JPH0912478A - New therapeutic agent for dermal deficiency - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a medicine capable of acting on the curing processes of dermal deficiency in which complicated processes participate, especially wounds or dermal ulcer and further chronic (intractable) dermal ulcer, solely manifesting effective activities, acting on operational wounds or traumas due to a surgical operation, promoting the curing thereof and contracting the operational scars or traumatic scars. SOLUTION: This medicine contains at least one selected from the group consisting of tissue inhibitor of metalloproteases(TIMPs) which are inhibitors of matrix metalloproteases(MMPs). The medicine is capable of manifesting excellent effects of actions in complicated curing processes in dermal deficiency such as wounds or dermal ulcer and the tissue inhibitor of metalloprotease-2(TIMP-2) has especially excellent characteristics as the medicine. The recombinant tissue inhibitor of metalloprotease-2(rTIMP-2) is extremely useful as a practical therapeutic agent for dermal deficiency such as wounds or dermal ulcer and further a medicine capable of acting on operational wounds or traumas due to surgical operations, promoting the curing thereof and contracting operational scars or traumatic scars.

Description

Detailed Description of the Invention

[0001]

[0001] The present invention relates to a tissue inhibitor of metalloproteases (tissue).
Inhibitor of metalloprote
inases: TIMPs) relating to a medical therapeutic agent characterized by comprising at least one tissue inhibitor selected from the group consisting of:
A therapeutic agent for skin deficiency, particularly a therapeutic agent for skin ulcer applied to an affected area of a skin ulcer patient and a therapeutic agent for wound applied to an affected area of a wound patient, and further, a surgical scar or a wound due to preventive treatment of a surgical wound or a traumatic wound. The present invention relates to a therapeutic agent effective in reducing traumatic scarring. More specifically, the present invention provides tissue inhibitors of metalloprotease-1 (issue).
inhibitor of matalloprote
instances-1: TIMP-1) or tissue
Inhibitor of metalloprotease-2 (tis
sue inhibitor of matallop
Rotineases-2: TIMP-2) as a main active ingredient, which is effective for the treatment of skin ulcers and wounds, and is effective for the prevention of surgical scars and trauma wounds by various surgical operations. And a therapeutic agent characterized by reducing traumatic scarring. Another aspect of the present invention is a therapeutic agent for skin deficiency, particularly a recombinant agent, which comprises, as an active ingredient, at least one tissue inhibitor selected from the group consisting of recombinant tissue inhibitors of metalloproteases (rTIMPs). Of a skin defect characterized by containing at least an active ingredient selected from the group consisting of tissue inhibitor of metalloprotease-1 (rTIMP-1) and recombinant tissue inhibitor of metalloprotease-2 (rTIMP-2). The present invention also relates to a therapeutic agent, and a medicine for preventing and treating wounds, chronic ulcers such as decubitus ulcers, inflammatory ulcers, and skin ulcers such as simple ulcers.

[0002]

2. Description of the Related Art The healing process of wounds and ulcers roughly involves reconstitution of inflammatory cell proliferating epidermis and dermal components, and characteristic cells are present at each stage. The first response to wounds is the synthesis of extracellular matrix components such as fibronectin, fibrinogen and vitronectin,
It provides a matrix that provides a scaffold for cells to migrate to the wound. Platelets derived from the activated platelets.
h factor: PDGF), transforming growth factor-α (transforming growt)
hfactor-α: TGF-α), transforming growth factor-β (TGF-β), insulin-like growth factor-I (insulin-like growth).
factor-I: IGF-I) and the like are released, and inflammatory cells migrate to the wound site.

When no infectious disease is caused, macrophages and lymphocytes appear after 1 to 2 days and hold the key to wound healing.
That is, macrophages and lymphocytes serve as sources of removal of necrotic tissue at the wound site and growth factors and cytokines. Macrophage secreted TGF-α, TGF-β, IG
FI, colony stimulating factor
laminating factor: CSF), interleukin-8 (interleukin-8: IL-8)
Migrates from the inflammatory process to the tissue regeneration process by migrating cells to the wound site. In addition, heparin-binding epidermal growth factor secreted by lymphocytes (heparin bi)
nding epidermal growth fa
ctor: HB-EGF), basic fibroblast growth factor (basic fibroblast growth factor)
factor: bFGF) induces proliferation of fibroblasts, vascular endothelial cells, and vascular smooth muscle cells, and promotes angiogenesis.
Then, the extracellular matrix of the new dermis is constituted by fibronectin, collagen, hyaluronic acid and the like. P
DGF, TGF-β, and bFGF promote the cell division of skin cells and induce keratinocyte growth factor (keratinoc).
yte growth factor (KGF) acts only on epithelial cells and promotes proliferation. It is believed that keratinocytes produce cytokines that promote fibroblast proliferation and collagen formation, and determine the final quality of skin repair. It is considered that the expression of cell surface receptors for such various growth factors plays an important part in the healing process of cell migration and proliferation.

However, the action of cytokines such as growth factors is based on complicated crosstalk, and one kind of cytokine does not always hold the key to the healing process. In addition, the expression of cell adhesion factor receptors on the cell surface plays a role in adhesion between cells, adhesion between cells and extracellular matrix, fusion of wound site, and imparting contractility. In tissue destruction and remodeling during the healing process of wounds and ulcers, inflammatory cells and proteases derived from tissue cells are important in the inflammatory reaction involving tissue degeneration / necrosis, perfusion due to circulatory disorders, and proliferation of tissue cells and free cells. It is known to play a role. In fact, in skin ulcers, corneal ulcers, burn ulcers, cutaneous bullous diseases, etc., certain matrix metalloproteinases (mat) are involved.
rix metalloproteinase: MM
P) Increased activity has been observed.

Matrix metalloproteases (MM
Ps) is a family of neutral proteases with Zn ²⁺ in the active center. It is well known that MMPs play an important role in the degradation of extracellular matrix, and more than ten kinds of MMPs are known to date. Destruction of extracellular matrix by MMPs is one of the major causes of delaying the healing of intractable diseases associated with tissue destruction, and this increase in MMP activity is associated with the endogenous MMPs inhibitor TIMPs. It is believed to be the result of a physical imbalance. Among inflammatory cells derived from blood cells, neutrophils and macrophages have the ability to secrete various types of MMPs, but various cytokines including growth factors that are promoted during inflammation cause MMPs to be secreted. Induction of production is complicatedly regulated.

[0006]

The skin ulcers include vascular ulcers represented by arterial occlusive lower leg ulcers and venous stasis lower leg ulcers, as well as pressure ulcers due to continuous pressure stimulation as difficult ulcers. In addition to diabetic ulcer, there are burn ulcer, traumatic ulcer, radiation ulcer, drug ulcer, postoperative ulcer, inflammatory ulcer, simple ulcer, etc. depending on the origin. Chronic (refractory)
Skin ulcers are associated with various factors such as aging, physical factors, and sometimes underlying underlying diseases.
Furthermore, it is not uncommon to have a wound infection,
Many require long-term treatment. Currently, for the treatment of these difficult-to-treat skin ulcers, particularly chronic (refractory) ulcers, purified sucrose / povidone-iodine preparations, tocoretinate preparations,
Bucladesine sodium agent, cadexomer / iodine agent, etc. are used. However, most of these drugs are drugs and wound-wounding agents for the purpose of sterilizing and cleaning the affected area, and few of them have been actively developed with the intention of proliferating cell and tissue regeneration of the affected area. Chronic (refractory) ulcers differ in site, size, pathological condition, etc. depending on their type, and the factors that prevent healing have not been clarified yet, so a drug that has a powerful effect by itself has appeared. I haven't. In the future, it is expected that the number of elderly people aged 65 and over will increase in the population, and the number of sick elderly people will increase. Among them, the number of patients with chronic (refractory) ulcers such as decubitus ulcers and leg ulcers will also increase. Since it is expected, it is desired to develop a new drug that has a wide range of effects on chronic (refractory) skin ulcers and wounds.

It is said that millions of operations are performed annually in Japan, but at least the healing of surgical scars in simple surgical operations can be shortened, so that the hospitalization period can be shortened. This, in turn, will reduce the financial burden on health insurance and other medical financing. Furthermore, the prevention of the occurrence of keloids and hypertrophic scars and the prevention and treatment of trauma scars in postoperative skin defect wounds are extremely useful from an aesthetic point of view, which is an important factor of quality of life. However, until now, there has been a very effective direct therapeutic agent for wounds, a healing accelerator for surgical wounds by surgery, and a preventive agent for keloids and hypertrophic scars in postoperative skin defect wounds. The reality is that there is nothing. For clinical considerations and explanations related to skin deficiency, for example, "Christopher Surgery (2nd Edition)" (translated by Koichi Ishikawa et al., Published by Ikushosho), "Color atlas of pressure ulcers and skin ulcers, diagnosis And treatment ”(supervised and edited by Atsushi Kukita and 1 other person, published by the Clinical Medicine Research Group, Chugai Medical Co., Ltd.),
"Recent Progress in Treatment of Wounds" (edited by Kiyonori Narii, edited by Takahiko Moriguchi, Katseido Publishing Co., Ltd., 1993), "New Wound Management for Dressing" (Sadao Anazawa)
Supervised, edited by Akira Kuramoto and 3 others, Herusu Publishing, 1995
(Issue) etc., and the descriptions in these are appropriately referred to and used for understanding problems and the like.

[0008]

SUMMARY OF THE INVENTION An object of the present invention is to provide a TIM
By using a pharmaceutical composition containing Ps as a main active ingredient, treatment and prevention of chronic (refractory) ulcers, treatment of wounds, and prevention and treatment of surgical scars and trauma scars due to various surgical operations and surgical scars and external It is to provide a treatment means characterized by reducing the size of scars. The present inventors have found that TIMPs are endogenous inhibitors that are present in tissues and body fluids and specifically inhibit the activity of MMPs, and that they have growth factor-like activity on cultured epidermal keratinocytes and cultured fibroblasts. Paying attention to
We believe that an effective therapeutic agent for chronic (refractory) ulcers that utilizes inhibition of MMPs activity by TIMPs can be provided, and as a result of various studies on clinical usefulness, TIMPs
The present invention has succeeded in providing a therapy with a therapeutic agent for skin defects containing s as an active ingredient, particularly a therapeutic agent for skin ulcers and a therapeutic agent for wounds.

The present inventors have been unable to obtain a large amount of TIMPs from tissues or cultured cells derived from animals, including humans, or blood, and it has been difficult to actually apply or use TIMPs. Using recombinant DNA technology to obtain a large amount of the recombinant TIMPs (rTIMPs) thus obtained in a large amount, it was confirmed what kind of pharmacological action it had, and it was found that it can be clinically used. The present invention has been completed.
The present invention comprises (1) a tissue inhibitor for treating skin deficiency (a pharmaceutical composition for treating skin deficiency, comprising at least one tissue inhibitor selected from the group consisting of tissue inhibitors of metalloproteases as an active ingredient. The same shall apply hereinafter), and (2) the therapeutic agent is used for the purpose of including prevention of the generation of scars in skin defects and prophylactic treatment for reducing the size of scars in the treatment of skin defects. And the therapeutic agent according to (1) above, (3)
The therapeutic agent according to (1) above, wherein the skin defect is a wound, and (4) the wound is a surgical wound, and the surgical wound or surgical scar related thereto is reduced by preventive treatment. The therapeutic agent according to (3) above, wherein the wound is a traumatic wound, and the traumatic wound or traumatic scar related thereto is reduced by prophylactic treatment. The therapeutic agent according to (3) above,

(6) The therapeutic agent according to (1) above, wherein the skin defect is a skin ulcer, (7) the skin ulcer is a postoperative ulcer, and the postoperative ulcer or a postoperative scar associated therewith. (6) The therapeutic agent according to (6) above, which is reduced by prophylactic treatment, (8) The skin ulcer is a traumatic ulcer, and the traumatic ulcer or a traumatic scar related thereto is prevented. (6) The therapeutic agent according to (6) above, wherein the skin ulcer is a chronic ulcer, and (10) ) The therapeutic agent according to the above (6), wherein the skin ulcer is a decubitus ulcer, (11) The therapeutic agent according to the above (6), wherein the skin ulcer is an angiopathic ulcer, 12) The above, wherein the skin ulcer is an inflammatory ulcer (6) The therapeutic agent, (13) the skin ulcer is a simple ulcer, the therapeutic agent according to (6) above, and (14) containing the tissue inhibitor of metalloprotease-1 as an active ingredient. A therapeutic agent as described in any one of (1) to (13) above,

(15) Tissue inhibitor of
Recombinant tissue inhibitor of metalloprotease-1 as metalloprotease-1 is contained, The therapeutic agent according to the above (14),
(16) A recombinant tissue inhibitor of metalloprotease-1 is used as a host cell in E. coli,
The therapeutic agent according to the above (15), which is expressed by a transformant cell obtained by using CHO cells or COS-1 cells, and the obtained gene product is purified, (17) effective Tissue inhibitor as an ingredient
A therapeutic agent according to any one of the above items (1) to (13), characterized by containing an oblate metalloprotease-2.
(18) Recombinant tissue inhibitor of metalloprotease-2 is contained as tissue inhibitor of metalloprotease-2, (19) Recombinant tissue inhibitor of metalloprotease-2 is a host cell. The therapeutic agent according to the above (18), which is expressed by a transformant cell obtained by using Escherichia coli, CHO cell or COS-1 cell as described above, and the obtained gene product is purified, 20) The tissue inhibitor of metalloproteases, wherein a mixture of tissue inhibitor of metalloprotease-1 and tissue inhibitor of metalloprotease-2 is used as an active ingredient, and any one of the above (1) to (13) is provided. Treatment , (2
1) Recombinant tissue inhibitor of metalloprotease-1 as tissue inhibitor of metalloprotease-1 and recombinant tissue inhibitor of metalloprotease-2 as tissue inhibitor of metalloprotease-2, respectively (20). Therapeutic agent for (22) Recombinant
Tissue inhibitor of metalloprotease
1 and recombinant tissue inhibitor of metalloprotease-2 are expressed by transformant cells obtained by using Escherichia coli, CHO cells or COS-1 cells as host cells, and the obtained gene products are purified. The therapeutic agent according to (21) above is provided.

Further, in the present invention, (23) the therapeutic agent is a dosage form suitable for local administration to the affected area, and the therapeutic agent according to any one of the above (1) to (22),
(24) The dosage form of the therapeutic agent is an ointment preparation, plaster preparation, solution, liquid, oil, cream, pasta, poultice, liniment, lotion, spray, suspension, emulsion, The therapeutic agent according to any one of (1) to (23) above, which is one selected from the group consisting of an external tincture, a skin liquid, an irrigation agent and a patch. 25) The above-mentioned (1) to (23), wherein the dosage form of the therapeutic agent is one selected from the group consisting of a dressing agent, a skin coating agent or a plaster patch, a skin adhesive agent and a bandage. ) Any one of the therapeutic agents, (2
6) A therapeutic agent according to any one of the above (1) to (25), characterized in that it contains a pharmaceutically acceptable carrier, excipient or diluent, (27) Tissue inhibitor of metalloprotease A method for treating a skin defect, which comprises administering to a patient an effective amount of at least one tissue inhibitor selected from the group consisting of the following: (28) Prevention of scarring of skin defect and reduction of the scar (27) A wound, a skin ulcer, a surgical wound by a surgical operation,
Traumatic wounds, vascular ulcers including arterial occlusive leg ulcers and venous stasis leg ulcers, pressure ulcers and diabetic ulcers due to continuous pressure stimulation, burn ulcers, traumatic ulcers, radiation ulcers, drug ulcers, postoperative ulcers The method according to (27) or (28) above, which comprises treating any one of diseases selected from the group consisting of inflammatory ulcer and simple ulcer, and (30) ulcer or wound affected area. The method according to any one of the above (27) to (29), characterized in that the at least one tissue inhibitor selected from the group consisting of (31) tissue inhibitors of metalloproteases is effective. A method for treating skin deficiency, characterized in that an amount thereof is used together with artificially cultured skin, and (32) a pharmaceutical composition for treating or preventing skin deficiency. The use of a tissue inhibitor selected from the group consisting of tissue inhibitors of metalloproteases, is provided. According to the present invention, (33) Kodama et al. ,
Collagen Rel. Res. , 7,341-3
50, 1987 or Kishi and Haya
kawa, J .; Biochem. , 96, 395-40
According to the method described in 4,1984, in cartilage, dental pulp, gingiva, uterus, placenta, and skin tissues derived from human, bovine, and other animals, including culture medium of bovine dental pulp-derived cells and human serum, or
TIMP-obtained from articular chondrocytes, osteoblasts, fibroblasts derived from various tissues, or epithelial cells, amniotic fluid, serum, plasma, platelets, monocytes, macrophages, or culture fluids thereof
The therapeutic agent according to (1) above, which contains 1 as an active ingredient,
(34) Kodama et al. , J. et al. Immun
ol. Methods, 127, 103-108, 19
90. TIMP obtained from human placenta according to the method described in
(35) Fujimoto et al., Which contains -1 as an active ingredient. , Cli
n. Chim. Acta, 220, 31-45, 199
3 or according to the method described in JP-A-6-300757, tissues such as cartilage, dental pulp, gingiva, uterus and skin derived from humans including human placenta, bovine and other animals, articular chondrocytes, osteoblasts, The therapeutic agent according to (1) above, which contains TIMP-2 obtained from various tissue-derived fibroblasts, or epithelial cells, amniotic fluid, serum, plasma, platelets, monocytes, macrophages, or a culture solution thereof as an active ingredient, (36)
Williamson, et al. , Bioche
m. J. , 268, 267-274, 1990, Boo
ne, et al. Proc. Natl. Acad.
Sci. USA. , 87, 2800 to 2804, 199
(1) containing rTIMP-1 or / and rTIMP-2 obtained according to the method described in 0.
(37) Human normal gingival fibroblasts (Gi
1st strand cDNA was synthesized by a reverse transcription reaction using poly A ⁺ mRNA prepared from (n-1 cells) as a template and oligo dT (15 to 18) as a primer, and then PCR primer: primer T1Fl; 5 ′.
-ATGGCCCCCTTTGAGCCCCTG-3 '
And primer TlRl; 5'-CAGGATTCAG
TIM by PCR reaction using GCTATCTG-3 '
The P-1 gene is amplified, and the resulting TIMP-1 gene is subcloned into an appropriate cloning vector such as pUC13, and then an appropriate expression vector such as pM.
EMneo (Lee et al., Nature, 2
94, 228-232, 1981),
The therapeutic agent according to (1) above, which contains rTIMP-1 as an active ingredient, which has been prepared by culturing a transformant containing a TIMP-1 gene-introduced yeast and a CHO cell, which has been introduced into a host cell. 38) Poly A ⁺ mRNA prepared from human Gin-1 cells as a template, oligo dT (15-
1st by reverse transcription reaction using 18) as a primer
synthesis of strand cDNA is performed, then PCR primer: primer T2F7; 5'-AAAGTCGAC
CATGGGGCGCCGCGGCCCGCACCCT-
3'and primer T2R5; 5'-TTAAGATC
TGTCGACTTAAGGATCCTCGATATC
The resulting TIM was obtained by amplifying the TIMP-2 gene by PCR reaction using GAGGAATTCTTGC-3 '.
The P-2 gene is cloned into a suitable cloning vector, such as p
After subcloning into UC13, a suitable expression vector,
For example, rTIMP-2 prepared by cloning into pKG, introducing into a host cell, and culturing a transformant cell containing the thus obtained TIMP-2 gene-introduced CHO cell.
The therapeutic agent according to (1) above, which comprises:
(39) T prepared as described in Example 1.
The therapeutic agent according to (1) above, which contains IMP-1 as an active ingredient, (40) The therapeutic treatment according to (1), which contains TIMP-2 prepared as described in Example 1 as an active ingredient. Agent, (41) The therapeutic agent according to (1) above, which contains rTIMP-1 prepared as described in Example 1 as an active ingredient, (42) prepared as described in Example 1. (1) The therapeutic agent according to the above (1) containing rTIMP-2 as an active ingredient, and (43) above containing rTIMP-1 prepared according to the method described in JP-A-5-199868 as an active ingredient. (1) The therapeutic agent, and (44) the method of Aoki et al. (Connective Tissue, 1995; 2).
6: 281-290).
There is provided a therapeutic agent according to (1) above, which comprises:

[0013]

BEST MODE FOR CARRYING OUT THE INVENTION TIMPs used in the present invention
May include inhibitors to the MMP family, eg M such as TIMP-1, TIMP-2
Inhibitors for MPs can be used. In particular, TIMP-2 has many excellent properties as a therapeutic agent for skin defects, especially a therapeutic agent for skin ulcers and a therapeutic agent for wounds. In particular, rTIMP-2 shows excellent properties.

TIMP-1 is a glycoprotein and has cartilage, dental pulp, gingiva, uterus, derived from human, bovine and other animals.
Placenta, tissue such as skin, articular chondrocytes, osteoblasts, various tissue-derived fibroblasts, cultured cells such as epithelial cells, amniotic fluid,
It is produced from serum, plasma, platelets, monocytes, macrophages and the like, and can be prepared from the condition culture medium of these tissues and cultured cells. For example, Kodama e
t al. , Collagen Rel. Res. ,
7,341-350,1987 and Kishi and
Hayaka, J .; Biochem. , 96, 3
According to the method described in 95-404, 1984, it can be isolated from the culture solution of bovine dental pulp-derived cells or human serum by affinity chromatography using a monoclonal antibody. Also, Kodama et al. , J. et al. I
mmunol. Methods, 127, 103-10
It can also be obtained from human placenta according to the method described in 8, 1990.

TIMP-2 was found relatively recently and has about 40% homology in amino acid sequence with TIMP-1, but unlike TIMP-1, it binds N-linked oligosaccharide chains. Not. TIMP-2 can also be obtained from various tissues and culture solutions of cultured cells derived from tissues as in the case of TIMP-1. For example, Fujimoto et
al. , Clin. Chim. Acta, 220, 3
1-4, 1993, JP-A-6-300575, and the like, and can be obtained from human placenta or the like by affinity chromatography using a monoclonal antibody. TIMP-2 has a property that is different from TIMP-1 and has a different molecular structure that does not have an N-linked oligosaccharide chain, but has a direct medicinal effect, a wound healing agent, and a surgical wound healing by surgery. It is very useful as a promoter and a preventive agent for the occurrence of keloids and hypertrophic scars in skin defect wounds after surgery.

TIMP-1 and TIMP-2 are recombinant D
NA technology (Maniatis, T. et al., Mo
regular Cloning, Cold Spri
ng Harbor Laboratory, Cold
Spring Harbor, New York, 1
982) can also be used. There are certain restrictions inherent in the use of conventional cell culture conditions and culture media, serum, and even placenta. However, production methods using recombinant DNA technology are subject to these restrictions. In addition, it is possible to obtain TIMPs in a quantity and quality that can be used in animal experiments and clinical tests required for approval of the production of pharmaceuticals. In particular, the healing process of wounds and skin ulcers involves a complex multi-step process as described above, and various in-vivo cells and bioactive factors that are different at each stage are involved, and further, they are in various balances. It is difficult to ascertain what role TIMPs actually play under pathological conditions, what kind of pharmacological activity and physiological activity they have, and what kind of disease they are effective under. Should be understood. From this point of view, by using recombinant DNA technology,
Manufactured in direct form and in sufficient quantity and quality to confirm its function in the healing process of complex wounds and skin ulcers, and in animal experiments and clinical trials required for drug approval. RT obtained in quantity and quality that can be used
It is noteworthy that IMPs have been found to have a therapeutic activity for skin defects, particularly a therapeutic or preventive activity for skin ulcers, and a therapeutic and wound healing activity.

For example, using nucleic acid sequences encoding TIMP-1 and TIMP-2, eukaryotic host cells such as yeast and Chinese hamster ovary cells (CHO cells), prokaryotic host cells such as E. coli, insect cells such as Sf21, etc. It can be obtained by using all hosts usually used for recombinant DNA technology and expression vectors corresponding to the hosts. In the case of TIMP-1, which is a glycoprotein, a host vector system using eukaryotic cells as a host is preferably used.
RTIMP-1 and rTIMP- by recombinant DNA method
2 is obtained, for example, by Williamson, et a
l. , Biochem. J. , 268, 267-27
4, 1990, Boone, et al. Proc.
Natl. Acad. Sci. USA. , 87,280
0-2804, 1990 can be referred to.

For example, rTIMP-1 is polyA ⁺ mR prepared from human normal gingival fibroblasts (Gin-1 cells).
1st strand cDN by reverse transcription reaction using NA as a template and oligo dT (15-18) as a primer
A, followed by PCR primers such as primer TlFl; 5'-ATGGCCCCCTTTGAG
CCCCTG-3 'and primer TlR1; 5'-C
PC using AGGATTCAGGCTATCTG-3 '
The TIMP-1 gene is appropriately amplified by an R reaction, and the obtained TIMP-1 gene is subcloned into an appropriate cloning vector, for example, pUC13, and then an appropriate expression vector, for example, pMEMneo (Lee et a).
l. , Nature, 294, 228-232, 198.
It was cloned in 1) and introduced into CHO cells and the like by a common calcium phosphate coprecipitation method or the like. Transformants such as TIMP-1 transgenic yeast and CHO cells are cultured by a suitable method such as microcarrier culture or high-density continuous culture,
RTIMP-1 is prepared from the obtained condition medium. It should be understood that, depending on the host cell into which the expression vector has been introduced, the sugar chain structure of the gene product may be different from that of the natural product.

RTIMP-2 is, for example, a human Gi
The first strand cDNA was synthesized by a reverse transcription reaction using polyA ⁺ mRNA prepared from n-1 cells as a template and oligo dT (15 to 18) as a primer,
Then PCR primers, for example primer T2F7;
5'-AAAGTCGACCATGGGGCGCCGCG
GCCCGCACCCT-3 'and primer T2R
5; 5'-TTAAGATCTGTCGACTTAAG
GATCCTCGATATCGAGGAATTCTTG
The TIMP-2 gene is appropriately amplified by a PCR reaction using C-3 ', and the obtained TIMP-2 gene is subcloned into an appropriate cloning vector, for example, pUC13, and then cloned into an appropriate expression vector, for example, pKG. Calcium phosphate coprecipitation method
It was introduced into HO cells and the like. TIMP-2 transgenic CHO
A transformant such as a cell is cultured by a suitable method such as microcarrier culture or high-density continuous culture, and rTIMP-2 is prepared from the obtained condition medium. Recombinant DN
RTIMPs obtained by using the A technique differ in the amino acid sequence by one or more mutations in the constituent amino acids, for example, deletion, substitution, insertion, transposition or addition, as long as the purpose of the present invention is met. There can be. Using recombinant DNA technology, it is possible to delete, substitute, or insert one or more amino acids by, for example, inducing a mutation at a specific site in a basic DNA sequence. Representative methods include the site-directed mutagenesis method (edited by The Biochemical Society of Japan, “New Biochemistry Experiment Course 2, Nucleic Acid III, Recombinant DNA Technology”, Tokyo Chemical Dojin, 23
3 to 251, October 5, 1992).

TIMPs derived from these various sources
Are conventionally known methods used for purification of normal proteins, for example, salting out method using ammonium sulfate or sodium sulfate, chromatography method using gel filtration carrier or ion exchange carrier, electrophoresis, monoclonal antibody against each TIMPs Affinity chromatography using HPLC, ConA, etc., high performance liquid chromatography, etc., can be used as appropriate, depending on the properties of each TIMP, alone or in any combination.
By the way, there is a limit in obtaining a natural product as a homogeneous product from a microscopic point of view.
In fact, -1 is a product consisting of substances having various forms of sugar chains in the molecule due to the effect of the treatment inherently or in the process of isolation, resulting from various molecular weights and the like. . It is considered that rTIMPs does not contain contaminants which are normally involved in non-recombinant cells (non-transformants) because they have a small amount of biological activity and are difficult to completely separate and purify. In particular, rTIMP-2 can be obtained as a final product containing little denatured protein and the like by subjecting it to purification and isolation. rTIMP-2 is
Sufficient amount and purity to confirm its function in the healing process of complex wounds and skin ulcers, and sufficient amount to be used in animal experiments and clinical trials required for approval of drug manufacturing And the fact that it can be obtained with purity is recognized, and it is excellent as an active ingredient of medicine.

The present invention provides a pharmaceutical composition containing TIMPs as an active ingredient and a pharmaceutically and pharmaceutically acceptable excipient. The active ingredient selected from the group consisting of TIMPs comprises from about 0.001 ng to about 10 ng / day.
Although it is possible to administer in the range of 0 mg, of course, the dose can be selected so as not to cause side effects according to the symptoms, age, degree of disease, concomitant drugs, etc. It can be appropriately selected from once per day to more than once. The active ingredient selected from the group consisting of TIMPs can be added to the preparation in the range of 0.0001% to 50%, but the amount can be appropriately selected as necessary. The pharmaceutical composition of the present invention is prepared by mixing or the like,
Stabilizers, pH adjusters, surfactants, if necessary
Buffers, fragrances, preservatives, bases, solvents, diluents, fillers,
Bulking agents, solubilizers, solubilizers, isotonic agents, emulsifiers, suspending agents, dispersants, thickeners, gelling agents, curing agents, absorbents,
Adhesives, elasticizers, plasticizers, binders, disintegrants, propellants, preservatives, antioxidants, sunscreens, humectants, emollients, antistatic agents, soothing agents, etc., alone or in combination be able to. Examples of the stabilizer include amino acids or salts thereof such as glycine, sugars such as glucose and sucrose, sugar alcohols such as mannitol and sorbitol, oligosaccharides, polysaccharides, proteins such as albumin, gelatin, globulin, and protamine, and peptides. Can be p
Examples of the H regulator include inorganic acids such as hydrochloric acid, sulfuric acid, phosphoric acid, and carbonic acid, organic acids such as citric acid, and salts thereof. In addition, it can be appropriately selected and used from those known to be used in pharmaceuticals.

The pharmaceutical composition of the present invention can be administered orally, topically, transdermally,
It may be suitable for intravenous, intramuscular, subcutaneous, intradermal or intraarticular administration, but local administration to ulcers or wounds is preferred.
Of course, it can be used in combination with other drugs such as ulcer therapeutic agents and wound therapeutic agents. Also cytokines such as PD
GF, TGF-α, TGF-β, IGF-I, CSF,
It is also possible to mix cytokines including growth factors such as IL-8, EGF, bFGF and KGF, or other physiologically active substances, as long as it is effective for the treatment of skin defects of the present invention. In some cases, it can be used together with artificially cultured skin, and can also be used in combination with a medical material for treatment or a drug which is considered to be effective in treating skin defect symptoms. When the pharmaceutical composition of the present invention is administered locally to an affected area, as a preparation, an ointment preparation, a plaster preparation, a solution, a liquid preparation, an oil preparation, a cream preparation, a pasta preparation,
Pap, liniment, lotion, spray,
Suspension, emulsion, tincture for external use, water solution for skin, irrigant,
A patch or the like can be arbitrarily selected. It is also possible to impregnate a liquid agent or the like into gauze, absorbent cotton, a wound covering material, an adhesive plaster, or the like. In manufacturing pharmaceutical products, the additives, preparation methods, etc. are, for example, supervised by the Japan Official Book Association, 11th revised Japanese Pharmacopoeia Manual, published on July 18, 1986, published by Hirokawa Shoten Co., Ltd .; Takashi Bangase et al. Development of Pharmaceuticals Volume 12 (Pharmaceutical Formulation [I]), Issued October 15, 1990, Hirokawa Shoten Co., Ltd .; Development of Pharmaceuticals Volume 12 (Formulation Material [II]) 1990
It can be applied by appropriately selecting it from those referring to the description of Hirokawa Shoten Co., Ltd., issued on October 28, 2012, as necessary. When used for the treatment of skin deficiency, absorption of the active ingredient through the skin is considered to be important, but generally, when kept in a moist state, drug absorption may be good. Any method or means known in the art can be used so long as it is effective for treating the skin defect of the present invention. TI contained in the pharmaceutical composition of the present invention
As the MPs, any TIMPs can be used as long as they inhibit MMPs activity. However, rTIMPs artificially prepared can be used because preferably a large amount of homogeneous TIMPs can be obtained. In particular, rTIMP-2 is obtained in a uniform amount and in a purity effective for working in the healing process of complex wounds and skin ulcers, and has excellent properties in handling. When used as a medicament, strict requirements are required for the stability of the preparation and the like, but rTIMP-2 also has excellent properties in this respect.

The quantification of TIMPs necessary for the preparation of the pharmaceutical composition according to the present invention is carried out according to the method described in JP-A-63-210665 and JP-A-5-244985.
Enzyme immunochemistry can be performed by a sandwich assay system using two types of monoclonal antibodies that specifically recognize different epitopes in MP-1 or TIMP-2.

To confirm the effect of the pharmaceutical composition of the present invention,
Various wounds, skin ulcers, surgical wounds from various surgical procedures,
Traumatic wound, vascular ulcer represented by arterial occlusive lower leg ulcer and venous stasis lower leg ulcer, pressure ulcer due to continuous pressure stimulation, diabetic ulcer, burn ulcer, traumatic ulcer, radiation ulcer, drug ulcer, surgery Confirmed using a system suitable for evaluating skin deficiency therapeutic activity, especially skin ulcer therapeutic or preventive activity, wound healing and healing promoting activity, using models such as post-ulcer, inflammatory ulcer and simple ulcer Can be done. In particular, the test for confirming the effect of the pharmaceutical composition according to the present invention can be carried out by using the experimental skin defect (ulcer and wound) model, the experimental surgical wound model, etc. described below, but other various methods are used. It should be understood that you can. The effect confirmation test using the experimental skin defect model can be evaluated as follows. Skin defects are made in two places with circular punches (internal diameter 8 mm) on the dorsal skin of rats or mice shaved beforehand under ether anesthesia. TIMPs-containing liquid agent (solvent 0.005% benzalkonium chloride-containing physiological saline; 0.005% benzalkonium chloride-containing 0.15M NaCl solution, pH 7.2) as a test drug for the affected area of skin defect
Was administered once a day for 22 μl every day. On the other hand, as a control, only 0.005% benzalkonium chloride-containing physiological saline containing no TIMPs is similarly administered to the affected area every day. As a result, compared with the control group, in the group administered with the pharmaceutical composition of the present invention, promotion of reduction of the defect area of the skin defect affected area was observed, showing shortening of the number of days until complete recovery, and the affected area and its peripheral area The improvement was also remarkable. Further noteworthy points are:
The re-epithelialization of the skin defect affected area, formation of granulation tissue, angiogenesis, etc. were promoted, repair of the affected area was promoted, and the treatment scar was small and less conspicuous. This effect is
Not only is Ps useful as a therapeutic agent for chronic (refractory) ulcers, but it can also be used to reduce general surgical scars and trauma scars, and is also very useful from a aesthetic point of view, which is an important factor in Quality of life. It was judged to be highly effective. The effect confirmation test using the experimental surgical wound model can be evaluated as follows. For example, diabetic mice (KK-A
y / Ta Jcl) (♀ 6 weeks old, body weight around 30 g), using Nembutal anesthesia (30 mg / kg, ip), pre-shaving and disinfecting the skin from the back to the abdomen. Using a scalpel, make a lateral abdominal incision with a length of about 10 mm in left and right contrast, perpendicular to the midline. Immediately, a TIMPs-containing liquid agent (solvent 0.
Physiological saline containing 005% benzalkonium chloride; 0.0
0.15M NaCl containing 05% benzalkonium chloride
Solution, pH 7.2) 2 drops (about 22 μl) of the control 0.005% benzalkonium chloride-containing physiological saline was dropped into the other incision using a syringe with a 26G needle, and 2 drops were rapidly taken at equal intervals. At the place, suture using silk thread. After that, the test drug or the control solution is continuously applied (dropped) once a day for 7 days. The wound site is covered with a coating (biocl) to prevent contamination.
and wrap with an elastic bandage (Silky Tex). On the 7th day of the test, the yarn is removed, and the healing effect is evaluated by observing the macroscopic findings such as the healing status of the affected area and the degree of scar formation and the surface tissue of the affected area, and conducting a histopathological search. The macroscopic findings are evaluated based on the size of the suture wound compared to the control group and the blood color of the suture wound and the surrounding area. Histopathological findings are evaluated based on degeneration, the degree of necrosis and the balance of regenerated images, the degree of fibrosis and infiltration of inflammatory cells, and the balance of edema in comparison with the control group. No side effect was observed on the site to which the pharmaceutical composition according to the present invention was applied, which was judged macroscopically.

Thus, the drug containing at least one tissue inhibitor selected from the group consisting of TIMPs as an active ingredient is difficult to treat in addition to vascular ulcers represented by arterial occlusive lower leg ulcers and venous stasis lower leg ulcers. Ulcer, pressure ulcer and diabetic ulcer due to continuous pressure stimulus,
It is considered to have a preventive or therapeutic action, a symptom-improving action, etc. for burn ulcers, traumatic ulcers, radiation ulcers, drug ulcers, postoperative ulcers, inflammatory ulcers, simple ulcers, etc., which are called by their origins. A drug containing at least one tissue inhibitor selected from the group consisting of TIMPs as an active ingredient is a chronic (refractory) skin ulcer, etc., and is associated with aging, physical factors or serious underlying diseases. In some cases, various factors are involved, and it is judged that it has significant activity against symptoms and diseases in which it is not uncommon for complications of wound infection. TIM
A drug containing at least one tissue inhibitor selected from the group consisting of Ps as an active ingredient is useful as a drug showing a strong effect alone. In addition, a drug containing at least one tissue inhibitor selected from the group consisting of TIMPs as an active ingredient shows a preventive activity against keloids and hypertrophic scars in a skin defect wound after surgery and a preventive effect on a trauma, and has a direct medicinal effect. It is useful as a wound healing agent, a healing accelerator for surgical wounds caused by surgery, and an agent for preventing the occurrence of keloids and hypertrophic scars in postoperative skin defect wounds. Furthermore, TIMPs are useful as therapeutic agents for chronic (refractory) ulcers. at least one tissue inhibitor selected from the group consisting of rTIMPs, in particular rTIM
A drug containing P-2 as an active ingredient exhibits not only advantages such as processing as a preparation thereof but also excellent activity against various wounds as described above, wounds associated with surgery, skin ulcers and the like. A therapeutic agent for skin defect containing rTIMP-2 can be expected to have stable physiological activity even after long-term storage, and can be expected to have excellent biological activity even after being applied to an affected area.

[0026]

EXAMPLES The present invention will be described in more detail with reference to the following examples, but it should be understood that the present invention is not limited to the examples and includes various embodiments. Example 1 Preparation of TIMPs TIMP-I is described, for example, in Kodama et al. ,
Collagen Rel. Res. , 7,341-3
50, 1987, from a conditioned medium of normal human gingival fibroblasts (Gin-1 cells), Ultrogel AcA-44 (LKB), Con
A Sepharose, anti-TIMP-1 monoclonal antibody (for example, clone No. 7-21B12 disclosed in Japanese Patent Application Laid-Open No. 63-219392, etc.) conjugated Sepharose 4B
-Purification using an affinity column, and finally, 35
C. for 30 minutes in 4M guanidine-hydrochloric acid,
Tests were carried out on a Bio-gel P60 column. A proteinaceous factor possibly binding to TIMP-1 was digested and prepared by fractionation.

TIMP-2 is, for example, Fujimoto.
et al. , Clin. Chim. Acta, 22
0, 31-45, 1993 and JP-A-6-300575
According to the method described in Japanese Patent Application Laid-Open Publication No. H07-115, the placenta is shredded and then stirred in a buffer, and the resulting supernatant is subjected to an anti-TIMP-2 monoclonal antibody (for example, clone No. 67- 4Hll, etc.) bound Sepharose 4
B. After applying the sample to the affinity column,
It was prepared using el AcA-44 (LKB). rT
IMP-1 was prepared, for example, according to the method described in JP-A-5-199868. Poly A ⁺ mRNA was prepared from the total RNA fraction prepared from human normal gingival fibroblasts (Gin-1 cells) by oligo (dT) -cellulose column.
Purified and concentrated. Poly A ⁺ mRNA as template, oligo dT
1st strand cDNA was synthesized by a reverse transcription reaction using (15 to 18) as a primer. Do
cherty et al. , Nature, 318,
66-69, 1985 with reference to the cDNA sequence of TIMP-1 described in PCR primer, primer T
1Fl; 5'-ATGGCCCCCTTTGAGCCC
CTG-3 'and primer TlRl; 5'-CAGG
ATTCAGGCTATCTG-3 'was prepared and the 1st str prepared above using these PCR primers was prepared.
TIM by PCR reaction using and cDNA as a template
Amplification of the P-1 gene was performed.

The resulting TIMP-1 gene is subcloned into an appropriate cloning vector, such as pUC13, and then an appropriate expression vector, such as pMEMneo (L
eeet al. , Nature, 294, 228-2.
32, 1981) and introduced into CHO cells by a general calcium phosphate coprecipitation method. TIMP
-1 gene-introduced CHO cells were cultured by a suitable method such as microcarrier culture or high-density continuous culture, and rTIMP-1 was prepared from the obtained condition medium. The prepared rTIMP-1 was observed as a single band of about 30 kDa on sodium dodecyl sulfate-polyacrylamide electrophoresis (SDS-PAGE, 12% homogeneous gel, under reducing conditions), and a peroxidase-labeled mouse anti-human TIM
A single band of about 30 kDa was also observed in western blotting using the P-1 antibody. rTI
The inhibitory activity of MP-1 on MMP-1 derived from human fibroblasts (CCD-41SK cells) has an IC ₅₀ of about 1 × 10
^-9M .

The rTIMP-2 can be obtained, for example, by the method of Aoki et al. (Connective Tissue, 1995;
26: 281-290). Human Gin
-1 oligo (dT) from total RNA fraction prepared from cells
-Poly A ⁺ mRNA was purified and concentrated by a cellulose column. Poly A ⁺ mRNA as template, oligo dT (15-1
1st s by reverse transcription reaction using 8) as a primer
The synthesis of tran cDNA was performed. Bone, e
t al. Proc. Natl. Acad. Sci.
USA. , 87, 2800 to 2804, 1990 with reference to the cDNA sequence of TIMP-2, PCR primer, primer T2F7; 5'-AAAGTCCGACC
ATGGGGCGCCGCGGCCCGCACCCT-
3'and primer T2R5; 5'-TTAAGATC
TGTCGACTTAAGGATCCTCGATATC
GAGGAATTCTTGC-3 ′ was prepared and the above-prepared 1st stra was prepared using these PCR primers.
TIMP by PCR reaction using nd cDNA as a template
-2 genes were amplified. The resulting TIMP-2 gene is subcloned into a suitable cloning vector, such as pUC13, and then a suitable expression vector, such as pK.
It was cloned into G and introduced into CHO cells by a general calcium phosphate coprecipitation method. TIMP-2 gene-introduced CHO cells were cultured by an appropriate method such as microcarrier culture or high-density continuous culture, and rTIMP-2 was prepared from the obtained condition medium. Prepared TIMP-
2 was recognized as a single band of about 24 kDa on SDS-PAGE (12% uniform gel, reducing conditions), and was also recognized as a single band of about 24 kDa in Western blotting using mouse anti-human TIMP-2 monoclonal antibody. Met. The inhibitory activity against CCD-41SK cell-derived MMP-1 has an IC ₅₀ of about 1.1 ×.
It was 10 ^-9 M. In the pharmaceutical composition provided in the present invention, any TIMPs can be used as long as they are TIMPs that inhibit MMPs activity, but preferably artificially prepared in that a large amount of homogeneous TIMPs can be obtained. rTIMPs can be used.

Example 2 Preparation of rTIMP-1 Containing Ointment As an ointment preparation, various publicly known ointment bases can be used. For example, rTIMP-1 was added to Macrogol ointment to prepare as follows. Can be converted.
Macrogol 400 and Macrogol 4000 5g each
To this, 5 mg of ethyl paraoxybenzoate and 1 mg of TIMP-1 obtained in Example 1 were added and uniformly mixed by a conventional method to prepare an ointment.

Example 3 Preparation of rTIMP-2 Containing Ointment rTIMP-2 containing ointment was formulated by adding the rTIMP-2 obtained in Example 1 to macrogol ointment in the same manner as in Example 2. can do.

Example 4 Preparation of solution containing rTIMP-1 Physiological saline containing 0.005% benzalkonium chloride (0.15M containing 0.005% benzalkonium chloride)
NaCl solution, pH 7.2) with the r obtained in Example 1
TIMP-1 is added and prepared to a final concentration of 0.1%. The prepared solution is sterilized with a membrane filter having a pore size of 0.1 μm, and then refrigerated (4 ° C.) until use.
Saved in.

Example 5 Preparation of liquid formulation containing rTIMP-2 A liquid formulation containing rTIMP-2 can be formulated using the rTIMP-2 obtained in Example 1 in the same manner as in Example 4. .

Example 6 Daily stability of rTIMP-2 containing liquid formulation The stability of the rTIMP-2 containing liquid formulation stored at 4 ° C.
It was evaluated by its inhibitory activity against purified human MMP-1 in vitro. The rTIMP-2 containing liquid preparation was prepared according to the method described in Example 5. Human latent MMP-1
Is disclosed in, for example, Fujimoto et al. , Cli
n. Chim. Acta, 219, 1-14, 1993.
Human neonatal fibroblasts (NB1R
It can be purified from the culture supernatant of GB). (1) Method of measuring in vitro inhibitory activity of rTIMP-2 containing liquid agent The inhibitory activity was measured by Nagai et al. ,inflammation,
4,123-130,1984 and Nagai et.
al. , Inflammation, 4, 247-254, 1984. 0.02% B
SA, 0.2M NaCl, 5mM CaCl _{2 included} 5
20 μl of purified human latent MMP-1 appropriately diluted with 0 mM Tris-HCl (pH 7.5) buffer was added to an equal amount of 2
mM 4-Aminophenylmercurica
Add cerate and incubate at 35 ° C. for 2 hours. To this was added 60 μl of rTIMP-2 containing solution diluted stepwise with 50 mM Tris-HCl (pH 7.5) buffer containing 0.2 M NaCl and 5 mM CaCl ₂ (at this time, 60 μl of buffer alone was added as a control), and the temperature was 35 ° C.
Incubate for an additional 15 minutes. Further 0.4M
0.1M Tr containing NaCl and 10mM CaCl ₂
F diluted 2-fold with is-HCl (pH 7.5) buffer
Add 100 μl of ITC-labeled collagen and incubate at 35 ° C. for 2 hours (control reaction system is 5 ° C. at 5 ° C.).
Boil for minutes). The reaction is stopped by adding 10 μl of o-phenanthroline dissolved in 50% ethanol. 0.
02% BSA, 0.2 M NaCl, 5 mM CaCl ₂
Add 200 μl of elastase diluted appropriately with 50 mM Tris-HCl (pH 7.5) buffer containing 35 ° C
Incubate for 10 minutes. 400 μl of 7
Tris- containing 0% ethanol and 0.67 M NaCl
Add HCl (pH 9.5) buffer and stir with a mixer for 30 seconds. This was centrifuged and the fluorescence of the resulting supernatant was Ex;
Measured at a wavelength of 495 nm, Em; 520 nm. Assuming that the fluorescence intensity of the control was 100% when the substrate was decomposed, the difference in fluorescence intensity of the samples was calculated, and the 50% inhibitory concentration (IC
₅₀ values).

(2) Storage stability The stability of the rTIMP-2 containing solution stored at 4 ° C. was evaluated by the IC ₅₀ value. As a result, it was judged that the liquid preparation has stable inhibitory activity for at least 12 weeks, and stable physiological activity can be expected even after storage for a relatively long period of refrigeration. The results of weekly inhibitory activity measurement are shown in FIG.

Example 7 Effect of rTIMP-2 Containing Agent on Skin Defects (Wounds and Ulcers) (1) Preparation of rTIMP-2 Containing Test Agent rTIMP-2 Containing rTIMP-2 Prepared in Example 5 A liquid agent was used. 0.0 as a control
A physiological saline solution containing 05% benzalkonium chloride was sterilized with a membrane filter having a pore size of 0.1 μm. (2) Preparation of test animal and experimental skin defect model SD rat (♀ 12 weeks old, body weight 254-
385 g) 8 mice, old ICR mouse (♀ 30 weeks old, body weight 20-56 g) 9 and diabetic mouse (KK-Ay / Ta Jcl) (♀ 6 weeks old, body weight 26
~ 34g) 6 rats were shaved and sterilized under ether anesthesia in advance, and a circular punch (inner diameter 8mm) was used on the back skin of these rats or mice, and the experimental skin defect site was symmetrically centered on the midline. Were prepared at two locations. One skin defect site was the administration site of the test drug containing rTIMP-2, and the other site was the administration site of the control solvent. (3) Administration of rTIMP-2 Containing Test Drug and Observation of Affected Area The solvent for the rTIMP-2 containing test drug and the control is 1 a day.
2 drops (about 22 μl) using a syringe with 26G needle
Was directly dropped onto the affected area and continuously administered. Old age (retir)
e) In ICR mice and diabetic mice, a coating agent (bioclusive) is used to prevent contamination of the skin defect affected area.
And the affected part was hermetically bandaged using an elastic bandage (Silky Tex). The major axis and minor axis of the skin defect portion were measured with a caliper every day, and the change in wound area during the healing process was determined by the following method. The product of the major axis and the minor axis on the date of skin defect preparation (Day 0) was defined as 100%, and the ratio to this was calculated by the following formula.

[0037]

The area change of the skin defect portion was determined from the calculated change over time of the area ratio. Test result of SD rat The administration group of the test drug containing rTIMP-2 was 4 compared with the control group.
From the first day onward, the reduction of the skin defect area was observed to be significantly reduced,
It also showed a slight reduction in the number of recovery days. The typical results of the daily healing process are shown in FIG. Test results of aged ICR mice The administration group of the rTIMP-2 containing test drug was 3
From the first day onward, the reduction of the skin defect area was observed to be significantly reduced,
He also showed a reduction in the number of recovery days. FIG. 3 shows the results of averaging the test results and displaying the healing process. Test result of diabetic mouse The administration group of the test drug containing rTIMP-2 was 3 compared with the control group.
From the first day onward, the reduction of the skin defect area was observed to be significantly reduced,
He also showed a reduction in the number of recovery days. FIG. 4 shows the results of averaging the test results and displaying the healing process. The macroscopic findings in all of these three types of test animals clearly showed that the skin deficient site had a good blood color and a high degree of dryness in the test drug administration group as compared with the control group on the third day of the test. Test 9 days to 1
On day 0, the area of the skin defect site in the control group was considerably reduced and the blood color was improved, but in the test drug administration group, the area of the skin defect site was further reduced, approaching the normal color. Comparing the treatment sites of the control group and the test drug administration group at the stage when the skin defect was healed, the test drug administration group showed less therapeutic scar and was less noticeable. In other words, what is noteworthy in the present test results is that not only the healing of the skin defect but also the treatment scar is small and less conspicuous, and when applied to humans, the occurrence of keloids and hypertrophic scars in the skin defect wound and the external appearance of the scar. Presumed to prevent scars. In these tests, no adverse effects were observed at all.

Example 8 Dose Dependence of Skin Tissue Defect Treatment Effect of rTIMP-2 Containing Agent (1) Preparation of rTIMP-2 Containing Test Drug r prepared in Example 5 as rTIMP-2 containing test drug
A TIMP-2 containing solution was used. However, rTIMP-
In addition to 0.1%, the content of 2 was set to four kinds of 0.05%, 0.01% and 0.001% in total. 0.0 as a control
A physiological saline solution containing 05% benzalkonium chloride was used. (2) Preparation of test animal and experimental skin defect model As a test animal, diabetic mouse (KK-Ay / Ta Jc
1) (13-week-old, weight 39-55g) 30 animals,
According to the method described in Example 7, two experimental skin defect sites were prepared on the back skin of the mouse. Each wound was used as the administration site of the rTIMP-2 containing test drug or control solvent having a different concentration. (3) Administration of rTIMP-2 Containing Test Drug and Observation of Affected Area The rTIMP-2 containing test drug and the control were administered once a day by direct instillation of the dose described in Example 7 to the affected part, and were continuously administered until wound closure. . The skin defect affected area is covered with a coating (bioclusiv).
The affected area was hermetically bandaged using e) and an elastic bandage (Silky Tex). The major axis and minor axis of the skin defect portion were measured with a caliper every day, and the area change of the affected portion was calculated by the method described in Example 7. Various concentrations of rT to be administered to two wounds
The combination of IMP-2 containing test agents is (a) control (0%)
And 0.001%, (b) 0.001% and 0.01
%, (C) 0.01% and 0.05%, (D) 0.05
% And 0.1%, (e) 0.01% and 0.1%,
Six mice were used for each combination. FIG. 5 shows the daily change of the wound area when treated with the test drug containing rTIMP-2 at various concentrations. Compared with the control, the test drug containing rTIMP-2 at a concentration of at least 0.001% or more showed a clear effect of promoting wound healing. There is a dose-dependent tendency in the intensity of the action, but the actions of 0.001% drug and 0.01% drug are almost the same, and 0.0
The 5% drug and the 0.1% drug showed almost the same effects.

Example 9 Histological evaluation of skin defect treatment effect of rTIMP-2 containing agent (1) Preparation of rTIMP-2 containing test drug rTIMP-2 containing rTIMP-2 prepared as in Example 5 As a control, a liquid saline containing 0.005% benzalkonium chloride was used as a control. (2) Preparation of test animal and experimental skin defect model As a test animal, diabetic mouse (KK-Ay / Ta Jc
1) Using 30 mice (age 8 to 13 weeks, body weight 36 to 53 g), two experimental skin defect sites were prepared on the dorsal skin of the mouse by the method described in Example 7. One skin defect site was the rTIMP-2 containing test drug administration site, and the other was the control solvent administration site. (3) Administration of rTIMP-2 Containing Test Drug and Histological Evaluation of Affected Area With the rTIMP-2 containing test drug and the control, once a day, the dose described in Example 7 was directly dropped on the wounded site to close the wound. Was administered every day. The affected area of the skin defect is covered with a coating agent (bioclusi).
ve) and an elastic bandage (silky tex) were used to hermetically bandage the affected area. On the 0th, 5th, 10th, 15th and 20th days of the test, 6 animals each were killed by intraperitoneal administration of pentobarbital. Cut the skin in a square shape at a depth above the fascia so that it includes all the wounds, and fix it with 10% formalin,
Paraffin-embedded blocks were prepared. A 5 μm thin section slide was prepared from each block, and each slide was stained with hematoxylin-eosin. (4) Histological evaluation With the progress of treatment days, a clear regenerated image of the epidermis was observed in the rTIMP-2 containing test drug treatment group, and in the lower part thereof, granulation tissue formation and dense formation were observed. Matrix formation and angiogenesis were clearly promoted. In particular, re-epithelialization was remarkable, and it was considered that the result was histologically promoted migration of keratinocytes. In addition, rTIMP-2
Was also thought to have an action of promoting granulation. Histological images of the control group and the test drug treatment group containing rTIMP-2 on day 15 of the test are shown in FIGS. As is clear from FIG. 6 and FIG. 7, which is a magnified photograph of a part of the histological image shown in FIG. 6, it can be seen that the rTIMP-2 treated mouse is completely cured (the wound is small) (FIG. In No. 7, it was found that the thickness of the epidermis at the healing site was the same as the thickness of the epidermis other than the wound, indicating that healing was more complete). This is more apparent when comparing control mice (FIG. 8 and FIG. 9 which is a magnified photograph of a part of the histological image shown in FIG. 8) (in FIG. 9, epithelialization of the uncured site has not been achieved yet). It is insufficient, and it can be seen that the epithelial part also has a thinner epidermis than the healing part in the test drug treatment group containing rTIMP-2). In addition, the histological findings of the wound were classified and quantified according to their degree as follows, and evaluated. (A) Re-epithelialization: 0 immediately after wound creation, 1 when completely healed
The degree of re-epithelialization was set to 0 and the degree of re-epithelialization was evaluated on a scale of 10. (B) Granulation formation: The following 4 steps evaluated. 1; thin granulation 2; medium granulation 3; thick granulation 4;
Very thick granulation (c) Matrix density: evaluated in the following 4 stages. 1; Edema 2; Small amount of coarse matrix 3; Medium matrix 4; Dense matrix (d) Number of infiltrated cells (fibroblasts, macrophages): evaluated in the following 4 stages. 1; almost none 2; moderate 3; majority 4; very many (e) number of capillaries per wound: evaluated at the next stage. 0; 0-4 1; 5-14 2; 15-24 3; 25
~ 34 ・ ・ ・ ・ ・ ・ ・ ・ ・ ・ ・ 10; 95-104
etc. For example, Table 1 shows the results of digitizing and evaluating each histological finding on the 10th day of the test. From numerical evaluation, rTIMP-
Re-epithelialization in the 2-containing test drug treated group compared to the control group,
Granulation formation, promotion of matrix density, and increase in the number of capillaries were confirmed, and re-epithelialization was particularly remarkable.

[0041]

[Table 1]

Example 10 Effect of liquid formulation containing rTIMP-2 on proliferation of human normal skin fibroblasts (1) Preparation of rTIMP-2 test drug Physiological saline (0.15M NaCl solution, pH 7.2)
The rTIMP-2 obtained in Example 1 is added to and the final concentration is adjusted to, for example, 10 mg / ml. The prepared solvent is
After sterilization with a membrane filter having a pore size of 0.1 μm, it was stored refrigerated (4 ° C.) until use. (2) Cultivation of human normal skin fibroblasts and determination of growth promoting effect Human normal skin fibroblasts can be obtained by primary culture of human skin, or commercially available, for example, Clonetic.
Newborn-derived normal skin fibroblasts sold by S. Co. can be used. The cell proliferation was measured by the dye extraction method. Eagle M containing 10% fetal bovine serum
The cells cultured in the EM medium were inoculated into a 96-well microplate at 10 ³ cells / well of 0.13 cells. 3
After overnight culture in a 5% CO ₂ incubator at 7 ° C, the cells were washed 3 times with PBS to remove the medium. Eagle MEM medium containing fetal bovine serum supplemented with various concentrations of rTIMP-2 was added to the washed cells, and 37
Culturing was carried out at 5 ° C. and 5% CO ₂ for 5 days. At this time, rTIM
As a basal medium to which P-2 is added, 0%, 1.25%,
Eagle's MEM medium containing 2.5%, 5%, 10% fetal bovine serum was used.

After completion of the culture, the medium was removed by suction, 0.5% crystal violet dissolved in 20% methanol was added, and staining was carried out for 30 minutes. The cells were gently washed with distilled water and dried, and then crystal violet incorporated into the cells was eluted with 30% acetic acid. Elute the crystal violet with a microplate reader (Tosoh,
Using MPRA4), the absorbance was measured at 570 nm. The degree of cell proliferation was judged from the difference from the absorbance of the control cultured without the addition of rTIMP-2. Various r in FIG.
The degree of proliferation of cells cultured at the TIMP-2 concentration was shown by the absorbance. Further, in FIG. 11, the degree of proliferation with respect to the control is shown as a percentage. As a result, rTIMP-2
The concentration of 3 μg / ml promoted the growth of human normal skin fibroblasts in a dose-dependent manner. In addition, rTIMP-2 concentration 1
At 00 μg / ml, 40 to 50% promotion of growth was observed as compared with the control. As is clear from FIG. 11,
Irrespective of the amount of fetal bovine serum contained in the medium, r
The growth-promoting effect was uniformly shown depending on the TIMP-2 concentration. That is, this effect does not depend on the amount of fetal bovine serum in the medium and can be presumed to be the action of rTIMP-2 itself.

Example 11 rTIMP-1 and rTIM
Comparison of W-2 Healing Promoting Effect of P-2 (1) Preparation of rTIMP-1 Containing Test Drug and rTIMP-2 Containing Test Drug As the rTIMP-1 containing test drug, the rTIMP-1 containing liquid preparation prepared in Example 4 was used as rTIMP. The rTIMP-2 containing liquid preparation prepared in Example 5 was used as the -2 containing test drug. As a control, physiological saline containing 0.005% benzalkonium chloride was sterilized with a membrane filter having a pore size of 0.1 μm. (2) Preparation of test animal and experimental skin defect model As a test animal, diabetic mouse (KK-Ay / Ta Jc
1) Using 10 mice (aged 8 weeks, body weight: 31 to 36 g), two experimental skin defect sites were prepared on the dorsal skin of the mouse by the method described in Example 7. 5 mice each with rT
The IMP-1 administration group and the rTIMP-2 administration group were used. One skin defect site was the administration site of the rTIMP-1 containing test drug or rTIMP-2 containing test drug, and the other was the control solvent administration site. (3) Administration of Test Drug and Observation of Affected Area The test drug and the control were administered once a day by directly dropping the dose described in Example 7 to the affected area, and administered continuously until wound closure. The protection of the skin defect part and the change in the area of the affected part were calculated by the method described in Example 7. FIG. 12 shows rTIMP-1 and rTIMP.
The change over time in the area of the wound when treated with -2 was shown. Both groups showed almost the same wound healing process, and no significant difference was observed. Also, when comparing the number of days required for 50% healing, no significant difference was observed between the two groups. That is, at the concentration of 0.1% used in this test, rTIMP-1 and rTIMP
MP-2 has been shown to have approximately equivalent wound healing effects.

At least one tissue inhibitor selected from the group consisting of rTIMPs, in particular rTIMP
A drug containing -2 as an active ingredient exhibits, in addition to advantages including processing as a formulation thereof, excellent activity against various wounds, wounds associated with surgery, skin ulcers and the like as described above. A therapeutic agent for skin defect containing rTIMP-2 can be expected to have stable physiological activity even after long-term storage, and can be expected to have excellent biological activity even after being applied to an affected area. Thus, a drug containing at least one tissue inhibitor selected from the group consisting of TIMPs as an active ingredient is useful for treating ulcers such as arterial occlusive lower leg ulcer and venous stasis lower leg ulcer, which are difficult to treat. Preventive or therapeutic action and symptoms for pressure ulcers, diabetic ulcers, burn ulcers, traumatic ulcers, radiation ulcers, drug ulcers, drug ulcers, postoperative ulcers, inflammatory ulcers, simple ulcers etc. It is judged to have an improving effect. A drug containing at least one tissue inhibitor selected from the group consisting of TIMPs as an active ingredient is a chronic (refractory) skin ulcer, etc., and is associated with aging, physical factors or serious underlying diseases. In some cases, various factors are involved, and it is judged that it has significant activity against symptoms and diseases in which it is not uncommon for complications of wound infection. A drug containing at least one tissue inhibitor selected from the group consisting of TIMPs as an active ingredient is useful as a drug having a strong effect alone. In addition, a drug containing at least one tissue inhibitor selected from the group consisting of TIMPs as an active ingredient shows a preventive activity against keloids and hypertrophic scars in a skin defect wound after surgery and a preventive effect on a trauma, and has a direct medicinal effect. It is useful as a wound healing agent, a healing accelerator for surgical wounds caused by surgery, and an agent for preventing the occurrence of keloids and hypertrophic scars in postoperative skin defect wounds. Further TI
MPs are useful as therapeutic agents for chronic (refractory) ulcers.

[0046]

Industrial Applicability The present invention provides a pharmaceutical composition containing TIMPs as a main active ingredient. TIMP related to the present invention
A pharmaceutical composition containing s as a main active ingredient can achieve accelerated healing of chronic (refractory) skin ulcers that are difficult to treat, but it is additionally noteworthy that healing scars are small and less prominent. This effect is quality of
It is also very useful from an aesthetic point of view, which is an important element in life. Furthermore, the treatment with the pharmaceutical composition according to the present invention can accelerate the healing of the surgical wound at least in simple surgery and shorten the hospital stay. This also contributes to reducing the financial burden on health insurance such as health insurance.

[Brief description of the drawings]

FIG. 1 shows the results of a stability test of a liquid drug containing rTIMP-2.

FIG. 2: rTIM in SD rat experimental skin defect model
The change of the area of the skin defect part by P-2 administration is shown.

FIG. 3 r in experimental skin defect model of aged ICR mouse
The change of the area of the skin defect part by TIMP-2 administration is shown.

FIG. 4. rTI in experimental skin defect model of diabetic mouse
The change of the area of the skin defect part by MP-2 administration is shown.

FIG. 5 shows the results of a dose-dependent test of the therapeutic effect on skin defects of a test drug containing rTIMP-2.

FIG. 6 Test 1 in experimental skin defect model of diabetic mouse
Photographs of typical histopathological findings of the rTIMP-2 containing test drug treatment group on day 5 show the morphology of the organism.

FIG. 7: Test 1 in experimental skin defect model of diabetic mouse
Fig. 7 is a magnified photograph of a boxed portion in Fig. 6 showing typical histopathological findings of the rTIMP-2 containing test drug-treated group on day 5, showing a photograph of the morphology of the organism.

FIG. 8: Experiment 1 in experimental skin defect model of diabetic mouse
Photographs of typical histopathological findings of the control group to the rTIMP-2 containing test drug treated group on day 5 show the morphology of the organism.

FIG. 9 is a magnified photograph of the boxed part of FIG. 8 showing typical histopathological findings of the control group in the test in the experimental skin defect model of diabetic mouse, showing a photograph of the morphology of the organism.

FIG. 10 shows the growth promoting effect of rTIMP-2 on human normal skin fibroblasts.

FIG. 11 shows the growth promoting effect of rTIMP-2 on human normal skin fibroblasts as a percentage of control.

FIG. 12: rTIMP-1 containing test drug and rTIMP-
The result of having compared the skin defect treatment effect of 2 contained test drug is shown.

 ─────────────────────────────────────────────────── ─── Continuation of the front page (72) Inventor Takanori Aoki 530 Chokeiji Temple, Takaoka City, Toyama Prefecture, Fuji Pharmaceutical Co., Ltd. 72) Inventor Takashi Shintani 530 Chokeiji Temple, Takaoka City, Toyama Prefecture Fuji Pharmaceutical Co., Ltd.

Claims (22)

[Claims] 1. A therapeutic agent for skin deficiency, which comprises as an active ingredient at least one tissue inhibitor selected from the group consisting of tissue inhibitors of metalloproteases. 2. The therapeutic agent is used for the treatment of skin deficiency, including the preventive treatment for the prevention of scarring of skin deficiency and the reduction of the scar. The therapeutic agent according to claim 1. 3. The therapeutic agent according to claim 1, wherein the skin defect is a wound. 4. The therapeutic agent according to claim 3, wherein the wound is a surgical wound, and the surgical wound or a surgical scar related thereto is reduced by prophylactic treatment. 5. The therapeutic agent according to claim 3, wherein the wound is a traumatic wound, and the traumatic wound or a traumatic scar related thereto is reduced by prophylactic treatment. 6. The therapeutic agent according to claim 1, wherein the skin defect is a skin ulcer. 7. The therapeutic agent according to claim 6, wherein the skin ulcer is a postoperative ulcer, and the postoperative ulcer or a postoperative scar related thereto is reduced by prophylactic treatment. 8. The therapeutic agent according to claim 6, wherein the skin ulcer is a traumatic ulcer, and the traumatic ulcer or a traumatic scar related thereto is reduced by prophylactic treatment. 9. The therapeutic agent according to claim 6, wherein the skin ulcer is a chronic ulcer. 10. The therapeutic agent according to claim 6, wherein the skin ulcer is a decubitus ulcer. 11. The therapeutic agent according to claim 6, wherein the skin ulcer is a vascular lesion. 12. The therapeutic agent according to claim 6, wherein the skin ulcer is an inflammatory ulcer. 13. The therapeutic agent according to claim 6, wherein the skin ulcer is a simple ulcer. 14. The therapeutic agent according to any one of claims 1 to 13, which comprises a tissue inhibitor of metalloprotease-1 as an active ingredient. 15. A recombinant tissue as tissue inhibitor of metalloprotease-1.
The therapeutic agent according to claim 14, which comprises an inhibitor of metalloprotease-1. 16. A recombinant gene inhibitor is expressed by a transformant cell obtained by using Escherichia coli, CHO cell or COS-1 cell as a host cell, and the obtained gene product is purified. The therapeutic agent according to claim 15, wherein the therapeutic agent is present. 17. The therapeutic agent according to any one of claims 1 to 13, which comprises a tissue inhibitor of metalloprotease-2 as an active ingredient. 18. A recombinant tissue as tissue inhibitor of metalloprotease-2.
The therapeutic agent according to claim 17, which comprises an inhibitor of metalloprotease-2. 19. A recombinant gene inhibitor of metalloprotease-2 is expressed by a transformant cell obtained by using Escherichia coli, CHO cell or COS-1 cell as a host cell, and the obtained gene product is purified. The therapeutic agent according to claim 18, wherein the therapeutic agent is present. 20. The mixture of tissue inhibitor of metalloprotease-1 and tissue inhibitor of metalloprotease-2 as tissue inhibitor of metalloprotease is used as an active ingredient. Therapeutic agent. 21. Recombinant tissue as tissue inhibitor of metalloprotease-1
Inhibitor of metalloprotease-1 and tissue inhibitor of metalloprotease-
21. The therapeutic agent according to claim 20, wherein each of the two contains recombinant tissue inhibitor of metalloprotease-2. 22. Recombinant tissue inhibitor of metalloprotease-1 and recombinant tissue inhibitor of metalloprotease-2 are respectively expressed by transformant cells obtained by using Escherichia coli, CHO cells or COS-1 cells as host cells, The therapeutic agent according to claim 21, wherein the obtained gene product is purified.