JPH09294600A - Determination of activity of a plurality of promoters - Google Patents

Abstract

PROBLEM TO BE SOLVED: To simultaneously determine activities of a plurality of promoters in high sensitivity by allowing the cells (or their extract) including vectors having sequences of a plurality of luciferase genes emitting light of different colors connected to different promoters respectively to emit different lights. SOLUTION: As 2 or more different kinds of luciferase genes emitting lights of different colors, are used mutant type firefly luciferase genes, which are bonded to different-promoters, respectively. Then, 2 or more kinds of these promoter luciferase fused genes are individually inserted into the vectors to prepare a recombinant DNA and the recombinant DNA is introduced into cells. The cells containing the recombinant DNA or an extract therefrom are brought into contact with luminous substrate solution containing luciferin from outside to emit light whereby the activities of a plurality of promoters can be simultaneously detected and determined in high sensitivity.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a method for measuring a plurality of promoter activities.

2. Description of the Related Art Hitherto, a method for detecting a plurality of promoter activities by a luminescence method which is superior in sensitivity as compared with a coloring method, a fluorescence method and the like has not been established.

DISCLOSURE OF THE INVENTION According to the present invention, different promoters are bound to two or more kinds of luciferase genes which emit light of different colors, and these two or more kinds of promoter-luciferase fusion genes are inserted into a vector, respectively. It is an object of the present invention to provide a method for measuring a plurality of promoter activities that cause cells containing recombinant DNA or an extract of the cells to emit light.

[0002]

Therefore, as a result of various studies to solve the above problems, the present inventors have linked different E. coli promoters to two or more types of firefly luciferase genes having different luminescent colors, After inserting these two or more promoter-luciferase fusion genes into a vector, introducing them into E. coli, culturing the E. coli under the inducing conditions of the respective promoters, and adding a luminescent substrate, the luciferases to be expressed under the respective inducing conditions are introduced. The present invention has been completed based on the knowledge that activity can be measured. That is, the present invention relates to a cell containing a recombinant DNA in which two or more kinds of luciferase genes that emit different colors of light are combined with different promoters, and these two or more kinds of promoter-luciferase fusion genes are inserted into a vector, respectively, or A method for measuring the activity of a plurality of promoters, which comprises illuminating an extract of cells.

The present invention will be described in detail below. Luciferase genes that emit light of different colors, such as firefly luciferase gene, were collected from the fireflies that emit light of different colors from the natural world and used in a conventional method (for example, Sambrook J. et a
l., Molecular Cloning, second edition, 18.60-18.75
(1989)]. The firefly luciferase gene that emits light of different colors can be obtained by randomly mutating the wild-type firefly luciferase gene in the same manner as in the method described in JP-A-3-285683. Further, the firefly luciferase gene that emits light of different colors is a site-specific mutagenesis method for other firefly luciferases with a mutation equivalent to the luminescent color mutation Genji firefly luciferase described in JP-A-3-285683.
nkel, TA et al., Methods Enzymol., 154, 367-382
(1987)].

Two or more kinds of luciferase genes that emit different colors of light have different promoters (for example, an Escherichia coli-derived lactose promoter and λ phage-derived PL _).
Ca from promoter, cauliflower mosaic virus
MV35S promoter, CMV promoter derived from cytomegalovirus, etc.), and these two or more promoter-luciferase fusion genes are linked to different vectors [eg pAG60 [Colbere-Garapin, F. et al., J. Mo.
L. Biol., 150, 1 (1981)], pBIN19 (Bevan M., Nucle
ic Acids Res. 12, 8711), pUC119 (manufactured by Takara Shuzo)
Etc.] into the cells [eg, animal cells (eg, COS-7 cells, Hela cells, CHO cells, etc.), plant cells (eg, Solanaceae plant cells, Aceraceae plant cells, etc.), microorganisms] Cells (eg, bacteria, yeast, mold, etc.)]
After culturing the cells and culturing the cells, a luminescent substrate solution containing luciferin is brought into contact with the cells or an extract of the cells to cause them to act on the cells, and the luminescence is observed as it is or using a microscope or the like. If necessary, take a picture with a camera, or a spectrophotometry system for the emission spectrum, for example, Hamamatsu Photonics PMA-100 or Otsuka Electronics IMUC-7000, etc.
And by analyzing with waveform analysis software, the activities of a plurality of promoters can be detected, measured quantitatively and the like. With this system, specific expression of multiple promoters in cells, tissues, organelles, etc. can be detected simultaneously, and inducers of multiple promoters can be detected simultaneously.

[0005]

BEST MODE FOR CARRYING OUT THE INVENTION

EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples. Example 1. Obtaining a gene encoding firefly luciferase that emits orange light The heat-resistant luciferase gene from Heike firefly, which emits yellow light, has a red mutation in Genji firefly luciferase.
CM-3 (His residue at position 433 is replaced with Tyr residue.
A mutation equivalent to that described in JP-A-3-285683) was introduced by the following method. E. coli CJ236 [pHLf107] [E. coli CJ236
Is manufactured by BIO-RAD, pHLf107 is manufactured by pUC119 (manufactured by Takara Shuzo)
The 217th Ala is replaced with Leu, and the thermostable mutant Heike firefly luciferase (LlL-217L) gene is inserted (described in JP-A-7-289264), from which helper phage M13KO7 (Takara Shuzo) Oligonucleotides SLF85 (ATAAAGAAATATTTTTCTTCA) and Mut prepared by using the single-stranded plasmid pHLf107 prepared by using DNA Model 392 Synthesizer (Applied Biosystems).
a-Gene in vitro Mutagenesis Kit (Bio-Rad)
Recombinant plasmid pHLf20 having a gene encoding a thermostable Heike firefly luciferase (LlL-217L / 433Y) in which the 433rd His residue was replaced with a Tyr residue using
8 DNA was obtained (Fig. 1).

Escherichia coli JM101 [pHLf208] containing the recombinant plasmid pHLf208 DNA was applied to a sterilized nitrocellulose filter to give 50 μg / ml of ampicillin and 1
LB agar medium containing 1 mM isopropyl-β-thiogalactoside (IPTG) [1% Bactotryptone (manufactured by DIFCO),
0.5% yeast extract, 0.5% sodium chloride, 1.4% agar)
After incubating at 37 ℃ for 16 hours, the luminescent substrate solution (0.5 mM
Luciferin, 100 mM sodium citrate, pH 5.0)
As a result of observing the luminescence in a dark place by immersing the nitrocellulose filter in, the Escherichia coli JM101 [pHLf208] was confirmed to emit orange light. That is, by introducing a mutation equivalent to the red mutant Genji firefly luciferase CM-3 into LlL-217L, a gene encoding luciferase LlL-217L / 433Y emitting orange light was obtained.

[0007] 2. It has an origin of replication for the plasmid ColE1,
Construction of plasmid pHLf261 expressing LlL-217L / 433Y gene under control of rc promoter Recombinant plasmid pHLf208 DNA was cleaved with restriction enzyme EcoRI, and fragment containing LlL-217L / 433Y gene was subjected to agarose gel electrophoresis and GENECLEAN2 kit (BIO101 company). The plasmid pTrc99A (origin of replication of plasmid ColE1, the origin of replication of plasmid ColE1, the trp promoter of the Escherichia coli tryptophan synthase gene and the trc promoter (IP of the lactose promoter lac)
Having a lacI ^q gene encoding the repressor of the induced) and the trc promoter by TG. Pharmacia Bio
tech company]. As a result, the plasmid ColE1
A gene encoding a luciferase LlL-217L / 433Y that emits orange light under the control of the trc promoter was expressed, and a recombinant plasmid pHLf261DNA having the ampicillin resistance gene Ap as a marker was constructed (Fig. 1). .

[0008] 3. Construction of recombinant plasmid pHLf265DNA, which has the origin of replication of p15A and expresses the LlL-217L gene under the control of the P _L promoter. The plasmid pHLf107 was cut with the restriction enzyme EcoRI to obtain LlL-217L.
The fragment containing the gene was recovered by the method described in item 2. Both ends of this fragment were blunted using DNA Blunting Kit (Takara Shuzo Co., Ltd.) and cut with the restriction enzyme HpaI to generate Alkaline Phosphata.
Plasmid pP dephosphorylated by se (Takara Shuzo)
_L- 1ambda [having a P _L promoter derived from λ phage (inducible by nalidixic acid)] and luciferase LlL-21 that emits yellow light under the control of P _L promoter
A recombinant plasmid pHLf262DNA expressing the 7L gene was prepared (Fig. 2). Recombinant plasmid pHLf262DNA was digested with restriction enzyme BamHI, P _L promoter and LlL-217L
The fragment containing the gene was recovered by the method described in item 2, and
It was ligated with the plasmid pACYC184 that had been cleaved with the plasmid pACYC184 (which has a replication origin derived from the plasmid p15A and can coexist with the plasmid having the replication origin of the plasmid ColE1 in the same cells. As a result, the gene encoding the luciferase LlL-217L, which has the origin of replication of plasmid p15A and emits yellow light under the control of the P _L promoter, was expressed, and the chloramphenicol resistance gene Cm was used as a marker.
A recombinant plasmid pHLf265DNA having the above was constructed (Fig. 2).

4. Inducible Expression of LlL-217L Gene and LlL-217L / 433Y Gene Using the recombinant plasmid pHLf261DNA and the recombinant plasmid pHLf265DNA, Escherichia coli N99cI ⁺ having the repressor gene cI of λ phage (Pharmacia Biotech.
E. coli N99cI ⁺ [pHLf261 / pHLf265] having both plasmids by Ap resistance and Cm resistance (deposited as FERM P-15602 at the Institute of Biotechnology, Institute of Biotechnology, AIST) was selected. . E. coli N99cI ⁺ [pHLf261
/ pHLf265] was permeated and cultured overnight at 30 ° C. and 120 rpm in 2 ml of LB medium containing 10 μg / ml of chloramphenicol (Cm) and 50 μg / ml of ampicillin (Ap). This medium 20
LB was added with 1% glucose to suppress the activity of 10 μg / ml Cm, 50 μg / ml Ap and trc promoters.
The medium was added to 2 ml of LB medium containing 2 ml or 10 μg / ml of Cm and 50 μg / ml of Ap, and osmotic culture was performed at 30 ° C. and 120 rpm for 4 hours. 60 μg / ml nalidixic acid for the former and the latter for the latter
0.2 mM IPTG was added, and the culture was further permeated at 30 ° C. and 120 rpm for 4 hours. 100 μl of each culture solution was centrifuged, and the obtained cells were suspended in 50 μl of a luminescent substrate solution (0.5 mM luciferin, 100 mM sodium citrate, pH 5.0),
Transfer to Fluoro Nunc plate (manufactured by Nunc), and emit light with Ektachrome Professional P1600 film (KODAK
The image was taken using a product manufactured by the company (Fig. 3). The exposure was F4.0 for 20 minutes. As shown in FIG. 3 performs induction of P _L promoter by nalidixic acid bacteria was subjected to inhibition of the trc promoter by glucose, yellow light emission was observed, was also subjected to induction of the trc promoter by IPTG The cells were observed to emit orange light. That is, it was revealed that two kinds of promoter activities can be detected by the luminescent method by using the gene of firefly luciferase having different luminescent colors.

[0010]

Industrial Applicability According to the present invention, the activities of a plurality of promoters can be simultaneously detected and quantitatively measured, and the present invention is extremely useful.

[Brief description of drawings]

FIG. 1 is a construction diagram of a recombinant plasmid pHLf261DNA.

FIG. 2 is a construction diagram of a recombinant plasmid pHLf265DNA.

FIG. 3 is a diagram in which a luminescence diagram of Escherichia coli cells induced with nalidixic acid or IPTG is converted into black and white by a computer.

[Procedure amendment]

[Submission date] August 12, 1996

[Procedure amendment 1]

[Document name to be amended] Statement

[Correction target item name] Brief description of drawings

[Correction method] Added

[Correction contents]

[Brief description of drawings]

FIG. 1: Construction diagram of recombinant plasmid pHLf261DNA

[Fig. 2] Construction diagram of recombinant plasmid pHLf265DNA

[Fig. 3] A halftone image obtained by converting the luminescence diagram of E. coli cells induced by nalidixic acid or IPTG into black and white by a computer.

 ─────────────────────────────────────────────────── ─── Continued Front Page (72) Inventor Taiji Koyama 339 Noda, Noda City, Chiba Prefecture Kikkoman Corporation

Claims (2)

[Claims] 1. A cell containing recombinant DNA in which different promoters are bound to two or more kinds of luciferase genes that emit different colors of light, and these two or more kinds of promoter-luciferase fusion genes are inserted into vectors, respectively, or A method for measuring a plurality of promoter activities, which comprises causing a cell extract to emit light. 2. The method for measuring a plurality of promoter activities according to claim 1, wherein the luciferase gene according to claim 1 is selected from mutant firefly luciferase genes that emit light of different colors.