JPH09201199A - Detection of dna mutation - Google Patents

Abstract

PROBLEM TO BE SOLVED: To simply detect a DNA mutation useful for detecting gene deficiency, diagnosis, etc., of cancer with high sensitivity by carrying out the polymerase chain reaction (PCR) of a sample with a labeled primer and then performing the smoothing treatment of the 3'-terminal side of the resultant PCR product. SOLUTION: The polymerase chain reactional (PCR) method is carried out for a sample containing a gene by using a fluorescence-labeled oligonucleotide primer to replicate a DNA in a gene region where a gene polymorphism is present from the gene in the sample. The smoothing treatment of the 3'-terminal side of a DNA fragment of the resultant replicated PCR product is carried out to analyze the prepared DNA fragment according to a single-stranded conformation polymorphism method (SSCP method). Thereby, the loss of heterozygosity (LOH) is detected to simply detect the DNA mutation used for diagnosis, etc., of cancer by the presence or absence of the sensitivity to a restriction enzyme HaeIII in a p53 tumor suppressor gene.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to the detection of loss of heterozygosity (loss of heterozygosity: LOH) using genetic polymorphism, for example, quantitatively, easily and with high sensitivity to detect cancer and the like. The present invention relates to a detection method applicable to diagnosis of diseases.

[0002]

2. Description of the Related Art Advances in gene manipulation methods have been remarkable, and are being spread to methods for diagnosing diseases using genes. For example, diagnosis of genetic diseases caused by genetic defects in functional proteins (enzymes and structural proteins) and functional abnormalities, diagnosis of cancer that detects gene mutation from normal cells to cancer cells associated with canceration, infectious bacteria Infectious diseases that utilize detection and identification of genes such as viruses and viruses, and a wide range from detection of mRNA in cells of tissues to quantification of gene transcription level (prediction of protein expression level). Some have been done.

In the narrow sense, the gene diagnosis of cancer is to identify an abnormality such as expression or mutation of an oncogene or a tumor suppressor gene from a gene (DNA or mRNA).
In a broad sense, it also includes identifying a protein specifically expressed in a certain type of cancer and searching the expression level. Many oncogenes and tumor suppressor genes have been reported as genes involved in this canceration, and some mutations such as deletions and mutations are often found in these genes. However, among these genes, there are few reports of genes of diagnostic value, that is, genes in which a common mutation is recognized in a relatively large number of cases. The p53 gene is known as a tumor suppressor gene.

Polymerase chain reaction method (P
CR) has been used to analyze various gene mutations such as point mutations, gene amplifications, and chromosome deletions. Chromosome deletion is a common feature of malignant neoplasms, and polymorphic ba
se substitutions, variable number of tandem repeats
The loss of heterozygosity (LOH) is detected by using various genetic polymorphism markers such as (VNTR) and microsatellite polymorphism.

[0005]

PCR has been used for the detection of heterozygotes with microsatellite polymorphism as an index, and has been widely used for gene linkage analysis. However, when targeting solid cancer, LOH using this method
There were some problems in the detection of. (1) In general, the number of cancer cells contained in a cancer tissue is small, and it may be difficult to determine the deletion due to proliferation of stromal cells or infiltration of leukocytes caused by the cancer cells. (2) It was always necessary to compare with normal cells. (3) For storage materials such as formalin fixed paraffin embedded sections, DN
A fragmented and PCR was difficult, and detection of LOH was difficult.

[0006]

Means for Solving the Problems As a result of intensive studies to solve the above-mentioned problems, the present inventors have found that DNA fragments whose ends have been blunted are analyzed by, for example, single-stranded DNA conformational polymorphism analysis. The present invention has been completed by finding that LOH can be detected easily and quantitatively when analyzed by the method (SSCP method). That is, the present invention provides LOH useful for cancer diagnosis and the like.
It provides a simple and highly sensitive detection method.

A first aspect of the present invention is a method for detecting a mutation in a DNA fragment, which comprises subjecting a DNA fragment in a sample to a blunt end treatment of the DNA fragment in advance.

The second gist of the present invention is that the DNA fragment in the sample is a polymerase chain reaction method (PCR).
The first method is a method for detecting a mutation in a DNA fragment as a product of the above.

The third aspect of the present invention is the method for detecting a mutation in a DNA fragment according to the first or second aspect, wherein the method for detecting a mutation is a single-stranded DNA conformational polymorphism analysis method (SSCP method). is there.

The fourth gist of the present invention is to duplicate the DNA of a gene region in which a gene polymorphism exists from a gene, subject the 3'end side of the duplicated DNA fragment to blunting, and obtain the obtained DNA fragment. Single-stranded DNA conformational polymorphism analysis method (SSC
P method), which is a method for detecting loss of heterozygosity (LOH).

The fifth gist of the present invention is that the polymorphism in one gene region to be replicated as a DNA fragment is a polymorphism due to a single base substitution.
Is a detection method.

The sixth gist of the present invention is that the gene polymorphism is p
53 Restriction enzyme in intron 1 region of tumor suppressor gene
LO of the fourth or fifth gist with or without Hae III sensitivity
This is a method of detecting H.

The seventh gist of the present invention is that the replicating DNA fragment is an oligonucleotide primer, 5'TCTTA.
GCTCCGGGTTGTTTTC 3 '(forward) and 5'
Region 4 or 5 which is a region amplified by PCR using ACTGGCGCTGTGTGTAAAATG 3 '(reverse direction)
Is a method for detecting LOH.

The eighth gist of the present invention is that the gene polymorphism is p
53 Restriction enzyme B in exon 4 region of tumor suppressor gene
Fourth or fifth summary LOH with or without stU I sensitivity
Is a detection method.

The ninth gist of the present invention is that the replicating DNA fragment is an oligonucleotide primer, 5'AGCTC.
CCAGAATGCCAGAG 3 '(forward) and 5'C
Region 4 or 5 which is a region amplified by PCR using TGGGAAGGGACAGAAGATG 3 '(reverse direction)
Is a method for detecting LOH.

The tenth gist of the present invention is that the genetic polymorphism is
The LO of the fourth or fifth aspect, which is the presence or absence of sensitivity to the restriction enzyme Apa I in the intron 7 region of the p53 tumor suppressor gene.
This is a method of detecting H.

The eleventh aspect of the present invention is to replicate DNA.
The fragment is an oligonucleotide primer, 5'AGGT
CAGGAGCCACTTGCC 3 '(forward) and 5'
Fourth or fifth region which is amplified by PCR using GTGATGAGAGGGTGGATGGGGT3 '(reverse direction)
Is a method for detecting LOH.

The twelfth aspect of the present invention is to identify each of a plurality of gene polymorphisms in the p53 tumor suppressor gene as a fourth or fifth gene polymorphism.
The method for detecting cancer is the method of detecting cancer by the method of detecting LOH according to the gist of, and combining the results.

The thirteenth aspect of the present invention is the seventh, ninth and eleventh aspects.
The detection result obtained by the method of detecting LOH in the summary of
The twelfth aspect of the present invention is a cancer inspection method by combining the above.

The fourteenth aspect of the present invention is the method for detecting LOH according to the fourth or fifth aspect, wherein two or more sets of primers are simultaneously used.

[0021]

BEST MODE FOR CARRYING OUT THE INVENTION The present invention will be described in detail below.
First, the DNA fragment in the sample in the present invention is a tissue,
DNA fragments extracted from blood, cells, body fluids, sperm, infectious bacteria, viruses, etc., are cleaved to an appropriate size with restriction enzymes, or DNA extracted from tissues, blood, cells, body fluids, etc. is used as a template. P in the DNA region only
It means a DNA fragment amplified by CR or the like.

The term "blunt-end treatment" of the present invention means double-stranded DN.
To make the terminal single-stranded portion of the A fragment blunt, Klen
3'such as ow fragment and T4 DNA polymerase
→ It may be treated with an enzyme which has a 5 ′ exonuclease activity and repairs a single-stranded portion, or may be treated with a restriction enzyme which smoothly cuts to remove the end portion containing the single-stranded portion. 3 '
→ It is possible to use a method such as carrying out the PCR method using a thermostable polymerase having 5 ′ exonuclease activity. When the sense and antisense strands of the double-stranded DNA fragment to be analyzed have different or irregular lengths, when they are heat-denatured to be single-stranded and analyzed, the peak derived from the DNA fragment is split, resulting in multiplex. Become. On the other hand, 2
When the double-stranded DNA fragment is smoothed and analyzed, it converges to a single peak, which makes it very easy to distinguish it from a DNA fragment having a gene mutation.

The mutations in the DNA fragment of the present invention include point mutations, substitution of bases such as gene polymorphisms, deletion or insertion of bases and accompanying frame shift, deletion or insertion of several bases, loss of entire gene, etc. Is included.

As a method for detecting a mutation in a DNA fragment of the present invention, SSCP (single-stranded conformation polymo
rphism) method, HET (hetero duplex analysis) method, DG
GE (denaturing gradient gel electrophoresis) method,
DS (direct sequence) method, CCM (chemical cleavage)
Examples include the mismatch method and the CDI (carbodiimide modification) method (Bio manual series 1, basic technology of genetic engineering, edited by Masaru Yamamoto, Yodosha (1993)).

The gene in the present invention is a DNA extracted from a tissue, blood, cell, body fluid, infectious bacterium, virus or the like of a subject. In particular, in the case of diagnosing cancer patients, genomic DNA extracted from cancer tissues, cancer cells, or body fluids such as urine, pancreatic juice and duodenal juice are targeted.

The genetic polymorphism of the present invention is a genetic polymorphism of a human chromosome, and is derived from individual differences in the nucleotide sequence on the gene. It is said that such polymorphisms exist in one site in several hundred bases on average, and by analyzing the polymorphisms, it is possible to distinguish between a paternal-derived chromosome (allele) and a maternal-derived chromosome (allele). can do. Therefore, the gene deletion can be detected by utilizing the genetic polymorphism and measuring the loss (LOH) of one allele in the heterozygote. However, polymorphisms due to single nucleotide substitutions are heterozygous at a maximum frequency of 50%.
In order to investigate the deletion of one gene, it is desirable to combine multiple genetic polymorphisms in which heterozygotes occur frequently. In addition, since there is a difference in gene polymorphism between ethnic groups, it is necessary to select a gene polymorphism with a high appearance frequency in that ethnic group from among the genes whose deletion is to be diagnosed.

The region of the gene to be replicated according to the present invention is 1
There is no particular limitation as long as it is a range containing one gene polymorphism,
It is necessary to select a length and a range that are easily amplified by PCR and suitable for SSCP. Length is usually 100-200bp, range is PCR
It may be determined from the design of an oligonucleotide primer suitable for

For the detection of the DNA fragment, the DNA fragment can be labeled. For labeling the DNA fragment, a method using a pre-labeled primer as a primer, a method using a labeled base component (for example, radioactive label of phosphorus) when performing PCR, or PCR was performed. There is a way to label it later.

The labeling method is not particularly limited as long as it can be easily detected after SSCP.
For example, the 5'end side of DNA may be labeled with a fluorescent substance, a chemiluminescent substance, biotin (detected with an enzyme-labeled avidin), or the like. Particularly preferably, the 5'end of the oligonucleotide primer for PCR is previously labeled with A. L. F. r
Fluorescence-labeled with ed (Cy5 ^™ ) amide reagent (Pharmacia) may be used. This is S
The fluorescent SSCP method is applied to the SCP method.

According to the present invention, LOH can be determined easily and with high sensitivity, and can be used for diagnosis of various cancers such as colon cancer, pancreatic cancer, bladder cancer and the like. or,
LO for two or more gene polymorphisms that exist at the same gene locus and preferably do not overlap each other.
By detecting H and combining the detection results,
That is, if any one of the detection results is heterozygous and LOH-positive, even if the other is homozygous, it is determined as “positive”, thereby increasing the number of cases in which gene deletion can be determined. It is possible to further contribute to the improvement of the diagnosis efficiency of diseases such as cancer.

[0031]

EXAMPLES The present invention will be specifically described with reference to examples, but the present invention is not limited to these examples.

Experimental Example Restriction enzyme H in intron 1 of p53 tumor suppressor gene
Detection of ae III gene polymorphism (oligonucleotide primer, 5'TCTTAGCTCGCGGTTGTTTTC
3 '(forward) and 5'ACTGGCGCTGTGTGT
SSCP of a 124 bp DNA fragment amplified by PCR using AAATG 3 '(reverse direction). Preparation of oligonucleotide primer Oligonucleotide primer for PCR, 5'TCT
TAGCTCGCGGTTGTTTC3 '(forward facing)
And 5'end to A. L. F. red ^TM (Cy5 ^TM ) am
5'ACTGGCGCGCTTGTGTAAATG3 'fluorescently labeled with the idite reagent (Pharmacia)
(Reverse) is Oligo 1000 DNA synt
It was synthesized using Hesizer ^™ (Beckman).

2. Extraction of Genomic DNA Cancer tissue and normal tissue were obtained from fresh colon cancer and pancreatic cancer patient specimens obtained by surgery. In addition, white blood cells of peripheral blood were used as tissues of normal persons. DNA is extracted from these tissues by digestion with proteinase K and then extraction with phenol / chloroform (Basic Method in Mole).
ular Biology, published by Elsevir Science Publishing)
And Kanno et al. (Lab. Invest. 68 361 (1993)).

3. 0.5 μg of genomic DNA (template) extracted from PCR tissue, 12.5 pmole of each oligonucleotide primer, 10 nmole of each nucleotide triphosphate (dNTP), Taq
1.25 units of DNA polymerase (Toyobo Co., Ltd.)
Cl 50 mM, MgCl ₂ 1.0 mM, Triton X-100
50 mM 10 mM Tris-HCl buffer (pH 9.0) containing 0.1%
l, plus 50 μl of mineral oil (Sigma)
Was layered. PCR was performed on this solution under the following conditions. The first denaturing condition was 94 ° C for 5 minutes, and the subsequent reaction was 94 ° C for 1 minute, 50 ° C for 1 minute, 72 ° C for 1 minute, repeated 40 times, and finally 72 ° C for 7 minutes. I went.

P due to the difference in DNA polymerase
In order to compare the state of the CR product on the 3'end side (extended portion independent of genomic DNA), Taq DNA polymerase (Toyobo Co., Ltd.) was used as Taq DNA polymerase (Perkin Elmer Cetus) or Pfu DNA polymerase (Stratadine). Company) and reacted in the same manner. The reaction buffer was KCl 50 mM, MgCl for Taq DNA polymerase (Perkin Elmer Cetus).
₂ 10 mM Tris-HCl buffer (pH 8.3) containing 1.5 mM and 0.001% gelatin, KCl 10 mM for Pfu DNA polymerase (Stratadine), (NH ₄ ) ₂
SO ₄ 6 mM, MgCl _{2 2} mM, Triton X-100
A 20 mM Tris-hydrochloric acid buffer solution (pH 8.2) containing 0.1% BSA 10 μg / ml free from nuclease contamination was used.

The yield of PCR product was determined by electrophoresis on 8% acrylamide gel and staining with ethidium bromide.

4. The 3 'end of the smoothing 0.5 units of PCR products Klenow fragment (Takara Shuzo (Ltd.)), T
It was added to 5 μl of the PCR reaction solution prepared with aq DNA polymerase (Toyobo Co., Ltd. or Perkin Elmer Cetus) and reacted at 37 ° C. for 30 minutes.

5. Fluorescent SSCP analysis The analysis is based on A. L. F. red ^™ DNA sequence
er (Pharmacia) using Tris-glycine buffer (Tris 25 mM, glycine 192 mM) containing 15% acrylamide (bisacrylamide / acrylamide = 1)
/ 30) gel (height 200 mm x width 345 mm x thickness 0.5 mm) was used. PCR reaction solution or 3'smoothed P
1 μl of CR reaction solution was added to loading solution for SSCP 10
In addition to μl, heat-transform at 80 ° C for 5 minutes, then
l was charged on the gel and electrophoresed. The composition of the loading solution is a deionized 90% formamide solution containing 20 mM EDTA and 0.05% bromphenol blue. The electrophoresis buffer is a solution containing 25 mM Tris and 192 mM glycine. Electrophoresis was performed at 24 ° C. for 20 W × 10 hours. The analysis of measurement data is performed by the analysis software Fragme.
nt Manager ^™ (Pharmacia) was used.

The following comparative example was carried out according to each operation of the experimental example.

Comparative Example 1 Genomic DN extracted from white blood cells of a colon cancer patient and normal
A is the Taq DNA polymerase (Perkin Elmer
The results of fluorescence SSCP analysis after amplification by PCR using Cetus) are shown in FIG. 1A. Lines in the figure are, respectively, 1: Hae III-sensitive homozygous healthy subjects,
2: Normal subjects with Hae III-resistant homozygotes, 3: Normal tissue parts of colon cancer patients with heterozygotes, 4: Cancer tissue parts (LOH +) of the same colon cancer patients are shown.

Comparative Example 2 Taq DNA polymerase (Toyobo Co., Ltd.) was used as the DNA polymerase, and the same procedure as in Comparative Example 1 was performed. The results are shown in Figure 1B.

Comparative Example 3 The same procedure as in Comparative Example 1 was carried out using Pfu DNA polymerase (Stratadine) as the DNA polymerase. The results are shown in Figure 1D.

In any of FIGS. 1A, 1B and 1D, the peak was split into two or many peaks appeared, and the determination of gene deficiency was complicated.

Example 1 (for blunting the 3'end of the PCR product
Effect) Kle was added to the PCR reaction product of Comparative Example 2 according to the operation method of the experimental example.
After adding the now fragment (Takara Shuzo Co., Ltd.) to blunt the 3 ′ end, fluorescent SSCP analysis was performed. The result is shown in FIG. 1C. By blunting the 3'end of the PCR product, the splitting of the peaks as shown in FIGS. 1A and 1B converged and the LOH determination became extremely easy. The conceptual diagram is as shown in FIG. That is, the peak splitting converges by the end smoothing process. Also, for the PCR reaction product of Comparative Example 1 in which the DNA polymerase was changed, Klenow fragment (Takara Shuzo Co., Ltd.) was added to blunt the 3 ′ end, and then fluorescent SSCP analysis was performed, and the same results as in FIG. 1C were obtained. .

Example 2 (Detection Sensitivity of LOH ) In order to examine the detection sensitivity of LOH + for cancer cells, leukocyte genomic DNA (corresponding to normal cells of LOH−) of healthy heterozygous individuals was used as a LOH + DNA model. Hae II
20% of I-sensitive homozygous healthy leukocyte genomic DNA (half amount of DNA is sufficient for cancer cells lacking one allele since homozygous LOH-cells are used as a model): 0 (the content of cancer cells corresponds to 0%), 18: 1 (10%), 16: 2 (20%), 14: 3 (30
%), 12: 4 (40%), 10: 5 (50%), 8: 6 (60
%), 6: 7 (70%), 4: 8 (80%), 2: 9 (90)
%), Mixed at a ratio of 0:10 (100%), followed by PCR reaction, blunting of 3 ′ end of PCR product, fluorescent S according to the experimental example
SCP analysis was performed. The measurement data is the software F for analysis.
ragment Manager ^™ (Pharmacia)
Was analyzed and the results are shown in FIG. In FIG.
The Hae III resistant allele (A1) and the Hae III sensitive allele (A2) were set to 100 bp and 200 bp, respectively, and the heights of A2 were overwritten. Also, the ratio of cancer cells and A
When the ratio of 1 / A2 was plotted, the plot was on a good straight line (FIG. 3). From this, it is understood that the amount of allele deficiency, that is, the number of cancer cells contained in normal cells can be accurately measured by blunting the 3'end side of the PCR product to obtain the A1 / A2 ratio. .

Example 3 (p53 gene in pancreatic cancer tissue)
Example of LOH detection of 14 cancer patients Normal tissues of p53 gene Hae III resistant allele (A1) and Hae III sensitive allele (A2) were analyzed. 7 (50%) were heterozygous and LOH
Was suitable as an object to be measured. Therefore, the genomic DNAs of normal tissues and cancer tissues of these 7 cancer patients were analyzed by the fluorescent SSCP method of Example 1 (Table 1). A1 / A2 ratio of normal tissues of 7 subjects was 0.96 ± 0.01 (mean ± SD)
Met. Average ± 2SD range 0.94 to 0.98 is normal value (L
OH-), 5/7 (71.4%) beyond that was positive (LOH +). The agreement between LOH + and the mutation in the K-ras gene was 5/6 (83.3%).
The range of A1 / A2 ratio of LOH + cases is 0.52 to 1.48,
The ratio of cancer cells contained in the cancer tissue estimated from the formula of {A1 / A2 (normal tissue) -A1 / A2 (cancer tissue)} / {A1 / A2 (normal tissue)} was 19 to 37%. It was Thus, it can be seen that the method for detecting LOH using the method of the present invention is useful for diagnosing cancer. Here, A1 indicates the deleted allele, and A2 indicates the conserved allele.

[0047]

[Table 1]

Example 4 (L of p53 gene of bladder cancer patient)
OH detection example) 1. Extraction of Genomic DNA Twenty-eight urine samples of bladder cancer and 12 urine samples of healthy subjects were obtained.

The urine sample collected in a 50 mL dosed disposable centrifuge tube was centrifuged at 1000 rpm for 5 minutes, the supernatant was discarded, and the urine sediment was collected. This precipitate was redispersed in 40 mL of physiological saline and again washed by centrifugation at 1000 rpm for 5 minutes. Until the DNA was extracted, the sediment was frozen and stored at -80 ° C. Similar to the experimental example, the washed precipitate was enzymatically digested with proteinase K, and then DNA was extracted by the phenol / chloroform method.

DN of normal and cancerous tissues of 19 patients with bladder cancer
A is the method of Levi et al. (Canc.
er Res., 68 , 361 (1993)).

2. Oligonucleotide primers are Oligo 100
It was synthesized using 0 DNA synthesizer ^™ (Beckman). intron 1 of the p53 gene,
Table 2 shows the combinations of the respective primers designed to analyze the gene polymorphism at the exon 4 and intron 7 sites.

[0052]

[Table 2]

The 5'end of either the forward or the backward primer was labeled with A. L. F. red (Cy5
^TM ) amidite reagent (Pharmacia)
It was fluorescently labeled with iodide dicarbocyanine.

3. PCR PCR of intron 1 and exon 4 sites of p53 gene
The conditions were as follows. Extracted genomic DNA
(Template) 0.1-0.5 μg, each oligonucleotide primer 12.5 pmol each nucleotide triphosphate (d
NTP), 10 nmole each, Taq DNA polymerase (Toyobo Co., Ltd.) 1.25 units, KCl 50 mM, MgC
10m including l ₂ 1.0 mM, Triton X-100 0.1%
M Tris-HCl buffer (pH 9.0) (50 μl) was added, and mineral oil (Sigma) (50 μl) was layered thereon. On the other hand, for the intron 7 site, the extracted genomic DN
0.1 to 0.5 μg of A (template), 12.5 pmole of each oligonucleotide primer, 10 nmole of dNTP,
1.25 units of Taq DNA polymerase (Perkin Elmer Cetus) were added to KCl 50 mM and MgCl ₂ 1.5 m.
M, 50 μl of 10 mM Tris-HCl buffer (pH 8.3) containing 0.001% (W / V) gelatin, and 50 μl of mineral oil was layered thereon. PCR was performed on these solutions under the following conditions. For intron 1, only the first modification condition was 94 ° C for 5 minutes, and the subsequent reaction was modification condition 94 ° C for 1 minute, annealing 50 ° C for 1 minute, extension reaction.
The cycle of 1 minute at 72 ° C. was repeated 40 times, and finally the extension reaction was performed at 72 ° C. for 7 minutes. For Intron 7,
Only the first transformation condition was 94 ° C for 5 minutes, and the subsequent reaction was
A cycle of 94 ° C. for 1 minute, 60 ° C. for 30 seconds and 72 ° C. for 1 minute was repeated 40 times, and finally the reaction was carried out at 72 ° C. for 7 minutes. For exon 4, only the first denaturing condition was 94 ° C for 5 minutes, and the subsequent reaction was 94 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C.
Cycle 1 minute at ℃ 40 times, finally at 72 ℃ 7
The reaction was performed for minutes.

The yield of PCR product was determined by electrophoresis on 8% polyacrylamide gel and staining with ethidium bromide.

4. Blunted 3'end of PCR product 0.5 units / μl of Klenow fragment (Takara Shuzo)
PCR reaction solution 5 prepared by Taq DNA polymerase (Toyobo Co., Ltd. or Perkin Elmer Cetus)
It was added to μl and reacted at 37 ° C. for 30 minutes.

5. Fluorescent SSCP analysis The analysis is based on A. L. F. red ^™ DNA sequence
er (Pharmacia) containing Tris-glycine buffer (Tris 25 mM, glycine 192 mM) in 15% polyacrylamide (bisacrylamide / acrylamide =
1/30) gel (height 200 mm x width 345 mm x thickness 0.5 mm) was set. 1 µl of the PCR reaction solution having the 3'end blunted was added to 10 µl of the SSCP loading solution and heat denatured at 80 ° C for 5 minutes, and 1 µl of this was charged on the gel for electrophoresis. The composition of the loading solution is ED
A deionized 90% formamide solution containing 20 mM TA and 0.05% bromphenol blue. The electrophoresis buffer is a solution containing 25 mM Tris and 192 mM glycine. Electrophoresis was performed at temperatures of 24 ° C for intron 1 and intron 7 and 20 ° C for exon 4 at 20 ° C.
W × 10 hours. For analysis of measurement data, software for analysis Fragment Manager ^™ (Pharmacia) was used.

Calculations for estimating the proportion of cancer cells contained in cancer tissues from the signal ratio of alleles of normal tissues and cancer tissues of patients who are heterozygotes were performed in the same manner as in Example 3. When the ratio of cancer cells exceeds 10%, LO
H +.

6. Analysis Examples FIGS. 4 to 7 show analysis examples of a typical urine sample in which intron 1, exon 4, and intron 7 of the p53 gene were all heterozygotes. 4, 5 and 6 are examples of LOH + patients A25, A6 and A1, respectively, and FIG. 7 is an example of healthy person B1. The arrow indicates the signal of the allele with the deletion.

In addition, urine and tissue of the same patient A6 were analyzed,
Examples of comparing the results are shown in FIGS. 8 shows urine, FIG. 9 shows the cancer tissue, and FIG. 10 shows the analysis results of the normal part of the corresponding tissue. The parentheses in FIG. 8 indicate the expected proportion of cancer cells contained in the cancer tissue calculated from the height of the allele signal. As shown in FIGS.
The analysis pattern of urine of cancer patients and the pattern of cancer tissue were in good agreement.

7. Summary of analysis results We analyzed 40 urine samples and analyzed intron 1 of p53 gene,
Of the three gene polymorphisms present in exon 4 and intron 7, 23 urine samples (58%) in which one or more were heterozygous were effective as the analysis target. this house,
There were 16 bladder cancer patients and 7 healthy subjects. The relative variation of the signals of alleles in each gene polymorphism of 7 healthy subjects was very stable, being less than 5% at ± 2SD.
The measurement results of 16 cancer patients are summarized in Table 3. Eight specimens (50 specimens with positive LOH of any gene polymorphism)
%)Met. When judged from a single gene polymorphism selected from three gene polymorphisms of p53 gene, L
OH + was inferior to the combinations of 3 in all cases, 6 to 7 samples. Therefore, it was shown that the LOH detection efficiency can be further improved by selecting gene polymorphisms with as few duplications as possible and combining them.

On the other hand, at the cancer tissue level, out of the 9 samples that could be measured, 8 samples (89%) were LOH +. In addition, the concordance rate of urine samples and LOH is 6/8 samples (75 samples).
%) And a high rate. From this, it was found that in bladder cancer, LOH can be sufficiently detected even by using a urine sample.

[0063]

[Table 3]

The results of Table 3 are further classified into stages and grades and summarized in Table 4. In the early stages of Tis and Ta, there are no positive cases of LOH, and it can be seen that they become positive as the stage progresses. By combining it with a gene marker other than p53 or the result of cytodiagnosis, more detailed understanding of cancer becomes possible.

[0065]

[Table 4]

Example 5 (Performing multiple PCR reactions simultaneously
Method for simultaneously analyzing multiple gene polymorphisms) Using a sample of a colorectal cancer patient, extraction of genomic DNA and PCR of Example 4 were changed as follows to obtain LOH of p53 gene.
Was detected.

1. Extraction of genomic DNA Cancer tissues and normal tissues were obtained from specimens of colorectal cancer patients, and genomic DNA was extracted in the same manner as in the experimental example.

2. PCR 0.1-0.5 μg / 2.5 of extracted genomic DNA (template)
μl, 1.25 μl of a solution containing 5 pmole of each oligonucleotide primer of intron 1 in Table 2, 1.25 μl of a solution containing 5 pmole of each oligonucleotide primer of exon 4 in Table 2, 1.25 pmole of each oligonucleotide primer of intron 7 in Table 2 Solution containing 0.125μ
1, 4 μl of a solution containing 5 nmole of each nucleotide triphosphate (dNTP), 500 mM of KCl, 10 m of MgCl ₂
2.5 μl of 100 mM Tris-HCl buffer (pH 9.0) containing 1% of M and Triton X-100, O.625 units / 0.125 μl of Taq DNA polymerase (Toyobo Co., Ltd.), and 13.0625 μl of distilled water were mixed. Onto 25 μl of this reaction solution, 50 μl of mineral oil (Sigma) was layered, and PCR reaction was carried out. Only the first denaturing condition was 94 ° C for 5 minutes, and the subsequent reaction was denaturing condition 94 ° C for 1 minute, annealing at 55 ° C for 1
The extension reaction at 72 ° C. for 1 minute was repeated 40 times, and finally the extension reaction was performed at 72 ° C. for 7 minutes. The yield of the PCR product was determined by electrophoresis on 8% polyacrylamide gel and staining with ethidium bromide.

The analysis results are shown in FIG. As is clear from the figure, three PCR polymorphisms at each site of exon 4, intron 7, and intron 1 of a colorectal cancer patient can be simultaneously analyzed by only one PCR (FIG. 11A), and colon cancer patient cancer tissue It can be seen that LOH (FIG. 11B) can be detected.

12 to 14 show exon 4 of FIG.
The gene polymorphisms of the intron 7 and intron 1 sites are expanded, respectively. The estimated proportion of cancer cells contained in the cancer tissue calculated from the peak height of the allele at each site was 61.2% for exon 4, 52.3% for intron 7, and 58.4% for intron 1, respectively. , And almost the same result was obtained. From this, it is understood that by devising the PCR conditions, a plurality of PCR reactions can be performed simultaneously and a plurality of gene polymorphisms can be analyzed at the same time.

[0071]

INDUSTRIAL APPLICABILITY According to the present invention, LOH can be determined easily and with high sensitivity (high detection rate), which is useful for cancer diagnosis.

[Brief description of drawings]

FIG. 1 3 ′ of PCR product in fluorescent SSCP analysis
The effect of end blunting is shown.

FIG. 2 shows detection sensitivity of LOH according to the present invention.

FIG. 3 shows a calibration curve of cancer cell content.

FIG. 4 shows the analysis results of a urine sample of cancer patient A25 by the end-blunting SSCP method.

FIG. 5 shows the analysis results of a urine sample of cancer patient A6 by the end-blunted SSCP method.

FIG. 6 shows the analysis results of a urine sample of cancer patient A1 by the end-blunted SSCP method.

FIG. 7 shows the analysis results of a urine sample of a healthy subject B1 by the end-blunted SSCP method.

FIG. 8 shows the analysis results of a urine sample of cancer patient A6 by the end-blunted SSCP method.

FIG. 9 shows the results of analysis of cancer tissue (Tumor) samples of cancer patient A6 by the end-blunting SSCP method.

FIG. 10 shows the results of analysis of corresponding normal site tissue (Normal) samples of cancer patient A6 by the end blunted SSCP method.

FIG. 11 shows LOH analysis results obtained by simultaneously performing a plurality of PCR reactions and simultaneously analyzing a plurality of gene polymorphisms using genomic DNA extracted from a tissue of a colorectal cancer patient.

FIG. 12 is an enlarged view of the gene polymorphism at the exon 4 site in FIG.

FIG. 13 is an enlarged view of gene polymorphisms in the rentron 7 site of FIG. 11.

FIG. 14 is an enlarged view of a gene polymorphism in the intron 1 site of FIG.

FIG. 15 is a conceptual diagram of highly sensitive detection of gene deletion by the blunt-end SSCP method.

Claims (14)

[Claims] 1. A method for detecting a mutation in a DNA fragment, which comprises blunt-end treatment of the DNA fragment in advance when detecting the DNA fragment in a sample. 2. The DNA fragment in the sample is a product of polymerase chain reaction (PCR).
A method for detecting a mutation in the described DNA fragment. 3. The method according to claim 1, wherein the mutation detection method is a single-stranded DNA conformational polymorphism analysis method (SSCP method).
A method for detecting mutations in NA fragments. 4. A DNA of a gene region in which a gene polymorphism is present is replicated from a gene, the 3'end side of the replicated DNA fragment is blunted, and the resulting DNA fragment is single-stranded
A method for detecting loss of heterozygosity (loss of heterozygosity: LOH), characterized by being analyzed by NA higher order polymorphism analysis method (SSCP method). 5. The method for detecting LOH according to claim 4, wherein the gene polymorphism in one gene region to be replicated as a DNA fragment is a polymorphism due to a single base substitution. 6. The method for detecting LOH according to claim 4, wherein the gene polymorphism is the presence or absence of sensitivity to the restriction enzyme Hae III in the intron 1 region of the p53 tumor suppressor gene. 7. The replicating DNA fragment is an oligonucleotide primer, 5′TCTTAGCTCGCGGGTT.
GTTTC 3 '(forward) and 5'ACTGGGCGCTG
The method for detecting LOH according to claim 4 or 5, which is a region amplified by PCR using TGTGTAAATG3 '(reverse direction). 8. The method for detecting LOH according to claim 4, wherein the genetic polymorphism is the presence or absence of sensitivity to the restriction enzyme BstU I in the exon 4 region of the p53 tumor suppressor gene. 9. The replicating DNA fragment is an oligonucleotide primer, 5′AGCTCCCAGAATGCC.
AGAG 3 '(forward) and 5'CTGGGA AGGGA
The method for detecting LOH according to claim 4 or 5, which is a region amplified by PCR using CAGAAGATG 3 '(reverse direction). 10. The method for detecting LOH according to claim 4, wherein the gene polymorphism is the presence or absence of sensitivity to the restriction enzyme Apa I in the intron 7 region of the p53 tumor suppressor gene. 11. The replicating DNA fragment is an oligonucleotide primer, 5′AGGTCAGGAGCCAC.
TTGCC 3 '(forward) and 5'GTGATGAGAG
The method for detecting LOH according to claim 4 or 5, which is a region amplified by PCR using GTGGATGGGT3 '(reverse direction). 12. A method for examining cancer by detecting each of a plurality of gene polymorphisms in the p53 tumor suppressor gene by the method for detecting LOH according to claim 4 or 5, and combining the results. 13. The method for examining cancer according to claim 12, wherein two or more detection results obtained by the method for detecting LOH according to claim 7, 9, or 11 are combined. 14. The method for detecting LOH according to claim 4, wherein two or more sets of primers are used simultaneously.