JPH09100300A - Amino acid sequence of anticancer human monoclonal antibody and dna base sequence coding for the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new antibody fragment containing a hypervariable region CDR3 having a specific amino acid sequence, having binding property to mouse anti-idio type antibody against human immunoglobulin which is specific to a human cancer cell antigen and suppressing proliferation of human cancer cell. SOLUTION: This new immunoglobulin heavy chain variable region fragment contains a hypervariable region CDR3 having an amino acid sequence represented by formula I, further contains hypervariable region CDR1 having amino acid sequence represented by formula II and/or a hypervariable region CDR2 having an amino acid sequence represented by formula III. The fragment has a binding property to mouse anti-idio type antibody against human immunoglubulin which is specific to human cancer cell antigen and is useful as an anticancer agent, etc. The antibody fragment is obtained by fusing a peripheral blood lymphocyte of a cancer patient to which an anti-human cancer cell human monoclonal antibody is administered with a human lymphocyte, selecting a hybridoma producing antibody having binding property to anti-ideo type antibody of the monoclonal antibody and carrying out enzymatic treatment of an antibody produced by the hybridoma.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to the fields of medicine and pharmaceuticals such as prevention, treatment and diagnosis of human diseases, and
The present invention relates to the structure of the variable region of an antigen-specific human immunoglobulin, which is useful in a wide range of fields including pharmacology such as biochemical reagents and biopolymer purification reagents, and biochemistry. More specifically, the present invention relates to a mouse antibody against a human immunoglobulin CLN-IgG specific for a cancer cell antigen produced by a human / human fusion cell line CLN / SUZ H11 of a human uterine cancer patient B cell and a human lymphoblast cell line. Human immunoglobulin CL that binds to the idiotype antibody Idio33 and suppresses the growth of human cancer cells
It relates to the amino acid sequences of the heavy and light chain variable regions of N ″ 1-IgM and the nucleotide sequences of their genes.

[0002]

2. Description of the Related Art Since the development of a technique for producing a monoclonal antibody by cell fusion or immortalization of cells, many useful antibodies have been obtained mainly in mice. Among them, monoclonal antibodies against malignant tumor cells are used not only for basic research such as analysis of tumor antigens, but also for therapy, serodiagnosis, diagnostic imaging of tumors with labeled antibodies, and their utility value is extremely high. . However, xenoantibodies such as mice are foreign to humans, and frequent administration to humans induces an immune reaction to the administered antibody, resulting in side effects and reduced therapeutic or prophylactic effect of the antibody. From the above, prevention, treatment of human cancer,
Considering the clinical field in which antibodies are actually administered to humans, such as in-vivo diagnosis, it is desirable to use humanized antibodies. However, since human-type monoclonal antibodies are difficult to prepare, they have not been practically used at present.

In this situation, one of the inventors of the present invention
As disclosed in detail in JP-A-58-201994 (Japanese Patent Publication No. 01-59878), JP-A-59-135898 and JP-A-59-137497, high reactivity with human cancer cells Cell line CLN / SU producing human monoclonal antibody
ZH11 (ATCC No. HB8307) was established. The antibody (CLN-IgG) produced by this cell line has an antibody class of IgG,
Interesting findings have been obtained that the isotypes are γ1 type and k type, and they have the effect of immunohistochemically binding to a cancer antigen present on the surface of a cancer cell and suppressing the growth of the cancer cell. Currently, the entire amino acid sequence and DNA of the antibody
The base sequence has been clarified (JP-A-4-34679).
No. 2).

On the other hand, since Jerne proposed the so-called network theory, various studies have been conducted on the structure of antibody variable regions. An antibody binds to an antigen at its variable region (antigen binding site). Therefore, the variable region of the antibody also has various three-dimensional structures depending on the structure of the antigenic determinants on the surface of the recognized antigen. Therefore, the antibody itself can be considered as an antigen, in which case the structure of the variable region of the antibody is called an idiotype, and the antibody against the idiotype of the antibody is called an anti-idiotype antibody.
Further, a structure corresponding to an antigenic determinant is called an idiotope. An idiotype is a collection of idiotopes. Among anti-idiotypic antibodies (Ab2) against antibodies (Ab1), antibodies that competitively inhibit the binding between Ab1 and antigen and that have an idiotope similar to the antigen recognized by Ab1, the so-called internal antigen Image (internal im
It has been reported that there is an antibody having a structure of (age).

As disclosed in detail in Japanese Patent Application Laid-Open No. 7-101999, the present inventors have developed five mouse anti-idiotypic antibodies against CLN-IgG (Idio3, Idio17, Idio2).
0, Idio27, Idio33) and clarified the variable region amino acid sequence and DNA base sequence. These antibodies have class IgG, isotypes γ1 and k, and CLN
-Since it inhibits the binding of IgG to cancer cells, it was revealed that the antibody has an internal image of the antigen.

Ab2 is further known to induce an antibody (Ab3) which binds to its own idiotype.
The induced antibody is called the anti-anti-idiotype antibody of the original antibody (Ab1). Ab3 contains an antibody with a structure similar to Ab1, and recognizes the same antigen that Ab1 recognizes. Therefore, an Ab with an internal image of the antigen
If 2 is used as an antigen, Ab3 that binds to the original antigen can be produced. That is, theoretically, a new anti-cancer human monoclonal antibody can be prepared by preparing an anti-idiotype antibody against the anti-cancer human monoclonal antibody and further preparing a human monoclonal antibody that binds to the anti-idiotype antibody. A cell fusion method or a cell immortalization method can be used for producing a monoclonal antibody. The novel human monoclonal antibody thus obtained can be used in cancer treatment, diagnosis and the like.

[0007]

In order to clinically utilize an anti-cancer human monoclonal antibody, there are problems to be solved as described below.

1) Monoclonal antibody-producing cell lines are generally known to decrease in antibody production performance with passage. In addition, generally speaking, human hybridomas produce less antibody than those of mice. When a human monoclonal antibody is used for cancer treatment or diagnosis, a large amount of antibody is necessary, and it is essential to solve this problem.

2) According to the current knowledge of immunology, a mechanism is known in which a monoclonal antibody binds to human cancer cells and the action of the antibody itself suppresses the growth of cancer cells or kills cancer cells. There is. Furthermore, complement or K
It is known to suppress the growth of cancer cells with the help of cells and macrophages and cause the death of cancer cells. However, these effects are not as potent in nature as one might expect, therefore further attempts are needed to increase the anti-cancer activity of the antibody.

As a means for solving the above problems, that is, one means for embodying the improvement of the antibody production amount and the improvement of the anticancer activity of the antibody, there is a method by genetic manipulation. For example, in the case of the problem 1), it is considered that after cloning the antibody gene, the gene is introduced into a host cell such as animal cell or Escherichia coli, the antibody gene is expressed, and a large amount of the antibody is obtained. In the case of 2), it may be necessary to artificially change the antibody gene to increase various functions of the antibody, such as binding affinity with an antigen, anti-cancer activity mediated by immunocompetent cells, or tissue invasion. Or even a function that the antibody originally does not have,
For example, it is possible to design a molecule having higher anticancer activity by adding cytotoxicity, enzyme activity, immunity-inducing activity, etc. to an antibody molecule or a fragment thereof.

In order to achieve these objects, it is important to separate antibody genes and elucidate their structures. However, so far, there is no report on a novel anti-cancer human monoclonal antibody corresponding to the anti-cancer human monoclonal antibody Ab3, and therefore, the structures of the light and heavy chains constituting Ab3 and specifically the antigen are specifically bound. Nothing is known about the gene structure of the functional variable region.

The main object of the present invention is to create a novel anti-cancer human monoclonal antibody corresponding to Ab3 of the anti-cancer human monoclonal antibody and to elucidate the gene structure of the light chain and heavy chain of the monoclonal antibody.

[0013]

[Means for Solving the Problems] Therefore, the present inventors
N-IgG-administered brain tumor patient peripheral blood lymphocytes and human lymphoblast HIH / TO1 cells are fused, and the resulting human-human hybridoma produces antibodies that bind to the anti-idiotype antibody Idio33 of CLN-IgG. Was selected, and as a result, hybridoma HT2 secreting IgM was obtained. further,
This human monoclonal antibody IgM (CLN''1 secreted by HT2
-IgM) had an activity of suppressing the growth of human glioma (glioblastoma) cells. From hybridoma HT2, cD encoding the light and heavy chains of the antibody CLN''1-IgM
The present invention was completed by separating NA, elucidating its DNA base sequence, and determining the amino acid sequences of the light chain and heavy chain variable regions of the antibody from the sequence.

Thus, according to the present invention, a hypervariable region CDR3 having the following amino acid sequence Gly Pro Lys Gly Tyr Cys Ser Ser Thr Ser Cys Tyr Phe Asp Tyr Tyr Tyr Tyr Gly Met Asp Val, and preferably 1) Hypervariable region CDR1 having the following amino acid sequence Gly Tyr Tyr Met His and / or (2) Hypervariable region CDR2 having the following amino acid sequence Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe Gln Gly An immunoglobulin heavy chain variable region fragment and a DNA and RNA fragment encoding the same are provided.

According to the present invention, it further comprises a hypervariable region CDR3 having the following amino acid sequence Gln Gln Ser Tyr Ser Thr Pro Gln Thr, and preferably (1) the following amino acid sequence Arg Ala Ser Gln Ser Ile Ser Hypervariable region CDR1 having Ser Tyr Leu Asn and / or (2) Hypervariable region CDR2 having the following amino acid sequence Ala Ala Ser Ser Leu Gln Ser and an immunoglobulin light chain variable region fragment, and the same DNA and RNA fragments encoding the are provided.

In the present invention, mRNA is prepared from human-human hybridoma HT2, and RNA is converted into cDNA by reverse transcriptase.
After conversion into cDNA, the cDNA gene is used as a template to amplify the antibody gene using the PCR method, and the amplified DNA fragment is inserted into the plasmid and cloned, and the base of the inserted DNA of the plasmid purified from the isolated E. coli clone is cloned. The sequence was determined, and the amino acid sequence was determined from the base sequence. Hereinafter, these steps will be described in more detail.

[1] Isolation of mRNA A human-human hybridoma is prepared under appropriate conditions, for example, 37 ° C.
Under the condition of carbon dioxide concentration of 5%, the cells are cultured and grown in a culture medium containing 10% fetal bovine serum, for example, RDF or RPMI1640 medium, and the obtained cells are collected by centrifugation, and then the cells are collected by a conventional method such as Molecular Cloning. (Second edition, Sambrook
Et al., Cold Spring Harbor Laboratory Press 1989) 7
Extract cytoplasmic RNA or mRNA by the method described in Chapter. The resulting RNA can be further used as a template for cDNA synthesis. In the present invention, specifically, mRNA was extracted from human-human hybridoma HT2 and used for cDNA synthesis.

[2] Synthesis of cDNA Using the mRNA obtained in the above step [1] as a template, oligo dT corresponding to poly A, a synthetic nucleotide having a random sequence, or a synthetic nucleotide having a specific sequence is used as a primer. , Single strand DNA complementary to mRNA is synthesized by reverse transcriptase in the presence of dATP, dGTP, dTTP and dCTP. In the specific operation of the present invention, cDNA was synthesized using the mRNA obtained in the above step [1] as a template and a primer encoding an antibody gene, and subjected to the step of amplifying the antibody gene.

[3] Amplification of antibody gene by PCR Using the single-stranded cDNA obtained in the above step [2] as a template, the sequence of the antibody gene (for example, the sequence encoding the constant region, variable region or leader region of the antibody gene) Etc.) as primers to carry out PCR reaction in the presence of dATP, dGTP, dTTP, dCTP and Taq polymerase to amplify the antibody gene. In the present invention, it is preferable to use the single-stranded cDNA obtained in the above step [2] as a template and a synthetic DNA oligomer corresponding to the sequences of the leader and variable regions of the light and heavy chains of the antibody Was amplified.

[4] Cloning of PCR-amplified DNA fragment The PCR-amplified DNA fragment obtained in the above step [3] is treated with various vectors such as pUC18 and pCR directly or after treatment with a restriction enzyme.
1000, plasmid vector such as pCRII ^TM , phage vector such as M13 phage, or pUC118, pBlues
Create a vector containing the insert fragment by ligating to a phagemid vector such as cript SK +. Further, E. coli is transformed with the vector to obtain E. coli colonies containing the desired antibody gene fragment. In a specific operation of the present invention, the PCR-amplified DNA fragment obtained in the above step [3] is used as pCRI.
After you have connected to the I ^TM plasmid vector, E. coli INVαF '
Was transformed to obtain E. coli colonies containing the antibody gene fragment.

[5] Determination of DNA base sequence and amino acid sequence The antibody gene fragment DNA base sequence is determined from the Escherichia coli colony containing the antibody gene fragment obtained in the above step [4] by the cycle sequencing method or the like. be able to. In the present invention, E. coli INVαF ′ containing an antibody gene fragment
The antibody gene was amplified from the colony by PCR, and the base sequence of the amplified fragment was determined by the cycle sequencing method.

[0022]

The present invention will be described more specifically with reference to the following examples.

Example 1 Preparation of Human-Human Hybridoma After the surgery for removing glioblastoma, CL is administered once a week at a dose of 1 mg.
Peripheral blood of a 56-year-old male, who was intravenously administered with N-IgG for 3 weeks, was collected and overlaid on Ficoll-Hypaque (Nacalai Tesque), and then lymphocytes were separated by centrifugation at 400 g for 30 minutes. The lymphocytes were washed with phosphate buffer and suspended in the culture solution.

Human lymphoblast HIH / TO1 (FERM BP-1884)
And the isolated lymphocytes were mixed at a ratio of 1: 5, and 5
0% polyethylene glycol 4000 (Merck) is added dropwise to fuse the cells. The fused cells are suspended in a medium containing hypoxanthine-amethopterin-thymidine (HAT) and plated on a 96-well microplate (Corning) at a concentration of 2 × 10 ⁵ per well. The HT medium was replaced on the 7th day after the fusion, and then replaced every week thereafter. Then, the proliferation of the fused cells was observed under a microscope, and the culture medium of the wells in which the proliferation was observed was used to confirm the binding to the human glioblastoma cell line U251MG.
Confirmed by ELISA reaction. A hybridoma secreting an antibody reactive with U251MG was further cloned by the limiting dilution method in the presence of interleukin 6.

By the above method, human-human hybridoma
HT2 was produced.

Example 2 Determination of Isotype of Human Monoclonal Antibody The isotype of the antibody secreted by the human hybridoma obtained in Example 1 was determined as follows.

In determining the isotype of the heavy chain, a solution of anti-human IgG antibody and anti-human IgM antibody (ORGANOTEKNIKA) diluted 200-fold with PBS was dispensed in 100 μl aliquots into 96-well microplates (Nunc). Incubate at 30 ° C for 30 minutes and wash 3 times with PBS containing 0.3% gelatin (gelatin buffer).

Dispense 200 μl of PBS containing 1% BSA, 37
After incubating at ℃ for 30 minutes, wash 3 times with gelatin buffer. In addition, add 1x HT2 culture solution diluted 100 times with PBS.
Dispense 00 μl each and incubate at 37 ℃ for 30 minutes. After washing three times with a gelatin buffer, 100 μl of a peroxidase-conjugated anti-human IgG antibody and a peroxidase-conjugated anti-human IgM antibody (BIOSOURCE INTERNATIONAL) each diluted 3000 times with PBS is dispensed. After reacting at 37 ℃ for 1 hour, wash 3 times with gelatin buffer, dissolve 20 mg of o-phenylenediamine-2HCl in 30 ml of citrate buffer (pH 5.0), and add 6 μl of 30% H ₂ O ₂ immediately before use. Added enzyme substrate solution (o-PD
Dispense 50 μl of each solution). After 15 minutes, 5NH ₂ SO ₄ was added to stop the reaction, and the absorbance at 492 nm was measured.

96 in light chain isotyping
Add HT2 culture solution to a well microplate (Nunc) 1
Dispense 00 μl each and incubate at 37 ℃ for 30 minutes. 0.3
After washing three times with PBS containing 1% gelatin (gelatin buffer), 200 μl of PBS containing 1% BSA is dispensed. 37 ° C,
After incubating for 30 minutes and further washing 3 times with gelatin buffer, peroxidase-conjugated anti-human κ light chain antibody and peroxidase-conjugated anti-human λ diluted 10,000 times with PBS.
100 μl of light chain antibody (BIOSOURCE INTERNATIONAL) is dispensed and incubated at 37 ° C. for 30 minutes. After washing 3 times with gelatin buffer, add 50 μl each of o-PD solution, and after 15 minutes,
NH ₂ SO ₄ was added to stop the reaction, and the absorbance at 492 nm was measured.

As a result, human-human hybridoma HT-2
The isotypes of the antibodies secreted by G. were μ and κ as shown in Table 1 below.

Table 1 Isotype Absorbance (492 nm) γ 0.007 μ 0.492 κ 1.258 λ 0.013 Example 3: Purification of human monoclonal antibody To 3 liters of the culture supernatant of human-human hybridoma HT2, 70% saturated ammonium sulfate was added, Centrifuge at 8000 rpm for 30 minutes to collect the precipitate. 400 ml of 10 mM collected precipitate
Suspend in PBS and dialyze against 10 mM PBS overnight at 4 ° C.
50% saturated ammonium sulfate is added to the dialyzed solution again, and the resulting precipitate is centrifuged at 8000 rpm for 30 minutes and collected. The collected precipitate is suspended in 40 ml of 10 mM PBS and dialyzed against 10 mM PBS overnight at 4 ° C. The crude IgM fraction thus obtained was further subjected to gel filtration using Sephacryl S-300 to obtain a final purified IgM fraction. The polyacrylamide gel electrophoresis pattern of purified IgM (CLN ″ 1-IgM) is shown in FIG.

Example 4 Identification of Antigens Recognized by Human Monoclonal Antibody CLN ″ -IgM by Western Blot Human glioblastoma cell line U251MG / S * was treated with 62.5 mM Tris (pH 6.
8), sonicated in a solution containing 2% SDS, 5% 2-mercaptoethanol, 4M urea, and then cells 8x10 ^{3 to} 2x10 ⁵
The corresponding disruption solution was subjected to SDS polyacrylamide gel electrophoresis. After electrophoresis, 48 mM Tris, 39 mM glycine,
Blotting was performed on a Hybond ECL nitrocellulose membrane (Amersham) using a semi-dry type blotting apparatus in 0.037% SDS, 10% methanol. Blot the nitrocellulose membrane with TTBS solution (20 m
M Tris (pH 7.5), 0.25 M NaCl, 0.3% Tween-20) and let stand for 30 minutes at room temperature. After washing twice with TTBS solution, primary antibody (CLN''1-IgM 2 μg / ml or CLN-Ig
G 2 μg / ml) at room temperature for 1 hour. Furthermore TTBS
After washing 3 times with the solution, biotinylated anti-human IgM or biotinylated anti-human IgG (VECTASTAIN ABC
Kit; VECTOR LABORATORIES) is reacted with a 1000-fold diluted solution, washed, and further incubated with an avidin-biotin complex solution. After washing, the membrane is ECL Western blot.
React with a ting detection reagent (Amersham) for 1 minute, overlay the X-ray film and record. The result is shown in figure 2.

* The human glioblastoma cell line U251MG / S is a cell line in which the human glioblastoma cell line U-251MG was transplanted to a Scid mouse and the formed tumor was returned to the culture system again. U-251M
The origin of G is described in Ponten, J. et al. Med. Biol, 56, 184-193, 1978.

Example 5: Cell growth inhibitory effect Human glioblastoma cell line U251MG / S suspended in DF medium containing 10% fetal bovine serum (FBS) at a concentration of 5 × 10 ⁴ / ml was added to 96 wells of 100 μl each. Spread it on a microplate (Nunc), and then CLN''1-IgM, human IgM (INTER-CELL TECHNOLOGIES, In
c.) or CLN-Igg was added to a final concentration of 37.5 to 300 μg / ml. 2% under conditions of 5% carbon dioxide concentration and 37 ° C
After culturing for one day, remove the culture supernatant, add 50 μl of 0.25% trypsin containing 0.02% EDTA, incubate at 37 ° C for 15 minutes, and then add 50 μl of 0.1% trypan blue solution to suspend and then use live cells with a hemocytometer. I counted the number. The results are shown in Figure 3.

Example 6: Cloning of the CLN "1 heavy chain gene Fast Track m from human-human hybridoma HT2 cells
MRNA was isolated using RNA isolation kit (Invitrogen) and RT-PCR was performed using this to isolate CLN "1 heavy chain gene. Specifically, mRNA solution 0.5 μl (150 ng), 1
0 x RT-PCR solution (500 mM KCl, 100 mM Tris-HCl (pH 9.0),
1% Triton X-100, 15mM MgCl ₂ ) 5μl, dNTP (2.5mM) 4
μl, Primer # 1 (10 mM) 2 μl, Primer # 2 (10 mM)
M) 2 μl, Taq polymerase (TAKARA) 0.5 μl, RNasin (Pro
mega) 0.5 μl, reverse transcriptase (TAKARA) 0.3 μl and DEPC
Treatment H ₂ O 35.2 μl was mixed, reverse transcription reaction was carried out at 42 ° C for 30 minutes, 95 ° C for 5 minutes, 94 ° C for 30 seconds, 55 ° C for 1 minute, 72 ° C for 1 minute, repeated 40 times, and further 72 ° C. Allowed to react for 7 minutes. The DNA fragment thus obtained is used in the TA cloning kit.
(Invitrogen) was used for cloning. Ie PCR
Reaction product 1 μl, 10 x ligation buffer 1 μl, pCR
A ligation mix solution was prepared by mixing 2 μl of II ^TM vector (corresponding to 50 ng), T4 DNA ligase and 6 μl of sterilized water, and incubated at 12 ° C. overnight. Then, 0.
Prepare 50 μl of a suspension of competent Escherichia coli INVαF ′ strain containing 2 μl of 5 M β-mercaptoethanol, and add 1 μl of the above ligation mix solution thereto. After leaving it on ice for 30 minutes, it is incubated at 42 ° C for 1 minute, and further rapidly cooled on ice for 2 minutes. In this E. coli solution
Add 450 μl of SOC medium pre-warmed to 42 ° C and
Incubate with shaking at 7 ° C for 1 hour.

Meanwhile, containing ampicillin (50 μg / ml)
Coat 25 μl of X-Gal (40 mg / ml) onto LB agar plate and incubate at 37 ° C until completely permeated.

200 μl of the Escherichia coli culture solution that had been shake-cultured was spread on a dried plate and left at 37 ° C. overnight,
The next day, ampicillin-resistant white colonies were obtained. The sequences of primers # 1 and # 2 are as follows.

# 1 ATGGACTGGACCTGGAGGRTCYTCTKC # 2 AGACGAGGGGGAAAAGGGTT Example 7: Sequencing of CLN "1 heavy chain gene Dynabeads Template from the colony obtained in Example 6
A preparation kit (DYNAL) was used to prepare a DNA fragment for determining the nucleotide sequence. Specifically, pick up the obtained colony with the tip of a toothpick, and use lysis buffer (20 mM Tris-
The suspension was suspended in 10 μl of HCl pH8.3, 50 mM KCl, 0.1% Tween 20), incubated at 96 ° C. for 5 minutes, and the supernatant after centrifugation was used for the following PCR. 10 x PCR buffer (100 mM Tris-HC
l pH8.3, 500 mM KCl, 15 mM MgCl ₂ ) 5 μl, dNTP (2.5 mM) 4
μl, Primer SetA 2 μl, lysate supernatant 5 μl, Taq polymerase 0.25 μl, H ₂ O 33.75 μl were mixed, 96 ° C. 30 seconds, 65
A cycle of 1 minute at ℃ and 2 minutes at 72 ℃ was repeated 30 times for reaction.

The DNA fragment thus obtained has a form in which biotin is bound to one 5'end of one of the primers used because one 5'end is biotinylated. 40 μl of a solution containing this DNA fragment was mixed with 40 μl of a solution containing Dynabeads to which streptavidin was bound.
Incubated for 15 minutes at room temperature. After collecting the beads to which DNA is bound with a magnet, the supernatant is removed and the B & W buffer solution (10
Suspended in 40 μl of mM Tris-HCl pH 7.5, 1 mM EDTA, 2.0 M NaCl). After collecting the beads again with a magnet,
The suspension was suspended in 10 μl of NaOH and incubated at room temperature for 10 minutes to separate the biotinylated DNA on the bead side and the non-biotinylated DNA on the supernatant side. The single-stranded DNA thus obtained was used as a template for nucleotide sequence determination, and TAKARA
The nucleotide sequence was determined using Taq Cycle Sequencing kit (TAKARA). Specifically, 5 μl of beads or supernatant containing DNA, 1 μl of FITC-labeled primer (1 pmol / μl, using forward or reverse), 2 μl of 10x cycling mix solution and 1 μl of TAKARATaq solution were mixed,
Add 1 μl of sterilized water to make a reaction mix with a final volume of 10 μl. Prepare 4 tubes with 2 μl of termination mix (A, G, C, T) dispensed in advance. 2 μl from the reaction mix above
Take each and place in each tube. After centrifuging and mixing, overlay 10 μl of mineral oil and perform cycling reaction under the following conditions.

Pre-cycle 95 ° C for 3 minutes; first cycle 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 1 minute (repeated 15 times); second cycle 95 ° C for 30 seconds, 72 ° C for 1 minute (repeated 15 times); Post Cycle 4 ° C.

After adding 2 μl of a reaction stop dye solution (95% formamide, 20 mM EDTA, 0.05% methyl violet), centrifuging, mixing, and storing at −20 ° C. until electrophoresis.

7% long ranger gel is urea 21g, 10
x TBE BUffer (0.89M Tris-HCl, 0.89M Boric acid, 0.025
M EDTA / Na ₂ salt) 6 ml and 50% long ranger gel solution (FMC Bio Products) 7 ml to which pure water is added to make 50 ml.
After filtering with a 2 μm filter, 22 mg of ammonium persulfate and 22 μl of TEMED were added, and the one that had been used for 3 hours or more after the initiation of polymerization was used.

The gel was mounted on a DNA sequencer DSQ-1 and prerun at a constant voltage of 1000 V for 1 hour. Immediately before electrophoresis, the sample was heat denatured at 95 ° C. for 3 minutes, rapidly cooled on ice, and 2-3 μl of the reaction solution was sucked up from the bottom side of the tube with a microsyringe and loaded on the gel. Sample run is constant voltage
It was performed at 1200V for 12 hours.

After completion of the electrophoresis, the nucleotide sequence was determined using the software attached to DSQ-1.

Example 8 Cloning of CLN "1 Light Chain Gene Human-human hybridoma HT2 cells were freeze-thawed and then RT-PCR was performed to isolate the CLN" 1 light chain gene.
Specifically, DEPC treated H ₂ O (including RNAsin) 5x10 to 10 [mu] l ⁴ /
Add 2 μl of ml cell suspension, freeze and thaw, and add 10 x RT-PCR solution (500 mM KCl, 100 mM Tris-HC) to the same tube.
l (pH9.0), 1% Triton X-100, 15mM MgCl ₂ ) 5μl, dNTP
(2.5 mM) 4 μl, primer # 3 (10 mM) 1 μl, primer # 4 (10 mM) 1 μl, Taq polymerase (TAKARA) 0.5 μl, RNa
sin (Promega) 0.5 μl, reverse transcriptase (TAKARA) 0.3 μl, DE
PC-treated H ₂ O 35.2 μl was mixed, reverse transcription reaction was performed at 42 ° C for 30 minutes, 95 ° C for 5 minutes, 94 ° C for 30 seconds, 55 ° C for 1 minute, 72 ° C for 1 minute, and repeated for 40 times. The reaction was carried out at ℃ for 7 minutes. The DNA fragment thus obtained is used in the TA cloning kit.
(Invitrogen) was used for cloning. Specifically, PC
R reaction product 1 μl, 10 x ligation buffer 1 μl, pC
A ligation mix solution was prepared by mixing 2 μl of RII ^™ vector (corresponding to 50 ng), T4 DNA ligase and 6 μl of sterilized water, and incubated at 12 ° C. overnight. Then, 0.
Prepare 50 μl of a suspension of competent Escherichia coli INVαF ′ strain containing 2 μl of 5 M β-mercaptoethanol, and add 1 μl of the above ligation mix solution thereto. After leaving it on ice for 30 minutes, it is incubated at 42 ° C for 1 minute, and further rapidly cooled on ice for 2 minutes. In this E. coli solution
Add 450 μl of SOC medium pre-warmed to 42 ° C and
Incubate with shaking at 7 ° C for 1 hour.

Meanwhile, containing ampicillin (50 μg / ml)
Coat 25 μl of X-Gal (40 mg / ml) onto LB agar plate and incubate at 37 ° C until completely permeated.

200 μl of the Escherichia coli culture solution that had been subjected to shaking culture was spread on a dried plate and left at 37 ° C. overnight,
The next day, ampicillin-resistant white colonies were obtained.

Example 9: Nucleotide sequence determination of CLN "1 light chain gene From the colony obtained in Example 8, Dynabeads Template
A preparation kit (DYNAL) was used to prepare a DNA fragment for determining the nucleotide sequence. Specifically, pick up the obtained colony with the tip of a toothpick, and use lysis buffer (20 mM Tris-
The suspension was suspended in 10 μl of HCl pH8.3, 50 mM KCl, 0.1% Tween 20), incubated at 96 ° C. for 5 minutes, and the supernatant after centrifugation was used for the following PCR. 10 x PCR buffer (100 mM Tris-
HCl pH 8.3, 500 mM KCl, 15 mM MgCl ₂ ) 5 μl, dNTP (2.5 mM)
4 μl, Primer SetA 2 μl, lysate supernatant 5 μl, Taq polymerase 0.25 μl, H ₂ O 33.75 μl were mixed, 96 ° C. 30 seconds, 65
A cycle of 1 minute at ℃ and 2 minutes at 72 ℃ was repeated 30 times for reaction.

The thus-obtained DNA fragment has a form in which biotin is bound to one 5'end since one 5'end of the primer used is biotinylated. 40 μl of a solution containing this DNA fragment was mixed with 40 μl of a solution containing Dynabeads to which streptavidin was bound.
Incubated for 15 minutes at room temperature. After collecting the beads to which DNA is bound with a magnet, the supernatant is removed and the B & W buffer solution (10
Suspended in 40 μl of mM Tris-HCl pH 7.5, 1 mM EDTA, 2.0 M NaCl). Then suspend the beads in 10 μl of 0.1 M NaOH and
After incubation at room temperature for 1 minute, the biotinylated DNA beads were separated on the side and the non-biotinylated DNA was separated on the side of the supernatant. The single-stranded DNA thus obtained was used as a template for nucleotide sequencing, and the TAKARA Taq Cycle Sequencing kit (T
AKARA) was used to determine the nucleotide sequence. Specifically, DNA
5μl of beads or supernatant containing FITC-labeled primer (1 pmol / μl, using forward or reverse) 1
μl, 10x Cycling mix solution 2 μl and TAKA
Mix 1 μl of RATaq solution and 1 μl of sterilized water to make a reaction mix with a final volume of 10 μl. Prepare 4 tubes with 2 μl of termination mix (A, G, C, T) dispensed in advance. Take 2 μl each of the above reaction mix and add to each tube. After centrifuging and mixing, overlay 10 μl of mineral oil and perform cycling reaction under the following conditions.

Pre-cycle 95 ° C for 3 minutes; first cycle 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 1 minute (repeated 15 times); second cycle 95 ° C for 30 seconds, 72 ° C for 1 minute (repeated 15 times); Post Cycle 4 ° C.

Add 2 μl of the reaction stop dye solution (95% formamide, 20 mM EDTA, 0.05% methyl violet), centrifuge and mix, and store at −20 ° C. until electrophoresis.

7% long ranger gel contains 21 g of urea, 1
0 x TBE BUffer (0.89M Tris HCl, 0.89M Boric Acid, 0.02
5M EDTA) 6 ml and 50% long ranger gel solution (FMC
(Bio Products) Add pure water to 7 ml to make 50 ml, filter with 0.22 μm filter, and then add ammonium persulfate 22 mg and TE.
MED (22 μl) was added, and the mixture was used after 3 hours or more had elapsed from the initiation of polymerization.

The gel was mounted on a DNA sequencer DSQ-1 and prerun at a constant voltage of 1000 V for 1 hour. Immediately before electrophoresis, the sample was heat denatured at 95 ° C. for 3 minutes, rapidly cooled on ice, and 2-3 μl of the reaction solution was sucked up from the bottom side of the tube with a microsyringe and loaded on the gel. Sample run is constant voltage
It was performed at 1200V for 12 hours.

After the electrophoresis was completed, the nucleotide sequence was determined using the software attached to DSQ-1. The sequences of primers # 3 and # 4 are as follows. The nucleotide sequences of the variable regions of the heavy and light chains of the obtained human monoclonal antibody and the amino acid sequences predicted from them are shown in the sequence listing.

SEQ ID NO: 1: CLN ″ 1-IgM heavy chain variable region SEQ ID NO: 2: CLN ″ 1-IgM light chain variable region Example 10: Determination of hypervariable region Sequences of proteins of im of Kabat et al.
munological interest (Fifth edition, USDepartment
of health and human services. Public health servi
ce, National Institutes of health. NIH Publication
No. 91-3242. Kabat et al. 1991) according to the numbering, the amino acid sequences obtained in Example 7 and Example 9 are listed in parallel to identify the amino acid sequences of the hypervariable regions CDR1, CDR2, CDR3 ( 4A, heavy chain; FIG. 4B, light chain). In order to confirm the novelty of the amino acid sequences of the identified hypervariable regions CDR1, CDR2, CDR3, the above Kabat et al. Database and protein database NBRF-PDB (National
Biomedical Research Foundation-Protein Database) Release 44 was used to perform a computer search.

[0056]

[Table 1]

[0057]

[Table 2]

[Brief description of the drawings]

FIG. 1 is an electrophoretic pattern of CLN ″ 1-IgM.

FIG. 2 is a Western blot of antigens recognized by CLN ″ 1-IgM.

FIG. 3 is a graph showing the cancer cell growth inhibitory effect of CLN ″ 1-IgM.

FIG. 4 is a diagram in which the amino acid sequences of the heavy and light chain variable regions of CLN ″ 1-IgM are numbered according to the Kabat notation to determine the hypervariable region CDR1, CDR2 and CDR3 regions.

Continuation of the front page (51) Int.Cl. ⁶ Identification code Office reference number FI Technical display location C12N 5/10 G01N 33/574 A C12P 21/08 33/577 B G01N 33/53 9162-4B C12N 15/00 C 33/574 9162-4B ZNAA 33/577 5/00 B

Claims (13)

[Claims] 1. An immunoglobulin heavy chain variable region comprising a hypervariable region CDR3 having the following amino acid sequence Gly Pro Lys Gly Tyr Cys Ser Ser Thr Ser Cys Tyr Phe Asp Tyr Tyr Tyr Tyr Gly Met Asp Val. fragment. 2. A hypervariable region CDR1 having the following amino acid sequence Gly Tyr Tyr Met His and / or (2) the following amino acid sequence Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe Gln Gly 2. The immunoglobulin heavy chain variable region fragment of claim 1, further comprising a hypervariable region CDR2 having 3. The following amino acid sequence Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly Pro Lys Gly Tyr Cys Ser Ser Thr Ser Cys Tyr Phe Asp Tyr Tyr Tyr Tyr Gly Met Asp Val Trp Gly Gln Gly Thr Thr Val. 4. An immunity comprising a nucleotide sequence encoding a hypervariable region CDR3 having the following amino acid sequence Gly Pro Lys Gly Tyr Cys Ser Ser Thr Ser Cys Tyr Phe Asp Tyr Tyr Tyr Tyr Gly Met Asp Val. DNA and RNA fragments encoding globulin heavy chain variable region fragments. 5. A nucleotide sequence encoding a hypervariable region CDR1 having the following amino acid sequence Gly Tyr Tyr Met His and / or (2) the following amino acid sequence Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala The DNA and RNA fragment according to claim 4, further comprising a nucleotide sequence encoding a hypervariable region CDR2 having Gln Lys Phe Gln Gly. 6. The following nucleotide sequence CAG GTG CAG CTG GTG CAG TCT GGG GCT GAG GTG AAG AAG CCT GGG GCC TCA GTG AAG GTC TCC TGC AAG GCT TCT GGA TAC ACC TTC ACC GGC TAC TAT ATG CAC TGG GTG CGA CAG GCC CCT GGA CAA GGG CTT GAG TGG ATG GGA TGG ATC AAC CCT AAC AGT GGT GGC ACA AAC TAT GCA CAG AAG TTT CAG GGC AGG GTC ACC ATG ACC AGG GAC ACG TCC ATC AGC ACA GCC TAC ATG GAG CTG AGC AGG CTG AGA ACT GAC GAC GCC GTG TAT TAC TGT GCG AGA GGA CCG AAA GGG TAT TGT AGT AGT ACC AGC TGC TAT TTT GAC TAC TAC TAC TAC GGT ATG GAC GTC TGG GGC CAA GGG ACC ACG GTC An immunoglobulin heavy chain variable region fragment. 7. An immunoglobulin light chain variable region fragment comprising a hypervariable region CDR3 having the following amino sequence Gln Gln Ser Tyr Ser Thr Pro Gln Thr. 8. A hypervariable region CDR1 having (1) the following amino acid sequence Arg Ala Ser Gln Ser Ile Ser Ser Tyr Leu Asn, and / or (2) a hypervariable region having the following amino acid sequence Ala Ala Ser Ser Leu Gln Ser. 8. The immunoglobulin light chain variable region fragment of claim 7, further comprising the region CDR2. 9. The following amino acid sequence Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Thr Immunoglobulin light chain variable region fragment having Pro Gln Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr Val. 10. A DNA and RNA fragment encoding an immunoglobulin light chain variable region fragment, which comprises a nucleotide sequence encoding a hypervariable region CDR3 having the following amino acid sequence Gln Gln Ser Tyr Ser Thr Pro Gln Thr. . 11. A base sequence encoding a hypervariable region CDR1 having the following amino acid sequence Arg Ala Ser Gln Ser Ile Ser Ser Tyr Leu Asn and / or (2) the following amino acid sequence Ala Ala Ser Ser Leu Gln. The DNA and RNA fragment according to claim 10, further comprising a nucleotide sequence encoding a CDR2 having a hyper variable region having Ser. 12. The following nucleotide sequence GAC ATC CAG ATG ACC CAG TCT CCA TCC TCC CTG TCT GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC CGG GCA AGT CAG AGC ATT AGC AGC TAT TTA AAT TGG TAT CAG CAG AAA CCA GGG AAA GCC CCT AAG CTC CTG ATC TAT GCT GCA TCC AGT TTG CAA AGT GGG GTC CCA TCA AGG TTC AGT GGC AGT GGA TCT GGG ACA GAT TTC ACT CTC ACC ATC AGC AGT CTG CAA CCT GAA GAT TTT GCA ACT TAC TAC TGT CAA CAG TAC AGT ACC CCT CAG ACG TTC GGC CAA GGG ACC AAG GTG GAA ATC AAA CGA ACT GTG is an immunoglobulin light chain variable region fragment. 13. An Fv region fragment comprising the immunoglobulin heavy chain variable region fragment according to claim 3 and the immunoglobulin light chain variable region fragment according to claim 9.