host cells include Escherichia coli, yeast, insect cells, and animal cells (eg, COS cells,
Lymphocytes, fibroblasts, CHO cells, blood cells, tumor cells, etc.).

The above transformed host cells can be cultured in an appropriate medium, and the protein or peptide according to the present invention can be obtained from the culture. Therefore, according to another aspect of the present invention, there is provided a method for producing a protein or peptide according to the present invention. The culture of the transformed host cells and their conditions may be essentially the same as for the cells used. In addition, the protein and the like according to the present invention can be collected and purified from the culture broth according to a conventional method.

The cells to be transformed are, for example, cancer cells in cancer patients (for example, leukemia cells, digestive organ cancer cells, lung cancer cells, spleen cancer cells, ovarian cancer cells, uterine cancer cells, melanoma cells, brain tumor intestines). Cell) or the like), by introducing the vector containing the nucleotide sequence according to the present invention into cancer cells in vivo including human by a suitable method to express the protein or peptide according to the present invention, Gene therapy can be performed for malignant tumors and the like.

For example, a modified amino acid sequence of PKN which has an active Rho protein-binding ability according to the present invention and does not have a protein kinase activity, or a modified amino acid sequence of PKN which inhibits the binding between PKN and an active Rho protein. Is expressed in a living body including human, the active Rho protein binds to it (inhibits the binding between PKN and the active Rho protein), and as a result, the signal transduction from the active Rho protein to PKN occurs. It is believed to be blocked and able to suppress tumor formation or metastasis involving Rho proteins.

Cytoskeletal protein-binding proteins, that is, intermediate filament-binding protein and α-actinin-binding protein, are
Signal transduction from N to the intermediate filament and α-actinin can be blocked, and protein kinase N catalytic domain-binding protein or PKN protein kinase activity-inhibiting peptide can inhibit PKN phosphorylation. As described below, since Rho protein is closely related to tumor formation or metastasis, PKN, which controls downstream signal transduction, and cytoskeletal protein, which controls downstream signal transduction, are also closely related to tumor formation or metastasis. It is believed that Therefore, it is considered that by expressing these proteins in vivo including humans, the formation or metastasis of tumors associated with Rho protein can be suppressed. For gene therapy vectors, see Experimental Medicine (Supplement) No. 12 supervised by Fumiko Takaku.
Vol. 15, No. 15, "Forefront of Gene Therapy" (1994).

Use / pharmaceutical composition As described above, the active Rho protein-binding protein according to the present invention binds to the active Rho protein (by inhibiting the binding between PKN and the active Rho protein), P from activated Rho protein
It is thought that the signal transduction to KN can be blocked. Moreover, it is considered that the intermediate filament-binding protein and the α-actinin-binding protein can block the signal transduction from PKN to the intermediate filament and α-actinin by binding to the regulatory region of PKN. Furthermore, the PKN catalytic domain binding protein and the PKN protein kinase activity inhibitory peptide are
By binding to the catalytic region of KN, the phosphorylation reaction of PKN can be inhibited.

On the other hand, the active Rho protein-binding protein according to the present invention inhibits PKN translocation from the cytoplasm to the nucleus (see Examples below), and thus suppresses the oncogene transcription activity by the Rho protein, thus leading to tumorigenesis. It is thought that this can be inhibited. Specifically, it is as follows.

First, according to Hill, CS et al., Supra, lysophosphatidylic acid, serum, and stress (eg, arsenite and osmotic shock) induce SRF.
Regulates c-fos transcription via SRE activation by S. cerevisiae, which requires a functional Rho protein. From this, it is located downstream of the Rho protein,
An unknown pathway responsible for signal transduction to the cell nucleus was suggested.

On the other hand, by the present inventors, PKN is Rh
o protein is a target protein (eg, Examples 1 and 2), and heat shock, sodium arsenite, or serum starvation revealed a shift in the intracellular distribution of PKN from the cytoplasm to the nucleus (implementation). Examples 19-21). In addition, when PKN-PK ^- is overexpressed, even the endogenous wild-type PKN does not translocate to the nucleus (Example 22).

Therefore, the activated Rho protein-binding protein or PKN protein kinase-inhibiting peptide in which the kinase was inactivated was used as a "dominant
It can be used as a "negative inhibitor". That is,
Neutralizing a signaling molecule acting upstream of PKN by overexpressing an active Rho protein binding protein or PKN protein kinase inhibitor peptide in which the kinase activity or kinase domain is inactivated or deleted into a cell As a result, it is possible to block the signal transduction (signal transduction into the cytoskeleton or nucleus) involving the endogenous wild-type PKN. As a result, R
It is considered that transcriptional activation of oncogenes by ho can be suppressed.

Therefore, the protein according to the present invention is considered to be effective in suppressing tumor formation or metastasis. Therefore, the activated Rho protein-binding protein and the PKN protein kinase activity-inhibiting peptide are
It can be used as an inhibitor of tumor formation or metastasis involving Rho protein (that is, by transmitting a signal via Rho protein) (hereinafter referred to as “inhibitor of tumor formation, etc.”).

Here, tumor formation and metastasis include R
ho involved tumor formation, other low molecular weight G protein (eg Ras, Rac, Cdc42, Ral, etc.) involved tumor formation, low molecular weight G protein GDP /
Tumor formation involving GTP exchange proteins (eg, Dbl, Ost, etc.), lysophosphatidic acid (LP
A) Involvement of tumor formation, receptor-type tyrosine kinase (eg, PDGF receptor, EGF receptor, etc.), transcription control protein (myc, p53, etc.) or formation of tumors involving various human tumor viruses. Can be

The tumor formation inhibiting agent according to the present invention also comprises
Oral or parenteral administration (eg, intramuscular injection, intravenous injection, subcutaneous administration, rectal administration, transdermal administration, nasal administration, etc.), preferably oral administration, and various drugs suitable for oral or parenteral administration Dosage form for use in humans and non-human animals.

Tumor formation inhibitors are oral agents such as tablets, capsules, granules, powders, pills, fine granules, troches, and injections such as intravenous injection and intramuscular injection, depending on the application. , Rectally administered agents, oily suppositories, water-soluble suppositories, and the like. These various formulations include commonly used excipients, fillers, binders,
Manufactured by a conventional method using a wetting agent, a disintegrating agent, a surface active agent, a lubricant, a dispersant, a buffer, a preservative, a solubilizing agent, a preservative, a flavoring agent, a soothing agent, a stabilizer and the like. be able to. Examples of the nontoxic additives that can be used include lactose, fructose, glucose, starch, gelatin, magnesium carbonate, synthetic magnesium silicate, talc, magnesium stearate, methylcellulose, carboxymethylcellulose or salts thereof, gum arabic, polyethylene glycol Syrup, petrolatum, glycerin, ethanol, propylene glycol, citric acid, sodium chloride, sodium sulfite, sodium phosphate and the like.

The content of the peptide or the like of the present invention in the drug varies depending on the dosage form, but is usually about 0.
The concentration is from 1 to about 50% by weight, preferably from about 1 to about 20% by weight. The dose for the treatment of tumor formation and metastasis is
It is appropriately determined in consideration of the usage, the age of the patient, the sex, the degree of the symptoms, and the like.
mg, preferably about 0.5 to about 50 mg, which can be administered once or several times a day.

According to the present invention, the inhibition of tumorigenesis or metastasis comprising the presence of a protein or peptide according to the invention in cells in which a tumor has been formed or cells in which the tumor is at risk of metastasis. A method is provided. In this case, the effective dose, administration method, administration form and the like can be in accordance with the above-mentioned tumor formation inhibitor.

The nucleotide sequence encoding the protein or peptide according to the present invention can be used in such a manner as to suppress tumor formation or metastasis by transforming a target cell with the above-mentioned vector having the nucleotide sequence. That is, the nucleotide sequence can be used as a gene therapeutic agent for suppressing tumor formation or metastasis.

Screening method According to the present invention, (1) the substances to be screened are activated Rho protein and protein kinase N.
Or an activated Rho protein-binding protein, and

(2) measuring the degree of inhibition of the binding between the activated Rho protein and the protein kinase N or the activated Rho protein-binding protein,
Provided is a screening method for a substance that inhibits binding between activated Rho protein and protein kinase N.

Here, "to measure the degree of inhibition of binding"
As a method, cell-free recombinant PKN and GTPγ
A method for measuring the binding to S.GST-RhoA protein using glutathione sepharose beads, a method for measuring the binding between PKN and Rho protein in an animal cell (cell line) by using immunoprecipitation and immunoblot, Two hybrid system
(M. Kawabata Experimental Medicine 13,2111-2120 (1995), ABVoj
etk et al. Cell 74,205-214 (1993)), R as described later.
Examples thereof include a method of measuring the degree of inhibition of the activity or enhancement of activity of ho protein GTPase. For example, in Examples 1 and 4 (1) and (2), Example 5, and Examples 16 to 18 The degree of inhibition of binding can be measured according to the method described. Further, in the present specification, "measuring the degree of inhibition of binding" is used in a sense including measurement of the presence or absence of binding.

The screening system may be either a cell system or a cell-free system. Examples of the cell system include yeast cells, COS cells, Escherichia coli, insect cells, nematode cells, lymph cells, fibroblasts (NIH3T3). Cells, Balb /
c3T3 cells, Rat-1 cells, etc.), CHO cells, blood cells, and tumor cells. The target of the screening is not particularly limited, but includes, for example, peptides, peptide analogs, microbial cultures, and organic compounds.

As used herein, the term “screening” is meant to include “assay”.

According to the present invention, (1) the substances to be screened are activated Rho protein and activated Rho.
(2) Rho protein GTP, which is present in a screening system comprising a ho protein binding protein and
Rh, including measuring the degree of inhibition of the activity of ase
A method for screening a substance that inhibits the activity of o protein GTPase is provided.

According to the present invention, (1) the substance to be screened is an activated Rho protein,
An activated Rho protein binding protein, and R
ho protein GTPase activating protein (GA
Ph), and (2) measuring the degree of inhibition of the activity or enhancement of activity of the active Rho protein GTPase.
A method for screening a substance that inhibits the activity or enhancement of the activity of o protein GTPase is provided.

[0128] As a method for measuring the "inhibition of activity or enhancement of activity of Rho protein GTPase", [γ- ³² P] GTP in a cell-free system in the presence of MBP-PKN (see Example 4) was used. -A method for measuring a decrease in the radioactivity of GST-Rho and the like can be mentioned. For example, the Rho protein GTP can be prepared according to the method described in Example 18.
The degree of inhibition of the activity of ase or the enhancement of its activity can be measured. The screening system and the subject of the screening system include those similar to the above-mentioned screening method.

According to the present invention, (1) the substance to be screened is present in a screening system containing an intermediate filament and protein kinase N or an intermediate filament-binding protein, and (2) an intermediate Provided is a screening method for a substance that inhibits binding between an intermediate filament and protein kinase N, which comprises measuring the degree of inhibition of binding between an intermediate filament and protein kinase N or an intermediate filament-binding protein.

Here, "to measure the degree of inhibition of binding"
As a method, a method of measuring the binding between the recombinant protein kinase N and the recombinant intermediate filament in a cell-free system using glutathione sepharose beads, a method of measuring using the yeast two hybrid system, and Examples include a method of measuring the binding between the intermediate filament and PKN in an animal cell using immunoprecipitation and immunoblot, and for example, binding inhibition according to the method described in Examples 6-8. The degree can be measured. The screening system and the object of screening include the same ones as described above.

According to the present invention, further, (1) a screening system in which the substance to be screened comprises an intermediate filament and a protein kinase N or a peptide having a modified amino acid sequence having protein kinase activity or a derivative thereof And (2)
Provided is a screening method for a substance that inhibits the polymerization of intermediate filaments, which comprises measuring the degree of inhibition of polymerization of intermediate filaments.

Here, "to measure the degree of inhibition of polymerization"
Examples of the method include a method of measuring the binding between the head and rod domains of the recombinant intermediate filament in a cell-free system using glutathione sepharose beads (G-Beads), and are described in, for example, Example 10. The degree of inhibition of polymerization can be measured according to the method. Further, in the present specification, “measuring the degree of inhibition of polymerization” is used to mean including measurement of the presence or absence of polymerization. The screening system and the object of screening include the same ones as described above.

According to the present invention, (1) the substance to be screened is present in a screening system containing skeletal muscle α-actinin and protein kinase N or α-actinin-binding protein, and (2) Skeletal muscle α-actinin and protein kinase N or α
-A method for screening a substance that inhibits the binding between skeletal muscle α-actinin and protein kinase N is provided, which comprises measuring the degree of inhibition of the binding with actinin-binding protein.

According to the present invention, (1) substances to be screened are non-skeletal muscle α-actinin, protein kinase N or α-actinin-binding protein, and calcium ion (Ca ²⁺ ). And (2) non-skeletal muscle type α
-A screening method for a substance that inhibits the binding between non-skeletal muscle α-actinin and protein kinase N, which comprises measuring the degree of inhibition of the binding between actinin and protein kinase N or α-actinin binding protein. Provided.

Here, "to measure the degree of inhibition of binding"
As a method, a method for measuring the binding between recombinant protein kinase N and recombinant α-actinin in a cell-free system using glutathione sepharose beads, yeast-2.
Examples include a method of measuring using a hybrid system, a method of measuring the binding between α-actinin and PKN in animal cells using immunoprecipitation and immunoblot, and for example, Examples 24-29. The degree of inhibition of binding can be measured according to the method described. The screening system and the object of screening include the same ones as described above.

According to the Examples described later, the presence of PI4,5P2 in the screening system strengthens the binding between PKN and α-actinin. Therefore, from the viewpoint of clarifying the screening, PI4,5P2 is added to the screening system.
Is preferably present.

According to the present invention, (1) a substance to be screened is present in a screening system containing a peptide having a protein kinase N or a modified amino acid sequence thereof having protein kinase activity or a derivative thereof, and (2) ) A method for screening a substance that inhibits the activity of protein kinase N, which comprises measuring the degree of inhibition of the protein kinase activity of protein kinase N.

According to the present invention, (1) the substance to be screened is an activated Rho protein,
A protein kinase N or a peptide having the modified Rho protein-binding ability and a peptide having a modified amino acid sequence thereof having protein kinase activity, or a derivative thereof, and (2) the protein kinase of protein kinase N Measuring the degree of inhibition of the activity of
Provided is a screening method for a substance that inhibits the activity of Rkin protein-dependent protein kinase of protein kinase N or the enhancement of the activity.

[0139] As a method for measuring "the degree of inhibition of protein kinase activity" or "the degree of inhibition of enhancement of protein kinase activity", the autophosphorylation activity of protein kinase N or an enzyme whose activity is changed by phosphorylation is used. The method for measuring the activity of the protein kinase can be mentioned, for example, the activity of protein kinase or the activity of protein kinase according to the method described in Example 3, (3) of Example 4, Example 9, Example 10 and Examples 13 to 15 The degree of inhibition of the enhancement of its activity can be measured. In addition, in the present specification, the measurement of “the degree of inhibition of protein kinase activity” or “the degree of inhibition of protein kinase activation” means the presence or absence of protein kinase activity or inhibition of protein activation inhibition. Shall be used.

The degree of inhibition of protein kinase activity or enhancement of its activity depends on the complex of vimentin, neurofilament-L, neurofilament-M, neurofilament-H, and neurofilament triplet protein (NFL, NFM and NFH). ), ΑPKC peptide, δPKC peptide, the peptide described in SEQ ID NO: 2, caldesmon, and a substrate selected from the group consisting of G-actin. The screening system and the target of screening are
The same as the above-mentioned screening method can be mentioned.

Examples of the method for measuring "the degree of inhibition of protein kinase activity" or "the degree of inhibition of enhancement of protein kinase activity" include the method of measuring nuclear translocation of PKN by immunofluorescence or the like. Example 1
According to the method described in 9 to 21, the degree of inhibition of protein kinase activity or the degree of inhibition of protein kinase activity can be measured. In this case, the screening system may be a cell line (eg NIH3T3 cells, Rat-1
Cells, Balb / c3T3 cells) can be used.

As described above, the active Rho protein has been confirmed to be closely associated with tumor formation and metastasis. In addition, according to the present invention, PKN is activated Rh
It has been shown that PKN is also closely involved in tumor formation or metastasis, as it has been shown to receive signaling from the o protein. Therefore, the above screening method can also be used as a screening method for a tumor formation or metastasis inhibitor.

[0143]

EXAMPLES The present invention will be explained with reference to the following examples, but the present invention is not limited thereto. Hereinafter, the Rho protein may be simply referred to as “Rho” and the RhoA protein may be simply referred to as “RhoA”.

Example 1 Activated Rho Protein Binding Tag
Purification of protein A crude membrane fraction was prepared from 200 g of bovine brain gray matter. The protein in the membrane fraction was mixed with an equal volume of a homogenizing buffer containing 4 M NaCl (25 mM Tris / HCl).
(PH 7.5), 5 mM EGTA, 1 mM dithiothreitol, 10 mM MgCl ₂ , 10% sucrose) (100 ml) was added for extraction, and then the extract was extracted with buffer A (20 mM Tris / HC).
1 (pH 7.5), 1 mM EDTA, 1 mM dithiothreitol, 5 mM MgCl ₂ ) was dialyzed. Then, solid ammonium sulfate was added so that the final concentration was 40% saturated. 16m of precipitate with 0-40% ammonium sulfate
It was dissolved in 1 l of buffer A, dialyzed against buffer A, and applied to a 1 ml glutathione-Sepharose column. One-eighth volume (2 ml) of the flow-through fraction was treated with guanine nucleotide in advance to obtain the corresponding GST-glutathione containing 6 nmole of low molecular weight G protein-
Apply to a 0.25 ml Sepharose column. 2.5m
After washing with 1 A of buffer A, addition of 10 mM glutathione-containing buffer A (0.825 ml)
The bound protein was eluted with the corresponding GST-small G protein. In order to purify a protein having a molecular weight of 128 kD (hereinafter referred to as “p128”), the flow-through fraction was applied to 1 ml of a glutathione-Sepharose column containing 24 nM GTPγS.GST-RhoA protein. p128 was eluted by the addition of buffer A containing 0.2M NaCl.

The sample was dialyzed against buffer A,
Loaded onto a 0.3 ml DEAE Sepharose column equilibrated with buffer A. After washing with buffer A (1.5 ml) containing 50 mM NaCl, the protein was buffer A (1.5 ml) containing 75 mM NaCl.
The fractions of 0.3 ml each were collected. 3 for each fraction
Each 0 μl was subjected to SDS-PAGE and analyzed by silver staining. The results were as shown in FIG. The results shown are representative of 3 independent experiments. p128
Appeared as a single peak in fractions 1-3.

The GST-RhoA protein and GST-Rac1 used here are Shimizu, K. et al., J. Bi.
Purified according to the method described in ol. Chem. 269, 22917-22920 (1994) and loaded with guanine nucleotides.

Example 2 Binding to activated Rho protein
Demonstration that the protein of interest was the same as PKN Purified p128 was subjected to SDS-PAGE and transferred to a polyvinylidene difluoride membrane. The band corresponding to p128 was digested with lysyl-endopeptidase (Achromobacter protease I). The resulting peptides were fractionated by C18 column chromatography and identified by amino acid sequence analysis. Five internal sequences derived from the peptide were obtained, which corresponded to a part of the sequence of PKN set forth in SEQ ID NO: 1.

In addition, anti-PKN antibody (Mukai, H. et al., Bio
chem.Biophys.Res.Commun.204,348-356 (1994)), immunoblot analysis of p128 was carried out.
It showed cross-reactivity with p128. The results were as shown in FIG.

Example 3 Dependence on activated Rho protein
PKN kinase activity 2 μM [γ- ³² P] ATP (600-800 MBq /
mmol) and purified PKN (10 ng protein amount) in kinase buffer (50 mM Tris
/ HCl (pH 7.5), 1 mM EDTA, 5 m
Kinase reactions were performed in 50 μl of M MgCl ₂ , 0.06% CHAPS) in the presence or absence of 40 μM αPKC. After incubating at 30 ° C. for 10 minutes, the reaction solution was boiled in SDS-sample buffer, and SDS- was added to measure autophosphorylation reaction.
I went to PAGE. Radioactively labeled bands were made visible by autoradiography. Reactions were spotted on Whatman p81 paper to measure kinase activity. The incorporation of ³² P into the αPKC peptide was measured by scintillation counting.

(1) Autophosphorylation of PKN The autophosphorylation of PKN was measured in the presence of various low molecular weight G proteins (50 pmol each). The results were as shown in FIG.

(2) Volume-dependent activation of PKN kinase activity against αPKC peptide by activated RhoA protein In the presence of various amounts of GDP / GST-RhoA protein or GTPγS / GST-RhoA protein, 40 μM αPKC peptide Was used to carry out the kinase reaction. The results were as shown in FIG.

(3) Effect of various low molecular weight G proteins on kinase activity of PKN Kinase reaction was performed using 40 μM αPKC peptide in the presence of various low molecular weight G proteins (50 pmol each) or arachidonic acid (2 nmol). Carried out. The result was as shown in FIG. The results shown are representative of 3 independent experiments.

Example 4 PKN and activated Rho protein
Binding to quality and by the Rho protein in vivo.
-Induced autophosphorylation of PKN (1) Recombinant PKN and GTPγS ・ GS in cell-free system
Binding with T-RhoA protein The N-terminal region of PKN is a PKN full-length cDNA (H. Mukai
& Y.Ono, Biochem.Biophys.Res, Commun.199,897-904 (199
4)) as a template and a primer (5'-AATTTTGG
ATCCCTTGCAGAGTGAGCCTCGCA-
3'and 5'-TATATGGATCCTCAGCC
ATTGCTGTAGGTCTGGAT-3 ') was prepared by amplification according to a conventional method by the PCR method. N-terminal region of PKN (7-155 of SEQ ID NO: 1)
Numbered amino acid sequence) to MBP fusion protein (hereinafter,
"MBP-PKN"), and purified with amylose resin (New England Biolabs).

MBP-PKN (0.2 nmol) was added to
0.75 nmol GST, GDP / GST-Rho
A, GTPγS ・ GST-RhoA, GTPγS ・ GS
T-RhoA ^Asp38 , GDP / GST-Rac, G
TPγS ・ GST-Rac, GDP ・ GST-H-Ra
30μ containing s or GTPγS · GST-H-Ras
l glutathione-Sepharose beads and 1 mg /
Buffer A containing 0.7 ml of bovine serum albumin (0.7
5 ml). 0. 2 with 0.2 M NaCl.
MBP-PKN was eluted by adding 1 ml of buffer A three times and then adding 0.1 ml of buffer A containing 10 mM glutathione three times. 30 μl of each first fraction eluted with glutathione was added to SDS-PAG.
It was subjected to E and dyed with silver. The results were as shown in FIG. In addition, when the N-terminal region of PKN consisting of the amino acid sequences 7 to 540 of SEQ ID NO: 1 was expressed as an MBP fusion protein and the same experiment as above was carried out, the same result was obtained.

(2) Binding of PKN to activated RhoA protein in COS7 cells For the complex formation assay in COS7 cells (ATCC CRL 1651), Mukai, H. & Ono.Y, Bioche.
m.Biophys.Res.Commun.199,897-904 (1994), pMh-PKN7 and pTB701-HA.
-RhoA or pTB701-HA-RhoA
^Val14 was transfected into COS7 cells. After 48 hours, the cells were collected, and a buffer for homogenization (30 mM Tris / HCl (pH 7.5),
0.5 mM Na ₃ VO ₄ , 5 mM NaF, 2.5 μ
g / ml leupeptin, 0.05% NP-40,
After suspension in 0.05 M NaCl), homogenization was performed using a Dounce homogenizer. Immunoprecipitation was performed using anti-HA antibody from each cytoplasmic extract.

To determine if PKN or RhoA protein was present in the immunoprecipitates, the washed immunoprecipitates and cytoplasmic extracts were subjected to SDS-PAG.
The cells were subjected to E and immunoblotted with anti-PKN antibody or anti-HA antibody. The results were as shown in FIG.

(3) Promotion of PKN autophosphorylation reaction by LPA Swiss 3T3 cells were cultured in a 35 mm dish,
Labeled with 5 mCi of ³² P or thiophosphate for 2 hours. Swiss 3T3 cells labeled with ³² P were LPA
(200 ng / ml) for 10 minutes. Rh
Clostridium botulinum C3, a selective inhibitor of o protein
To study the effects of enzymes, Kumagai, K. et al. J. Bio
I. Chem. 268, 24535-24538 (1993) and treated with Clostridium botulinum C3 enzyme (10 μg / ml). The cells were then lysed and immunoprecipitated with anti-PKN antibody. The washed immunoprecipitates were subjected to SDS-PAGE and autoradiographed. The results were as shown in FIG. That is, LAP is PK in Swiss 3T3 cells.
It promoted N autophosphorylation approximately 2-fold, while this autophosphorylation was suppressed by the Clostridium botulinum C3 enzyme. The results shown are representative of 3 independent experiments.

Example 5 Yeast two hybrid cis
Measurement of binding between Rho protein and PKN by TEM according to the method described in AB Vojetk et al. Cell 74,205-214 (1993), wild-type H-Ras, CAX CAAX structure (S.Ando et al. 11,1973-1980 (1993)), wild-type RhoA and mutant RhoA ^Val14
The cDNA fragment was cloned into the pBTM116 vector (above ABVo
jetk et al) and Lex
Vectors for expressing A in yeast cells as fusion proteins (respectively pBTM116-RasWT,
pBTM116-RhoWT, pBTM116-RhoWT
^Val14 ) was constructed, and yeast (L
(40 strains).

CDNA of the N-terminal region of PKN (sequences 7 to 155 of the amino acid sequence set forth in SEQ ID NO: 1)
Was introduced into the BamHI site of a pACT vector (MATCHMAKER library kit manufactured by Clontech) to express this and GAL4 as a fusion protein in yeast cells (pACTIIHK-
PKN-N) was constructed. PKN used at this time
The cDNA fragment corresponding to the N-terminal region of was obtained according to the method described in Example 1 (1).

PBTM116-RasWT, pBTM1
16-RhoWT, pBTM116-Rho ^Val14
Yeast transformed with pACTIIHK-PK
Transformed with NN. Transformants were selected for histidine requirement (ABVojetk et al Cell 74,205-214).
(1993)).

As a result, as shown in FIG. 9, the N-terminal region of PKN (amino acid sequence Nos. 7 to 155) was found to bind to both wild-type RhoA and mutant RhoA ^Val14 .

Example 6 Yeast two hybrid cis
Isolation of PKN-Binding Proteins Using the Yeast Two-Hybrid System to Identify Proteins That Bind the N-Terminal Region of Human PKN. As the chimeric protein, one containing the DNA binding domain of GAL4 protein fused to the N-terminal region of human PKN was used. That is, 1 to 5 of SEQ ID NO: 1
40th amino acid sequence (this region is referred to as "PKNN1"
EcoRI / BamHI fragment encoding the vector pGBT9 (Clontech Laboratories
Company). This vector was obtained by clipping a fusion protein of the DNA binding domain of Gal4 (amino acid Nos. 1 to 147) and the N-terminal regulatory region of PKN.
It is expressed by the H promoter. This plasmid carrying the TRP1 marker was cloned into a human brain cDNA library (Clontech Laboratories; each plasmid was LEU2).
With the yeast strain YGH1 (a, ur
a3-52, his3-200, ade2-101, lys2-801, trp1-901, le
u2-3, Can ^r , gal4-542, gal80-538, LYS2 :: galI _uas
-galI _tata -HIS3, URA3 :: galI-lacZ). The transformant was inoculated on a yeast dropout medium containing 10 mM 3-amino-1,2,4, triazole (3-AT) without containing leucine, tryptophan and histidine.

About 1 × 10 ⁶ transformants were analyzed.
After 7-14 days of growth, HIS + colonies were examined for β-galactosidase activity as follows. Colonies (or patches derived from positive colonies) were directly plated onto Hybond-N nylon membrane (Amersh).
Am) and quickly frozen in liquid nitrogen (about 40 seconds), and immediately β-galactosidase assay buffer (60 mM Na ₂ HPO ₄ , 60 mM NaH).
PO ₄ , 10 mM KCl, 1 mM MgSO ₄ , 5 m
M DTT, 0.01% 5-bromo-4-chloro-3
-Indolyl-β-D-galactopyranoside (X-ga
l)) Whatman presoaked in
Placed on a 3MM filter. The filter was placed in a dish and incubated at 30 ° C. Plasmid DN
A was recovered from positive colonies and introduced into E. coli HB101 strain by electroporation. The major positive clone is Gal4 DNA binding domain-PKN.
Alternatively, the original yeast host strain was retransfected in combination with Gal4 DNA binding domain-p53 tumor suppressor protein. Library plasmids that expressed the marker only in the presence of PKN were further analyzed. DN
16 different cDNAs as determined by A sequence analysis
82 plasmids containing A were isolated. Nucleotide sequence analysis revealed that one of these cDNAs encoded the head-rod domain of the NFL protein.

Example 7 Yeast Two Hybrid Cis
Measurement of the binding between PKN and various NF fragments using a system.
B. et al., Cell, 74, 205-214 (1993)) (pGBT9
) -PKN and pVP16 (Vojtek, A.
B. et al., Cell, 74, 205-214 (1993)) (pGAD1
L instead of 0) -NF, or vice versa, L
It was examined by measuring the lacZ expression ability in 40 cells. As a result, as described below, the N-terminal region of PKN is associated with each subunit of NF (NFL, NFM, NF).
It was revealed that it binds to the head / rod domain region of H). The structure of the fusion gene of each subunit of NF used by the present inventors was as shown in FIG.

The yeast expression vector was prepared as follows. VP16 transcriptional activation domain-human NFL head / rod domain yeast expression vector pVP / NFL #
21 is the Eco plasmid of library plasmid # 21 that was first isolated by the two-hybrid screen.
RI insert (amino acid number 1 to 349) was added to pVP1.
6 (Vojtek, AB et al., Cell, 74, 205-214 (199
3)) was subcloned into.
VP16 Transcriptional Activation Domain-NFL and NFH Tail Domains, or VP16 Transcriptional Activation Domain-N
Yeast expression vectors for FM head / rod and tail domains are pGST / NFLt and pGST, respectively.
/ NFHt, pGST / NFMhr or pGST /
The BamHI / NotI insert of NFMt (described in Example 8) was constructed by in-frame subcloning into pVP16 (respectively pVP / NF).
Lt, pVP / NFHt, pVP / NFMhr, pVP
/ NFMt). The expression vector pVP / NFHf for the VP16-full length NFH fusion protein is pBlue.
A plasmid containing the full length coding region of NFH in the script II SK vector (Stratagene), pBH, was digested with BglII, and the full length cDNA insert was pVP.
Subcloned into 16. Vector for expression of VP16-NFH head / rod domain fusion protein pVP /
NFHhr converts pVP / NFHf to Tth111I and E
After digestion with coRI, the ends were filled in with T4 DNA polymerase, and these were ligated with T4 DNA ligase to prepare them. This operation removed the C-terminus of the DNA sequence at the Tth111I site, which encodes the tail domain of NFH. LexA DNA binding domain-NF
Vector for yeast expression of L head / rod domain or LexA DNA binding domain-NFL tail domain pBTM / NFL # 21 or pBTM / NFLt
Replaces pVP16 with pBTM116 (Vojtek, A.
B. et al., Cell, 74, 205-214 (1993)) was used, and prepared in the same manner as above. LexA- or VP16-PKNN1 expression vector pBTM / or pVP / PKNN1 is EcoRI / of human PKN /
BamHI fragment (corresponding to amino acid sequence 1 to 540 of SEQ ID NO: 1) was added to pBTM116 or pVP1.
6 was subcloned and constructed. LexA- or VP16-PKNC terminal region (511-9 of SEQ ID NO: 1)
The 42nd amino acid sequence, this region is referred to as "PKNC
1 ") expression vector pBTM / or pVP /
PKNC1 was constructed by subcloning the ClaI / EcoRI fragment of human PKN into pBTM116 or pVP16.

FIG. 11A shows the N-terminal region of PKN and the N-terminal region.
It shows specific binding between the head and rod domains of FL. To examine whether the N-terminal region of PKN binds to NFM or NFH in the same manner as NFL, the region corresponding to the head / rod domain of NFM and NFH was p-typed.
It was ligated to VP16 and lacZ expression was measured with the two hybrid system. As a result, N of PKN
The terminal region bound to each head / rod domain of the NF subunit (FIG. 11 (B)). Furthermore, in the two-hybrid system, it also bound to the head-rod domain of vimentin, which is a member of intermediate filaments that is universally expressed in various tissues (data not shown).

Example 8 In Vitro Translated PKN
And GST-NF subunit fusion proteins
In order to further investigate the binding between PKN and NF, the present inventors also analyzed PKN prepared by in vitro translation according to the method described below, using GST-NF.
Tested in an in vitro binding assay for binding to L, GST-NFM, GST-NFH, or GST.

(1) Preparation of PKN by In Vitro Translation A partial human PKN for in vitro transcription was prepared as follows; the N-terminal region of PKN (amino acid sequence from 1 to 474 of SEQ ID NO: 1, this region is The expression vector pPKNN2 (referred to as "PKNN2") is phPKN-H4.
(The human PKN in pBluescript II SK
Plasmid containing cDNA (Mukai, H. & Ono, Y., B
iochem. Biophys. Res. Commun. 199, 897-904 (199
4)) was digested with BstEII, the ends were filled in with T4 DNA polymerase, and self fly gated. By doing so, the BstEII site (start A
The C-terminal amino acid sequence downstream (1425 nucleotides from the TG codon) was removed and a stop codon was placed within the plasmid sequence. A fragment encoding the amino acid sequence of positions 614 to 942 of SEQ ID NO: 1 (this region is hereinafter referred to as “PKNC2”) retaining the catalytic domain of human PKN was prepared by PCR amplification. The expression vector pPKNC2 is a PCR-amplified fragment of pRc / C.
It was prepared by subcloning into MV (Invitrogen). These plasmids were linearized by cutting with XbaI and using T7 RNA polymerase to c
RNA was transcribed. For NFL, pBL (Nakagaw
a, T. et al., J. Cell. Biol. 129, 411-429 (199
5)) was cut with HindIII and linearized, and T3 RN
CRNA was transcribed using A polymerase. For in vitro translation, these cRNAs were isolated from rabbit erythroblast lysate (Promega) in the presence of [ ³⁵ S] methionine.
Company).

(2) Preparation of GST fusion protein GST-NFL # 21 (amino acid sequence 1 to 349 of human NFL) expression vector pGST / NFL # 21
PG the EcoRI insert in plasmid # 21.
EX4T vector (Pharmacia Biotec)
h company). GST-NFLdelA (1-175 of human NFL
No. and 335-349 amino acid sequence) The expression vector pGST / NFLdelA is pGST / NFL #.
21 was digested with PstI to remove the 480 bp fragment and self-gated with T4 DNA ligase. GST-NFLdelB (24 of human NFL
5th-349th amino acid sequence) Expression vector pGST
/ NFLdelB is Bgl of pGST / NFL # 21
The II / EcoRI fragment was made by subcloning into the pGEX4T vector. GS
The vector pGST / NFLt for expressing the T-NFL tail domain fusion protein has a Kp of about 700 bp of pBL.
The nI-EcoRI fragment was generated by subcloning into the pGEX4T vector. GS
T-NFM head / rod domain (1 to 1 of human NFM)
411 amino acids) fusion protein expression vector pGS
T / NFMhr was generated by PCR amplification from a human hippocampus cDNA library and subcloning it into the pGEX4T vector. GST-Full length N
The FL expression vector pGST / NFLf is the B of pBL.
The amHI / EcoRI insert was constructed by subcloning into the pGEX4T vector.
GST-NFM tail domain fusion protein expression vector pGST / NFMt is pBM (Nakagawa, T.
et al., J. Cell. Biol. 129, 411-429 (1995)), and a XhoI-NotI fragment of about 1.0 kbp,
It was constructed by subcloning into the pGEX4T vector. Vector for expressing GST-full length NFH fusion protein pGST / NFHf is pBH (Nakagaw
a, T. et al., J. Cell. Biol. 129, 411-429 (199
5)) was digested with BglII and the insert fragment was digested with pGEX.
Subcloned into the 4T BamHI restriction site.
The vector pGST / NFHhr for expressing GST-NFH head / rod domain fusion protein is pGST / N.
FHf was digested with Tth111I and EcoRI and the ends were filled in with T4 DNA polymerase.
4 by ligating them together with DNA ligase. Thus, the C-terminal DNA after the Tth111I site in the tail domain of NFH
The sequence was removed. The vector for expressing GST-NFH tail domain fusion protein pGST / NFHt is pBH
Was digested with Tth111I and BglII, and a fragment of about 2 kbp with the ends filled in was digested with pGE.
It was made by subcloning into X4T.

Expression of GST or GST fusion proteins was induced with 0.1 mM IPTG. 5, cells
Centrifuge at 000 xg for 5 minutes and pellet the resulting pellet to 1%.
Triton X-100 with or without 1 M urea in GST lysis buffer (50 mM Tris / HCl,
Resuspended in pH 8.0, 1 mM EDTA, 1 μg / ml leupeptin, 1 mM DTT, 1 mM PMSF). The cells were lysed by sonication. The cell debris was removed by centrifugation (30,000 xg for 10 minutes), and the supernatant was added to glutathione-Sepharose 4B (Pharmacia B).
iotech). Sepharose 4B has 4
The column was washed with 0 column volume of GST lysis buffer. GS
T and GST fusion proteins are GST elution buffer (100 mM Tris / H with or without 1 M urea).
Cl, pH 8.0, 20 mM glutathione, 120 m
M NaCl, 1 mM EDTA, 1 mM DTT, 1
μg / ml leupeptin). The eluate is 1
mM EDTA, 1 mM DTT and 0.1 μg / ml
10 mM Tris / HCl containing leupeptin (pH
It was dialyzed overnight at 8.8).

(3) In vitro binding experiment For in vitro NF binding experiment, 2.5 μl of PKNN2 or PKNC2 prepared by in vitro translation was added to 400 μl of GST binding buffer (20 m).
M Tris / HCl, pH 7.5, 0.5 mM DT
T, 150 mM NaCl, 0.05% Triton-X10
GST-NF fusion protein (5 μg each) in 0, 1 mM EDTA, 1 μg / ml leupeptin), or G
Mix with ST (25 μg) and incubate at 4 ° C. for 1 hour. Then, to prevent nonspecific binding, 10
25 μl of glutathione-Sepharose 4B pre-treated with mg / ml of E. coli extract was added, and then the binding reaction was carried out while rotating at 4 ° C. for another 30 minutes. Next, glutathione-Sepharose 4B was added to 0.5M NaCl.
And GST wash buffer containing 20% Triton-X100 (20 mM Tris / HCl, pH 7.5, 0.5 m
(MDTT, 1 mM EDTA, 1 μg / ml leupeptin) three times and then further washed with GST wash buffer. Bound proteins were eluted with GST elution buffer to 1
0% SDS-PAGE electrophoresis was performed. The binding reaction is
It was quantified with a FUJI BAS1000 bioimaging analyzer.

The results are shown in FIG. 12. In the in vitro binding assay, the N-terminal region of PKN binds to the head-rod domain of NFL, but the C-terminal catalytic domain of PKN binds to the head-rod domain of NFL. Was hardly observed. The binding ability between PKN translated in vitro and each subunit fusion protein of GST-NF was also examined. As a result, it was found that PKN directly binds to each subunit of NF in the head / rod domain in vitro (Fig. 13).

As shown in Examples 4 and 5, Rho
The protein is the N-terminal region of PKN (7-1 of SEQ ID NO: 1).
55 amino acid sequence). On the other hand, the head lod domain of NF is the N-terminal regulatory region of PKN (SEQ ID NO: 1).
~ 540 or 1-474). So N
It is possible that the F head-rod domain competes with the Rho protein for binding to the Rho protein binding domain of PKN. To investigate this, an in vitro binding assay examined whether the RhoA protein and NFL competed with each other for binding to the N-terminal region of PKN (amino acid sequence 1 to 540 of SEQ ID NO: 1). As a result, bacterially synthesized NFL did not compete with bacterially synthesized RhoA protein for binding to the N-terminal region of PKN (data not shown). From this, the NF binding region in the N-terminal regulatory region of PKN is the Rho protein binding region (amino acid sequence of 33 to 111 of SEQ ID NO: 1) (Example 1
It was revealed that it exists in a region different from 6). That is, the NF binding region is SEQ ID NO: 1 to 32 or 11 or 11.
It was presumed to be contained in the amino acid sequence of Nos. 2 to 540.
Furthermore, since the amino acid sequences of SEQ ID NOs: 1 to 474 also bind to NF as described above, the NF binding region was presumed to be included in the amino acid sequences of 1 to 32 or 112 to 474 of SEQ ID NO: 1.

Example 9 Phosphorylation of NF by PKN (1) Phosphorylation of natural NF by PKN In order to examine the phosphorylation ability of each subunit of NF by PKN, NF was purified from spinal cord and in vitro by PKN. It was subjected to phosphorylation reaction. The preparation of natural NF from bovine spinal cord is described by Hisanaga, S. & Hirokawa, N., J. Mol.
It carried out according to the method described in Biol. 202, 297-305 (1988). The kinase assay was performed according to the method described below.

Soluble cytosolic extract or purified NF of spinal cord
The protein was boiled for 5 minutes to inactivate the endogenous protein kinase activity and then used as a phosphorylated substrate. The phosphorylation reaction of NF is 20 mM Tris / HC
1, pH 7.5, 8 mM MgCl ₂ , 100 μM A
TP, 185 kBq [γ- ³² P] ATP, NF each subunit, 20 ng / ml purified PKN from rat testis, 40 μM arachidonic acid in assay mixture with or without each experiment at 30 ° C. Was carried out as indicated by. The reaction is terminated at various reaction times by adding an equal volume of Laemli's sample buffer,
Separated by 7% SDS-PAGE. The gel was dried under vacuum and then run on a BAS1000 Bioimaging Analyzer. The dephosphorylation of NF protein was carried out using calf intestinal alkaline phosphatase by Carden, MJ et al.
al., J. Biol. Chem. 260, 9805-9817 (1985), followed by boiling for 5 minutes to stop the enzymatic reaction. The results were as shown in Figures 14-18. PKN efficiently phosphorylated all three NF subunits.

The initial rate of phosphorylation of each subunit by PKN was approximately 5 to 10 times higher in the presence of arachidonic acid than in the absence (FIG. 14). Further, in the presence of arachidonic acid, the uptake of phosphoric acid into the NF subunit reached the maximum value about 60 minutes after the start of the reaction, and continued in a plateau state until 120 minutes thereafter (FIGS. 15 and 16). Although the purified PKN was unstable in the diluted state, the phosphorylation level was not significantly reduced from 60 minutes to 120 minutes in the absence of arachidonic acid (data not shown), and thus the decrease in the phosphorylation rate was lower than that of PKN. It did not seem to be due to inactivation. Predicted by image quant in this experiment, PKN per mol of protein subunit
The maximum degree of phosphorylation by each is about 2 mol / N
FH 1 mol, about 6 mol / NFM 1 mol and about 1
It was mol / NFL 1 mol. NFH, which has been reported to be the most strongly radiolabeled subunit in vivo, is (Sihag, RK & Nixon, RA, J. Biol. Ch.
em. 264, 457-464 (1989)), NFM in vitro.
It was inferior as a substrate.

Since NFH and NFM were already partially phosphorylated in this assay, it is possible that PKN phosphorylated sites were masked. Therefore, enzymatically dephosphorylated NF was used to examine the presence of other phosphorylated sites. As shown in FIG. 15, NF
Electrophoretic mobility was changed with dephosphorylation of H and NFM (Carden, MJ et al., J. Biol. Chem. 260, 98).
05-9817 (1985)). Bovine N with alkaline phosphatase
No significant difference was observed in the phosphorylation of NFH and NFM subunits by PKN even after dephosphorylation of F, suggesting that natural NF contains a site susceptible to phosphorylation by PKN. (FIGS. 15 and 16).

(2) Phosphorylation of recombinant NF by PKN In order to identify the region containing the phosphorylation site of NF by PKN, the head / rod domain of each subunit of GST-NF synthesized in bacteria and The tail domain was prepared (Example 8) and subjected to an in vitro phosphorylation assay according to the method described above. As a result, as shown in FIG. 17, ³² P was incorporated into the head-rod domain of each GST-NF at a ratio of 3: 10: 2 with respect to NFH: NFM: NFL. The tail domain of GST-each subunit was not labeled at all. PKN also phosphorylated the head-rod domain of GST-vimentin (data not shown). This result shows that the phosphorylated site is the head of these intermediate filaments.
It is shown to exist in the rod domain.

Example 10 In vitro NFL filters
Effect of phosphorylation on Lament structure (polymerization) It is widely accepted that NFL subunits form the "core" of NF, with NFL first associating and then NFM and NFH subunits co-associating. Alternatively, it has been suggested to supply the backbone and signals for polymerization. Phosphorylation of NFL by PKA and PKC
It has been shown in vitro to inhibit NFL polymerization and depolymerize filaments (Gonda, Y. et al., Bioc.
hem. Biophys. Res. Commun. 167, 1316-1325 (1990);
Nakamura, Y. et al., Biochem.Biophys. Res. Commu
n. 169, 744-750 (1990); Hisanaga, S. & Hirokawa,
N., J. Mol. Biol. 211, 871-882 (1990)). Therefore, it was confirmed by in vitro binding analysis whether NFL was polymerized.

Head-rod domain of bacterially produced GST-NFL or GST-full length NFL fusion protein was prepared by in vitro translation together with [ ³⁵ S] -labeled NFL and 1 mM MgCl 2.
_The mixture was mixed in a buffer solution containing _{2 and} having a pH of 8.5, and then the pH of the reaction mixture was adjusted to 7.2, followed by incubation at 35 ° C. for 1 hour. After extensive washing, the protein bound to the beads was analyzed by autoradiography. As a result, as shown in FIG. 18, NFL polymerization was detected (lanes 6 and 8).

Next, in this assay system, NF by PKN was used.
It was investigated whether phosphorylation of L inhibits NFL polymerization. GST-NFL head / rod domain or G
After phosphorylating ST-full length NFL with PKN, it was added to the reaction mixture and mixed with NFL prepared by in vitro translation. A more specific method is as described below.

For in vitro NF polymerization experiments, 5 μg each of phosphorylated or non-phosphorylated protein of bacterially synthesized GST-NFL and GST-NFL # 21 was added to 1 mM.
It was prepared by incubation for 2 hours at 30 ° C. in the presence or absence of MgCl ₂ , 60 ng PKN and 100 μM ATP. NFL produced by in vitro translation was a depolymerization buffer containing 1 mM MgCl ₂ (20 mM Tris / HCl, pH 8.5, 1 m).
M DTT, 1 μg / ml leupeptin) and incubated with the above mixture or 25 μg GST,
Then, the pH of the reaction mixture was adjusted to 7.2 by adding an appropriate amount of 1M PIPES (pH 6.8), and the mixture was incubated at 35 ° C. for 1 hour. It was then pretreated with 10 mg / ml E. coli extract to inhibit non-specific binding.
5 μl of glutathione-Sepharose 4B was added, after which the binding reaction was carried out at 4 ° C. for 30 minutes with rotation. Glutathione-Sepharose 4B was then washed twice in depolymerization buffer containing 0.5% Triton-X100,
Further, it was washed with a depolymerization buffer. GST binding protein
Elute with elution buffer and run on 10% SDS-PAGE. The binding reaction was quantified with a FUJI BAS1000 bioimaging analyzer. As shown in FIG. 18, as a result of phosphorylation by PKN, almost no binding between the head-rod domain of GST-NFL or GST-full length NFL and in vitro translated NFL was detected (lanes 7 and 9). This showed that phosphorylation of NFL by PKN inhibited NFL polymerization.

Example 11 Yeast Two Hybrid Si
Stem-based PKN amino-terminal region and carboxyl terminal
Detection of Binding to Edge Regions To investigate the possibility that the catalytic regions are masked by regulatory regions (catalytic and regulatory regions bind), a yeast two hybrid assay was performed. The construction of the two-hybrid system for this purpose was carried out as described below.

A plasmid pBTM / PKN-N for expressing a fusion protein of the DNA binding region of LexA and the amino terminal region of PKN (amino acid sequence of 1 to 540 of SEQ ID NO: 1) is Ec of human PKN cDNA.
The oR1 / BamH1 fragment was inserted into pBTM116 (Wa
tanabe, G. et al., Science 271, 645-648 (1996)). VP16
The plasmid pVP / PKN-N for expressing a fusion protein of the transcriptional activation region of Escherichia coli and the amino terminal region of PKN (amino acid sequence 1 to 540 of SEQ ID NO: 1) is an EcoR1 / BamH1 fragment of human PKN.
P16 (Vojetk, AB et al., Cell, 74, 205-214 (1
It was constructed by subcloning into 993)).
pBTM / PKN-C and pVP / PKN-C are the carboxyl terminal region of human PKN (511 of SEQ ID NO: 1).
~ 942 amino acid sequence)
The ClaI / EcoRI fragment of the cDNA was constructed by subcloning into pBTM116 and pVP16, respectively. Lex in yeast L40 cells
A plasmid (pBTM / PKN-N) encoding a fusion protein of the A DNA binding domain and a PKN partial fragment.
Or an expression plasmid (pVP / PKN-N or pVP / which encodes a fusion protein of pBTM / PKN-C), a VP16 transcription activation domain and a PKN partial fragment.
PKN-C) was co-transfected. Binding was detected by measuring β-galactoside activity by the filter lift assay (Fields, S. & Son.
g, O., Nature 340, 245-246 (1989)).

As a result, as shown in FIG. 19, a vector expressing the amino terminal region of PKN (pBTM / PKN-
N or pVP / PKN-N) and a vector expressing the carboxyl terminal region (pVP / PKN-C or pBT)
It was confirmed that β-glucosidase was expressed in yeast cells co-transfected with M / PKN-C) (4) and 5) in FIG. That is, it was shown that the regulatory region (amino terminal region) of PKN and the catalytic region (carboxyl terminal region) bind to each other.

Example 12 Modulation of PKN in vitro
Area (amino terminal area) and catalytic area (carboxyl terminal area)
Detection of binding of the region) In order to confirm that the regulatory region (amino terminal region) of PKN and the catalytic region (carboxyl terminal region) are bound,
An in vitro binding assay was performed using the GST fusion protein and the in vitro translated ³⁵ S-labeled protein according to the method described below.

(1) In Vitro Transcription and Translation Human PKN partial fragment was prepared as follows. Expression vector pPKN-N corresponding to the amino terminal region was added to phP
KN-H4 (human PKN cDNA inserted into pBluescript IISK) (Mukai, H. & Ono, Y.,
Biochem. Biophys. Res. Commun., 199, 897-904 (199
4)) was digested with BstEII, both ends were filled in with T4 DNA polymerase, and self-ligation was performed. The resulting plasmid encodes amino acid residues 1-474 of SEQ ID NO: 1.
A cDNA insert was excised from this plasmid to obtain pR
It was cloned into c / CMV (Invitrogen). 614 to SEQ ID NO: 1 containing the catalytic region of human PKN
A fragment encoding the amino acid sequence of 942 was prepared by PCR amplification method. The expression vector pPKN-C containing the carboxyl terminal region of PKN was prepared by using this fragment as pRc /
It was prepared by subcloning into CMV.
These plasmids were linearized by cutting with XbaI and the cRNA was transcribed using T7 RNA polymerase. The cRNA was translated in a chicken erythroblast lysate (Promega) in the presence of [ ³⁵ S] methionine.

(2) Preparation of GST fusion protein The amino terminal regions of GST and PKN (1-5 of SEQ ID NO: 1)
PGST / PKN-N for expressing a fusion protein with the 40th amino acid sequence) was prepared by subcloning the BamH1 insert of phPKN-H4 into pGEX4T (Pharmacia Biotech). PGST / PKN-C for expressing a fusion protein of GST and the carboxyl terminal region of PKN (amino acid sequence of 634 to 942 of SEQ ID NO: 1) is p
It was generated by subcloning the EcoRI insert of hPKN-H4 into the pGEX4T vector.
Expression of GST or GST fusion protein is 0.1 mM
It was induced with IPTG. Cells were centrifuged at 5,000 xg for 5 minutes and the resulting pellet was washed with 1% Triton X-10.
0 containing GST lysis buffer [50 mM Tri
s / HCl (pH 8.0), 1 mM EDTA, 1 μg
/ Ml leupeptin, 1 mM DTT, 1 mM PM
SF] was resuspended. The cells were lysed by sonication. Cell debris was removed by centrifugation at 30,000 xg for 10 minutes and the supernatant glutathione-
Sepharose 4B (Pharmacia Biotech) was added. The resin was washed with 40 column volumes of GST lysis buffer. GST and GST fusion proteins were added to GST elution buffer [100 mM Tr
is / HCl (pH 8.0), 20 mM glutathione, 120 mM NaCl, 1 mM EDTA, 1 μg
/ Ml leupeptin, 1 mM DTT].
The eluate was diluted with 1 mM EDTA, 1 mM DTT and 0.
10 mM Tris containing 1 μg / ml leupeptin
Dialyzed against / HCl (pH 8.0) overnight.

(3) In vitro binding assay 2.5 μl of in vitro translated PKN-N or PK
5 μg of GST-PKN-N or GST-N-C
PKN-C fusion protein or 25 μg GST alone and 400 μl GST binding buffer [20 mM T
ris / HCl (pH 7.5), 0.5 mM DTT,
150 mM NaCl, 0.05% Triton X-10
0, 1 mM EDTA, 1 μg / ml leupeptin]
Mix in and incubate at 4 ° C. for 1 hour. Then, glutathione-Sepharose 4B (25 μl) pre-treated with 10 mg / ml E. coli extract to inhibit non-specific binding was added and the binding mixture was further incubated at 4 ° C. for 3 hours.
Rotated for 0 minutes. Glutathione-Sepharose 4B was then added to GST wash buffer [20 m containing 0.5 M NaCl and 0.5% Triton X-100.
M Tris / HCl (pH 7.5), 0.5 mM D
TT, 1 mM EDTA, 1 μg / ml leupeptin]. Then, the bound protein is
Elute with ST elution buffer and subject to 10% SDS.
The quantification of the binding reaction was performed using a BAS1000 bio-imaging analyzer (FUJI).

As a result, the binding between the regulatory region (amino terminal region) of PKN and the catalytic region (carboxyl terminal region) was:
It was also confirmed by an in vitro binding assay using the GST fusion protein and the in vitro translated ³⁵ S-labeled protein (FIG. 20, lanes 6 and 8).
From the above results, it was shown that the regulatory region at the amino terminal of PKN is directly bound to the catalytic region at the carboxyl terminal.

Example 13 PKN [Ser ⁴⁶ ]
Phosphorylation of PKN (39-53) peptide Using an automated peptide synthesizer (Applied Biosystems, model 403A), [Ser ⁴⁶ ] PKN
A (39-53) peptide (corresponding to the amino acid sequence of amino acids 39 to 53 of SEQ ID NO: 1, but having Ile substituted by Ser; RERLRRRESRKELKLK) was synthesized,
It was investigated whether PKN phosphorylates this peptide.

The kinase assay was performed by the method described below. Purified PKN from rat testis cytoplasm
(Kitagawa, M. et al., Biochem. J., 310, 657-664
(1995)) 1 ng to 50 mM Tris / HCl (pH
7.5), 8 mM MgCl ₂ , 20 μM ATP, 1
The cells were incubated at 30 ° C. for 5 minutes in a reaction solution (final volume 25 μl) containing 8.5 kBq of [γ- ³² P] ATP, 40 μM arachidonic acid, the phosphate receptor and the inhibitor shown in each experiment. The reaction was initiated by the addition of enzyme preparation, and the reaction mixture was immersed in 75 mM phosphate Whatman P.
81 Stopped by spotting on filter paper. Incorporation of ³² P into the phosphate receptor is associated with liquid scintillation
It was measured by counting. The result was as shown in FIG.

[Ser ⁴⁶ ] PKN (39-53) peptide functions as a substrate for PKN, and its Km value is about 25.
It was revealed that μM and Vmax were 400 nmoles / min / mg protein. In FIG. 21, a double reciprocal plot of the measured data is shown. Results are mean ± S.E. From 3 independent experiments performed in duplicate. E. FIG. It is.

Example 14 PKN Using Synthetic Peptide
Inhibition of protein kinase activity of PKN, as described in Examples 11 and 12, the amino-terminal region of PKN (SEQ ID NO: 1-540 or 1-474)
No. amino acid sequence, hereinafter also referred to as “regulatory region”) and carboxyl terminal region (511 to 9 of SEQ ID NO: 1)
42, 614 to 942 or 634 to 942 amino acid sequences (hereinafter sometimes referred to as "catalytic region") are bound, so that the regulatory region of PKN may contain a sequence that binds to the catalytic region. Was shown. In this example, this pseudo substrate-like sequence was synthesized, and the protein kinase inhibitory activity of this peptide was examined.

First, the following PKN substrate peptide and pseudo substrate-like peptide were respectively prepared in rat δPKC.
(Ono, Y. et al., J. Biol. Chem. 263, 6927-6932 (1
988)) and human PKN (Mukai, H. & Ono, Y., Bioch
em. Biophys. Res. Commun., 199, 897-904 (1994)) using an automatic peptide synthesizer (Applied Biosystems, model 403A): δPKC peptide (δPKC amino acid) 137
~ 153, but with Ala replaced by Ser; AMFPTMNRRGSIKQAKI); PKN
(39-53) peptide (corresponding to the amino acid sequence of Nos. 39 to 53 of SEQ ID NO: 1; RERLRREIRKELKL
K); PKN (54-73) peptide (5 of SEQ ID NO: 1)
Corresponds to amino acid sequence 4 to 73; EGAENLKKA
TTDLGKSLGPV).

The protein kinase assay was performed according to the method described in Example 13. However, PKN uses PKN (39-53) as a substrate with δPKC peptide as a substrate.
Peptide (Figure 22; black circle) or PKN (54-73)
Peptides (Fig. 22; open circles) were used as inhibitors for measurement. The concentration of δPKC peptide was the Km concentration of δPKC peptide (10 μM). Protein kinase reactions were performed in the presence of varying concentrations of PKN (39-53) or PKN (54-73) peptides.

Further, in order to determine the specificity of the action of the inhibitor peptide, a protein kinase assay was carried out using PKA as an enzyme preparation. The catalytic subunit of bovine heart PKA used in the experiment was Bechtel, PJ et a.
Purified according to the method described in I., J. Biol. Chem., 252, 2691-2697 (1977). The protein kinase activity of PKA was determined by Kemptide (Kemp, BE et al., J. Biol. Chem.,
252, 4888-4894 (1977)) was used as a substrate and contained no arachidonic acid, and was measured under the same conditions as described in Example 13. The concentration of Kemptide was determined as the Km concentration of Kemptide (16 μM), and PKN (39-53) peptide was used as an inhibitor (FIG. 22; white square). Kinase activity was determined according to the method described in Example 13.

As a result, the PKN (39-53) peptide inhibited the phosphorylation of the δPKC peptide in a concentration-dependent manner,
The IC50 (Km concentration of substrate peptide phosphorylation
Inhibitor peptide concentration required for 0% inhibition)
Was about 80 μM (FIG. 22; black circles).

In contrast, the PKN (54-73) peptide showed almost no inhibitory effect (FIG. 22; open circles). The specificity of the peptide was confirmed using another basic amino acid-requiring protein kinase (PKA). That is, the PKN (39-53) peptide is PKA
It has a weak inhibitory activity against
It was 000 μM or more (FIG. 22; white square). From the above results, it was shown that the PKN (39-53) peptide specifically inhibits the protein kinase activity of PKN. It was suggested that the PKN (39-53) peptide acts as a pseudo-substrate for PKN.

Example 15 PKN Protein Kinase
Effect of PKN (39-53) peptide on activity To confirm that PKN (39-53) acts as a pseudo-substrate for PKN, purified PKN was used to detect ATP.
The concentration was fixed at 100 μM and various concentrations (10-80 μM
Kinetic assays were performed using M) delta PKC peptides. The protein kinase reaction of PKN was carried out according to Examples 13 and 14. 40-80 μM
The results in the presence of the PKN (39-53) peptide of E. coli are shown in a double reciprocal plot in FIG. 23 (A). Inhibition occurs competitively-noncompetitively and results in Km / Vma
x (concentration required to give half-maximal velocity / maximal velocity) was a linear secondary plot with respect to the inhibitory peptide concentration (FIG. 23 (B)). Apparent inhibition constant (Ki) is Km for double reciprocal plot and inhibitor peptide concentration.
It was 41 μM, which was obtained from the linear secondary plot of / Vmax (FIG. 23 (B)). On the other hand, non-competitive inhibition plots were obtained with the inhibitor peptides at various ATP concentrations, indicating that inhibition does not occur at the ATP binding site (data not shown).

From the above results, it was shown that the PKN (39-53) peptide acts as an autoinhibitory sequence for this enzyme, and its inhibition is non-competitive with ATP.

Example 16 Yeast Two Hybrid Si
Detection of Rho protein binding region of PKN using stem
To further characterize the binding of the cord PKN to the RhoA protein, a yeast two-hybrid system was investigated. The N-terminal regulatory region of human PKN fused to the LexA DNA binding region was expressed in yeast strain L40 along with the RhoA protein or RhoA protein mutant fused to the VP16 activation region.

The scheme for constructing the fusion gene of the partial PKN cDNA used in the present invention is as shown in FIG.
CDNA fragments encoding human PKN of various lengths were
PBT together with the sequence of the upstream LexA DNA binding region
V in the M116 vector (Example 7) or upstream
Each was inserted in frame into the pVP16 vector (Example 7) together with the sequence of the P16 transcription activation region. Human RhoA, RhoA ^Val14 and RhoA
CDNA fragments encoding ^Ala37 were each treated with pG
EX-RhoA, pGEX-RhoA ^Val14 and pGEX-RhoA ^Ala37 (Example 1) were prepared by digestion with restriction enzymes and cloned into pBTM116 and pVP16.

Yeast L40 cells were transfected with the expression plasmid and plated on semi-solid medium lacking tryptophan and leucine. Binding was detected using a filter lift assay with β-galactosidase activity as an indicator according to the method described in Example 6. As a result, as shown in FIG. 24, β-galactosidase activity was PKN and RhoA ^Val14 (a mutant that does not show GTPase activity) (Ridley, AJ & Hall, A., Cell 70, 38.
9-399 (1992)).
However, transformants expressing PKN and wild type RhoA, and PKN and RhoA ^Ala37 (effector region mutants) (Examples 3 and 4, Paterson, HF et
al., J. Cell. Biol., 111, 1001-1007 (1990)).

Members of the Rho family have a CAAX motif (C is cysteine, A is an aliphatic amino acid, X is any amino acid) in the C-terminal region, and this region is characterized by geranylgeranylation, proteolysis and carboxylmethylation. It is known to undergo a series of post-translational modifications, which are believed to be important for targeting and activation of Rho proteins in the cell membrane (Katayama, M. et al., J. Biol. Chem.,
266, 12639-12 645 (1991), Adamson, P. et al., J.
Biol. Chem., 267, 20033-20038 (1992)). Therefore,
The presence of the CAAX motif in the RhoA fusion protein is expected to prevent the RhoA fusion protein from translocating efficiently into the nucleus, which may make it difficult to detect the binding between the RhoA fusion protein and the PKN fusion protein in the two-hybrid system. it was thought. Therefore, in order to suppress the binding between the RhoA fusion protein and the cell membrane and to efficiently transfer the RhoA fusion protein into the nucleus, Rho in which the lipid modification site at the C-terminal has been deleted
A mutant (hereinafter "CLVL ^-" represents a) it was carried out two hybrid system using. Human RhoA lacking the C-terminal lipid modification site (“RhoA CLV
L ^- cDNA corresponding to "hereinafter) was prepared by PCR, and inserted into pBTM116 and pVP16.

[0206] As a result, PKN is RhoA CLVL ^-
And RhoA ^Val14 CLVL ⁻ ,
It did not bind to RhoA ^Ala37 CLVL ⁻ . Similar results were observed with the combination of RhoA fused with LexA and PKN bound to VP16 (Fig. 2).
4). Thus, activated RhoA protein and PKN
The specific binding between and was reconfirmed by the two-hybrid system. It was also shown that the CAAX motif of the RhoA protein is not required for binding to PKN.

[0207] To identify RhoA protein binding region of PKN, plasmids expressing various portions PKN fragments ^RhoA Val14 CLVL ^- were together was transfected into yeast cells. As shown in FIG. 25,
In the two-hybrid system, RhoA
^Val14 CLVL ^- is SEQ ID NO: 1 to 538,
It was linked to the regions corresponding to the amino acid sequences of Nos. 3-135 and 33-111. From this result, it was shown that the Rho protein-binding region exists in the amino acid sequences 33 to 111 of SEQ ID NO: 1.

This region is the first leucine zipper-like motif of PKN (Mukai, H. et al., Biochem. Bioph.
ys. Res. Commun., 204, 348-356 (1994), Mukai, H. &
Ono, Y., Biochem. Biophys. Res. Commun., 199, 89
7-904 (1994)). Therefore, this motif is PK
It is speculated that it plays a role in the binding between N and RhoA.

Example 17 Rho Using Synthetic Peptides
Inhibition of Protein-PKN Binding Next, PKN and GTPγS.GST-RhoA prepared by in vitro translation (Example 1)
Binding to was determined in the presence of synthetic peptides corresponding to the various N-terminal regions of PKN according to the method described below.

According to the method described in Example 8,
A protein corresponding to the 1-474th amino acid sequence of SEQ ID NO: 1 was produced by in vitro translation. GTPγS or GDP / GST-RhoA
(15 nM) together with PKN (1.5 μl) prepared by in vitro translation for a total amount of 20
0 μl of binding buffer (20 mM Tris / HCl
(PH 7.5), 1 mM EDTA, 0.5 mM DT
T, 5 mM MgCl ₂ , 1 μg / ml leupeptin) for 60 minutes at 4 ° C. Then, glutathione sepharose 4B was pre-incubated in a binding buffer containing E. coli extract (10 mg / ml) to inhibit non-specific binding.
(Pharmacia Biotech) (40 μl) was added, and the mixture was rotated at 4 ° C. for 30 minutes. Unbound protein was washed with 0.2% Nonidet P-40 and 50m
It was removed by washing 4 times with a binding buffer containing M NaCl, and further washed twice with a binding buffer.
The specifically bound protein was eluted with a binding buffer containing 10 mM reduced glutathione and subjected to SDS-PAGE.
And gel was autoradiographed.

The synthetic peptide fragment expected as the RhoA protein binding region of PKN was synthesized using an automatic peptide synthesizer (Model 431, Applied Biosystems). Experiments with synthetic peptides were performed in 200 μl binding buffer with various concentrations of peptides.

As a result, as shown in FIG. 26, in the absence of the synthetic peptide, PKN prepared by in vitro translation was GTPγS.GST-R.
It bound specifically to hoA. The synthetic peptide fragments corresponding to the amino acid sequences 74 to 93 and 94 to 113 of SEQ ID NO: 1 inhibited the binding of PKN to GTPγS.RhoA in a concentration-dependent manner (FIG. 27). Inhibition was observed with peptides at concentrations above 30 μM and 100 μM, respectively (FIG. 27).

Furthermore, a synthetic peptide fragment corresponding to the amino acid sequence 82 to 103 of SEQ ID NO: 1 was also GTP of PKN.
Binding to γS GST-RhoA was inhibited in a concentration-dependent manner (Fig. 28). Inhibition was observed at a concentration of 3 μM or higher (FIG. 28). From the above results, 74- of SEQ ID NO: 1
Region corresponding to the 113th amino acid sequence, particularly 82-1
The region corresponding to amino acid sequence No. 03 was shown to play an important role in binding.

Example 18 Rho Protein GTPa
Effect of N-terminal region of PKN on se activity Activated Cdc42Hs-related kinase p120
Protein kinases that bind to active forms of low G proteins such as ^ACK and p21- (Cdc42 / Rac) activating kinase p65 ^PAK are
It is known to exist endogenously in proteins and inhibit GTPase activity that is stimulated by GAP and enhanced (Manser, E. et al., Nature, 367, 40-46 (1994), M
anser, E. et al., Nature, 363, 364-367 (1993)).
In order to examine whether the GTPase activity of RhoA is affected by the binding with PKN, [γ
^{- 32 P] GTP (1.11TBq /} mmol, DuPont
-New England Nuclear) loaded GST-Rh
The bound radioactivity of oA or GST-RhoA ^Val14 was measured in the presence or absence of PKN.

The vector for expressing the N-terminal region of human PKN fused to GST (GST-PKN) encodes the amino acid sequence of 1 to 538 of SEQ ID NO: 1 c
The DNA fragment was transferred to pGEX vector (Pharmacia Biotech
Company).
The GST fusion protein was expressed in E. coli according to the method described in Example 8 and purified by affinity chromatography using glutathione Sepharose 4B. MBP-PKN is Example 4
Prepared according to the method described in.

The assay for measuring endogenous GTPase activity was performed according to the method described below.
2 μM of purified GST-RhoA was added to 5 μM of [γ-
³² P] GTP (1.11 TBq / mmol) with 50 mM Tris / HCl (pH 7.5), 10 mM
EDTA, 1 mM MgCl ₂ , 50 mM NaC
1 in 1 mM DTT, 0.3% CHAPS, 30
Incubated at ° C. For the exchange reaction, transfer the reaction solution to ice and then use MgC to adjust the final concentration to 10 mM.
It was stopped by the addition of l _2. [Γ- ³² P] G
GST-RhoA or GST-Rh loaded with TP
oA ^Val14 (0.2 μM) was ^added with 10 nM GST-.
60 μl of hydrolysis buffer (50 mM in the presence or absence of PKN (amino acid residues 1-540)
Tris / HCl (pH 7.5), 5 mM MgC
l ₂ , 1 mM DTT, 1 mM GTP, 0.1 mg /
ml bovine serum albumin) at 30 ° C. The reaction was about 2 ml of ice-cold buffer (20 m
M Tris / HCl (pH 7.5), 100 mM N
aCl, 25 mM MgCl ₂ ) was added, followed by a nitrocellulose filter (Schleicher & Schuell).
It was stopped by rapid filtration with BA-85, 0.45 μm pore size). After washing the filter with the same ice-cold buffer three more times, the radioactivity collected on the filter was measured.

GAPas-stimulated RhoA GTPas
e activity is p122R fused to 50 nM GST
In the presence of hoGAP (GST-RhoGAP) and various concentrations of MBP-PKN, 100 μl of reaction mixture (20 mM Tris / HCl (pH 7.5), 10 m
M EDTA, 1 mM DTT, 10 mM MgC
l ₂ , 1 mM GTP, 0.075% CHAPS,
0.25 mM L-α-dimyristoylphosphatidylcholine, 100 nM [γ- ³² P] GTP-bound GS
T-RhoA) for 2 minutes at 25 ° C. [γ-
³² P] GTP • GST-RhoA was assayed by measuring the decrease in radioactivity (Homma, Y. & Emo
ri, Y., EMBO J. 14, 286-291 (1995)).

As a result, the half-life of GTP bound to RhoA was 12 minutes (FIG. 29) and that of RhoA ^Val14 was 100 minutes (data not shown). When a fusion protein of the amino acid sequence 1 to 538 of SEQ ID NO: 1 and GST was added, the half-life of GTP bound to RhoA was increased to 15 minutes or more.
No effect on the hydrolysis rate was observed. From these results, the endogenous G of RhoA is present in the N-terminal region of PKN.
It was shown that there is an activity that inhibits TPase activity. Also, the inhibition was dependent on PKN concentration (Fig. 3
0).

As shown in FIG. 31, MBP-PKN
Is a GST-stimulated by GST-RhoGAP
The GTPase activity of RhoA was inhibited in a concentration-dependent manner.
From this, it was shown that the N-terminal region of PKN binds to RhoA, thereby inhibiting the binding between GAP and RhoA.

From the above results, the N-terminal region of PKN is R
It was shown to bind to hoA and inhibit the GTPase activity intrinsic to the RhoA protein.
This also results in the Rho protein GTPas
It was revealed that the degree of binding between PKN and Rho protein can be measured by measuring e activity. Furthermore, it was shown that the GTPase activity can be more clearly measured by adding GAP of the Rho protein to the screening system.

Example 19 On intracellular distribution of PKN
Effect of heat shock (1): immunoblotting
Biochemical analysis used Polyclonal antiserum specifically reacting with PKN (αN
Immunoblotting with 2, αC6, and αF1) was performed to obtain NIH3T3, Rat-
1, and P in Balb / c3T3 cell lysates
The amount of KN was determined. Specifically, the method was performed according to the method described below.

NIH3T3 cells contained 10% bovine serum.
In Dulbecco's Modified Eagle Medium (DMEM)
I made it. Balb / c3T3 cells and Rat-1 cells
Cells are DME containing 10% fetal calf serum (FCS)
Proliferated in M. 5% CO _TwoHumidified containing 37
Incubate the cells in a chamber at
Experiments were performed using cells in fluent growth. This
Protein was extracted from these cells, and Kitagawa, M. et
 Those described in al., Biochem. J. 310, 657-664 (1995)
SDS-polyacrylamide gel electrophoresis according to the method
(PAGE) (Laemmli, U. K. Nature 227, 680-685 (1
970)) and immunoblot.

The polyclonal antiserum used for the immunoblot was prepared according to the following method. αN2 is 1 to 1 of rat PKN obtained by expressing it in E. coli.
It was prepared by immunizing rabbits with a fragment corresponding to number 391 (Mukai, H. et al., Biochem. Biophys. Re.
S. Commun. 204, 348-356 (1994)). αC6 is a fragment corresponding to amino acids 863-946 of rat PKN obtained by expression in Escherichia coli, and is described in Mukai, H. et al.
Prepared by immunizing rabbits according to the method described in al. (1994). αF1 was prepared using the entire coding region of rat PKN obtained by expression in Sf9 cells as an antigen (Mukai, H. & Ono,
Y., Biochem. Biophys. Res. Commun. 199, 897-904 (1
994)). Epitope-specific reactions of αN2, αC6, and αF1 were performed by immunoblotting using the amino- and carboxyl-terminal antigenic regions of PKN (supra).
Mukai, H. et al. (1994)). The blot was detected by the enhanced chemiluminescence method.

The results were as shown in FIG. That is, antiserum (αN2, αC6, and αF1) was
The PKNs derived from NIH3T3, Balb / c3T3 and Rat-1 cells cultured at 0 ° C were specifically recognized. Even when the cells were subjected to heat shock treatment (treatment at 42 ° C. for 90 minutes), there was no effect on the total amount of PKN in NIH3T3, Balb / c3T3, and Rat-1 cells (data not shown). Incidentally, the heat shock was carried out by transferring the replica dish of the cultured cells from the 37 ° C incubator containing 5% CO ₂ to the 42 ° C incubator. The culture time after the transfer was used as the heat treatment time.

Next, the effect of heat shock on the distribution of PKN in the cytosolic, plasma membrane and nuclear fractions was examined. The preparation of each cell fraction was performed according to the method described below. First, cells were collected, and 1 ml of buffer A (10 mM Tris-HCl was used.
(PH 7.5), 1 mM EGTA, 1 mM EDT
A, 5 mM MgCl ₂ , 1 mM phenylmethylsulfonylfluoride (PMSF), 1 μg / ml leupeptin) and suspended in a Dounce homogenizer for 30 strokes for homogenization. The amount of protein in the total cell homogenate was determined by the method of Peterson (Peterson, GL Anal. Bioc.
hem. 83,346-356 (1977)), an equal amount of protein was centrifuged at 500 xg for 7 minutes at 4 ° C to obtain a nuclear pellet and postnuclear fraction. The nuclear pellet was washed once with buffer A. The postnuclear fraction was further centrifuged at 100,000 × g for 1 hour at 4 ° C. to obtain cytosol (supernatant) and plasma membrane (pellet). These supernatant and pellet fractions were subjected to SDS-PAGE and immunoblot according to the method described above.

The results were as shown in FIG. That is, most of PKN was detected in the cytosolic fraction in the heat-shock-untreated cells, but PKN detected in the nuclear fraction was increased in the heat-treated cells, and it was detected in the cytosolic fraction. PKN has decreased. Further, no significant change was observed in the amount of PKN detected in the plasma membrane fraction even by heat treatment.

Example 20 On intracellular distribution of PKN
Effect of heat shock (2): Immunofluorescence staining
Cytobiological Analysis Next, the distribution of PKN immunofluorescence in NIH3T3 cells was examined by using antisera (αN2, αC6, and αF1). Immunofluorescence was performed according to the method described below.

Cells grown on coverslips were washed twice with phosphate buffered saline (PBS), fixed with 4% paraformaldehyde for 1 hour at 4 ° C., rinsed with PBS, then 5% normal goat serum. PBS-T containing
Blocked in (PBS containing 0.05% Triton X-100) for 1 hour. After washing with PBS, the cells were incubated overnight at 4 ° C. with an antiserum solution diluted with PBS to each antiserum concentration of about 10 μg / ml. Then, the cover glass was rinsed with PBS-T, and fluorescein isothiocyanate isomer I (FITC) was added.
Goat anti-rabbit IgG (Medical and biolog
ical laboratories) for 60 minutes. Coverslips were rinsed with PBS-T, then PBS, mounted with glycerol containing 0.1% 1,4-diazabicyclo (2,2,2) octane (DABCO) and observed with a Zeiss laser scanning microscope.

The results were as shown in FIG. That is, PKN was detected in the cytoplasmic region of untreated cells. Consistent with the immunoblotting results, a marked increase in PKN immunofluorescence was observed in the nucleus in heat shock cells. Incidentally, nonspecific fluorescence measured by incubation without primary antiserum was negligible (data not shown).

To investigate whether nuclear translocation is specific to PKN, protein phosphatase 2A (αPP2A)
Immunofluorescence was observed with an antiserum against. As a result, between heat shock cells and untreated cells, αPP
No difference was observed in the intracellular distribution of immunoreactivity of 2A. Therefore, it became clear that the nuclear translocation of PKN was not due to the nonspecific effect of the heat shock treatment. In FIG. 35, these phenomena are shown in Rat-1 cells and Ba.
It has been shown that similar observations were made in lb / c3T3 cells.

Next, it was examined whether the transfer of PKN to the nucleus by heat shock was reversible. After heat shocking the cells, the cells were cultured at 37 ° C. for 4 hours, and PKN immunofluorescence was redistributed into the perinuclear and cytoplasmic regions (FIGS. 34 and 35). From this, PKN
Was found to be reversible. In addition, it was observed using a confocal microscope that the immunofluorescence of PKN exists in the nucleus rather than the nuclear envelope in the heat shock-treated cells (FIG. 36).

Example 21 Sub-hidrosis to intracellular distribution of PKN
Effects of sodium phosphate, serum starvation and UV irradiation: cells
Biological study (1) Nuclear translocation of PKN by sodium arsenite treatment It was examined whether the intracellular distribution of PKN is affected by chemical shock. Toxic compounds and toxic heavy metals have also been shown to induce heat shock proteins and stress responses in experimental systems (Maytin, EV & Young, DA, J. Biol. Chem. 25.
8, 12718-12722 (1983)). A cellular response similar to heat shock-induced stress is also known to be produced by sodium arsenite treatment (Welch,
WJ & Suhan, JP, J. Cell Biol. 103, 2035-2052
(1986)). Therefore, Rat-1 cells were cultured by adding sodium arsenite to the medium, and the effect thereof was examined. As a result, induction of nuclear translocation of PKN was also observed by microscopic examination even by treatment with 50 μM sodium arsenite (FIG. 37). NIH3T3 cells and Balb / c3T
Similar results were obtained when 3 cells were treated with 80 μM sodium arsenite (data not shown).

(2) Nuclear translocation of PKN by serum starvation Furthermore, PK may also be induced by other stress such as serum starvation.
It was examined whether N nuclear translocation was induced. Serum starvation was performed by replacing the medium with serum free medium containing 1 mg / ml bovine serum albumin (lipid free).

As a result, even when NIH3T3 cells were serum-starved, PKN translocation to the nucleus was observed (FIG. 38). When 10% fetal calf serum was added thereafter, PKN gradually migrated to the cytoplasmic region. did. It took at least 4 hours for PKN to return to the intracellular distribution observed in the unstressed state (FIG. 38).

(3) Intracellular distribution of PKN by UV irradiation UV irradiation is another means for inducing stress in experiments, and the UV response of mammalian cells is AP-1 and NF-.
It has been characterized by a rapid and selective increase in gene expression mediated by κB (Devary, Y. et al., Sci.
ence 261, 1442-1445 (1993), and Devary, Y. et a.
l., Mol. Cell Biol. 11, 2804-2811 (1991)). At least part of the stress response to UV irradiation is JNK
/ SAPK subfamily and p38 / RK are known to be mediated (Davis, R. et al., TI.
BS 19, 470-473 (1994), and Cano, E. & Mahadeva
n, C., TIBS 20, 117-122 (1995)). Therefore, it was examined whether or not PKN nuclear translocation was also observed by UV irradiation. Ultraviolet irradiation was performed by treating the cells with UV-C, followed by incubation at 37 ° C for 1 hour (Adler, V. et al., J. Biol. Chem. 27.
0, 26071-26077 (1995)). As a result, 40 J / m2 of UV-C (Derijard, B.) which is sufficient for activation of JNK.
et al., Cell 76, 1025-1037 (1994)) in NIH3T3.
The cells were irradiated, but no PKN translocation was observed (data not shown).

Example 22 PKN Kinase Negative
Effect of overexpression of mutant protein In order to further analyze the change in the intracellular distribution of PKN induced by stress, the effect of overexpressing the PKN mutant was examined. A single point mutation in the kinase domain of human PKN (K644R; PKN-P
K ⁻ ) was used as a protein kinase negative mutant.

First, NIH3T3 cells stably overexpressing PKN-PK ^- were constructed according to the method described below. The lysine has been estimated that ATP binding site, by converting into arginine by in vitro site-directed mutagenesis, the vector phPKNH4-PK ^-.. Was constructed (Mukai, H. & Ono, Y. , Biochem Biophys Res .
Commun. 199, 897-904 (1994)). Vector for expression pMhPKN-PK ^- PKN-PK in mammalian cells ^-
Is a 2.9 kb cDNA obtained by partial digestion of phPKNH4-PK ^- with EcoRI to pTB701 (Ono,
Y. et al., J. Biol. Chem. 263, 6927-6932 (1988))
It was constructed by inserting it into the EcoR1 site of PMhPKN-PK ^- was NIH3T together with pWLneo (Stratagene) having a neomycin resistance gene.
400 μg / introduced into 3 cells (at a molar ratio of 50: 1)
A clone resistant to G418 of m1 was isolated. According to the method described above (Example 19), a clone (PK ⁻ / neo # 5) that most highly expressed PKN-PK ⁻ was selected from these clones by immunoblotting and used in this experiment.

[0238] Next, PKN-PK ^- To investigate whether shows the kinase activity, PKN-PK immunoprecipitated from cells ^- were examined for kinase activity. Specifically, the method was performed according to the method described below. Immunoprecipitation experiments were performed at 0-4 ° C. Wild type NIH3T3 cells and PK ⁻ / neo # 5 cells were added to 0.5 ml of buffer B (20 mM Tris-HCl (pH 7.
5) 1% Nonidet P-40, 137 mM
NaCl, 10% glycerol, 1 mM PMSF,
20 μg / ml aprotinin, 10 μg / ml leupeptin, 2.5 mM sodium fluoride, 0.25 m
M sodium vanadate) for 1 hour. Insoluble material was removed by centrifugation at 15,000 × g for 10 minutes and the supernatant was incubated with 1 μl of 10-fold diluted antiserum αN2 (Example 19) for 2 hours. After adding 40 μl of 50% Protein A Sepharose, the mixture was incubated for another hour. The immunoprecipitate adsorbed on protein A sepharose was treated with buffer C (100 mM Tris-HCl (pH 7.
5), washed twice with 0.5 M LiCl, 2.5 mM sodium fluoride, 0.25 mM sodium vanadate, and buffer D (10 mM Tris-HCl (pH
7.5), 2.5 mM sodium fluoride, 0.25 m
M sodium vanadate) twice. 25 μl of the mixed solution (20 mM) was added to each immunoprecipitate at 30 ° C.
Tris-HCl (pH 7.5), 4 mM MgCl
₂ , 40 μM ATP, 185 kBq [γ- ³² P] A
Incubated with TP, but no exogenous substrate) for 5 minutes. 5 μl of 6 × Laemmli (Laemml
i) Sample buffer (Laemmli, UK Nature 227, 680
-685 (1970)), boiled, and mixed solution 20 μl each
Was subjected to 7% SDS-PAGE. Phosphorylation was visualized and quantified using an image analyzer-1 (Fuji BAS1000).

[0239] As a result, PKN-PK ^- may be enzymatic activity is inactivated was confirmed (Figure 39). In addition, PK ⁻ / neo # 5 cells contain endogenous wild-type PKN
Immunoblotting showed that the PKN-PK ^- mutant protein was expressed in approximately 20-fold excess (Fig. 39).

As shown in FIG. 40, as a result of the microscopic observation, in the cells expressing PKN-PK ⁻ , PKN immunofluorescence was distributed in the cytoplasmic region, and the PKN immunofluorescence was distributed between the heat-treated cells at 42 ° C. and the untreated cells. There was no difference in No clear change was observed when the heat treatment temperature was further raised to 44 ° C. (FIG. 40). From these results, P
It was shown that the KN-PK ^- mutant protein does not translocate to the nucleus. The nuclear immunofluorescence / cytoplasmic immunofluorescence ratio was not significantly different between untreated and heat-treated cells as measured by confocal microscopy, so that PKN-PK ^- protein was overexpressed. , Endogenous wild-type PKN
It was thought that even nuclear transfer would cease.

[0241] Thus, PKN-PK ^- migration from the cytoplasm of PKN endogenous and overexpressed in cells to the nucleus is inhibited. Therefore, the cells are treated by expressing intracellularly a peptide having a PKN-modified amino acid sequence having no protein kinase activity or protein kinase region or a derivative thereof, or a substance that inhibits protein kinase activity or protein kinase activity. Therefore, it is considered that PKN can be prevented from translocating from the cytoplasm to the nucleus.

Example 23 Yeast Two Hybrid Si
Binding of activated Rho protein and PKN using stem
For Searching for Substances That Inhibit Sulfate Yeast (S. cerevisiae) L40 Strain (Mat a trp1 leu2 hi
s3 ade2 LYS2: :( LexAop) 4-HIS3 URA3: :( LexAop) 8-LacZ
), A cDNA fragment encoding PKN (1-540) was inserted into the pVP16 vector and human RhoA.
^PBTM into which the cDNA fragment encoding ^Val14 has been inserted
A transformant was obtained by co-transfecting the 116 vector (Example 16). 2 transformants
0 ml of adenine (Ade) and histidine (Hi
s) -containing BMM (BMM / Ade / His) medium was inoculated, statically cultured at 30 ° C., grown to 3 × 10 ⁷ cells / ml, and then the transformants were collected. Ad used here
The BMM medium containing e and His contained dextrose 20 g, asparagine 2 g, biotin 2 μg, calcium pantothenate 200 μg, inositol 10 mg, niacin 200 μg, pyridoxine hydrochloride 200 μg, thiamine hydrochloride 200 μ in 1 liter.
g, boric acid 30 μg, copper sulfate 20 μg, potassium iodide 100 μg, ferric chloride 125 μg, magnesium sulfate 50 μg, molybdenum sodium 100 μg
g, zinc sulfate 150 μg, potassium phosphate (monobasi
c) 1.5 μg, magnesium sulfate 500 mg, calcium chloride 330 mg, adenine 20 mg, and histidine 20 mg were prepared.

[0243] Half the amount of the transformed transformant was collected at 48 ° C.
BMM / Ad containing 300 ml of 2% purified agar powder (Nacalai Tesque) and 0.002% SDS kept warm
e / His medium (His ⁺ medium) in 1 × 10 ⁶ cells /
After suspending so as to have a volume of 30 ml, each 30 ml of the suspension was plated on a square petri dish. The remaining 1/2 amount of the transformant was similarly used for BMM / Ade medium (Hi) containing 300 ml of 2% purified agar powder and 0.002% SDS.
s ⁻ medium), and 30 ml of the suspension was plated on a square Petri dish (230 × 80 × 15 mm).

A culture broth of various actinomycetes and molds has a diameter of 6
mm paper disc (ADVANTEC Thi
Two sets of n PAPER DISK (Toyo Roshi Kaisha, Ltd.) were soaked and dried on the filter paper. After drying, one of the two sets of paper discs was placed on a transformant culture plate in a His ⁺ medium and the other was placed on a transformant culture plate in a His ⁻ medium and cultured at 30 ° C. for 2 to 3 days. After that, the diameter of the growth inhibition circle appearing around each paper disk was measured, and the transformant culture plate of His ⁺ medium and H
The difference in size of the inhibition circles appearing on the transformant culture plates in the is ^- medium was measured.

As a result, in most of the culture broths, the same degree of inhibition circle appeared on both plates. On the other hand, in rare cases, a culture broth was found in which a significantly large inhibition circle appeared on the His ^- medium plate as compared to the inhibition circle on the His ⁺ medium (data not shown). These culture broths are
Since almost no inhibition circle appeared in the is ⁺ medium, it is considered that the substance does not contain enough substances to prevent yeast growth. On the other hand, in His ^- medium, a blocking circle appears remarkably, so that in this culture broth, Rho
It was speculated that it contains a substance that inhibits the binding between A ^Val14 and PKN (1-540). As described above, it was revealed that it is possible to screen a substance that inhibits the binding between Rho protein and PKN by the yeast two hybrid system.

Example 24 Yeast Two-Hybrid
Detection of binding of α-actinin and PKN by system Human brain cDNA fused to Gal4 transcriptional activation domain
10 ⁶ yeast colonies transformed with both the library and the bait construct encoding PKNN1 fused to the Gal4 DNA binding domain were screened. Specifically, it was carried out according to the method described below.

Human PKN used, human skeletal muscle α-actinin (Beggs, A., et al., J. Biol. Chem. 267, 9)
281-9288 (1992) called HuActSk1) and non-skeletal muscle α-actinin (Beggs, A.,
The scheme of the fusion construct of (HuActNm in et al., J. Biol. Chem. 267, 9281-9288 (1992)) is shown in FIGS. 41 and 42. Human PK
Screening for proteins that bind to the N-terminal region of N (amino acids 1-540, designated as "PKNN1") was performed according to the method described in Example 6. Primary positive clones were recovered and Gal4bd-P
The original yeast host strain YGH1 (a, ura3-5 in combination with KN or Gal4bd-p53 tumor suppressor
2, his3-200, ade2-101, lys2-
801, trp1-901, leu2-3, Can ^r ,
gal4-542, gal80-538, LYS2 ::
gall _uas -gall _{tat a} -HIS3, URA
3 :: gal1-lacZ). Plasmids that activated expression of the marker only in the presence of PKN were further analyzed.

When the nucleotide sequence of the cDNA was determined, it was 1
82 plasmids showing 6 different cDNAs were isolated (Example 6). Of these, 3 positive clones (clone # 4, # 10, and # 25) were skeletal muscle α-
Actinin (HuActSk1) (Beggs, A., et al.,
J. Biol. Chem. 267, 9281-9288 (1992)). Clone # 4 encodes HuActSk1 from amino acid 333 to the C-terminus, and both clone # 10 and clone # 25 contain amino acids 344 to the C-terminus of H.
It coded uActSk1. These three clones contained the complete C-terminus, but the N-terminal actin binding domain (Fukami, K., et al., J. Biol. Chcm.
271, 2646-2650 (1996)) (Fig. 4)
2). These clones were derived from the original yeast host strain YGH1.
Co-transformed with the PKN bait construct showed high β-galactosidase activity.

L40 cells (MATa trp1 leu
2 his3 LYS2 :: lexA-HIS3 UR
LexAbd (instead of Gal4bd) -PK, another combination two-hybrid construct that induces expression of lacZ in A3 :: lexA-lacZ).
The specificity of this binding was tested by measuring the binding capacity of N, and Gal4ad-α-actinin.
As a result, as shown in FIG. 43, high β-galactosidase activity was also detected in this system.
Specific binding between the amino terminal region of N and α-actinin was suggested.

HuA using the two-hybrid method
A region on PKN that binds ctSk1 was identified and Rh that binds PKN to this region in vitro and in vivo.
Compared to the binding site of oA. RhoA binding site is PKN
Is mapped on amino acids 33-111 of PKN corresponding to the first leucine zipper-like sequence of Example 1 (Example 1
6), but α-actinin bound little to this region of PKN (FIG. 42). In contrast, α-actinin bound strongly to amino acids 136-189 of PKN,
No binding was detected in this region of RhoA and PKN (data not shown). This region corresponds to the second leucine zipper-like sequence and the N-terminal region adjacent thereto, the latter N-terminal region being conserved throughout vertebrate evolution (Mukai, H., et al., Biochim. Biophys. Acta 1261,
296-300 (1995)). Therefore, α-actinin is associated with Rho
It became clear that it binds to a region different from the binding region. These results indicate that PKN may bind to RhoA and α-actinin simultaneously.

Example 25 HuAc In Vitro
Detection of PKN binding to tSk1 α-actinin is composed of three domains:
N-terminal actin-binding domain, four 122
An elongated rod-shaped domain with an amino acid repeat (spectrin-like repeat) and a pair of putative helices −
C-terminal region containing a loop-helical Ca ²⁺ binding motif (often called the EF-hand) ((Blanch
ard, A., et al., J. Muscle Res. Cell Motil.10,280-
289 (1989)).

To clarify whether PKN binds directly to α-actinin and which region of α-actinin is required for PKN binding, HuActS.
Various truncated constructs of k1 were transformed into E. coli (E.
Produced as a GST fusion protein in i) (FIG. 42), the binding to the N-terminal region of in vitro transcribed PKN was analyzed. Specifically, it was carried out according to the method described below.

A plasmid for in vitro transcription of the full-length coding region of HuActSk1 was constructed as follows: HuAct containing an actin binding domain.
CDNA encoding the N-terminal region of Sk1 (amino acids 1-422) was transferred from a human brain cDNA library to PC.
It was amplified by R and ligated to the C-terminal part of clone # 4 (amino acids 423-894) isolated in the two-hybrid screen. CDNA containing the full-length coding region of HuActSk1 was cloned into pBluesc
Subcloned into ript IISK + (Stratagene). The plasmid was linearized by cutting with XhoI and the TRNA RNA polymerase was used to transcribe the cRNA.

N-terminal region of PKN (amino acids 1-47)
4, hereinafter referred to as "PKNN2" in this region (Example 8)) was subjected to in vitro transcription according to the method described in Example 8. Example 8 for in vitro translation
The cRNA was translated by a rabbit reticulocyte lysate (Promega) in the presence of [ ³⁵ S] methionine according to the method described in 1.

For in vitro binding experiments, 2 μl of in vitro translated PKNN2 was added to 400 μl GST binding buffer (20 mM Tris / HCl, pH 7.5,
0.5 mM DTT, 150 mM NaCl, 0.05
% Triton-X100, 1 mM EDTA, 1 μg /
ml leupeptin), 5 μg of each GST-α-
Actinin-fusion protein or 25 μg GS
Mix with T alone and incubate at 4 ° C. for 1 hour. 1
After addition of 25 μl of glutathione-Sepharose 4B pre-treated with 0 mg / ml E. coli extract to block non-specific binding, the binding reaction was continued at 4 ° C. for a further 30 minutes. Glutathione-Sepharose 4B was then added to GST wash buffer (20%) containing 0.5 M NaCl and 0.5% Triton X-100.
mM Tris / HCl, pH 7.5, 0.5 mM D
(TT, 1 mM EDTA, 1 μg / ml leupeptin) four times and further washed with GST wash buffer. The bound protein was transferred to GST elution buffer (1
00 mM Tris / HCl, pH 7.5, 10 mM glutathione, 120 mM NaCl, 1 mM EDT
A, 0.5 mM DTT, 1 μg / ml leupeptin), and subjected to SDS-PAGE. Visualize with image forming analyzer (FUJI BAS1000),
Binding was quantified.

As a result, as shown in FIG. 44, the in vitro translated PKNN2 was expressed in human skeletal muscle α-actinin fragments (amino acids 423-653, amino acids 653-8).
37, and amino acids 486-607), but fragments (amino acids 837-894, and amino acids 6).
04-719). 0.5% for complex
Resistance to washing with Triton X-100 / 0.5M NaCl indicated that this binding was not non-specific.

As suggested by the above results, recombinant α-
Actinin binds directly to recombinant PKN and two distinct regions of HuActSk1, which correspond to regions containing spectrin-like repeat 3 and EF-hand-like motifs, play important roles in binding to PKN. On the other hand, as expected from the two-hybrid data (Example 24), the RhoA binding region (amino acids 33 to 1).
The N-terminal region of in vitro translated PKN (amino acids 136-474) lacking 11) was sufficient for direct binding to α-actinin (FIG. 44, lane 18).
-20).

Example 26 In Vitro PKN and Non-Bone
Detection of the binding of muscle-type α-actinin (HuActNm)
^{Demonstration} of Ca ²⁺ Dependence of and Its Binding A number of different isoforms of α-actinin have been characterized, including skeletal muscle, smooth muscle, and nonmuscle α-actinin from various cells and tissues. The functional differences reported between these α-actinins are:
Binding of non-muscle isoforms to F-actin is Ca
It is inhibited by ^2+, but binding of nonmuscle isoforms is Ca ²⁺ insensitive (Burridge, K.
& Feramiscoo, JR Nature 294, 565-567 (1981), Be
nnett, JP, et al., Biochemistry 23, 5081-5086
(1984), Duhaiman, AS & Bamburg, JR Biochem
istry23, 1600-1608 (1984), and Landon, F., et
al., Eur. J. Biochem. 153, 231-237 (1985)). In humans, strong sequence homology with HuActSk1 (89
Non-muscle cytoskeletal isoforms (HuActNm (Beggs, A., with 80% identity and 80% identity).
et al., J. Biol. Chem. 267, 9281-9288 (1992)) has been isolated (Millake, DB, et a.
l., Nucleic Acids Res. 17, 6725 (1989), and Yo
ussoufian, H., et al., Am. J. Hum. Genet. 47,62-71
(1990)).

Therefore, the present inventors have asked whether the in vitro translated PKNN2 can bind to the region of HuActNm corresponding to the PKN binding site of HuActSk1.
The examination was carried out according to the method described in Example 25. The HuActNm fragment used in the experiment was prepared according to the method described below.

A cDNA encoding the spectrin-like repeat 3 (amino acids 479-600) and EF-hand-like region (amino acids 712-843) of HuActNm was amplified by PCR from a human brain cDNA library,
It was ligated into the pGEX4T vector. cDNAs encoding the spectrin repeat 20 and EF-hand-like region of α-actinin were amplified by PCR from a rat brain cDNA library and ligated into the pGEX4T vector. Expression and purification of GST or GST fusion protein was performed according to the manufacturer's instructions (Pharmacia Biotech). The eluate from glutathione-Sepharose 4B (Pharmacia Biotech) was added to 1 mM EDTA, 1 mM DTT, and 0.1 mM.
10 mM Tris containing μg / ml leupeptin
Dialyzed against / HCl, pH 7.5 overnight.

As a result, as shown in FIG. 45, PKNN
2 was able to bind to the spectrin-like repeat 3 domain of HuActNm, but E of HuActNm
No binding to the F-hand-like domain was detected in the absence of Ca2 ⁺ . However, PKNN2 is 1
HuActNm EF- in the presence of mM Ca ²⁺
We were able to effectively bind to the hand-like area (Fig. 4
5).

Example 27 PKN and α-actinin
Investigation of specificity of binding between α-actinin is a member of the spectrin superfamily including spectrin and dystrophin (Blanhard, A., et al., J. Muscle Res. C).
ell Motil.10,280-289 (1989), Dubreuil, RR Bioe
ssays 13, 219-226 (1991), and Bennett, V, Physi
ol. Rev. 70, 1029-1065 (1990)). Members of the family are the N-terminal actin-binding domain, the central rod-shaped spectrin-like repeat, and the C-terminal EF-.
It is characterized by a hand-like domain. α-spectrin is 21 at the N-terminus to the EF-hand-like domain
Includes individual rod-shaped repeats. The C-terminus of α-spectrin clearly matches α-actinin,
In particular, repeat 20 of α-spectrin shows very high homology to repeat 3 of α-actinin (Wassen
ius, VM, et al., J. Cell Biol. 108, 79-93 (198
9), and Hong, WJ & Doyle, DJ Biol. Che
m. 264, 12758-12764 (1989)), the repeat positions among the proteins appear to coincide with each other.

Since PKN bound to repeat 3 of α-actinin, PKN repeats 20 of α-spectrin.
I examined whether it can be combined with. As shown in FIG. 46, in vitro binding of PKN to rat α-spectrin repeat 20 was not detected under the same conditions in which PKN bound to α-actinin repeat 3. These results indicate that PKN specifically binds to the spectrin-like repeat of α-actinin.

Example 28 PKN to α-actinin
In Vivo Binding In vivo binding of α-actinin with PKN
It was tested by co-transfection experiments with OS7 cells. An epitope-tagged α-actinin was prepared by fusing a 9-amino acid epitope derived from influenza HA to the amino terminus of clone # 4 protein, and the labeled α-actinin polypeptide was labeled using anti-HA monoclonal antibody 12CA5. Allowed selective immunoprecipitation (Field, J., et al., Mol. Cel.
Biol. 8, 2159-2165 (1988)). This HA labeled α-
Actinin contains the complete C-terminal region of α-actinin, but lacks the N-terminal actin-binding domain. Specifically, the experiment was performed according to the following method.

HuAc labeled with HA by fusing the cDNA encoding the 9 amino acid epitope from influenza HA to the amino terminus of clone # 4.
The tSk1 cDNA (amino acids 333-894) was made. The vector pHA-Act was constructed by subcloning this cDNA into pTB701 (Ono. Y., et al., J. Biol. Chem. 263, 6927-6.
932 (1988)). CDNA encoding only HA epitope
By subcloning A into pTB701, a control pHA without HuActSk1 was obtained.
The vector was constructed. The vector pHA-Act or the control pHA vector was added to the expression vector pMhPKN3 (Mukai, H. & On, which encodes full-length human PKN).
o, Y. Biochem. Biophys. Res. Commun. 199, 897-904
(1994)) and co-transfected into COS7 cells. After 48 hours, the cells were lysed with lysis buffer (2
0 mM Tris / HCl, pH 7.5, 1% Non
idet P-40, 137 mM NaCl, 10%
Glycerol, 1 mM phenylmethylsulfonyl fluoride, 20 μg / ml aprotinin, 10 μg /
ml leupeptin) for 1 hour. Insoluble material was removed by centrifugation at 15,000 xg for 10 minutes and the supernatant was incubated with 12CA5 for 2 hours. After adding 20 μl of 50% Protein A Sepharose, the mixture was incubated for another hour. The immunoprecipitate adsorbed on Protein A Sepharose was washed with HA washing buffer (100 mM Tris / HC
l, pH 7.5, 0.5M LiCl)) twice,
It was washed twice with 10 mM Tris / HCl, pH 7.5. The resulting immunoprecipitates were detected by immunoblotting using αC6 and 12CA5.

The anti-hemagglutinin (HA) monoclonal antibody 12CA5 used in the experiment was purchased from Boehringer Mannheim. Specific antiserum αC6 for PKN
Is a rat PKN fragment (amino acid 86
After immunizing a rabbit with 3-946), it was prepared according to a conventional method.

The results are as shown in FIG. CO
HA-labeled α-actinin and full-length P in S7 cells
After co-expression of KN, anti-HA immunoprecipitates were immunoreactive with PK
It contained a lot of N. These results indicate that the C-terminal region of α-actinin can bind PKN in vivo.

Example 29 PKN and α-actinin
PI4,5-P2-dependent binding between α-actinin binds to varying amounts of endogenous PI4,5P2 in vivo, and specific binding between α-actinin and PI4,5P2 results in F-actin gelation of α-actinin. Regulates activity (Fukami, K., et al., Nature 359, 1
50-152 (1992)). This indicates that PI4,5P2 causes a conformational change of α-actinin. Exogenously added PI4,5P2 can bind strongly to α-actinin, and this binding is robust and stable (Fukami, K., et al., Nature 359, 150-1.
52 (1992)).

Therefore, the present inventors examined the binding activity of α-actinin and PKN in the presence or absence of PI4,5P2. The binding region of PI4,5P2 is α-
It exists in the actin-binding domain of actinin (Fukam
i, K., et al., J. Biol. Chcm. 271, 2646-2650 (199
6)) so the full length α-actinin containing the in vitro translated actin binding domain (FIG. 42) was used in this in vitro binding assay. Specifically, it was carried out according to the method described below.

Phosphatidylinositol 4,5 bisphosphate (PI4,5P2) for binding between α-actinin and PKN (Boehringer Mannheim)
To analyze the effect of 2 μl of in vitro translated full-length HuActSk1 was added to 400 μl of buffer P (20 mM Tris / HCl, pH 7.5, 0.5).
mM DTT, 120 mM NaCl, 1 mM EDT
In A), mixed with 5 μg GST-PKNN1 fusion protein or with 25 μg GST alone, PI4.
Incubated for 1 hour at room temperature in the presence or absence of 5P2. After the addition of 25 μl of glutathione-Sepharose 4B pretreated with E. coli extract, the binding reaction was continued at 4 ° C. for a further 30 minutes. Glutathione-Sepharose 4B was then added to 0.
Washed 4 times in Buffer P containing 01% Triton X-100. Bound proteins were eluted with GST elution buffer and subjected to SDS-PAGE. The binding was visualized and quantified by an image forming analyzer (FUJIBAS1000).

The results are as shown in FIG. Full-length α-actinin bound very weakly but specifically to PKN in the absence of PI4,5P2. However, when 10 μM PI4,5P2 was added, PK
The binding between N and full-length α-actinin was promoted (FIG. 48).
A). Therefore, it is considered that PI4,5P2 influences the conformation of α-actinin and exposes the binding region of PKN.

The binding activity was P up to 2.5 to 10 μM.
It increased with increasing I4,5P2 concentration, but decreased to 100 μM above this concentration (FIG. 48B). PI
This biphasic pattern, which depends on the concentration of 4,5P2, is α-
It has also been reported in the binding between actinin and PI3-kinase (Shibasaki, F., et al., Biochem. J.30.
2, 551-557 (1994)). Fukami et al. Showed that the effect of PI4,5P2 on the gelling activity of α-actinin was PI.
The concentration of 4,5P2 increases up to 5-10 μM, but P
If the concentration of I4,5P2 increases further, PI4,5
It was reported that the gelling activity was reduced to the original level due to the formation of P2 micelles (Fukami, K., et al., Na
ture 359, 150-152 (1992)). The PI4,5P2 concentration-dependent biphasic binding pattern for α-actinin binding to PKN can also be explained for the same reason.

Example 30 On PKN Kinase Activity
Effect of α-actinin It was investigated whether the binding of α-actinin to PKN regulates or directly changes the catalytic function of PKN. Specifically, the method was performed according to the method described below. The α-actinin used in the experiment was purified from bovine aorta by the method of Feramisco et al. (Feramisco, JR & Burridg.
e, KJ Biol. Chem. 255, 1194-1199 (1980)). PK
Phosphorylation experiment with N was 20 mM at 30 ° C.
Tris / HCl, pH 7.5, 4 mM MgCl
₂ , 100 μM ATP, 185 kBq [γ- ³²
P] ATP, a substrate for phosphorylation (phosphate acce
ptor), PK purified from 20 ng / ml rat testis
N (Abe, M., et al., J. Biochem. Tokyo 107, 507-5
09 (1990)) in the presence or absence of 40 μM arachidonic acid as indicated in each experiment. The partially purified protein was boiled for 3 minutes to inactivate the endogenous kinase activity before it was used as a substrate for phosphorylation. After incubation for 5 minutes, the reaction was stopped by adding an equal volume of Laemmli sample buffer (Laemmli, UK Nature 2Z7, 680-685 (1970)) and separated on SDS-PAGE. Dry the gel under vacuum to visualize phosphorylation,
It quantified with the image analyzer (FUJI BAS1000). δPKC peptide (Mukai, H., et al.
Biochem, Biophys. Res. Commun. 204,348-356 (l99
4)) was used as a substrate for phosphorylation, the reaction was stopped by spotting the mixture onto Whatman (Whatman) P81 and immersing in 75 mM phosphoric acid, then 10 min. Washing was performed 3 times. ³² P incorporation into peptides was assessed by scintillation counting.

As a result, α-purified from bovine aorta
Actinin did not inhibit PKN autophosphorylation when added at> 1000 molar excess relative to PKN, nor did it affect PKN phosphorylation of PKC pseudosubstrate peptides (data not shown). Therefore, it was revealed that α-actinin is not a direct modulator of PKN purified from the soluble fraction of rat testis in vitro.

Example 31 α-Actinin and Other Amino Acids
Phosphate by PKN of Kutin-cytoskeleton-related protein
Since the modified PKN bound to α-actinin, the present inventors examined whether α-actinin itself is a substrate for PKN. PKN purified from rat testes did not phosphorylate α-actinin purified from bovine aorta (Example 30) and recombinant α-actinin expressed in E. coli (data not shown).

We searched for PKN substrates among other actin-cytoskeletal proteins including filamin, meta-vinculin, vinculin, talin, caldesmon, and actin. Actin is a Mommaert
Purified from rabbit skeletal muscle according to the method of S., W. et al.
mmaerts, WFHMJBiol. Chem. 559, 559 (1951)
). Vinculin was purified from bovine aorta by the method of Kobayashi et al. (Kobayashi, R. & Tashima,
YJ Muscle Res. Cell Motil. 11, 465-470 (199
0)). Caldesmon was partially purified from bovine aorta by the method of Abe et al. (Abe, M., et al., J. Bioche
m. Tokyo 107, 507-509 (1990)). Filamin, Meta-Vinculin, and Tallin are available from Feramisco, JR &
Burridge, KJBiol. Chem. 255, 1194-1199 (1980)
Partially purified from bovine aorta according to the method described in.

As a result, among these, it was revealed that caldesmon and G-actin are preferable substrates for PKN. As shown in FIG. 49, phosphorylation of G-actin and caldesmon was promoted by about 2-fold and 6-fold or more, respectively, in the presence of arachidonic acid.

Some actin-based cytoskeletal proteins such as actin and caldesmon are good PK
As a N substrate, PKN was speculated to mediate the effects of Rho proteins and phosphoinositides by phosphorylating these proteins.

[0279]

[Sequence list]

 SEQ ID NO: 1 Sequence Length: 942 and 2968 Sequence Type: Amino Acid and Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Peptide and cDNA Origin: Organ Name: Human Sequence GAATTCCCGC GCAGAGACTC CAGGTCGCAG GTCGAC ATG GCC AGC GAC GCC GTG 54 Met Ala Ser Asp Ala Val 15 CAG AGT GAG CCT CGC AGC TGG TCC CTG CTA GAG CAG CTG GGC CTG GCC 102 Gln Ser Glu Pro Arg Ser Trp Ser Leu Leu Glu Gln Leu Gly Leu Ala 10 15 20 GGG GCA GAC CTG GCG GCC CCC GGG GTA CAG CAG CAG CTG GAG CTG GAG 150 Gly Ala Asp Leu Ala Ala Pro Gly Val Gln Gln Gln Leu Glu Leu Glu 25 30 35 CGG GAG CGG CTG CGG CGG GAA ATC CGC AAG GAG CTG AAG CTG AAG GAG 198 Arg Glu Arg Leu Arg Arg Glu Ile Arg Lys Glu Leu Lys Leu Lys Glu 40 45 50 GGT GCT GAG AAC CTG CGG CGG GCC ACC ACT GAC CTG GGC CGC AGC CTG 246 Gly Ala Glu Asn Leu Arg Arg Ala Thr Thr Asp Leu Gly Arg Ser Leu 55 60 65 70 GGC CCC GTA GAG CTG CTG CTG CGG GGC TCC TCG CGC CGC CTC GAC CTG 294 Gly Pro Val Glu Leu Le u Leu Arg Gly Ser Ser Arg Arg Leu Asp Leu 75 80 85 CTG CAC CAG CAG CTG CAG GAG CTG CAC GCC CAC GTG GTG CTT CCC GAC 342 Leu His Gln Gln Leu Gln Glu Leu His Ala His Val Val Leu Pro Asp 90 95 100 CCG GCG GCC ACC CAC GAT GGC CCC CAG TCC CCT GGT GCG GGT GGC CCC 390 Pro Ala Ala Thr His Asp Gly Pro Gln Ser Pro Gly Ala Gly Gly Pro 105 110 115 ACC TGC TCG GCC ACC AAC CTG AGC CGC GTG GCG GGC CTG GAG AAG CAG 438 Thr Cys Ser Ala Thr Asn Leu Ser Arg Val Ala Gly Leu Glu Lys Gln 120 125 130 TTG GCC ATT GAG CTG AAG GTG AAG CAG GGG GCG GAG AAC ATG ATC CAG 486 Leu Ala Ile Glu Leu Lys Val Lys Gln Gly Ala Glu Asn Met Ile Gln 135 140 145 150 ACC TAC AGC AAT GGC AGC ACC AAG GAC CGG AAG CTG CTG CTG ACA GCC 534 Thr Tyr Ser Asn Gly Ser Thr Lys Asp Arg Lys Leu Leu Leu Thr Ala 155 160 165 CAG CAG ATG TTG CAG GAC AGT AAG ACC AAG ATT GAC ATC ATC CGC ATG 582 Gln Gln Met Leu Gln Asp Ser Lys Thr Lys Ile Asp Ile Ile Arg Met 170 175 180 CAA CTC CGC CGG GCG CTG CAG GCC GGC CAG CTG GAG AAC CAG GCA GCC 630 Gln Leu Arg Arg Ala Leu Gln Ala Gly Gln Leu Glu Asn Gln Ala Ala 185 190 195 CCG GAT GAC ACC CAA GGG AGT CCT GAC CTG GGG GCT GTG GAG CTG CGC 678 Pro Asp Asp Thr Gln Gly Ser Pro Asp Leu Gly Ala Val Glu Leu Arg 200 205 210 ATC GAA GAG CTG CGG CAC CAC TTC CGA GTG GAG CAC GCG GTG GCC GAG 726 Ile Glu Glu Leu Arg His His Phe Arg Val Glu His Ala Val Ala Glu 215 220 225 230 GGT GCC AAG AAC GTA CTG CGC CTG CTC AGC GCT GCC AAG GCC CCG GAC 774 Gly Ala Lys Asn Val Leu Arg Leu Leu Ser Ala Ala Lys Ala Pro Asp 235 240 245 CGC AAG GCA GTC AGC GAG GCC CAG GAG AAA TTG ACA GAA TCC AAC CAG 822 Arg Lys Ala Val Ser Glu Ala Gln Glu Lys Leu Thr Glu Ser Asn Gln 250 255 260 AAG CTG GGG CTG CTG CGG GAG GCT CTG GAG CGG AGA CTT GGG GAG CTG 870 Lys Leu Gly Leu Leu Arg Glu Ala Leu Glu Arg Arg Leu Gly Glu Leu 265 270 275 CCC GCC GAC CAC CCC AAG GGG CGG CTG CTG CGA GAA GAG CTC GCT GCG 918 Pro Ala Asp His Pro Lys Gly Arg Leu Leu Arg Glu Glu Leu Ala Ala 280 285 290 GCC TCC TCC GCT GCC TTC AGC ACC CGC CTG GCC GGG CCC TTT CCC GCC 966 Ala Ser Ser Ala Ala Phe Ser Thr Arg Leu Ala Gly Pro Phe Pro Ala 295 300 305 310 ACG CAC TAC AGC ACC CTG TGC AAG CCC GCG CCG CTC ACA GGG ACC CTG 1014 Thr His Tyr Ser Thr Leu Cys Lys Pro Ala Pro Leu Thr Gly Thr Leu 315 320 325 GAG GTA CGA GTG GTG GGC TGC AGA GAC CTC CCA GAG ACC ATC CCG TGG 1062 Glu Val Arg Val Val Gly Cys Arg Asp Leu Pro Glu Thr Ile Pro Trp 330 335 340 AAC CCT ACC CCC TCA ATG GGG GGA CCT GGG ACC CCA GAC AGC CGC CCC 1110 Asn Pro Thr Pro Ser Met Gly Gly Pro Gly Thr Pro Asp Ser Arg Pro 345 350 355 CCC TTC CTG AGC CGC CCA GCC CGG GGC CTT TAC AGC CGA AGC GGA AGC 1158 Pro Phe Leu Ser Arg Pro Ala Arg Gly Leu Tyr Ser Arg Ser Gly Ser 360 365 370 CTC AGT GGC CGG AGC AGC CTC AAA GCA GAA GCC GAG AAC ACC AGT GAA 1206 Leu Ser Gly Arg Ser Ser Leu Lys Ala Glu Ala Glu Asn Thr Ser Glu 375 380 385 390 GTC AGC ACT GTG CTT AAG CTG GAT AAC ACA GTG GTG GGG CAG ACG TCT 1254 Val Ser Thr Val Leu Lys Leu Asp Asn Thr Val Val Gly Gln Thr Ser 395 400 405 TGG AAG CCA TGT GGC CCC AAT GCC TGG GAC CAG AGC TTC ACT CTG GAG 1302 Trp Lys Pro Cys Gly Pro Asn Ala Trp Asp Gln Ser Phe Thr Leu Glu 410 415 420 CTG GAA AGG GCA CGG GAA CTG GAG TTG GCT GTG TTC TGG CGG GAC CAG 1350 Leu Glu Arg Ala Arg Glu Leu Glu Leu Ala Val Phe Trp Arg Asp Gln 425 430 435 CGG GGC CTG TGT GCC CTC AAA TTC CTG AAG TTG GAG GAT TTC TTG GAC 1398 Arg Gly Leu Cys Ala Leu Lys Phe Leu Lys Leu Glu Asp Phe Leu Asp 440 445 450 AAT GAG AGGCAT GAG GTG CAG CTG GAC ATG GAA CCC CAG GGC TGC CTG 1446 Asn Glu Arg His Glu Val Gln Leu Asp Met Glu Pro Gln Gly Cys Leu 455 460 465 470 GTG GCT GAG GTC ACC TTC CGC AAC CCT GTC ATT GAG AGG ATT CCT CGG 1494 Val Ala Glu Val Thr Phe Arg Asn Pro Val Ile Glu Arg Ile Pro Arg 475 480 485 CTC CGA CGG CAG AAG AAA ATT TTC TCC AAG CAG CAA GGG AAG GCG TTC 1542 Leu Arg Arg Gln Lys Lys Ile Phe Ser Lys Gln Gln Gly Lys Ala Phe 490 495 500 CAG CGT GCT AGG CAG ATG AAC ATC GAT GTC GCC ACG TGG GTG CGG CTG 1590 Gln Arg Ala Arg Gln Met Asn Ile Asp Val Ala Thr Trp Val Arg Leu 505 510 515 CTC CGG AGG CTC ATC CCC AAT G CC ACG GGC ACA GGC ACC TTT AGC CCT 1638 Leu Arg Arg Leu Ile Pro Asn Ala Thr Gly Thr Gly Thr Phe Ser Pro 520 525 530 GGG GCT TCT CCA GGA TCC GAG GCC CGG ACC ACG GGT GAC ATA TCG GTG 1686 Gly Ala Ser Pro Gly Ser Glu Ala Arg Thr Thr Gly Asp Ile Ser Val 535 540 545 550 GAG AAG CTG AAC CTC GGC ACT GAC TCG GAC AGC TCA CCT CAG AAG AGC 1734 Glu Lys Leu Asn Leu Gly Thr Asp Ser Asp Ser Ser Pro Gln Lys Ser 555 560 565 TCG CGG GAT CCT CCT TCC AGC CCA TCG AGC CTG AGC TCC CCC ATC CAG 1782 Ser Arg Asp Pro Pro Ser Ser Pro Ser Ser Leu Ser Ser Pro Ile Gln 570 575 580 GAA TCC ACT GCT CCC GAG CTG CCT TCG GAG ACC CAG GAG ACC CCA GGC 1830 Glu Ser Thr Ala Pro Glu Leu Pro Ser Glu Thr Gln Glu Thr Pro Gly 585 590 595 CCC GCC CTG TGC AGC CCT CTG AGG AAG TCA CCT CTG ACC CTC GAA GAT 1878 Pro Ala Leu Cys Ser Pro Leu Arg Lys Ser Pro Leu Thr Leu Glu Asp 600 605 610 TTC AAG TTC CTG GCG GTG CTG GGC CGG GGT CAT TTT GGG AAG GTG CTC 1926 Phe Lys Phe Leu Ala Val Leu Gly Arg Gly His Phe Gly Lys Val Leu 615 620 625 630 CTC T CC GAA TTC CGG CCC AGT GGG GAG CTG TTC GCC ATC AAG GCT CTG 1974 Leu Ser Glu Phe Arg Pro Ser Gly Glu Leu Phe Ala Ile Lys Ala Leu 635 640 645 AAG AAA GGG GAC ATT GTG GCC CGA GAC GAG GTG GAG AGC CTG ATG TGT 2022 Lys Lys Gly Asp Ile Val Ala Arg Asp Glu Val Glu Ser Leu Met Cys 650 655 660 GAG AAG CGG ATA TTG GCG GCA GTG ACC AGT GCG GGA CAC CCC TTC CTG 2070 Glu Lys Arg Ile Leu Ala Ala Val Thr Ser Ala Gly His Pro Phe Leu 665 670 675 GTG AAC CTC TTC GGC TGT TTC CAG ACA CCG GAG CAC GTG TGC TTC GTG 2118 Val Asn Leu Phe Gly Cys Phe Gln Thr Pro Glu His Val Cys Phe Val 680 685 690 ATG GAG TAC TCG GCC GGT GGG GAC CTG ATG CTG CAC ATC CAC AGC GAC 2166 Met Glu Tyr Ser Ala Gly Gly Asp Leu Met Leu His Ile His Ser Asp 695 700 705 710 GTG TTC TCT GAG CCC CGT GCC ATC TTT TAT TCC GCC TGC GTG GTG CTG 2214 Val Phe Ser Glu Pro Arg Ala Ile Phe Tyr Ser Ala Cys Val Val Leu 715 720 725 GGC CTA CAG TTT CTT CAC GAA CAC AAG ATC GTC TAC AGG GAC CTG AAG 2262 Gly Leu Gln Phe Leu His Glu His Lys Ile Val Tyr Arg Asp Leu Ly s 730 735 740 TTG GAC AAT TTG CTC CTG GAC ACC GAG GGC TAC GTC AAG ATC GCA GAC 2310 Leu Asp Asn Leu Leu Leu Asp Thr Glu Gly Tyr Val Lys Ile Ala Asp 745 750 755 TTT GGC CTC TGC AAG GAG GGG ATG GGC TGC GGG GAC CGG ACC AGC ACA 2358 Phe Gly Leu Cys Lys Glu Gly Met Gly Tyr Gly Asp Arg Thr Ser Thr 760 765 770 TTC TGT GGG ACC CCG GAG TTC CTG GCC CCT GAG GTG CTG ACG GAC ACG 2406 Phe Cys Gly Thr Pro Glu Phe Leu Ala Pro Glu Val Leu Thr Asp Thr 775 780 785 790 TCG TAC ACG CGA GCT GTG GAC TGG TGG GGA CTG GGT GTG CTG CTC TAC 2454 Ser Tyr Thr Arg Ala Val Asp Trp Trp Gly Leu Gly Val Leu Leu Tyr 795 800 805 GAG ATG CTG GTT GGC GAG TCC CCA TTC CCA GGG GAT GAT GAG GAG GAG 2502 Glu Met Leu Val Gly Glu Ser Pro Phe Pro Gly Asp Asp Glu Glu Glu 810 815 820 GTC TTC GAC AGC ATC GTC AAC GAC GAG GTT CGC TAC CCC CGC TTC CTG 2550 Val Phe Asp Ser Ile Val Asn Asp Glu Val Arg Tyr Pro Arg Phe Leu 825 830 835 TCG GCC GAA GCC ATC GGC ATC ATG AGA AGG CTG CTT CGG AGG AAC CCA 2598 Ser Ala Glu Ala Ile Gly Ile Met Arg Arg Leu Leu Arg Arg Asn Pro 840 845 850 GAG CGG AGG CTG GGA TCT AGC GAG AGA GAT GCA GAA GAT GTG AAG AAA 2646 Glu Arg Arg Leu Gly Ser Ser Glu Arg Asp Ala Glu Asp Val Lys Lys 855 860 865 870 CAG CCC TTC TTC AGG ACT CTG GGC TGG GAA GCC CTG TTG GCC CGG CGC 2694 Gln Pro Phe Phe Arg Thr Leu Gly Trp Glu Ala Leu Leu Ala Arg Arg 875 880 885 CTG CCA CCG CCC TTT GTG CCC ACG CTG TCC GGC CGC ACC GAC GTC AGC 2742 Leu Pro Pro Pro Phe Val Pro Thr Leu Ser Gly Arg Thr Asp Val Ser 890 895 900 AAC TTC GAC GAG GAG TTC ACC GGG GAG GCC CCC ACA CTG AGC CCG CCC 2790 Asn Phe Asp Glu Glu Phe Thr Gly Glu Ala Pro Thr Leu Ser Pro Pro 905 910 915 CGC GAC GCG CGG CCC CTT ACA GCC GCG GAG CAG GCA GCC TTC CTG GAC 2838 Arg Asp Ala Arg Pro Leu Thr Ala Ala Glu Gln Ala Ala Phe Leu Asp 920 925 930 TTC GAC TTC GTG GCC GGG GGC TGC CGCCCCCCCCTCTAGCCCCCC 2892 Phe Asp Phe Val Ala Gly Gly Cys 935 940 CTGCCCGAGA GCTCTTAGTT TTTAAAAAGG CCTTTGGGAT TTGCCGGAAA AAAAAAAAAA 2952 AAAAAAAAAG GAATTC 2968

SEQ ID NO: 2 Sequence Length: 15 Sequence Type: Amino Acid Number of Chains: Single Chain Topology: Linear Sequence Type: Peptide Origin: Organism: Human Sequence Arg Glu Arg Leu Arg Arg Glu Ser Arg Lys Glu Leu Lys Leu Lys 1 5 10 15

[Brief description of drawings]

FIG. 1 is an electrophoretic photograph showing the result of purification of p128 by DEAE Sepharose column chromatography. Lane 1: 0.2 M NaCl elution fraction from GST-RhoA protein affinity column, Lane 2: 75 mM N from DEAE Sepharose column.
aCl elution fraction.

FIG. 2 is an electrophoretic photograph showing the result of immunoblot analysis of p128 using an anti-PKN antibody. Lane 1: pre-immune (premune) serum, lane 2: anti-PKN antibody.

FIG. 3 is an electrophoretic photograph showing the autophosphorylation reaction of PKN. Lane 1: GST, Lane 2: GDP-GST-Rho
A, lane 3: GTPγS / GST-RhoA, lane 4: GTPγS / GST-RhoA ^Asp38 , lane 5: GDP / GST-Rac, lane 6: GTPγS /
GST-Rac, Lane 7: GDP / GST-H-Ra
s, Lane 8: GTPγS.GST-H-Ras.

FIG. 4 is a diagram showing dose-dependent activation of PKN kinase activity against αPKC peptide by RhoA protein.

FIG. 5 shows the effect of various low molecular weight G proteins on the kinase activity of PKN.

FIG. 6: Recombinant PKN and GTPγS · G in a cell-free system
5 is an electrophoretic photograph showing formation of a complex between ST-RhoA. Lane 1: GST, Lane 2: GDP-GST-Rho
A, lane 3: GTPγS / GST-RhoA, lane 4: GTPγS / GST-RhoA ^Asp38 , lane 5: GDP / GST-Rac, lane 6: GTPγS /
GST-Rac, Lane 7: GDP / GST-H-Ra
s, Lane 8: GTPγS.GST-H-Ras.

FIG. 7 is an electrophoretic photograph showing complex formation between PKN and RhoA protein in COS7 cells.
“Blot” is blot, “IP” is immunoprecipitation, “cy”
"tosol" cytosol, respectively.

FIG. 8 is an electrophoretic photograph showing promotion of PKN autophosphorylation reaction by LPA. Lane 1: No addition, Lane 2: C3, Lane 3: LP
A, lane 4: C3 + LPA.

[Fig. 9] Yeast two hybrid system (two hybr
Fig. 3 is a photograph (photograph of the morphology of an organism) showing the binding of PKN and RhoA protein by the id system).

FIG. 10 is a diagram schematically showing the structure of a fusion construct of each subunit of NF. The full length sequence of each subunit of NF is shown as a light black box. The thick box indicates the position of the rod domain of each subunit of NF. The VP16 transactivation domain (reticulated box), LexA DNA binding domain (hatched box), or glutathione S-transferase (black box) was fused with various deletion mutations of NF (white box). PGAD10-NFL # 21 isolated from the library is shown at the bottom of the figure. The box indicated by the broken line indicates the deleted sequence portion. T is Tth111I, X is XhoI, P is P
stI, B indicates BglII, and K indicates KpnI.

[Fig. 11] PKN using a two-hybrid system
Showing the measurement of binding between NF and NF (photograph of biological form)
It is. (A) VP16 transcription activation domain plasmid (pVP
16; lines 7 and 10), or head-rod domain of NFL (pVP-NFL # 21; lines 1-
3), the tail domain of NFL (pVP-NFLt; lines 4-6), PKNN1 (pVP-PKNN1; lines 8 and 11) and PKNC1 (pVP-PKNC).
1; the fusion plasmids encoding lines 9 and 12) were added to the DNA binding domain plasmid (pBTM116;
Lines 1 and 4), or the head-rod domain of NFL (pBTM-NFL # 21; lines 7-9),
NFL tail domain (pBTM-NFLt; lines 10-12), PKNN1 (pBTM-PKNN1; lines 2 and 5) and PKNN1 (pBTM-PKN).
C1; transformed into yeast with a fusion plasmid encoding lines 3 and 6). (B) NFL (pVP-NFL # 21; line 1), N
FM (pVP-NFMhr; line 2), and NFH
It encodes the head-rod domain of (pVP-NFHhr; line 3) and the tail domain of NFL (pVP-NFLt; line 4), NFM (pVP-NFMt; line 5), and NFH (pVP-NFHt; line 6). VP16 transcription activation fusion plasmid
It was transformed into yeast with a DNA binding domain fusion plasmid encoding KNN1 (pBTM-PKNN1; lines 1-6). In each transformation, non-selection (His
Five independent colonies were isolated from the (+) plates, rubbed on agar plates and grown for 3 weeks before the production of β-galactosidase was examined. Data are representative of 3 independent transformants.

FIG. 12 is an electrophoretic photograph showing the binding of PKN and NF in vitro. N-terminal region (PKN) of ³⁵ S-labeled PKN prepared by in vitro translation
N2), or the C-terminal region (PKNC2), was bacterially synthesized GST (lanes 4, 6, 10, and 1).
2) or various deletion fragments of GST-NFL (GST-NFL # 21, lanes 1, 5, 7 and 1).
1; GST-NFLdelA, lanes 2 and 8; GS
Incubated with T-NFLdelB, lanes 3 and 9). Proteins were collected on glutathione-Sepharose beads (G-Beads), SDS-PAG
E, analyzed by autoradiography by the method described in Example 7. In the figure, “Input” means G-Bea
10 μl of the binding reaction before ds treatment is shown. "G
-Beads "indicates the precipitate after the G-Beads treatment. The figure is a typical result of three independent experiments.

FIG. 13 is an electrophoretic photograph showing the binding of PKN and NF in vitro. ³⁵ S-labeled PKNN2 prepared by in vitro translation, bacteria in synthesized GST (lanes 4 and 8), or fused to GST NFL (GST-NFL # 21 , lanes 1 and 5), NFM (GST-NFMhr , Lanes 2 and 6) and NFH (GST-NFHhr, lanes 3 and 7) were incubated with the head-rod domain. Glutathione-Sepharose beads (G-Bea
After adding ds), the sample was processed as in FIG. In the figure, “Input” indicates 10 μl of the binding reaction solution before the G-Beads treatment. "+ G-Bead
"s" indicates the precipitate after treatment with G-Beads. The position of the labeled protein is indicated by an arrow. The position of the protein molecular weight marker is shown on the left side of the figure. The figure is 3
This is a typical result of one independent experiment.

FIG. 14 is an electrophoretic photograph showing phosphorylation of NF by PKN. a and b are SDS-PAGE silver stains and autoradiographs of purified bovine NF incubated with purified rat PKN for 5 minutes at 30 ° C. in the presence (lane 2) of 40 μM arachidonic acid (lane 1). Shown respectively. NFH, NFM and NFL are indicated by H, M and L on the left side of lane 2, respectively.

FIG. 15 is an electrophoretic photograph showing phosphorylation of NF by PKN. FIG. 3 shows the time course of phosphorylation of purified bovine NF containing triplet protein (complex composed of NFL, NFM and NFH) by PKN. 0 with rat purified PKN and 40 μM arachidonic acid at 30 ° C
Minutes (lanes 1 and 6), 10 minutes (lanes 2 and 7), 30 minutes (lanes 3 and 8), 60 minutes (lane 4)
And 9) and SDS-PA showing dephosphorylated (lanes 1-5) and phosphorylated (lanes 6-10) NF incubated for 120 minutes (lanes 5 and 10).
GE autoradiograph. NFL, NFM and NF
H is indicated by L, M and H to the right of lanes 5 and 10, respectively. The position of PKN autophosphorylation is indicated by a white arrow. The position of the molecular weight size marker is shown on the left.

FIG. 16 is a diagram showing phosphorylation of NF by PKN. The amount of radiolabel incorporated into each NF protein is shown. White circles: NFL pre-treated with alkaline phosphatase (denoted by dL), black circles: NFL not treated with alkaline phosphatase (denoted by L), white triangles: NFH pre-treated with alkaline phosphatase (denoted by dH), black triangles: NFH untreated with alkaline phosphatase (indicated by H), open squares: NFM pre-treated with alkaline phosphatase (indicated by dM), filled squares:
NFM (indicated by M) not treated with alkaline phosphatase. Data are representative of 3 independent experiments.

FIG. 17 is an electrophoretic photograph showing that the head / rod domain of each subunit of NF is phosphorylated. (A) and (B) are SDS-PAGE of PKN-phosphorylated GST and NF fusion proteins, respectively.
The protein staining and autoradiograph of are shown. G
ST-NFL (GST-NFL # 21; lane 1), G
Head-rod domains of ST-NFM (GST-NFMhr; Lane 3) and GST-NFH (GST-NFHhr; Lane 5), and GST-NFL (GST
-NFLt; lane 2), GST-NFM (GST-N
FMt; lane 4) and GST-NFH (GST-N
The tail domain of FHt; lane 6) is labeled with rat purified P
Incubated with KN and 40 μM arachidonic acid for 10 minutes at 30 ° C. as described in Example 9. GS
The positions of the tail domains of T-NFL, NFM and NFH are L, M and H on the right side of lane 6 in (A), respectively.
Indicated by The position of PKN autophosphorylation is indicated by the white arrow in (B). The position of the head / rod domain of the GST-NF subunit is indicated by a black arrow.

FIG. 18 is an electrophoretic photograph showing the effect of phosphorylation on NFL polymerization. ³⁵ S-labeled NFL prepared by in vitro translation and rat purified PKN
To GST synthesized in bacteria (lanes 5 and 1
0), head-rod domain of GST-NFL (GS
T-NFL # 21; lanes 1, 2, 6 and 7) or GST-full length NFL (GST-NFLf; lane 3,
4, 8 and 9) and in the presence (lanes 2, 4, 7 and 9) and absence of 100 μM ATP (lanes 1, 3, 5, 6, 8, 10). GS
The T or GST fusion protein was collected with glutathione Sepharose-beads (G-Beads) and subjected to SDS.
-Analyzed by PAGE and subsequently by autoradiography as described in Example 10. "Inpu
"t" is the reaction liquid before treatment with G-Beads, "+ G-
"Beads" indicates the precipitate after the G-Beads treatment. The figure is a typical result of three independent experiments.

FIG. 19: PKN with two-hybrid system
3 is a photograph (a photograph of a morphology of a living organism) showing the binding between the amino terminal region and the carboxyl terminal region of the above.

FIG. 20 is an electrophoretic photograph showing in vitro binding of each portion of PKN. In vitro ^{translation, 35} amino-terminal region (lane 1, 2, 5, 6) labeled with S or carboxyl-terminal region of GST (lane 3, 4, 7, 8) were synthesized in bacteria (lanes 1, 3, 5, 7) or GST fused to the amino-terminal region of PKN (lanes 4, 8) or GST fused to the carboxyl-terminal region of PKN (lanes 2, 6). Proteins were collected on glutathione sepharose beads (G-Beads) according to the method described in Example 2 and analyzed by autoradiography after SDS-PAGE. Input: 10 μl recovered before sedimentation
2 shows the initial binding reaction liquid of. The position of the labeled protein is indicated by an arrow. "Input" is G-Be
"+ G-Beads" represents a reaction liquid before the treatment with ads, and "+ G-Beads" shows a precipitate after the treatment with G-Beads. The position of the protein marker is shown on the right (kDa). The figure is a representative example from three independent experiments.

FIG. 21: [Ser ⁴⁶ ] PKN (39- by PKN
FIG. 53 is a view showing phosphorylation of 53). [Ser ⁴⁶ ] PKN (39-5) according to the method described in Example 13.
3) The peptide was phosphorylated by purified PKN. A double reciprocal plot of the data is shown.
Results are mean ± S.E. From independent experiments performed in duplicate. E. FIG. It is.

FIG. 22 shows inhibition of protein kinase activity of PKN using a synthetic peptide. The phosphorylated peptide substrate was used at various concentrations of PK at corresponding Km concentrations (10 μM for δPKC peptide and 16 μM for Kemptide).
N (39-53) peptide or PKN (54-73)
Used in the presence of peptide. PKN was measured using δPKC peptide as a substrate and PKN (39-53) peptide (black circle) or PKN (54-73) peptide (white circle) as an inhibitor. PKA was measured using Kemptide as a substrate and PKN (39-53) peptide as an inhibitor (white square). Protein kinase activity was determined according to the method described in Examples 13 and 14. Results are mean ± S.E. From independent experiments performed in duplicate. E. FIG. It is.

FIG. 23: P in the protein kinase activity of PKN
It is the figure which showed the effect of KN (39-53) peptide. (A) Double reciprocal plot at various PKN (39-53) concentrations. The concentrations of PKN (39-53) are 0 (black square), 40 (white square), and 80, respectively.
(Black triangle) and 120 (white triangle) μM. δ
The concentration of PKC peptide was 10, 20, 40,
80 μM. Example 13 for protein kinase activity
And 14 according to the method described. (B) Secondary plot of apparent Km / Vmax vs. inhibitor. Results are mean ± S.E. From independent experiments performed in duplicate. E. FIG. It is.

FIG. 24 is a photograph showing the binding of PKN and Rho protein using the yeast two-hybrid system (photograph of morphology of organism). “PKN” indicates the N-terminal regulatory region of PKN. “CLVL ⁻ ” indicates a deletion mutant of the RhoA protein lacking the C-terminal lipid modification site. Results are representative from 3 independent experiments.

FIG. 25 is a diagram showing the binding between PKN and Rho protein using the yeast two-hybrid system.
The degree of binding is shown as β-galactosidase activity. A schematic diagram of the entire PKN structure is drawn at the top of the figure, and the structure of the deletion mutant is drawn below it.
"LZ" indicates a leucine zipper-like motif. "+
"++" and "++" mean strong color development within 20 and 60 minutes from the start of the assay, respectively. "-" Is 24
It means that the color did not develop within the time.

FIG. 26 is an electrophoretic photograph showing the binding between Rho protein and the N-terminal regulatory region of PKN. Results are representative from 3 independent experiments. "Input" is G-
Reaction solution before treatment with Beads, "+ G-Bead
"s" indicates the precipitate after the G-Beads treatment.

FIG. 27 is an electrophoretic photograph showing the inhibition of Rho protein binding to the N-terminal regulatory region of PKN by a partial peptide of PKN. GTPγS.GST-RhoA was incubated with in vitro translated PKN in the presence of the partial peptides of PKN shown in the figure.
Results are representative from 3 independent experiments.

FIG. 28 is an electrophoretic photograph showing the inhibition of binding between the Rho protein and the N-terminal regulatory region of PKN by a partial peptide of PKN. GTPγS.GST-RhoA was incubated with in vitro translated PKN in the presence of the partial peptide of PKN shown in the photograph. Results are representative from 3 independent experiments.

FIG. 29 is a diagram showing the influence of the N-terminal region of PKN on the RhoA protein endogenous GTPase activity.
[ ^{Γ- 32} P] GTP-GST-RhoA (black circle, white circle, cross mark) or GST-RhoA ^Val14 (white triangle) was ^{added in} the presence (black circle) or absence (white circle) or GST (cross mark) of GST-PKN. Mark) and incubated for the times indicated and bound radioactivity was measured by filter binding assay. The residual [γ- ³² P] GTP bound to each protein was measured by the residual [γ- ³² P] at 0 minutes of incubation.
Expressed as a percentage of GTP. Results are representative from 3 independent experiments.

FIG. 30 shows the effect of the N-terminal region of PKN on Rho protein GTPase activity. GTPa
A dose-dependent effect of PKN on se has been shown. [Γ- ³² P] GTP • GST-RhoA was incubated for 10 minutes with various concentrations of the GST fusion protein in the N-terminal region of PKN. Results are representative from 3 independent experiments.

FIG. 31 shows the effect of PKN on Rho protein endogenous GTPase activity stimulated by GAP. 100 nM [γ- ³² P] GTP ・ GST
-RhoA for GST-RhoGAP and MBP-PK
Incubated in the presence of N 2. Results are representative from 3 independent experiments.

FIG. 32 is an electrophoretic photograph showing PKB immunoblotting. NIH3T3 cells (lanes 1, 4,
7, 8), Rat-1 cells (lanes 2, 5), and B.
Cell lysates (50 μg protein) from alb / c3T3 cells (lanes 3, 6) were subjected to SDS-PAGE,
It was then immunoblotted. Proteins were stained with Coomassie Brilliant Blue (CBB) (lanes 1-3). Immunostaining was performed using αC6 (lanes 4-6), αN2 (lane 7), and αF1 (lane 8). The position of the marker protein is kDa and P
The position of KN is indicated by an arrow.

FIG. 33 is an electrophoretic photograph showing the effect of heat shock on the intracellular distribution of PKN. The cells were treated at 42 ° C. for 90 minutes, homogenized and fractionated into cytosolic (C), plasma membrane (M) and nuclear (N) fractions. By immunoblotting using αC6, P
KN was detected. The position of PKN in control untreated cells (a) and heat shock cells (b) is indicated by arrows.
NIH3T3 cells: Each lane contains a total of 19 μg of protein. Rat-1 cells: 1 in each lane
It contains 1 μg of protein. Balb / c3T3 cells: Each lane contains a total of 11 μg of protein.

FIG. 34 is a photograph showing the effect of heat shock on NIH3T3 cells by PKN immunostaining (a photograph of the morphology of an organism). Control untreated cells (a-d), 42 ° C
Cells treated for 90 minutes in (e-h) and cells incubated for 90 minutes after heat shock at 37 ° C for 240 minutes (i-1) were immunostained with each antiserum. Primary antisera were αC6 (a, e, i), αN2 (b,
f, j), αF1 (c, g, k), and αPP2A
It was (d, h, 1).

FIG. 35 is a photograph showing the effect of heat shock on Rat-1 and Balb / c3T3 cells by PKN immunostaining (photograph of morphology of organism). Rat-1
(A, c, e) and Balb / c3T3 (b, d,
f) The cells were exposed to a heat shock of 42 ° C. The primary antiserum was αC6. Control untreated cells (a, b); cells 90 minutes after heat shock (c, d); cells incubated at 37 ° C. for 240 minutes after heat shock (90 minutes) (e, f).

FIG. 36 is a photograph (photograph of the morphology of an organism) showing the effect of heat shock on NIH3T3 cells. Control untreated cells (a) and cells treated at 42 ° C for 90 minutes (b) were immunostained with αC6 and observed by confocal laser scanning microscopy. Optical cleavage from the bottom of the cells was performed at the depths shown.

FIG. 37 is a photograph showing an effect of sodium arsenite on the immunofluorescent staining of PKN (a photograph of the morphology of organism).
Control untreated cells (a) and cells treated with 50 μM sodium arsenite at 37 ° C. for 2 hours (b) were immunostained with αC6.

FIG. 38 is a photograph showing an effect of serum starvation on immunofluorescent staining of PKN (photograph of morphology of organism). Control untreated cells (a), cells serum-starved at 37 ° C for 24 hours (b), and cells starved after serum starvation at 37 ° C with 10% FCS for 4 hours (c).
Were immunostained with αC6.

FIG. 39 is an electrophoretogram showing the effect of heat shock in PK ⁻ / neo # 5 cells overexpressing PKN-PK ⁻ mutant protein by immunoblotting and autophosphorylation of PKN. Wild type NIH3T
3 cells (lanes 1, 3, 5) and PK ⁻ / neo # 5
Lysates of cells (lanes 2, 4, 6) were added to SDS-PA.
GE and protein stained with Coomassie Brilliant Blue (CBB) (lane 1,
2) followed by immunoblotting with αC6 (lanes 3, 4). Immunoprecipitations were performed from these cells using αN2. Immunoprecipitates were autophosphorylated and subjected to SDS-PAGE followed by autoradiography (lanes 5,6). The position of the marker protein is indicated in kDa and the position of PKN is indicated by an arrow.

FIG. 40 is a photograph showing the effect of heat shock in PK ⁻ / neo # 5 cells overexpressing PKN-PK ⁻ mutant protein by PKN immunofluorescence (photograph of morphology of organism). Control untreated cells (a), 42 ° C
(B) treated for 90 minutes at 90 ° C. and cells treated for 90 minutes at 44 ° C. (c) were immunostained with antiserum αC6. Optical sectioning at the center of the nucleus was performed at 2.5 μm from the bottom of the cell using a confocal laser-microscope.

FIG. 41 is a schematic representation of the expression constructs of human PKN and the results of their binding by the two-hybrid system. A schematic of the entire structure of the protein is shown at the top of each figure, with deletion mutants of the protein aligned below. The numbers before and after each line indicate the positions of the amino acid residues at each end of each clone, as indicated by the filled or unfilled boxes. Two-hybrid system coupling is β-
Tested by filter assay for galactosidase activity. “+++” and “+” are respectively
Blue development occurs within 20 minutes and 24 hours after the start of the assay. “±” indicates light blue color development 24 hours after the start of the assay, and “−” indicates no color development within 24 hours. Gal4bd and LexA
bd indicates the DNA binding domains of Gal4 and LexA, respectively. Gal4ad and VP16ad
Indicate the transcriptional activation domains of Gal4 and VP16, respectively. "LZ" indicates a leucine zipper-like motif. "BR" indicates a region rich in basic amino acids. Filled boxes indicate bite constructs.

FIG. 42 is a schematic representation of the expression constructs of HuActSk1 (skeletal muscle α-actinin) and HuActNm (non-skeletal muscle α-actinin) and their binding by the two-hybrid system. Abbreviations in the figure have the same meaning as in FIG. "SR" indicates spectrin-like repeats.

FIG. 43: PK in two-hybrid system
5 is a photograph showing the binding between N and HuActSk1. P
KNN1 (lanes 1-4) or murine tumor suppressor p53 (amino acids 72-390) (lanes 5-8) was expressed as a fusion protein with the LexA DNA binding domain and SV40 expressed as a fusion protein with the Gal4 activation domain. large T antigen (amino acids 84-708) (lanes 1 and 5), clone # 21
Proteins (2 and 6), clone # 4 proteins (3 and 7), and clone # 10 proteins (4
And binding with 8) was tested by a filter assay for β-galactosidase activity. Clone # 2
1 encodes the head-rod domain of the neurofilament L protein (Mukai, H. et al., J. Biol.
Chem., 271, 9816-9822 (1996)). Trp and Le
Blue development is shown 1 h after the start of the filter assay of independent colonies separated from selected plates lacking u.

FIG. 44 is an electrophoretic photograph showing an in vitro binding assay between PKN and HuActSk1. N-terminal region of ³⁵ S-labeled in vitro translated PKN (amino acids 1-
474, this region was designated PKNN2; lanes 1-
7 and 11-17) or that of PKNΔBal (amino acids 136-474; lanes 8-10 and 18-2).
0) and GST synthesized in E. coli or GST and FIG.
The fusion proteins were incubated with various deletion mutants of HuActSk1 as shown in. An aliquot (10 μl) of the initial binding reaction mixture was removed prior to sedimentation and electrophoresed (these electrophoresis are labeled “Input” in the figure above). GST or GST fusion proteins were collected on glutathione-Sepharose beads and analyzed by 10% SDS-PAGE followed by autoradiography (these are shown in the figure below as "G-bea").
"ds"). Lanes 1 and 11, GST-H
uActSk1 (333-423); lanes 2, 8, 1
2, and 18, GST-HuActSk1 (423-
653); lanes 3, 9, 13, and 19, GST-.
HuActSk1 (653-837); lanes 4 and 14, GST-HuActSk1 (837-894);
Lanes 5 and 15, GST-HuActSk1 (48
6-607); lanes 6 and 16, GST-HuAc.
tSk1 (604-719); lanes 7, 10, 17,
And 20, GST. White arrowheads are labeled PKNN
2 position, black arrowhead is labeled PKNΔBa
The position of 1 is shown. Molecular weight markers are shown in kDa.

FIG. 45 is an electrophoretic photograph showing the binding between PKN and HuActNm. ³⁵ S-labeled in vitro translated PKN
N2 was incubated with E. coli synthesized GST or various deletion mutants of HuActNm fused to GST as shown in FIG. 42. Aliquots (10 μl) of the initial binding reaction mixture were removed prior to sedimentation and subjected to electrophoresis (these were designated as “Input”).
GST or GST fusion protein was collected on glutathione-Sepharose beads, 10% SDS-PAGE,
It was then analyzed by autoradiography. White arrowheads indicate the location of labeled proteins. Molecular weight markers are shown in kDa. A: Specific binding of PKN to HuActNm deletion mutants. Lanes 1 and 4, GST-HuActNm.
(Amino acids 479-600); lanes 2 and 5, GS.
T-HuActNm (amino acids 712-834); lanes 3 and 6, GST. B: Effect of Ca ^{2+ on} the binding of HuActNm to the EF-hand-like region. GST-HuActNm (amino acids 712-834) was added in the absence of Ca ²⁺ (lane 1).
And 3) or in the presence of 1 mM Ca ²⁺ (lane 2
And in 4) incubated with in vitro translated PKN.

FIG. 46 is an electrophoretic photograph showing specific binding of spectrin-like repeats of α-actinin to PKN.
³⁵ S-labeled in vitro translated PKNN2 was incubated with spectrin-like repeats of α-actinin fused with GST or GST synthesized in E. coli or spectrin repeats of α-spectrin. Aliquots (10 μl) of the initial binding reaction mixture were removed prior to precipitation and electrophoresed (these were designated as “Input”). GST or GST fusion protein was collected on glutathione-Sepharose beads and 10% SDS-P
It was analyzed by AGE followed by autoradiography. White arrowheads indicate the location of labeled proteins.
Molecular weight markers are shown in kDa. Lanes 1 and 5, spectrin-like repeat 3 of GST-HuActSk1 (amino acids 486-607); lanes 2 and 6, spectrin-like repeat 3 of GST-HuActNm (amino acids 479-600); lanes 3 and 7, G
ST-α-spectrin spectrin repeat 20;
Lanes 4 and 8, GST.

FIG. 47 is an electrophoretic photograph showing in vivo binding between PKN and HuActSk1. Vector pHA-Act (lanes 1, 3, 5) encoding a HA epitope fused to amino acids 333-894 of HuActSk1 (lanes 1, 3, 5) or pHA vector (2, 4, 6) was added to full-length human PK.
The expression vector pMhPKN3 encoding N (Mukai,
H. & Ono, Y., Biochem. Biopys. Res. Commun. 199, 8
97-904 (1994)) into COS7 cells. Cells were extracted and recombinant polypeptides were immunoprecipitated using anti-HA antibody 12CA5.
PKN and HuActSk1 in each extract (lanes 3-6) and each immunoprecipitate (lanes 1-2) were labeled with anti-PKN antiserum αC6 (lanes 1-4) and 1 respectively.
Detection was by immunoprecipitation using 2CA5 (lanes 5 and 6). White arrows indicate the position of PKN. The black arrow indicates the position of HA-HuActSk1.

FIG. 48: P for PKN-α-actinin binding
It is an electrophoresis photograph which showed the effect of I4,5P2. ³⁵
The full-length coding region of S-labeled in vitro translated HuActSk1 was incubated with E. coli synthesized GST or GST-fused PKNN1. Aliquots (10 μl) of the initial binding reaction mixture were removed prior to precipitation and electrophoresed (these were labeled “Inpu”).
"t"). GST or GST fusion protein was collected on glutathione-Sepharose beads and 8% S
Analyzed by DS-PAGE followed by autoradiography. The arrow indicates the position of labeled HuActSk1. A: In the absence of 10 μM PI4,5P2 (lane 1,
2, 5, and 6) or in the presence (lanes 3, 4, 7,
And specific binding of full length α-actinin and PKN in 8). Lanes 1, 3, 5, and 7, GST-P
KNN1; lanes 2, 4, 6, and 8, GST. B: Effect of the concentration of PI4,5P2 on the binding activity of full-length α-actinin and PKN. Lanes 1 and 6,0
μM PI 4,5P2; lanes 2 and 7, 2.5 μM
PI 4,5P2; lanes 3 and 8, 10 μM PI
4,5P2; lanes 4 and 9, 30 μM PI4,5
P2; lanes 5 and 10, 100 μM PI4,5P
2.

FIG. 49 is an electrophoretic photograph showing phosphorylation of actin and actin-binding protein by PKN. 10
0 ng of purified G-actin (lanes 1-3) or caldesmon (lanes 4-6) purified from rat testis in the absence (lanes 1 and 4) or in the presence (lanes 2, 3, 5). , And 6) in the assay mixture in the absence (lanes 2 and 5) or presence (lanes 3 and 6) of 40 μM arachidonic acid. Phosphorylation was detected by 10% SDS-PAGE autoradiography. White arrowheads indicate the location of PKN autophosphorylation. The black arrow indicates the position of Caldesmon, and the black arrowhead is G
-Indicates the position of actin.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical indication C12N 1/21 C12P 21/02 C 5/10 9452-4B C12Q 1/48 Z C12P 21/02 C12N 9/12 C12Q 1/48 A61K 37/52 ADU // C12N 9/12 C12N 5/00 B (C12N 1/19 C12R 1:85) (C12N 1/21 C12R 1:19) (C12N 5/10 C12R 1 : 91) (C12P 21/02 C12R 1:19) (C12P 21/02 C12R 1:85) (C12P 21/02 C12R 1:91) (31) Priority claim number Japanese Patent Application No. 8-114226 (32) Priority Hihei 8 (1996) April 11 (33) Priority claiming country Japan (JP) Application for application of Article 30 (1) of the Patent Act 1995 Vol. 67, No. Published in "Biochemistry Vol.67, No.7"

Claims (66)

[Claims] 1. A peptide or a derivative thereof having a modified amino acid sequence of protein kinase N, which has an active Rho protein-binding ability and does not have protein kinase activity. 2. A peptide or a derivative thereof having a modified amino acid sequence of protein kinase N which inhibits the binding between activated Rho protein and protein kinase N. 3. A peptide or peptide having an active Rho protein-binding ability, having no protein kinase activity, and having a modified amino acid sequence of protein kinase N which inhibits the binding between active Rho protein and protein kinase N. Its derivatives. 4. The peptide or derivative thereof according to any one of claims 1 to 3, wherein the Rho protein is selected from the group consisting of RhoA protein, RhoB protein, RhoC protein, and RhoG protein. 5. Having an active RhoA protein-binding ability,
A peptide or a derivative thereof having a modified amino acid sequence of human-protein kinase N which does not have serine / threonine protein kinase activity. 6. Having an active RhoA protein-binding ability,
Human-protein kinase N having no serine / threonine protein kinase activity and inhibiting binding of activated RhoA protein to protein kinase N
Or a derivative thereof having a modified amino acid sequence of. 7. A modified amino acid sequence of 7 to 54 of SEQ ID NO: 1.
0, 7-155, 1-540, 3-135, or 33-111 amino acid sequence, or active R
The peptide or derivative thereof according to any one of claims 1 to 6, which comprises these modified amino acid sequences having an ho protein-binding ability and / or an activity-type Rho protein-protein kinase N binding inhibition ability. 8. A modified amino acid sequence consisting of 74 to 9 of SEQ ID NO: 1.
No. 3, 94 to 113, or 82 to 103 amino acid sequence, or these modified amino acid sequences having an active Rho protein binding ability and / or an ability to inhibit the binding of the activated Rho protein and protein kinase N, The peptide or derivative thereof according to any one of claims 1 to 7. 9. A protein kinase N having an intermediate filament binding ability and having no protein kinase activity.
Or a derivative thereof having a modified amino acid sequence of. 10. The intermediate filaments are vimentin, neurofilament-L, neurofilament-M,
The peptide according to claim 9, which is selected from the group consisting of neurofilament-H, acidic keratin, neutral keratin, basic keratin, desmin, glial fibrillary acidic protein (GFAP), lamin, and nestin, or a peptide thereof. Derivative. 11. The modified amino acid sequence is the amino acid sequence of 1 to 540, 1 to 32, 112 to 540 or 112 to 474 of SEQ ID NO: 1 or these modified amino acid sequences having an intermediate filament binding ability. Is,
The peptide according to claim 9 or 10, or a derivative thereof. 12. A peptide or a derivative thereof having a modified amino acid sequence of protein kinase N, which has α-actinin binding ability and does not have protein kinase activity. 13. The peptide or derivative thereof according to claim 12, wherein the α-actinin is skeletal muscle type or non-skeletal muscle type. 14. The modified amino acid sequence is the amino acid sequence of 1 to 540th, 3rd to 135th, 136th to 540th, or 136th to 189th of SEQ ID NO: 1 or these modified amino acids having α-actinin binding ability. Is an array,
The peptide according to claim 12 or 13, or a derivative thereof. 15. A peptide or a derivative thereof, which has a modified amino acid sequence of protein kinase N, which has a protein kinase catalytic domain binding ability of protein kinase N and does not have protein kinase activity. 16. The modified amino acid sequence is the amino acid sequence of 1 to 540 or 1 to 474 of SEQ ID NO: 1 or these modified amino acid sequences having the ability to bind the protein kinase catalytic domain of protein kinase N. 15. The peptide according to 15 or a derivative thereof. 17. A peptide or derivative thereof which has a modified amino acid sequence of protein kinase N which inhibits the protein kinase activity of protein kinase N and has no protein kinase activity. 18. The peptide or derivative thereof according to claim 17, wherein the modified amino acid sequence is the amino acid sequence of amino acids 39 to 53 of SEQ ID NO: 1 or a modified amino acid sequence thereof having the ability to inhibit the activity of protein kinase. 19. A peptide having the modified amino acid sequence of protein kinase N, which has a protein kinase N-binding ability of protein kinase N, inhibits the protein kinase activity of protein kinase N, and has no protein kinase activity. Its derivatives. 20. The modified amino acid sequence has the amino acid sequence of 1 to 540, 1 to 474 or 39 to 53 of SEQ ID NO: 1 or the protein kinase N binding ability of protein kinase N, and a protein The peptide or a derivative thereof according to claim 19, which is a modified amino acid sequence thereof having the ability to inhibit protein kinase activity of kinase N. 21. Protein kinase N from cytoplasm to nucleus
The peptide or a derivative thereof according to any one of claims 1 to 20, which inhibits the migration of the peptide. 22. A peptide or a derivative thereof, which has a modified amino acid sequence of protein kinase N which is phosphorylated by protein kinase N and has no protein kinase activity. 23. The peptide or derivative thereof according to claim 22, wherein the modified amino acid sequence is the sequence shown in SEQ ID NO: 2 or a modified amino acid sequence thereof phosphorylated by protein kinase N. 24. A modified amino acid sequence of an intermediate filament phosphorylated by protein kinase N,
A peptide or derivative thereof. 25. The intermediate filaments are vimentin, neurofilament-L, neurofilament-M,
The peptide according to claim 24 or a peptide thereof, which is selected from the group consisting of neurofilament-H, acidic keratin, neutral keratin, basic keratin, desmin, glial fibrillary acidic protein (GFAP), lamin, and nestin. Derivative. 26. The modified amino acid sequence of the intermediate filaments has a vimentin head-rod domain, a neurofilament-L head-rod domain, a neurofilament-M head-rod domain, and a neurofilament-H head. 25. The peptide or derivative thereof according to claim 24, which is selected from the group consisting of rod domains. 27. The modified amino acid sequence of the intermediate filament is human-neurofilament-L 1-349.
Amino acid sequence or human-neurofilament-
27. The peptide or derivative thereof according to claim 26, which is the amino acid sequence of the 1st to 411st amino acids of M. 28. The peptide or derivative thereof according to any one of claims 1 to 27, wherein the protein kinase N or the intermediate filament is derived from mammals. 29. The peptide or derivative thereof according to claim 28, wherein the protein kinase N or the intermediate filament is of human origin. 30. A peptide or derivative thereof having a modified amino acid sequence of a cytoskeletal protein having protein kinase N-binding ability. 31. The peptide or derivative thereof according to claim 30, wherein the cytoskeletal protein is α-actinin or an intermediate filament. 32. The modified amino acid sequence of α-actinin is the human skeletal muscle type α-actinin, numbered 423 to 653,
653-837 number, 486-607 number, or 333-
The peptide or its derivative according to claim 31, which has the amino acid sequence of 894th amino acid or the amino acid sequence of human non-skeletal muscle α-actinin of 479th to 600th or 719th to 843th. 33. The modified amino acid sequence of the intermediate filament is human-neurofilament-L 1-349.
Amino acid sequence or human-neurofilament-
32. The peptide or derivative thereof according to claim 31, which is the amino acid sequence of 1 to 411 of M. 34. A base sequence encoding the peptide according to any one of claims 1 to 33 or a derivative thereof. 35. A vector comprising the nucleotide sequence according to claim 34. 36. The vector according to claim 35, which is selected from the group consisting of a plasmid vector, a viral vector, and a liposome vector. 37. A host cell transformed with the vector according to claim 35 or 36 (however, human cells are limited to cells isolated from human). 38. Escherichia coli, yeast, insect cell, nematode cell, C
38. The host cell of claim 37, which is selected from the group consisting of OS cells, lymphoid cells, fibroblasts, CHO cells, blood cells, and tumor cells. 39. Culturing a host cell according to claim 37 or 38 and isolating the peptide according to any one of claims 1 to 33 or a derivative thereof from the culture. A method for producing the peptide or a derivative thereof according to any one of claims 1 to 33. 40. A tumorigenesis or metastasis inhibitor comprising the peptide according to any one of claims 1 to 33 or a derivative thereof. 41. The tumor formation or metastasis suppressor according to claim 40, which suppresses tumor formation or metastasis involving active Rho protein. 42. A gene therapeutic agent for suppressing tumor formation or metastasis, which comprises a nucleotide sequence encoding the peptide according to any one of claims 1 to 20. (1) A substance to be screened is present in a screening system containing active Rho protein and protein kinase N or the peptide or derivative thereof according to any one of claims 1 to 8. And (2) measuring the degree of inhibition of binding between the activated Rho protein and protein kinase N or the peptide according to any one of claims 1 to 8 or a derivative thereof, And a screening method for a substance that inhibits the binding of protein kinase N. 44. The screening method according to claim 43, wherein the screening system is a cell system or a cell-free system. 45. The screening method according to claim 43 or 44, wherein the screening system is a two-hybrid system. 46. The method according to claim 43, wherein the cell line is a yeast cell line.
The screening method according to any one of 45. 47. (1) The substance to be screened is present in a screening system containing the activated Rho protein and the peptide or derivative thereof according to any one of claims 1 to 8, and (2) ) A method for screening a substance that inhibits the activity of Rho protein GTPase, which comprises measuring the degree of inhibition of the activity of Rho protein GTPase. 48. (1) The substance to be screened is an activated Rho protein, the peptide or derivative thereof according to any one of claims 1 to 8, and R
ho protein GTPase activating protein (GA
Ph), and (2) measuring the degree of inhibition of the activity or enhancement of activity of the active Rho protein GTPase.
A screening method for a substance that inhibits the activity or enhancement of the activity of o-protein GTPase. 49. The screening method according to claim 47 or 48, wherein the screening system is a cell system or a cell-free system. (1) A substance to be screened is present in a screening system containing an intermediate filament and protein kinase N or the peptide or derivative thereof according to any one of claims 9 to 11, And (2) intermediate filament and protein kinase N
Alternatively, a screening method for a substance that inhibits the binding between the intermediate filament and the protein kinase N, which comprises measuring the degree of inhibition of the binding between the peptide according to any one of claims 9 to 11 or a derivative thereof. 51. The screening method according to claim 50, wherein the screening system is a cell system or a cell-free system. 52. The screening method according to claim 50 or 51, wherein the screening system is a two-hybrid system. 53. The method according to claim 50, wherein the cell line is a yeast cell line.
52. The screening method according to any one of 52. 54. (1) A substance to be screened is present in a screening system comprising an intermediate filament and a peptide having a modified amino acid sequence having protein kinase N or protein kinase activity or a derivative thereof, and ( 2) A screening method for a substance that inhibits polymerization of intermediate filaments, which comprises measuring the degree of inhibition of polymerization of intermediate filaments. 55. The screening method according to claim 54, wherein the screening system is a cell system or a cell-free system. 56. (1) A screening system comprising a substance to be screened, which comprises skeletal muscle α-actinin and protein kinase N or the peptide or derivative thereof according to any one of claims 12 to 14. And (2) determining the extent of inhibition of binding of skeletal muscle α-actinin to protein kinase N or the peptide or derivative thereof according to any one of claims 12-14. A screening method for a substance that inhibits the binding between skeletal muscle α-actinin and protein kinase N. 57. (1) The substances to be screened are non-skeletal muscle α-actinin, protein kinase N or the peptide or derivative thereof according to any one of claims 12 to 14, and calcium ion. (Ca ²⁺ )
And (2) the degree of inhibition of the binding of non-skeletal muscle α-actinin to protein kinase N or the peptide or derivative thereof according to any one of claims 12 to 14. And a method for screening a substance that inhibits the binding between non-skeletal muscle α-actinin and protein kinase N. 58. The screening system further comprises PI4,5.
58. The screening method according to claim 56 or 57, wherein P2 is present. 59. The screening method according to any one of claims 56 to 58, wherein the screening system is a cell system or a cell-free system. 60. The screening method according to any one of claims 56 to 59, wherein the screening system is a two-hybrid system. 61. The screening method according to any one of claims 56 to 60, wherein the cell line is a yeast cell or a COS7 cell. 62. (1) The substance to be screened is present in a screening system containing a protein kinase N or a peptide having a modified amino acid sequence thereof having protein kinase activity or a derivative thereof, and (2) the above protein kinase. A method for screening a substance that inhibits the activity of protein kinase N, which comprises measuring the degree of inhibition of the activity of N protein kinase. 63. (1) The substances to be screened are activated Rho protein and protein kinase N.
Or a peptide having the modified Rho protein binding ability and a peptide having a modified amino acid sequence thereof having protein kinase activity or a derivative thereof, and (2) the above protein kinase N
Kinase N, which comprises measuring the degree of inhibition of protein kinase activity or enhancement of its activity
A method for screening a substance that inhibits the activity of the activated Rho protein-dependent protein kinase or the enhancement of the activity. 64. Vimentin, neurofilament-L, neurofilament-M, neurofilament-H, and neurofilament (NF) triplets (NF-L, NF) are used to determine the degree of inhibition of protein kinase activity or enhancement of its activity. -M and NF-H), αPKC peptide, δPKC peptide, peptide described in SEQ ID NO: 2, caldesmon, and G-
64. The screening method according to claim 62 or 63, which is measured using a substrate selected from the group consisting of actin. 65. The screening method according to any one of claims 62 to 64, wherein the screening system is a cell system or a cell-free system. 66. The screening method according to any one of claims 43 to 65, which is a screening method for a tumor formation or metastasis inhibitor.