JPH09298981A - Transgenic pig - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a transgenic mouse, created by transducing an exogenote capable of expressing a human growth hormone and capable of expressing a human growth hormone gene in a mammary gland and mass-producing the human growth hormone in a porcine milk at a low cost. SOLUTION: This transgenic mouse is created by transducing an exogenote such as a fused gene, capable of expressing a human growth hormone and prepared by bonding a human growth hormone gene to the downstream side of a region for controlling the expression of a bovine α S1 casein gene and is capable of expressing the human growth hormone in a mammary gland.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD OF THE INVENTION The present invention relates to a novel transgenic pig designed to produce human growth hormone in milk. The transgenic pig of the present invention provides a method for producing human growth hormone in pig milk at low cost and in large quantities, and can cope with future expansion of the required amount of human growth hormone.

[0002]

Background Art Human growth hormone (hereinafter sometimes abbreviated as hGH) is a peptide hormone consisting of 191 amino acid residues secreted from the pituitary gland. Currently hG
H is manufactured by applying gene recombination technology. Its clinical indication is low growth in pituitary dwarfism without epiphyseal closure or Turner's syndrome without epiphyseal closure showing growth hormone deficiency. In addition, the usage is 0.5 unit / kg body weight per week (purified gene recombinant hGH is about 3 unit / mg). The market size in Japan in 1995 is about 71 billion yen on a drug price basis (the drug price as of August 1995 is 5940 yen / 4 unit), and the annual usage amount is about 16 kg.
Is calculated. This is a biopharmaceutical that is used in large quantities. Physiological actions of hGH are growth-promoting actions, as well as protein-anabolism promoting actions, lipid metabolism actions (lipid catabolism actions), glucose metabolism actions (glucose-preserving actions), electrolyte metabolism (Na, K, P, Ca storage actions) , Etc., clinical development is being carried out as a therapeutic agent for short stature due to chronic renal failure without epiphyseal closure, short stature due to chronic renal failure and chondrodystrophy, and further wasting and weight loss of HIV patients, It is expected that the required amount will further increase in the future. In recent years, the establishment of gene manipulation technology has led to the development of pharmaceuticals (biopharmaceuticals) that have produced rare human proteins that could not be obtained in the past using recombinant microorganisms or recombinant animal cells. Is recognized in. However, in the production of biopharmaceuticals, it is difficult to obtain high protein production efficiency, and the production cost is high. Under such circumstances, it is desired to develop an inexpensive manufacturing method for reducing the expanding medical cost.

On the other hand, research and development of inexpensive protein production technology (animal bioreactor) by gene manipulation utilizing the excellent protein synthesizing ability possessed by animals found in milk, eggs, blood, etc. has been vigorously carried out. There is. In particular, livestock such as cows, pigs, sheep, and goats have already been tried with some proteins because they have milk production capacity capable of producing a large amount of substances. For example, WO 94/05796 and Proc.
Natl. Acad. Sci. USA, 88, 12003-12007 (1992) describes a method for producing human protein C in pig milk. In addition, the production of whey acidic protein (WAP) in mice in pig milk was confirmed by Proc. Natl. Acad. Sc.
i. USA, 88,1697-1700 (1991) and Transgenic Res., 1, 1
24-132 (1992). In addition, the production of growth hormone in the milk of transgenic mice was
506751, JP 6-339331, Transgenic Res., 3, 79-89
(1994), the production of growth hormone in milk of transgenic rats is disclosed in JP-A-5-123083 and Mol. Reprod. Dev.,
37, 276-283 (1994). However, since the milk yield of these small experimental animals is small, it is difficult to supply the expected large amount of hGH in the future.

Promotion of animal growth by growth hormone is described in Japanese Patent Publication No. 1-503039 (WO 88/08026) and WO 94/04672. However, growth hormone also exhibits a damaging effect on individual animals due to its physiological effects. In transgenic animals that express the growth hormone gene, continued exposure to unnecessary growth hormone causes gastric ulcer, arthritis, cardiomyopathy, dermatitis, nephropathy, renal glomerulosclerosis, stress hypersensitivity, and female estrus. , Various disorders such as lack of sexual drive in males can be caused Science, 244, 1281-1288 (1988)
, Am. J. Pathol., 137, 541-552 (1990), J. Reprod.
Fertil. (Supple), 40, 235-245 (1990), Lab. Inves
t., 65, 601-605 (1991), Endocrinology, 130, 405-4
14 (1992).

[0005] Since milk is produced only during the rearing period of the offspring and released promptly from the breast, the transgenic animal producing hGH in the milk can minimize damage to the animal individual by hGH. Therefore, it becomes an effective means of material production. As described above, mice and rats that produce hGH in milk have been created. However, since it is difficult to produce a large amount of hGH in these small experimental animals, development of a method for producing hGH in livestock milk having a large milk production capacity is desired. Pig milk production capacity is 5-6
L / day is large and the lactation period is 8-9 weeks. Therefore, if transgenic pigs that produce hGH in milk can be produced, it is possible to provide an inexpensive method for producing hGH that can sufficiently meet the required amount that is expected to expand in the future.

[0006]

In order to solve the problem of establishing a means for inexpensively producing hGH in milk,
It is necessary to introduce a fusion gene expressing the hGH gene into a pig under the control of a promoter of a milk protein gene specifically expressed in the mammary gland to produce a transgenic pig expressing the hGH gene in the mammary gland. In addition, since the produced transgenic pigs can rapidly release the produced hGH into milk, unnecessary exposure to hGH can be avoided, and various damages to animal individuals due to the biological activity of hGH can be prevented. I do not receive it. Therefore, as a result of earnest research, the present inventors have completed a new transgenic pig that produces hGH in milk. Therefore, an object of the present invention is to provide a novel transgenic pig that produces hGH in milk.

[0007]

The present invention relates to a novel transgenic pig producing hGH in milk, which is produced by introducing a foreign gene expressing human growth hormone. More specifically, the present invention is a human gene transformed with a fusion gene in which the hGH gene is linked downstream of the gene expression control region of the bovine αS1 casein gene, which is a protein specifically expressed in the mammary gland and secreted in milk. It relates to a novel transgenic pig designed to produce growth hormone in milk. As mentioned above, human protein C is an acidic whey protein (WA
P) has been successfully expressed in pigs by fusion with the gene. In addition, hGH has been successfully expressed in small animals such as rats and mice by fusion with the WAP gene, but it is not found in large animals such as pigs. The present inventors transform swine with a fusion gene in which the hGH gene is linked downstream of the gene expression control region of bovine αS1 casein gene, which is different from the WAP gene and has excellent mammary gland-specific expression. The human growth hormone gene can be expressed in the mammary gland of the.

[0008]

BEST MODE FOR CARRYING OUT THE INVENTION The transgenic pig of the present invention is produced as follows. That is, in the already systematized rat, it was confirmed that hGH was produced at a high concentration in milk, and the fusion gene (bα that was linked to the hGH gene downstream of the gene expression control region of bovine αS1 casein gene)
S1CN / hGH) (described in Mol. Reprod. Dev., 37, 276-283 (1994)) is microinjected into the pronucleus of pronuclear stage fertilized eggs of pigs. The fertilized egg obtained is transferred into the oviduct of a foster mother pig to develop, and a gene-introduced individual is selected from the resulting offspring. Furthermore, a method for confirming the expression of the transgene in neonatal mammary gland tissue obtained by biopsy from the selected individual (Mol. Reprod. Dev., 43, 145-149 (1996)
According to (1) above, a transgenic pig that produces hGH in milk can be obtained by early prediction and selection of individuals who produce hGH in milk. In addition, the present inventors also proposed a fusion gene in which the hGH gene was linked to the downstream of the gene expression control region of the bovine β-casein gene.
(bβCN / hGH) was microinjected into the pronucleus of porcine pronuclear stage fertilized eggs in the same manner as described above, and the same method as described above was performed.

The present invention will be described in more detail by the following examples, but these are merely examples and the present invention is not limited thereto.

[0010]

Example 1 Method for Preparing Fusion Gene Two kinds of fusion genes designed to express hGH in porcine mammary gland, that is, fusion gene in which hGH gene is linked downstream of gene expression control region of bovine αS1 casein gene
(bαS1CN / hGH), or a fusion gene (bβCN / hGH) in which the hGH gene is linked to the downstream of the gene expression control region of the bovine β-casein gene is the method of Ninomiya et al. (Mol.Reprod. Dev.,
37, 276-283 (1994)). Fusion gene
After purification using GENECLEAN II (BIO 101),
It was prepared with an injection buffer (10 mM Tris-HCl containing 0.1 mM EDTA, pH 7.5) so that the concentration was 5 μg / ml. In addition, when there was a period (storage time) until the injection operation, it was stored at -20 ° C.

[0011]

Example 2 Fertilized egg acquisition (donor) pig and microinjection
Treatment of fertilized egg transplant foster parent (recipient) pig condition
Manufacturing Method The porcine donor and recipient used in the present invention were prepared as follows. 1) Induction treatment of estrus An immature sow (6 to 7 months old, a hybrid pig for meat; body weight of 100 to 110 kg) was supplemented with 1,000 units of eCG (pregnant mare serum gonadotropin; serotropin, Teikoku Organ Co., Ltd.) muscle. 72 hours after that, 500 units of hCG (human chorionic gonadotropin; pverogen, Sankyo Organ) were intramuscularly injected to induce estrus. 2) Preparation of fertilized egg acquisition (donor) pig For the sow which induced estrus by the above hormone treatment, h
Natural mating or artificial insemination was performed 32-34 hours after CG administration. 3) Preparation of foster parent pig (recipient) As a foster parent (recipient) into which the microinjected fertilized egg was transplanted, a sow which induced estrus by the above hormone treatment was used.

[0012]

Example 3 Fertilized egg collection method and microinjection method Fertilized egg collection and microinjection into the fertilized egg were carried out in the following manner. 1) Collection Method of Fertilized Eggs Fertilized eggs were collected from the donors by surgically operating the sows obtained in Example 2 which were subjected to natural mating or artificial insemination. That is, the donor pig obtained in Example 2 was subjected to laparotomy 50 to 56 hours after the hCG treatment, and both oviducts were perfused upward to collect ova (fertilized eggs). Laparotomy
First, a sedative (Azaperone manufactured by Sankyo Co., 300 mg / head) was intramuscularly injected into pigs. Approximately 20 minutes later, anesthesia agent (Yoshitomi Pharmaceutical Co., thiamylal sodium, 0.5 g / head) was administered through the ear vein to induce anesthesia, and then a mixed gas vaporized to laughing gas and oxygen (Hoechst Japan halothane, General anesthesia was performed. Open the lower abdomen about 10 cm to the midline, take out the fallopian tube, and use the perfusate (Dulbecco's PBS + 1%
FCS + antibiotics [75 μg / mL Penicilin- G + 50 μg / mL S
about 20 ml, and the oviduct was perfused upward to collect ova. The eggs obtained were collected under a stereomicroscope and washed (Hepes-MEM solution; 21 mM Hepes + 0.336 g).
/ L Sodium bicarbonate ＋ 5g / L BSA ＋ antibiotic) 3 in
It was washed by moving it twice.

2) Method of microinjection From the eggs collected by the above-mentioned treatment, an egg in which sperm attachment was observed in the zona pellucida at the 1-cell stage was selected as a fertilized egg, and 13,000 rpm (to visualize the pronucleus). 13,000XG), 8-10
Centrifugation was performed at 25 ° C. for 15 minutes (micro high-speed centrifuge MRX-150: Angle rotor (TMA-2), Tommy). The injection needle (micropipette) was prepared according to a conventional method. Glass capillary tube (G-1, Narimosha), puller (PN-3,
Narishigesha), Microforge (MF-79, Narishigesha) are used, the glass capillary tube is cut off by a puller, and hydrogen fluoride, Sigma coat (SIGMACOAT SL-2, Sigma) and distilled water are washed in this order. After that, when the micromanipulator was mounted on the microforge, the tip portion was bent so that it could be set horizontally with the microscope stage. For microinjection, use a micromanipulator (MO-102 / MO-103, Narimosha) attached to a microscope (DIAPHOTO-TDM300 with differential interference device, Nikon Corporation), 20% FCS (bovine) covered with paraffin oil. PB containing fetal serum)
S (phosphate buffered saline) 40
The fertilized egg was suspended in a μl droplet. While holding the fertilized egg in the retention capillary, microinjection was performed with an injection needle until the swelling of the pronucleus was saturated. The injected gene (DNA solution) was dissolved in an injection buffer (10 mM Tris-HCl containing 0.1 mM EDTA, pH 7.6) so as to be 5 μg / ml. The microinjected fertilized eggs were dispersed in a solution for transplantation (Hepes-MEM solution) and used for transplantation.

[0014]

[Example 4] Method of transplanting microinjected fertilized eggs to a foster mother
Of the microinjected fertilized egg obtained in Method Example 3
15-34 were surgically transplanted into the recipient's unilateral fallopian tube. When the number of microinjected fertilized eggs to be transplanted was insufficient, the number of fertilized eggs (including 2-cell ova) that were not microinjected was adjusted to about 30 and transplanted. When the specified number of fertilized eggs that could be added was not obtained, 20 or less were also transplanted. After the transplant, the laparotomy site was closed and the transplant operation was completed.

[0015]

[Example 5] Method for obtaining transgenic pigs (breeding and detection) Recipient pigs transplanted with the microinjected fertilized eggs of Example 4 were raised. About 4 after transplant
I got a baby in a month. A part of the tail tailed immediately after birth from the obtained offspring was used for transgene analysis. In addition, a part of the mammary gland tissue was collected by biopsy for expression analysis of the transgene. 1) Confirmation of transgene DNA was extracted from the tail of the collected newborn piglets by a conventional method. That is, a DNA extraction buffer (50 mM Tris-HCl, pH 8.0 / 100 mM EDTA / 100 mM was added to the tail of the collected newborn piglet.
NaCl / 1% SDS) was added, and proteinase K (500 μg / m
L) and pronase (500 μg / mL) were added, and the mixture was stirred at 55 ° C. overnight and dissolved. DNA by the phenol / chloroform method
Was extracted. PCR is performed according to a conventional method using the obtained DNA.
The transgene was confirmed by the method. For the primer, bα
To detect S1CN / hGH, BAC004 (5'ATCACCTTGATCATCAACCCAG
CTT3 ') and HGH102 (5'AGGGGCGCTTACCTGTAGCCATTGC3'),
To detect bβCN / hGH, use BBCG06 (5'ATCATCTATCTGTCCCAAAG
CTGTG3 ') and BBCG16 (5'AGGAAAGAATAGCCTCCTGAATATGG
3 ') were used respectively. PCR reaction (DNA thermal cy
Cler model # 480, Perkin Elmer), enzymatic reaction (DNA 2 μg / ml, Taq DNA polymerase 16 U / ml, primer 200 nM, 10 mM Tris-HCl buffer, 50 mM KCl, 2.
5 mM MgCl ₂ , 0.02% gelatin, dNTP 0.2 mM at 95 ℃ (0.5 minutes) -55 ℃ (1 minute) -72 ℃ (1 minute) for 30 cycles), then 4%
Electrophoresis (Mupid II, Advance Co.) with agarose gel, 40 mM Tris-acetate / 1 mM EDTA, pH8. Amplified D
The NA fragment was detected by ethidium bromide staining.

2) Expression of the transgene in the neonatal mammary gland The collected mammary gland tissue was analyzed by AGPC (Acid-Guanidinium-Phenol).
-Chloroform) method to extract total RNA, RT-PCR
The expression of the transgene was confirmed by the method. That is, total RNA was prepared from the collected neonatal pig mammary gland tissue by the AGPC method. Using 5 μg of total RNA, a Pharmacia cDNA kit (First-Strand cDNA Synthesis Kit, "r
andom hexamers "primer))
After preparing the DNA, a PCR reaction (same as above) was performed. The primer is GH3 (5'TTGACACCTACCAGGAGTTTG
AAG3 ') and GH4 (5'TGCGGAGCAGCTCTAGGTTGGAT3') were used. 2% agarose gel, 40mM Tris-acetate / 1mM ED
The presence or absence of expression was confirmed by detecting the amplified DNA fragment by electrophoresis (Mupid II, Advance Co.) at T, pH8. The results of the production of transgenic pigs carried out in Examples 3 to 5 are summarized in Table 1. The human growth hormone thus expressed exhibits the same specific activity as the commercially available recombinant growth hormone, and its physiological actions (growth promoting action, anabolic protein promoting action, lipid metabolism action, sugar metabolism action, electrolyte metabolism) are also similar. there were.

[0017]

[Table 1]

Two fusion genes (αS1CN / hGH and βCN / hG
H) was introduced into transgenic pigs. One transgenic individual was obtained for each construct. Among them, transgenic pigs in which a fusion gene in which the hGH gene was linked were introduced downstream of the gene expression control region of the bovine αS1 casein gene expressed the human growth hormone gene in the mammary gland.

[0019]

From the above results, the present invention provides a novel transgenic pig that produces hGH in milk. Specifically, human growth hormone, which has been transformed with a fusion gene in which the hGH gene is linked downstream of the gene expression control region of the bovine αS1 casein gene, which is a protein secreted in milk by being specifically expressed in the mammary gland, is transformed into milk. There is provided a novel transgenic pig designed to be produced therein. INDUSTRIAL APPLICABILITY The transgenic pig of the present invention provides a method for inexpensively producing a large amount of hGH, which is capable of coping with future expansion of the required amount of hGH.

[Brief description of drawings]

FIG. 1 is a fusion gene in which a human growth hormone gene is linked downstream of the bovine αS1 casein gene expression control region (bα
An outline of the structure of S1CN / hGH) is shown.

FIG. 2 is a fusion gene (bβCN / h) in which the human growth hormone gene is linked downstream of the bovine β-casein gene expression control region.
The structure of GH) is outlined.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification number Internal reference number FI Technical display location C12R 1:91) (C12P 21/02 C12R 1:91) (72) Inventor Riichi Takahashi Tochigi Prefecture 231, Shimokoyama, Ishibashi-machi, Shimotsuga-gun Kurai Condominium 3-D (72) Inventor Takanari Suzuki 2-18-1 Gion 2-chome, Gion, Minamikochi-cho, Kawachi-gun, Tochigi Prefecture Masayoshi Ueda Kawagoe, Saitama Prefecture Imafuku 1672-1-719

Claims (2)

[Claims] 1. A transgenic pig expressing a human growth hormone gene in the mammary gland, which is produced by introducing a foreign gene expressing human growth hormone. 2. The transgenic pig according to claim 1, wherein the foreign gene is a fusion gene in which a human growth hormone gene is linked downstream of a bovine αS1 casein gene expression control region.