JPH0870864A - New endonuclease 2 derived from superthrmophilic primordial microorganism - Google Patents

Abstract

PURPOSE: To obtain a new endonuclease 2 which is a rare cutter, capable of cleaving specific sites of a specified double-stranded DNA sequence, having high thermostability and capable of greatly cleaving the DNA and facilitating the genetic manipulation. CONSTITUTION: This new endonuclease 2 is capable of cleaving sites indicated by arrows in a DNA sequence of formula I and producing a 3'-protruding cleaved site of 4 bases of CTAC or GTAG in its complementary chain and prepared from a superthermophilic primordial microorganism such as Pyrococcus furiosus KOD1 strain, has about 62kDa molecular weight and contains an amino acid sequence of formula II. Furthermore, the endonuclease 2 is obtained by culturing a recombinant host cell transformed with a DNA recombinant expression vector having a DNA, capable of coding the endonuclease 2 and inserted into an expression vector.

Description

Detailed Description of the Invention

[0001]

The present invention relates to a novel hyperthermophilic archaeon (Pyr
ococcus furiosus) KOD1 derived new endonuclease 2 and a gene encoding the endonuclease, and a method for producing the endonuclease 2 using the gene.

[0002]

2. Description of the Related Art Endonuclease is a general term for enzymes that cleave nucleotide chains of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) from the middle. In particular, endonucleases called restriction enzymes recognize specific base sequences,
An enzyme that cleaves double-stranded DNA in a specific fashion. Its specific cleavage ability facilitates gene manipulation and makes it an extremely useful enzyme for studies in the field of molecular biology including current genetic engineering. Up to now, restriction enzymes have been isolated from bacteria, actinomycetes, cyanobacteria, etc., and about 150 kinds of those having different recognition base sequences and cleavage modes are known.

Generally, a restriction enzyme recognizes a base sequence and cuts at that position. For example, Sau3AI recognizes the following sequence and cleaves at the position of the arrow, so it is called 4-base recognition.

BamHI recognizes the following sequence and cleaves at the position of the arrow, and is therefore called 6-base recognition. Furthermore, NotI recognizes the following sequence and cleaves at the position of the arrow, so it is called 8-base recognition.

Assuming that the base sequence is completely random, the probability that the Sau3A sequence will appear is once every (4 ⁴ = 256) bases, BamHI once every (4 ⁶ = 4096) bases, and NotI ( 4 ⁸ = 65536) Once per base. Therefore
The cleavage fragment of Sau3A has an average size of 256 bases, BamHI has a size of 4096 bases, and NotI has a size of 65536 bases.

On the other hand, what is called a rare cutter is an enzyme that cleaves a rare base sequence in a genomic DNA sequence regardless of the size of the recognition base, and therefore the cleavage fragment is large. In addition, the recognition site of the enzyme derived from the intron (intervening sequence) described here is unknown, and only the cleavage form has been reported.

[0007] By the way, as a research target of recent gene research, huge DNA represented by human genome has come to be handled. In such a case, it is easier to handle the DNA into relatively large fragments. Therefore, DNA
It has become necessary to develop and provide an endonuclease called a rare cutter, which recognizes a large number of nucleotides that greatly cleaves. On the other hand, recently, it has been reported that genes of mitochondria, chloroplasts, and T-even phages have introns (intervening sequences), and the introns (intervening sequences) encode endonucleases. The endonucleases encoded by these introns are generally rare cutters and are known to largely cut DNA. Therefore, there is a strong demand for endonucleases encoded by introns having different cleavage patterns.

[0008]

DISCLOSURE OF THE INVENTION The present invention provides an intron-encoded endonuclease which exhibits a cleavage mode different from any of the conventionally known intron-encoded endonucleases.

[0009]

[Means for Solving the Problems] That is, according to the present invention, the CTA is cleaved at a position indicated by an arrow in the following double-stranded DNA sequence.
In C, or its complementary strand, it is endonuclease 2 which produces a cleavage site for the 4'3 'overhang of GTAG. As a specific example, a hyperthermophilic archaeon, such as Pyrococcus
There is an endonuclease 2 prepared from Pyrococcus furiosus strain KOD1. In addition, a hyperthermophilic archaeon, Pyrococcus furiosu
s) Endonuclease 2 is produced using a recombinant host cell transformed with an expression vector into which a gene derived from the KOD1 strain has been inserted. Endonuclease 2 of the present invention
Preferably contains the amino acid sequence set forth in SEQ ID NO: 3 in the Sequence Listing. These endonucleases 2 have a molecular weight of about 62 Kda.

The present invention is also an isolated DNA encoding the above-mentioned endonuclease 2, and specifically contains a base sequence encoding the amino acid sequence set forth in SEQ ID NO: 3 in the Sequence Listing. Further, the DNA has the sequence listing, SEQ ID NO: 2
It preferably contains the nucleotide sequence described in 1.

The present invention is a DNA recombinant vector in which the isolated DNA encoding the above-mentioned endonuclease 2 is inserted into the vector.

The present invention is also a DNA recombinant expression vector in which the isolated DNA encoding the above-mentioned endonuclease 2 is inserted into the expression vector.

The present invention is also a recombinant host cell transformed with a DNA recombinant expression vector in which a DNA encoding endonuclease 2 is inserted into the expression vector.

Further, according to the present invention, a host cell is transformed with a DNA recombinant expression vector in which a DNA encoding endonuclease 2 is inserted into the vector, the obtained recombinant host cell is cultured, and the endonuclease is removed from the culture. Two
Is a method for producing the endonuclease 2.

The present invention also provides a method for purifying endonuclease 2 which comprises the following steps. (A) A recombinant host cell transformed with a DNA recombinant expression vector in which a DNA encoding endonuclease 2 is inserted into an expression vector is cultured. (B) The recombinant host cells are collected and then crushed to prepare a cell extract. (C) A step of removing the impure protein derived from the host cell.

Pyrococcus furiosus KOD, which is one of the hyperthermophilic archaeon used as the gene source of the present invention
One strain is a strain isolated from sulfur gas turbine of Kotakarajima, Kagoshima Prefecture. The mycological properties of the strain are described below. Cell morphology Staphylococcus, dicocci, with flagella Growth temperature range 65-100 ° C Optimal growth temperature 95 ° C Growth pH range 5-9 Optimum pH 6 Optimum salt concentration 2-3% auxotrophy Heterotrophic oxygen demand Anaerobic cell membrane lipid GC content of ether type DNA 38%

The hyperthermophilic archaeon Pyrococcus furiosus KOD1 strain is a coccus having a diameter of about 1 μm and had a plurality of polar flagella. Due to the mycological properties, this strain is Pfu
DNA polymerase-producing bacterium (Pyrococcus furiosus),
And Tli (Vent) DNA polymerase producing bacteria (T
A relationship with hermococcus litoralis was suggested.

The cloning of the endonuclease 2 gene of the present invention is carried out by the following method. A type of hyperthermophilic archaeon, Thermococcus l
itoralis) has an intron in its DNA polymerase gene, and it has been reported that the intron encodes an endonuclease (Francine B
Perler et al., Proc.Natl.Acad.Sci., USA 1992). A hyperthermophilic archaeon, Pyrococcus
furiosus) KOD1 strain has an intron in its DNA polymerase gene, and in order to investigate whether the intron encodes an endonuclease, first, the DNA polymerase gene of the bacterium is obtained. Therefore, the presence of introns has not been reported, but the known homologous Pyrococcus furiosus
A primer is designed and synthesized based on the amino acid sequence of the conserved region of the derived Pfu DNA polymerase (see, for example, SEQ ID NOS: 4 and 5).

First, the chromosome DN of the hyperthermophilic archaeon KOD1 strain
A PCR is carried out using A as a template and the primer prepared by the above method to amplify the DNA fragment. The DNA sequence of the amplified DNA fragment is determined to confirm that it encodes the initially set amino acid sequence. Then, Southern hybridization is carried out on the restriction enzyme degradation product of the chromosome of the KOD1 strain using the DNA fragment as a probe. Limit the approximate size of the fragment containing the DNA polymerase gene of interest (approximately 4-7 Kb
p).

Further, a limited DNA fragment of 4 to 7 Kbp was recovered from the gel, and using this, a DNA library was prepared in Escherichia coli, and colony hybridization was carried out using the PCR amplified DNA fragment described above as a probe. , Obtain a clone strain containing the target DNA fragment.

When the DNA polymerase gene derived from the cloned KOD1 strain was analyzed, it was found that the gene was 501.
It was composed of 0 bases (estimated amino acid sequence 1670) (see Sequence Listing, SEQ ID NO: 1). When compared with other DNA polymerases, the gene contains a conserved region of α-DNA polymerase that is a eukaryotic type, Region 1 to Region 1.
There were five. In addition, 3 '→ N-terminal side of the gene
Exo 1-3, which is the 5'exonuclease motif, was present. Heat resistance D derived from hyperthermophilic archaeon KOD1 strain
Conserved region of NA polymerase gene, Region1,
Among the two, known Pyrococcus furiosus (Pyro
Unlike coccus friosus), introns (intervening sequences), IVS-A and IVS-B are present respectively. These intervening sequences are open reading frames (ORFs)
Are connected in the form of saving.

The thermostable DNA polymerase gene of the hyperthermophilic archaeon KOD1 strain is derived from the known enzyme Pyrococcus.
Pfu DN from Furiosus (Pyrococcus furiosus)
A polymerase gene and Tli (Ven from Thermococcus litoralis)
t) When compared with the DNA polymerase gene, KO
Genes derived from strain D1 contain intervening sequences, IVS-A, IVS
-B is present, but the Pfu DNA polymerase gene has no intervening sequence, and the Tli DNA polymerase gene has two intervening sequences,
The existence locations are Regions 2 and 3 which are storage areas, respectively.
Which is significantly different from the position of the intervening sequence in the thermostable DNA polymerase gene of the KOD1 strain of the present invention.

It is confirmed that the DNA polymerase gene of the hyperthermophilic archaeon KOD1 strain has two introns and they encode an endonuclease. In order to express these intron-derived endonucleases in Escherichia coli, 1374 to 245 of Sequence Listing
3 bp (IVS-A), 2708-4316 bp (IV
The intervening sequence of S-B) is removed by the PCR gene fusion method to construct a gene containing only one intron. Specifically, the cloned gene containing the intervening sequence was labeled with three sets of primers (eg, SEQ ID NOs: 8-13).
PCR reaction is carried out by the combination of (see) and two fragments containing one of the two introns are amplified. When designing the primers used here,
A part of the fragment to be ligated to the end is included at the 5'end. Next, the fragments to be ligated are ligated to each other by PCR using the overlapping sequences at their ends. Then, a plasmid vector capable of inducible expression with the T7 promoter, such as pET-8c, was cloned into
To synchronize. Furthermore, a host cell such as Escherichia coli is transformed with this recombinant plasmid, and the endonuclease gene derived from the KOD1 strain intron is induced and expressed in this recombinant E. coli.

The DNA encoding the endonuclease 2 of the present invention specifically contains a nucleotide sequence encoding the amino acid sequence shown in Sequence Listing / SEQ ID NO: 3. Further, it preferably contains the nucleotide sequence shown in Sequence Listing / SEQ ID NO: 2. These DNAs are endonuclease 2
Part of the DNA may be deleted or replaced as long as it encodes an active enzyme. In addition to DNA other DNA
May be inserted. The method for cloning the DNA encoding the endonuclease 2 of the present invention is as described above. The method for preparing DNA is not limited to these cloning methods, but a DNA fragment containing only IVS-A or IVS-B is cut out with an appropriate restriction enzyme, and only IVS-A or IVS-B is excised.
There are methods such as PCR amplification.

The recombinant vector of the present invention is obtained by inserting the above DNA into a vector. Vectors include phages and plasmids. Examples of phages are M13-based vectors, λgt10, λgt11, λ-DASH, λZA
P-II and the like. An example of a plasmid is pUC18
, PBR322, pBluescript, pSP, pGW, etc. The recombinant expression vector of the present invention is one in which the above DNA is inserted into an expression vector. Expression vectors include phages and plasmids. Examples of phage include λgt11, λZAP-II and the like. Examples of plasmids include pUC18, pBluescript, pET systems such as pET-8C. The method for inserting into a vector is in accordance with a conventionally known method. For example, the above vector is cleaved with a restriction enzyme that cuts complementary to the cut shape of the same end of the inserted gene, and then the gene is inserted and ligated using ligase (ligase).

Further, the recombinant host cell of the present invention is the above DN
It was transformed with the A recombinant expression vector. Examples of the host cell include Escherichia coli, Bacillus, such as Bacillus subtilis, and various Pseudomonas bacteria. The transduction method follows a conventionally known method.
For example, a phage infection method or competent cells of each cell is used. DNA can also be introduced by electroporation.

The method for producing the endonuclease 2 of the present invention comprises the steps of transforming a host cell with a DNA recombinant expression vector in which a DNA encoding the endonuclease 2 is inserted into the expression vector, and obtaining the recombinant host This is a method of culturing cells and collecting endonuclease 2 from the culture. As a specific example, a DNA recombinant expression vector containing a gene containing one intron derived from the KOD1 strain, for example, a host cell transformed with a pET-8c plasmid, for example, Escherichia coli, is cultured in a medium, and cells are treated after induction treatment. Collect by centrifugation, etc. The collected cells are suspended in an appropriate buffer, crushed, and then heat-treated to remove impure proteins.

The method for purifying endonuclease 2 of the present invention comprises the following steps. (A) A recombinant host cell transformed with a DNA recombinant expression vector in which a DNA encoding endonuclease 2 is inserted into an expression vector is cultured. (B) The recombinant host cells are collected and then crushed to prepare a cell extract. (C) The impure protein derived from the host cell is removed.

The medium to be used varies depending on the host cells, but for example, LB medium, Y medium, 2YT medium, TB medium and the like are often used. The culture conditions differ depending on the host cell and the medium used, but may be any conditions that show the maximum culture titer within about 24 hours, for example. The induction treatment can be carried out by changing physical conditions such as temperature increase or decrease, light irradiation or the like or chemical treatment such as sugar addition or isopropylthio-β-D-galactoside addition. Centrifugation, filtration or the like is used as a method for collecting the bacterial cells. As a method for crushing bacterial cells, there is a method of treating with a homogenizer, ultrasonic treatment, dynomill, French presence, etc. as a physical disruption method, and with a surfactant such as SDS, an enzyme such as lysozyme as a chemical treatment method. . The heat treatment conditions are 70 ° C or higher,
It is preferably 90 ° C. or higher.

The endonuclease 2 thus obtained has a molecular weight of about 62 KDa. The endonuclease 2 cleaves at the position shown by the arrow in the following double-stranded DNA sequence, and in CTAC or its complementary strand, GTA
It was confirmed to be endonuclease 2 which produces a cleavage site of the 4'G 3'overhang.

The endonuclease 2 of the present invention is 94 ° C., 20
It had sufficient activity even after heat treatment for a minute, and as shown in FIG. 2, the presence of the enzyme protein was confirmed even after heat treatment, indicating that it was thermostable.

[0032]

INDUSTRIAL APPLICABILITY The endonuclease 2 of the present invention has a high thermostability, is a rare cutter, and is a novel enzyme suitable for largely cutting DNA.

[0033]

EXAMPLES The present invention will be described below with reference to examples. Example 1 Pyrococcus furiosus (Pyrococcu)
Cloning of a DNA polymerase gene derived from S. furiosus) KOD1 strain The hyperthermophilic archaeon KOD1 strain isolated from Kotakarajima, Kagoshima Prefecture was cultured at 95 ° C., and then the bacterial cells were recovered. Chromosomal DN of the hyperthermophilic archaeon KOD1 strain is obtained from the obtained bacterial cells according to a conventional method.
A was prepared. Using the prepared chromosomal DNA as a template, two kinds of primers (SEQ ID NOs: 4 and 5) designed and synthesized based on the nucleotide sequence encoding the DNA polymerase (Pfu polymerase) derived from Pyrococcus furiosus were used. , PCR was performed.

The nucleotide sequence (SEQ ID NO: 6) of this PCR amplified DNA fragment was determined, and the amino acid sequence (SEQ ID NO: 7) was determined. Then, this amplified fragment was used as a probe for Southern digestion of the KOD1 strain chromosomal DNA restriction enzyme treated product. Hybridization was performed to determine the size of the fragment encoding the DNA polymerase (about 4-7 Kbp).

Further, a DNA fragment of this size was recovered from an agarose gel, inserted into plasmid pBS, and E. coli (E. coli JM109) was transformed with the mixture of these to prepare a library. Colony hybridization was performed using the probe previously used in Southern hybridization, and a clone strain (E.coli JM109 / pBSKOD1) considered to contain the DNA polymerase gene derived from the KOD1 strain was obtained from the library.

Example 2 Determination of nucleotide sequence of cloned DNA fragment E. coli JM109 / pBSKOD1 clone strain obtained in Example 1
The plasmid pBSKOD1 was recovered from the above and the nucleotide sequence was determined by a conventional method (SEQ ID NO: 1). Furthermore, the amino acid sequence was deduced from the determined base sequence (SEQ ID NO: 1). KO
The DNA polymerase gene derived from the D1 strain consisted of 5010 bases and encoded 1670 amino acids.

Example 3 Construction of Expression Recombinant Plasmid In order to prepare genes respectively expressing endonucleases 1 and 2 derived from the hyperthermophilic archaeon KOD1 strain intron, two intron portions (SEQ ID NO: 1, IVS-
A: 1374 to 2453 bp, IVS-B: 2708 to
4316bp) was removed by the PCR fusion method. This PCR fusion method is a combination of 3 sets of primers (SEQ ID NO: 8) using a plasmid recovered from a clone strain as a template.
~ 13) PCR is carried out to amplify two fragments excluding one intron. At this time, the primers used for PCR are designed so that the sequence similar to that of the binding partner is present on the side that binds to other fragments. Separate restriction enzyme sites on both ends (N-terminal side: EcoRV, C-terminal side: BamH
I) was designed to be created. Then, among the PCR-amplified fragments, a fragment containing IVS-A and a fragment located on the C-terminal side are mixed and PCR reaction is carried out using each fragment as a primer, and a gene fragment containing intron IVS-A (p
ol (Δivs-b)) was obtained. It contains the gene encoding endonuclease 1. Similarly, I
A fragment containing VS-B and a fragment located on the N-terminal side were mixed and PCR was carried out using each fragment as a primer, and a gene fragment containing intron IVS-B (pol (Δiv
s-a)) was obtained. It contains the gene encoding endonuclease 2 (SEQ ID NO: 2). These gene fragments have EcoRV at the N-terminus and BamHI site at the C-terminus.

Furthermore, EcoRI / Bam of the expression vector pET-8c capable of inducing the gene with the T7 promoter.
Using the HI site and the restriction enzyme site created earlier, subcloning, pET-pol (Δivs-b) as an expression vector expressing endonuclease 1, and pE as an expression vector expressing endonuclease 2
T-pol (Δivs-a) was obtained (FIG. 1).

Example 4 Endonucleases 1 and 2 derived from KOD1 strain intron
Expression and Purification of Expression Recombinant Expression Vector pET-pol Obtained in Example 3
(Δivs-b) and pET-pol (Δivs-a)
Escherichia coli was transformed with E. coli and the resulting transformant was transformed into T
B (Maniatis et al., Molecular Cloning: A Laboratory Ma
(nnual (1982)) medium, and 1 hour before the harvest, the T7 promoter was induced by the addition of isopropylthio-β-D-galactoside. The cells were recovered from the culture solution by centrifugation or the like, suspended in a buffer solution, and then disrupted by ultrasonication to obtain a cell extract. Further, in order to remove the impure protein derived from the host cell, the cell lysate was treated at 94 ° C. for 20 minutes to insolubilize the impure protein derived from the host.
The insoluble fraction was removed by centrifugation to obtain endonucleases 1 and 2 derived from the KOD1 strain intron.

Example 5 Molecular Weights of KOD1 Strain Intron-Derived Endonucleases 1 and 2 The molecular weights of the KOD1 strain intron-derived endonucleases obtained in Example 4 were determined by SDS-PAGE. They were about 41 kDa and about 62 kDa, respectively (Fig. 2).

Cleavage format of KOD1 strain intron-derived endonucleases 1 and 2 KOD1 strain intron-derived endonucleases 1 and 2
Does not use λ-DNA or the like as a substrate, the substrate was prepared as described below, and the cleavage sequence was determined by determining the base sequence of the cleaved fragment (FIG. 4).

As one of the substrates for the endonuclease 1, a gene fragment encoding a DNA polymerase containing no intron was constructed by the PCR fusion method as in the method described in Example 3. That is, from a DNA polymerase gene having an intron (intervening sequence), a combination of 3 sets of primers (SEQ ID NOs: 8 to 13)
An R reaction was performed to amplify 3 fragments that were separated by the intervening sequence. When designing the primer used here, a part of the fragment to be bound to the end was included at the 5'end. Then, PCR was carried out by using the fragments to be ligated with each other and utilizing the overlapping sequences at their ends to ligate the fragments. Further, PCR was performed in the same manner using the obtained two kinds of fragments, and the DNA derived from the KOD1 strain containing no intervening sequence.
Polymerase gene, pol (Δivs-a, Δivs
-B) was constructed (Figure 3). The obtained pol (Δivs
-A, Δivs-b) and pol shown in Example 3.
When (Δivs-a) was used as a substrate and the endonuclease 1 was allowed to act, Regio was fused in which the intron (intervening sequence) IVS-A was deleted in all cases.
A fragment cleaved at the n-1 portion was produced, and the fragment was cleaved at the position indicated by the arrow in the double-stranded DNA sequence from the nucleotide sequence of the fragment as shown below, and AGAT, or its complementary strand Was found to generate a cleavage site of 4 bases 3'overhang of ATCT.

Further, the cleavage mode of the endonuclease 2 was also determined in the same manner. That is, when the endonuclease 2 was used as a substrate with the above-mentioned pol (Δivs-a, Δivs-b) and the pol (Δivs-b) described in Example 3, the intron was (Intervening sequence) Re fused with deletion of IVS-B
A fragment cleaved at the portion of gion-2 was produced. Based on the nucleotide sequence of the fragment, the cleavage pattern was as follows:
It was revealed that the cleavage occurred at the position indicated by the arrow in the A sequence, and a cleavage site of 4 bases 3 ′ overhang of GTAG was generated in CTAC or its complementary strand.

[0044]

[Sequence Listing] SEQ ID NO: 1 Sequence length: 5342 Sequence type: Nucleic acid (DNA) Number of strands: Double-stranded Sequence type: cDNA Origin: Hyperthermophilic archaeal strain: KOD1 Sequence characteristics 156-5165 P CDS 1374-2453 Intervening sequence 2708-4316 Intervening sequence GCTTGAGGGC CTGCGGTTAT GGGACGTTGC AGTTTGCGCC TACTCAAAGA TGCCGGTTTT 60 ATAACGGAGAGA AAAATGGGGA GCTATTACGA TCTCTCCTCT As As GAC ATCACAT GACATle GACTT AGTACTAC GACAATCAGACAG ATCATGACAG ATCAGAAAG GGA AAG CCT GTC ATA AGA ATT TTC AAG AAG GAA 221 Tyr Ile Thr Glu Asp Gly Lys Pro Val Ile Arg Ile Phe Lys Lys Glu 10 15 20 AAC GGC GAG TTT AAG ATT GAG TAC GAC CGG ACT TTT GAA CCC TAC TTC 269 Asn Gly Glu Phe Lys Ile Glu Tyr Asp Arg Thr Phe Glu Pro Tyr Phe 25 30 35 TAC GCC CTC CTG AAG GAC GAT TCT GCC ATT GAG GAA GTC AAG AAG ATA 317 Tyr Ala Leu Leu Lys Asp Asp Ser Ala Ile Glu Glu Val Lys Lys Ile 40 45 50 ACC GCC GAG AGG CAC GGG ACG GTT GTA ACG GTT AAG CGG GTT GAA AAG 365 Thr Ala Glu Arg His Gly Thr Val Val Thr Val Lys Arg Val Glu Lys 55 60 65 70 GTT CAG AAG AAG TTC CTC GGG AGA CCA GTT GAG GTC TGG AAA CTC TAC 413 Val Gln Lys Lys Phe Leu Gly Arg Pro Val Glu Val Trp Lys Leu Tyr 75 80 85 TTT ACT CAT CCG CAG GAC GTC CCA GCG ATA AGG GAC AAG ATA CGA GAG 461 Phe Thr His Pro Gln Asp Val Pro Ala Ile Arg Asp Lys Ile Arg Glu 90 95 100 CAT GGA GCA GTT ATT GAC ATC TAC GAG TAC GAC ATA CCC TTC GCC AAG 509 His Gly Ala Val Ile Asp Ile Tyr Glu Tyr Asp Ile Pro Phe Ala Lys 105 110 115 CGC TAC CTC ATA GAC AAG GGA TTA GTG CCA ATG GAA GGC GAC GAG GAG 557 Arg Tyr Leu Ile Asp Lys Gly Leu Val Pro Met Glu Gly Asp Glu Glu 120 125 130 CTG AAA ATG CTC GCC TTC GAC ATT CAA ACT CTC TAC CAT GAG GGC GAG 605 Leu Lys Met Leu Ala Phe Asp Ile Gln Thr Leu Tyr His Glu Gly Glu 135 140 145 150 GAG TTC GCC GAG GGG CCA ATC CTT ATG ATA AGC TAC GCC GAC GAG GAA 653 Glu Phe Ala Glu Gly Pro Ile Leu Met Ile Ser Tyr Ala Asp Glu Glu 155 160 165 GGG GCC AGG GTG ATA ACT TGG AAG AAC GTG GAT CTC CCC TAC GTT GAC 701 Gly Ala Arg Val Ile Thr Trp Lys Asn Val Asp Leu Pro Tyr Val Asp 170 175 180 GTC GTC TCG ACG GAG AGG GAG ATG ATA AAG CGC TTC CTC CGT GTT GTG 749 Val Val Ser Thr Glu Arg Glu Met Ile Lys Arg Phe Leu Arg Val Val 185 190 195 AAG GAG AAA GAC CCG GAC GTT CTC ATA ACC TAC AAC GGC GAC AAC TTC 797 Lys Glu Lys Asp Pro Asp Val Leu Ile Thr Tyr Asn Gly Asp Asn Phe 200 205 210 GAC TTC GCC TAT CTG AAA AAG CGC TGT GAA AAG CTC GGA ATA AAC TTC 845 Asp Phe Ala Tyr Leu Lys Lys Arg Cys Glu Lys Leu Gly Ile Asn Phe 215 220 225 230 GCC CTC GGA AGG GAT GGA AGC GAG CCG AAG ATT CAG AGG ATG GGC GAC 893 Ala Leu Gly Arg Asp Gly Ser Glu Pro Lys Ile Gln Arg Met Gly Asp 235 240 245 AGG TTT GCC GTC GAA GTG AAG GGA CGG ATA CAC TTC GAT CTC TAT CCT 941 Arg Phe Ala Val Glu Val Lys Gly Arg Ile His Phe Asp Leu Tyr Pro 250 255 260 GTG ATA AGA CGG ACG ATA AAC CTG CCC ACA TAC ACG CTT GAG GCC GTT 989 Val Ile Arg Arg Thr Ile Asn Leu Pro Thr Tyr Thr Leu Glu Ala Val 265 270 275 TAT GAA GCC GTC TTC GGT CAG CCG AAG GAGAAG GTT TAC GCT GAG GAA 1037 Tyr Glu Ala Val Phe Gly Gln Pro Lys Glu Lys Val Tyr Ala Glu Glu 280 285 290 ATA ACA CCA GCC TGG GAA ACC GGC GAG AAC CTT GAG AGA GTC GCC CGC 1085 Ile Thr Pro Ala Trp Glu Thr Gly Glu Asn Leu Glu Arg Val Ala Arg 295 300 305 310 TAC TCG ATG GAA GAT GCG AAG GTC ACA TAC GAG CTT GGG AAG GAG TTC 1133 Tyr Ser Met Glu Asp Ala Lys Val Thr Tyr Glu Leu Gly Lys Glu Phe 315 320 325 CTT CCG ATG GAG GCC CAG CTT TCT CGC TTA ATC GGC CAG TCC CTC TGG 1181 Leu Pro Met Glu Ala Gln Leu Ser Arg Leu Ile Gly Gln Ser Leu Trp 330 335 340 GAC GTC TCC CGC TCC AGC ACT GGC AAC CTC GTT GAG TGG TTC CTC CTC 1229 Asp Val Ser Arg Ser Ser Thr Gly Asn Leu Val Glu Trp Phe Leu Leu 345 350 355 AGG AAG GCC TAT GAG AGG AAT GAG CTG GCC CCG AAC AAG CCC GAT GAA 1277 Arg Lys Ala Tyr Glu Arg Asn Glu Leu Ala Pro Asn Lys Pro Asp Glu 360 365 370 AAG GAG CTG GCC AGA AGA CGG CAG AGC TAT GAA GGA GGC TAT GTA AAA 1325 Lys Glu Leu Ala Arg Arg Arg Gln Ser Tyr Glu Gly Gly Tyr Val Lys 375 380 385 390 GAG CCC GAG AGA G GG TTG TGG GAG AAC ATA GTG TAC CTA GAT TTT AGA 1373 Glu Pro Glu Arg Gly Leu Trp Glu Asn Ile Val Tyr Leu Asp Phe Arg 395 400 405 TGC CAT CCA GCC GAT ACG AAG GTT GTC GTC AAG GGG AAG GGG ATT ATA 1421 Cys His Pro Ala Asp Thr Lys Val Val Val Lys Gly Lys Gly Ile Ile 410 415 420 AAC ATC AGC GAG GTT CAG GAA GGT GAC TAT GTC CTT GGG ATT GAC GGC 1469 Asn Ile Ser Glu Val Gln Glu Gly Asp Tyr Val Leu Gly Ile Asp Gly 425 430 435 TGG CAG AGA GTT AGA AAA GTA TGG GAA TAC GAC TAC AAA GGG GAG CTT 1517 Trp Gln Arg Val Arg Lys Val Trp Glu Tyr Asp Tyr Lys Gly Glu Leu 440 445 450 GTA AAC ATA AAC GGG TTA AAG TGT ACG CCC AAT CAT AAG CTT CCC GTT 1565 Val Asn Ile Asn Gly Leu Lys Cys Thr Pro Asn His Lys Leu Pro Val 455 460 465 470 GTT ACA AAG AAC GAA CGA CAA ACG AGA ATA AGA GAC AGT CTT GCT AAG 1613 Val Thr Lys Asn Glu Arg Gln Thr Arg Ile Arg Asp Ser Leu Ala Lys 475 480 485 TCT TTC CTT ACT AAA AAA GTT AAG GGC AAG ATA ATA ACC ACT CCC CTT 1661 Ser Phe Leu Thr Lys Lys Val Lys Gly Lys Ile Ile Thr Thr Pro Leu 490 495 50 0 TTC TAT GAA ATA GGC AGA GCG ACA AGT GAG AAT ATT CCA GAA GAA GAG 1709 Phe Tyr Glu Ile Gly Arg Ala Thr Ser Glu Asn Ile Pro Glu Glu Glu 505 510 515 GTT CTC AAG GGA GAG CTC GCT GGC ATA CTA TTG GCT GAA GGA ACG CTC 1757 Val Leu Lys Gly Glu Leu Ala Gly Ile Leu Leu Ala Glu Gly Thr Leu 520 525 530 TTG AGG AAA GAC GTT GAA TAC TTT GAT TCA TCC CGC AAA AAA CGG AGG 1805 Leu Arg Lys Asp Val Glu Tyr Phe Asp Ser Ser Arg Lys Lys Arg Arg 535 540 545 550 ATT TCA CAC CAG TAT CGT GTT GAG ATA ACC ATT GGG AAA GAC GAG GAG 1853 Ile Ser His Gln Tyr Arg Val Glu Ile Thr Ile Gly Lys Asp Glu Glu 555 560 565 GAG TTT AGG GAT CGT ATC ACA TAC ATT TTT GAG CGT TTG TTT GGG ATT 1901 Glu Phe Arg Asp Arg Ile Thr Tyr Ile Phe Glu Arg Leu Phe Gly Ile 570 575 580 ACT CCA AGC ATC TCG GAG AAG AAA GGA ACT AAC GCA GTA ACA CTC AAA 1949 Thr Pro Ser Ile Ser Glu Lys Lys Gly Thr Asn Ala Val Thr Leu Lys 585 590 595 GTT GCG AAG AAG AAT GTT TAT CTT AAA GTC AAG GAA ATT ATG GAC AAC 1997 Val Ala Lys Lys Asn Val Tyr Leu Lys Val Lys Glu Ile Me t Asp Asn 600 605 610 ATA GAG TCC CTA CAT GCC CCC TCG GTT CTC AGG GGA TTC TTC GAA GGC 2045 Ile Glu Ser Leu His Ala Pro Ser Val Leu Arg Gly Phe Phe Glu Gly 615 620 625 630 GAC GGT TCA GTA AAC AGG GTT AGG AGG AGT ATT GTT GCA ACC CAG GGT 2093 Asp Gly Ser Val Asn Arg Val Arg Arg Ser Ile Val Ala Thr Gln Gly 635 640 645 ACA AAG AAC GAG TGG AAG ATT AAA CTG GTG TCA AAA CTG CTC TCC CAG 2141 Thr Lys Asn Glu Trp Lys Ile Lys Leu Val Ser Lys Leu Leu Ser Gln 650 655 660 CTT GGT ATC CCT CAT CAA ACG TAC ACG TAT CAG TAT CAG GAA AAT GGG 2189 Leu Gly Ile Pro His Gln Thr Tyr Thr Tyr Gln Tyr Gln Glu Asn Gly 665 670 675 AAA GAT CGG AGC AGG TAT ATA CTG GAG ATA ACT GGA AAG GAC GGA TTG 2237 Lys Asp Arg Ser Arg Tyr Ile Leu Glu Ile Thr Gly Lys Asp Gly Leu 680 685 690 ATA CTG TTC CAA ACA CTC ATT GGA TTC ATC AGT GAA AGA AAG AAC GCT 2285 Ile Leu Phe Gln Thr Leu Ile Gly Phe Ile Ser Glu Arg Lys Asn Ala 695 700 705 710 CTG CTT AAT AAG GCA ATA TCT CAG AGG GAA ATG AAC AAC TTG GAA AAC 2333 Leu Leu Asn Lys Ala Ile Ser Gln Arg Glu Met Asn Asn Leu Glu Asn 715 720 725 AAT GGA TTT TAC AGG CTC AGT GAA TTC AAT GTC AGC ACG GAA TAC TAT 2381 Asn Gly Phe Tyr Arg Leu Ser Glu Phe Asn Val Ser Thr Glu Tyr Tyr 730 735 740 GAG GGC AAG GTC TAT GAC TTA ACT CTT GAA GGA ACT CCC TAC TAC TTT 2429 Glu Gly Lys Val Tyr Asp Leu Thr Leu Glu Gly Thr Pro Tyr Tyr Phe 745 750 755 GCC AAT GGC ATA TTG ACC CAT AAC TCC CTG TAC CCC TCA ATC ATC ATC 2477 Ala Asn Gly Ile Leu Thr His Asn Ser Leu Tyr Pro Ser Ile Ile Ile 760 765 770 ACC CAC AAC GTC TCG CCG GAT ACG CTC AAC AGA GAA GGA TGC AAG GAA 2525 Thr His Asn Val Ser Pro Asp Thr Leu Asn Arg Glu Gly Cys Lys Glu 775 780 785 790 TAT GAC GTT GCC CCA CAG GTC GGC CAC CGC TTC TGC AAG GAC TTC CCA 2573 Tyr Asp Val Ala Pro Gln Val Gly His Arg Phe Cys Lys Asp Phe Pro 795 800 805 GGA TTT ATC CCG AGC CTG CTT GGA GAC CTC CTA GAG GAG AGG CAG AAG 2621 Gly Phe Ile Pro Ser Leu Leu Gly Asp Leu Leu Glu Glu Arg Gln Lys 810 815 820 ATA AAG AAG AAG ATG AAG GCC ACG ATT GAC CCG ATC GAG AGG AAG CTC 2669 Ile Lys Lys Lys Met Lys Ala Thr Ile Asp Pro Ile Glu Arg Lys Leu 825 830 835 CTC GAT TAC AGG CAG AGG GCC ATC AAG ATC CTG GCA AAC AGC ATC CTA 2717 Leu Asp Tyr Arg Gln Arg Ala Ile Lys Ile Leu Ala Asn Ser Ile Leu 840 845 850 CCC GAG GAA TGG CTT CCA GTC CTC GAG GAA GGG GAG GTT CAC TTC GTC 2765 Pro Glu Glu Trp Leu Pro Val Leu Glu Glu Gly Glu Val His Phe Val 855 860 865 870 AGG ATT GGA GAG CTC ATA GAC CGG ATG ATG GAG GAA AAT GCT GGG AAA 2813 Arg Ile Gly Glu Leu Ile Asp Arg Met Met Glu Glu Asn Ala Gly Lys 875 880 885 GTA AAG AGA GAG GGC GAG ACG GAA GTG CTT GAG GTC AGT GGG CTT GAA 2861 Val Lys Arg Glu Gly Glu Thrlu Val Leu Glu Val Ser Gly Leu Glu 890 895 900 GTC CCG TCC TTT AAC AGG AGA ACT AAC AAG GCC GAG CTC AAG AGA GTA 2909 Val Pro Ser Phe Asn Arg Arg Thr Asn Lys Ala Glu Leu Lys Arg Val 905 910 915 AAG GCC CTG ATT AGG CAC GAT TAT TCT GGC AAG GTC TAC ACC ATC AGA 2957 Lys Ala Leu Ile Arg His Asp Tyr Ser Gly Lys Val Tyr Thr Ile Arg 920 925 930 CTG AAG TCG GGG AGG AGA ATA AAG ATA ACC TCT GGC CAC AGC CTC TTC TC 3005 Leu Lys Ser Gly Arg Arg Ile Lys Ile Thr Ser Gly His Ser Leu Phe 935 940 945 950 TCT GTG AGA AAC GGG GAG CTC GTT GAA GTT ACG GGC GAT GAA CTA AAG 3053 Ser Val Arg Asn Gly Glu Leu Val Glu Val Thr Gly Asp Glu Leu Lys 955 960 965 CCA GGT GAC CTC GTT GCA GTC CCG CGG AGA TTG GAG CTT CCT GAG AGA 3101 Pro Gly Asp Leu Val Ala Val Pro Arg Arg Leu Glu Leu Pro Glu Arg 970 975 980 AAC CAC GTG CTG AAC CTC GTT GAA CTG CTC CTT GGA ACG CCA GAA GAA 3149 Asn His Val Leu Asn Leu Val Glu Leu Leu Leu Gly Thr Pro Glu Glu 985 990 995 GAA ACT TTG GAC ATC GTC ATG ACG ATC CCA GTC AAG GGT AAG AAG AAC 3197 Glu Thr Leu Asp Ile Val Met Thr Ile Pro Val Lys Gly Lys Lys Asn 1000 1005 1010 TTC TTT AAA GGG ATG CTC AGG ACT TTG CGC TGG ATT TTC GGA GAG GAA 3245 Phe Phe Lys Gly Met Leu Arg Thr Leu Arg Trp Ile Phe Gly Glu Glu 1015 1020 1025 1030 AAG AGG CCC AGA ACC GCG AGA CGC TAT CTC AGG CAC CTT GAG GAT CTG 3293 Lys Arg Pro Arg Thr Ala Arg Arg Tyr Leu Arg His Leu Glu Asp Leu 1035 1040 1045 GGC TAT GTC CGG CTT AAG AAG ATC GGC TAC GAA GTC CTC GAC TGG GAC 3341 Gly Tyr Val Arg Leu Lys Lys Ile Gly Tyr Glu Val Leu Asp Trp Asp 1050 1055 1060 TCA CTT AAG AAC TAC AGA AGG CTC TAC GAG GCG CTT GTC GAG AAC GTC 3389 Ser Leu Lys Asn Tyr Arg Arg Leu Tyr Glu Ala Leu Val Glu Asn Val 1065 1070 1075 AGA TAC AAC GGC AAC AAG AGG GAG TAC CTC GTT GAA TTC AAT TCC ATC 3437 Arg Tyr Asn Gly Asn Lys Arg Glu Tyr Leu Val Glu Phe Asn Ser Ile 1080 1085 1090 CGG GAT GCA GTT GGC ATA ATG CCC CTA AAA GAG CTG AAG GAG TGG AAG 3485 Arg Asp Ala Val Gly Ile Met Pro Leu Lys Glu Leu Lys Glu Trp Lys 1095 1100 1105 1110 ATC GGC ACG CTG AAC GGC TTC AGA ATG AGA AAG CTC ATT GAA GTG GAC 3533 Ile Gly Thr Leu Asn Gly Phe Arg Met Arg Lys Leu Ile Glu Val Asp 1115 1120 1125 GAG TCG TTA GCA AAG CTC CTC GGC TAC TAC GTG AGC GAG GGC TAT GCA 3581 Glu Ser Leu Ala Lys Leu Leu Gly Tyr Tyr Val Ser Glu Gly Tyr Ala 1130 1135 1140 AGA AAG CAG AGG AAT CCC AAA AAC GGC TGG AGC TAC AGC GTG AAG CTC 3629 Arg Lys Gln Arg Asn Pro Lys Asn Gly Trp Ser Tyr Ser Val Lys Leu 11 45 1150 1155 TAC AAC GAA GAC CCT GAA GTG CTG GAC GAT ATG GAG AGA CTC GCC AGC 3677 Tyr Asn Glu Asp Pro Glu Val Leu Asp Asp Met Glu Arg Leu Ala Ser 1160 1165 1170 AGG TTT TTC GGG AAG GTG AGG CGG GGC AGG AAC TAC GTT GAG ATA CCG 3725 Arg Phe Phe Gly Lys Val Arg Arg Gly Arg Asn Tyr Val Glu Ile Pro 1175 1180 1185 1190 AAG AAG ATC GGC TAC CTG CTC TTT GAG AAC ATG TGC GGT GTC CTA GCG 3773 Lys Lys Ile Gly Tyr Leu Leu Phe Glu Asn Met Cys Gly Val Leu Ala 1195 1200 1205 GAG AAC AAG AGG ATT CCC GAG TTC GTC TTC ACG TCC CCG AAA GGG GTT 3821 Glu Asn Lys Arg Ile Pro Glu Phe Val Phe Thr Ser Pro Lys Gly Val 1210 1215 1220 CGG CTG GCC TTC CTT GAG GGG TAC TCA TCG GCG ATG GCG ACG TCC ACC 3869 Arg Leu Ala Phe Leu Glu Gly Tyr Ser Ser Ala Met Ala Thr Ser Thr 1225 1230 1235 GAA CAA GAG ACT CAG GCT CTC AAC GAA AAG CGA GCT TTA GCG AAC CAG 3917 Glu Gln Glu Thr Gln Ala Leu Asn Glu Lys Arg Ala Leu Ala Asn Gln 1240 1245 1250 CTC GTC CTC CTC TTG AAC TCG GTG GGG GTC TCT GCT GTA AAA CTT GGG 3965 Leu Val Leu Leu Leu Asn S er Val Gly Val Ser Ala Val Lys Leu Gly 1255 1260 1265 1270 CAC GAC AGC GGC GTT TAC AGG GTC TAT ATA AAC GAG GAG CTC CCG TTC 4013 His Asp Ser Gly Val Tyr Arg Val Tyr Ile Asn Glu Glu Leu Pro Phe 1275 1280 1285 GTA AAG CTG GAC AAG AAA AAG AAC GCC TAC TAC TCA CAC GTG ATC CCC 4061 Val Lys Leu Asp Lys Lys Lys Asn Ala Tyr Tyr Ser His Val Ile Pro 1290 1295 1300 AAG GAA GTC CTG AGC GAG GTC TTT GGG AAG GTT TTC CAG AAA AAC GTC 4109 Lys Glu Val Leu Ser Glu Val Phe Gly Lys Val Phe Gln Lys Asn Val 1305 1310 1315 AGT CCT CAG ACC TTC AGG AAG ATG GTC GAG GAC GGA AGA CTC GAT CCC 4157 Ser Pro Gln Thr Phe Arg Lys Met Val Glu Asp Gly Arg Leu Asp Pro 1320 1325 1330 GAA AAG GCC CAG AGG CTC TCC TGG CTC ATT GAG GGG GAC GTA GTG CTC 4205 Glu Lys Ala Gln Arg Leu Ser Trp Leu Ile Glu Gly Asp Val Val Leu 1335 1340 1345 1350 GAC CGC GTT GAG TCC GTT GAT GTG GAA GAC TAC GAT GGT TAT GTC TAT 4253 Asp Arg Val Glu Ser Val Asp Val Glu Asp Tyr Asp Gly Tyr Val Tyr 1355 1360 1365 GAC CTG AGC GTC GAG GAC AAC GAG AAC TTC CTC GTT GGC TTT GGG TTG 4301 Asp Leu Ser Val Glu Asp Asn Glu Asn Phe Leu Val Gly Phe Gly Leu 1370 1375 1380 GTC TAT GCT CAC AAC AGC TAC TAC GGT TAC TAC GGC TAT GCA AGG GCG 4349 Val Tyr Ala His Asn Ser Tyr Tyr Gly Tyr Tyr Gly Tyr Ala Arg Ala 1385 1390 1395 CGC TGG TAC TGC AAG GAG TGT GCA GAG AGC GTA ACG GCC TGG GGA AGG 4397 Arg Trp Tyr Cys Lys Glu Cys Ala Glu Ser Val Thr Ala Trp Gly Arg 1400 1405 1410 GAG TAC ATA ACG ATG ACC ATC AAG GAG ATA GAG GAA AAG TAC GGC TTT 4445 Glu Tyr Ile Thr Met Thr Ile Lys Glu Ile Glu Glu Lys Tyr Gly Phe 1415 1420 1425 1430 AAG GTA ATC TAC AGC GAC ACC GAC GGA TTT TTT GCC ACA ATA CCT GGA 44 Lys Val Ile Tyr Ser Asp Thr Asp Gly Phe Phe Ala Thr Ile Pro Gly 1435 1440 1445 GCC GAT GCT GAA ACC GTC AAA AAG AAG GCT ATG GAG TTC CTC AAC TAT 4541 Ala Asp Ala Glu Thr Val Lys Lys Lys Ala Met Glu Phe Leu Asn Tyr 1450 1455 1460 ATC AAC GCC AAA CTT CCG GGC GCG CTT GAG CTC GAG TAC GAG GGC TTC 4589 Ile Asn Ala Lys Leu Pro Gly Ala Leu Glu Leu Glu Tyr Glu Gly Phe 1465 1470 1475 TAC AA A CGC GGC TTC TTC GTC ACG AAG AAG AAG TAT GCG GTG ATA GAC 4637 Tyr Lys Arg Gly Phe Phe Val Thr Lys Lys Lys Tyr Ala Val Ile Asp 1480 1485 1490 GAG GAA GGC AAG ATA ACA ACG CGC GGA CTT GAG ATT GTG AGG CGT GAC 4685 Glu Glu Gly Lys Ile Thr Thr Arg Gly Leu Glu Ile Val Arg Arg Asp 1495 1500 1505 1510 TGG AGC GAG ATA GCG AAA GAG ACG CAG GCG AGG GTT CTT GAA GCT TTG 4733 Trp Ser Glu Ile Ala Lys Glu Thr Gln Ala Arg Val Leu Glu Ala Leu 1515 1520 1525 CTA AAG GAC GGT GAC GTC GAG AAG GCC GTG AGG ATA GTC AAA GAA GTT 4781 Leu Lys Asp Gly Asp Val Glu Lys Ala Val Arg Ile Val Lys Glu Val 1530 1535 1540 ACC GAA AAG CTG AGC AAG TAC GAG GTT CCG CCG GAG AAG CTG GTG ATC 4829 Thr Glu Lys Leu Ser Lys Tyr Glu Val Pro Pro Glu Lys Leu Val Ile 1545 1550 1555 CAC GAG CAG ATA ACG AGG GAT TTA AAG GAC TAC AAG GCA ACC GGT CCC 4877 His Glu Gln Ile Thr Arg Asp Leu Lys Asp Tyr Lys Ala Thr Gly Pro 1560 1565 1570 CAC GTT GCC GTT GCC AAG AGG TTG GCC GCG AGA GGA GTC AAA ATA CGC 4925 His Val Ala Val Ala Lys Arg Leu Ala Ala Arg Gly Val Lys Ile Arg 1575 1580 1585 1590 CCT GGA ACG GTG ATA AGC TAC ATC GTG CTC AAG GGC TCT GGG AGG ATA 4973 Pro Gly Thr Val Ile Ser Tyr Ile Val Leu Lys Gly Ser Gly Arg Ile 1595 1600 1605 GGC GAC AGG GCG ATA CCG TTC GAC GAG TTC GAC CCG ACG AAG CAC AAG 5021 Gly Asp Arg Ala Ile Pro Phe Asp Glu Phe Asp Pro Thr Lys His Lys 1610 1615 1620 TAC GAC GCC GAG TAC TAC ATT GAG AAC CAG GTT CTC CCA GCC GTT GAG 5069 Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn Gln Val Leu Pro Ala Val Glu 1625 1630 1635 AGA ATT CTG AGA GCC TTC GGT TAC CGC AAG GAA GAC CTG CGC TAC CAG 5117 Arg Ile Leu Arg Ala Phe Gly Tyr Arg Lys Glu Asp Leu Arg Tyr Gln 1640 1645 1650 AAG ACG AGA CAG GTT GGT TTG AGT GCT TGG CTG AAG CCG AAG GGA ACT 5165 Lys Thr Arg Gln Val Gly Leu Ser Ala Trp Leu Lys Pro Lys Gly Thr 1655 1660 1665 AGATGACCGATTCCTT CCTTAATC CCTTAATCCCTTTTACT CGGCGCCCGG TTAAATACGC TAGGATAGAA 5285 GTGAAGCCAG ACGGCAGGGT AGTCGTCACT GCCCCGAGGG TTCAACGTTG AGAAGTT 5342

SEQ ID NO: 2 Sequence length: 1608 Sequence type: Nucleic acid (DNA) Number of strands: Double-stranded Sequence type: cDNA sequence AGCATCCTAC CCGAGGAATG GCTTCCAGTC CTCGAGGAAG GGGAGGTTCA CTTCGTCAGG 60 ATTGGAGAGC TCATAGACCG GATGATGGAG GAAAATGCTG GGAAAGTAAA GA GAAGTCCCGT CCTTTAACAG GAGAACTAAC 180 AAGGCCGAGC TCAAGAGAGT AAAGGCCCTG ATTAGGCACG ATTATTCTGG CAAGGTCTAC 240 ACCATCAGAC TGAAGTCGGG GAGGAGAATA AAGATAACCT CTGGCCACAG CCTCTTCTCT 300 GTGAGAAACG GGGAGCTCGT TGAAGTTACG GGCGATGAAC TAAAGCCAGG TGACCTCGTT 360 GCAGTCCCGC GGAGATTGGA GCTTCCTGAG AGAAACCACG TGCTGAACCT CGTTGAACTG 420 CTCCTTGGAA CGCCAGAAGA AGAAACTTTG GACATCGTCA TGACGATCCC AGTCAAGGGT 480 AAGAAGAACT TCTTTAAAGG GATGCTCAGG ACTTTGCGCT GGATTTTCGG AGAGGAAAAG 540 AGGCCCAGAA CCGCGAGACG CTATCTCAGG CACCTTGAGG ATCTGGGCTA TGTCCGGCTT 600 AAGAAGATCG GCTACGAAGT CCTCGACTGG GACTCACTTA AGAACTACAG AAGGCTCTAC 660 GAGGCGCTTG TCGAGAACGT CAGATACAAC GGCAACAAGA GGGAGTACCT CGTTGAATTC 720 AATTCCATCC GGGATGCAGT TGGCATAATG CCCCTAAAAG AGCTGAAGGA GTGGAAGATC 780 GGCACGCTGA ACGGCTTCAG AATGAGAAAG CTCATTGAAG TGGACGAGTC GTTAGCAAAG 840 CTCCTCGGCT ACTACGTGAG CGAGGGCTAT GCAAGAAAGC AGAGGAATCC CAAAAACGGC 900 TGGAGCTACA GCGTGAAGCT CTACAACGAA GACCCTGAAG TGCTGGACGA TATGGAGAGA 960 CTCGCCAGCA GGTTTTTCGG GAAGGTGAGG CGGGGCAGGA ACTACGTTGA GATACCGAAG 1020 AAGATCGGCT ACCTGCTCTT TGAGAACATG TGCGGTGTCC TAGCGGAGAA CAAGAGGATT 1080 CCCGAGTTCG TCTTCACGTC CCCGAAAGGG GTTCGGCTGG CCTTCCTTGA GGGGTACTCA 1140 TCGGCGATGG CGACGTCCAC CGAACAAGAG ACTCAGGCTC TCAACGAAAA GCGAGCTTTA 1200 GCGAACCAGC TCGTCCTCCT CTTGAACTCG GTGGGGGTCT CTGCTGTAAA ACTTGGGCAC 1260 GACAGCGGCG TTTACAGGGT CTATATAAAC GAGGAGCTCC CGTTCGTAAA GCTGGACAAG 1320 AAAAAGAACG CCTACTACTC ACACGTGATC CCCAAGGAAG TCCTGAGCGA GGTCTTTGGG 1380 AAGGTTTTCC AGAAAAACGT CAGTCCTCAG ACCTTCAGGA AGATGGTCGA GGACGGAAGA 1440 CTCGATCCCG AAAAGGCCCA GAGGCTCTCC TGGCTCATTG AGGGGGACGT AGTGCTCGAC 1500 CGCGTTGAGT CCGTTGATGT GGAAGACTAC GATGGTTATG TCTATGACCT GAGCGTCGAG 1560 GACAACGAG A ACTTCCTCGT TGGCTTTGGG TTGGTCTATG CTCACAAC

SEQ ID NO: 3 Sequence length: 537 Sequence type: Amino acid Topology: Linear Sequence type: Protein sequence Ser Ile Leu Pro Glu Glu Trp Leu Pro Val Leu Glu Glu Gly Glu Val 1 5 10 15 His Phe Val Arg Ile Gly Glu Leu Ile Asp Arg Met Met Glu Glu Asn 20 25 30 Ala Gly Lys Val Lys Arg Glu Gly Glu Thr Glu Val Leu Glu Val Ser 35 40 45 Gly Leu Glu Val Pro Ser Phe Asn Arg Arg Thr Asn Lys Ala Glu Leu 50 55 60 Lys Arg Val Lys Ala Leu Ile Arg His Asp Tyr Ser Gly Lys Val Tyr 65 70 75 80 Thr Ile Arg Leu Lys Ser Gly Arg Arg Ile Lys Ile Thr Ser Gly His 85 90 95 Ser Leu Phe Ser Val Arg Asn Gly Glu Leu Val Glu Val Thr Gly Asp 100 105 110 Glu Leu Lys Pro Gly Asp Leu Val Ala Val Pro Arg Arg Leu Glu Leu 115 120 125 Pro Glu Arg Asn His Val Leu Asn Leu Val Glu Leu Leu Leu Gly Thr 130 135 140 Pro Glu Glu Glu Thr Leu Asp Ile Val Met Thr Ile Pro Val Lys Gly 145 150 155 160 Lys Lys Asn Phe Phe Lys Gly Met Leu Arg Thr Leu Arg Trp Ile Phe 165 170 175 Gly Glu Glu Ly s Arg Pro Arg Thr Ala Arg Arg Tyr Leu Arg His Leu 180 185 190 Glu Asp Leu Gly Tyr Val Arg Leu Lys Lys Ile Gly Tyr Glu Val Leu 195 200 205 Asp Trp Asp Ser Leu Lys Asn Tyr Arg Arg Leu Tyr Glu Ala Leu Val 210 215 220 Glu Asn Val Arg Tyr Asn Gly Asn Lys Arg Glu Tyr Leu Val Glu Phe 225 230 235 240 Asn Ser Ile Arg Asp Ala Val Gly Ile Met Pro Leu Lys Glu Leu Lys 245 250 255 Glu Trp Lys Ile Gly Thr Leu Asn Gly Phe Arg Met Arg Lys Leu Ile 260 265 270 Glu Val Asp Glu Ser Leu Ala Lys Leu Leu Gly Tyr Tyr Val Ser Glu 275 280 285 Gly Tyr Ala Arg Lys Gln Arg Asn Pro Lys Asn Gly Trp Ser Tyr Ser 290 295 300 305 Val Lys Leu Tyr Asn Glu Asp Pro Glu Val Leu Asp Asp Met Glu Arg 310 315 320 Leu Ala Ser Arg Phe Phe Gly Lys Val Arg Arg Gly Arg Asn Tyr Val 325 330 335 Glu Ile Pro Lys Lys Ile Gly Tyr Leu Leu Phe Glu Asn Met Cys Gly 340 345 350 Val Leu Ala Glu Asn Lys Arg Ile Pro Glu Phe Val Phe Thr Ser Pro 355 360 365 Lys Gly Val Arg Leu Ala Phe Leu Glu Gly Tyr Ser Ser Ala Met Ala 370 375 380 385 Thr Ser Thr Gl u Gln Glu Thr Gln Ala Leu Asn Glu Lys Arg Ala Leu 390 395 400 Ala Asn Gln Leu Val Leu Leu Leu Asn Ser Val Gly Val Ser Ala Val 405 410 415 Lys Leu Gly His Asp Ser Gly Val Tyr Arg Val Tyr Ile Asn Glu Glu 420 425 430 Leu Pro Phe Val Lys Leu Asp Lys Lys Lys Asn Ala Tyr Tyr Ser His 435 440 445 Val Ile Pro Lys Glu Val Leu Ser Glu Val Phe Gly Lys Val Phe Gln 450 455 460 465 Lys Asn Val Ser Pro Gln Thr Phe Arg Lys Met Val Glu Asp Gly Arg 470 475 480 Leu Asp Pro Glu Lys Ala Gln Arg Leu Ser Trp Leu Ile Glu Gly Asp 485 490 495 Val Val Leu Asp Arg Val Glu Ser Val Asp Val Glu Asp Tyr Asp Gly 500 505 510 510 Tyr Val Tyr Asp Leu Ser Val Glu Asp Asn Glu Asn Phe Leu Val Gly 515 520 525 Phe Gly Leu Val Tyr Ala His Asn 530 535

SEQ ID NO: 4 Sequence length: 24 Sequence type: Nucleic acid Topology: Linear Sequence type: Synthetic DNA Sequence GGATTAGTGC CAATGGAAGG CGAC 24

SEQ ID NO: 5 Sequence length: 24 Sequence type: Nucleic acid Topology: Linear Sequence type: Synthetic DNA Sequence GAGGGCGAAG TTTATTCCGA GCTT 24

SEQ ID NO: 6 Sequence length: 324 Sequence type: Nucleic acid (DNA) Topology: Linear Sequence type: cDNA sequence GGATTAGTGC CAATGGAAGG CGACGAGGAG CTGAAAATGC TCGCCTTCGA CATTCAAACT 60 CTCTACCATG AGGGCGAGGA GTTCGCCGCGAGGGGCCAGACCGCCGAGGAGTTCTACTAACATAGACGCAGAGGAGTTCTACTACGATAGACTCTACGATAGAC TGACGTCGTC 180 TCGACGGAGA GGGAGATGAT AAAGCGCTTC CTCCGTGTTG TGAAGGAGAA AGACCCGGAC 240 GTTCTCATAA CCTACAACGG CGACAACTTC GACTTCGCCT ATCTGAAAAA GCGCTGTGAA 300 AAGCTCGGAA TAAACTTCGC CCTC 324

SEQ ID NO: 7 Sequence length: 108 Sequence type: Amino acid Topology: Linear Sequence type: Protein sequence Gly Leu Val Pro Met Glu Gly Asp Glu Glu Leu Lys Met Leu Ala Phe 1 5 10 15 Asp Ile Gln Thr Leu Tyr His Glu Gly Glu Glu Phe Ala Glu Gly Pro 20 25 30 Ile Leu Met Ile Ser Tyr Ala Asp Glu Glu Gly Ala Arg Val Ile Thr 35 40 45 Trp Lys Asn Val Asp Leu Pro Tyr Val Asp Val Val Ser Thr Glu Arg 50 55 60 Glu Met Ile Lys Arg Phe Leu Arg Val Val Lys Glu Lys Asp Pro Asp 65 70 75 80 Val Leu Ile Thr Tyr Asn Gly Asp Asn Phe Asp Phe Ala Tyr Leu Lys 85 90 95 Lys Arg Cys Glu Lys Leu Gly Ile Asn Phe Ala Leu 100 105

SEQ ID NO: 8 Sequence length: 42 Sequence type: Nucleic acid Topology: Linear Sequence type: Synthetic DNA sequence GCCATCAAGA TCCTGGCAAA CAGCTACTAC GGTTACTACG GC 42

SEQ ID NO: 9 Sequence length: 32 Sequence type: Nucleic acid Topology: Linear Sequence type: Synthetic DNA sequence GATGGATCCA ACTTCTCAAC GTTGAACCCT CG 32

SEQ ID NO: 10 Sequence length: 46 Sequence type: Nucleic acid Topology: Linear Sequence type: Synthetic DNA sequence GAACATAGTG TACCTAGATT TTAGATCCCT GTACCCCTCA ATCATC 46

SEQ ID NO: 11 Sequence length: 42 Sequence type: Nucleic acid Topology: Linear Sequence type: Synthetic DNA sequence GCCGTAGTAA CCGTAGTAGC TGTTTGCCAG GATCTTGATG GC 42

SEQ ID NO: 12 Sequence length: 33 Sequence type: Nucleic acid Topology: Linear Sequence type: Synthetic DNA sequence ATCGATATCC TCGACACTGA CTACATAACC GAG 33

SEQ ID NO: 13 Sequence length: 46 Sequence type: Nucleic acid Topology: Linear Sequence type: Synthetic DNA sequence GATGATTGAG GGGTACAGGG ATCTAAAATC TAGGTACACT ATGTTC 46

[Brief description of drawings]

FIG. 1 shows the construction of a DNA recombinant expression vector expressing endonuclease 2 encoded by intron IVS-B.

FIG. 2 shows the results of measuring the molecular weight of endonucleases 1 and 2.

FIG. 3 shows the construction of pol (Δivs-a, Δivs-b).

FIG. 4 shows the cleavage mode of endonuclease 2.

Continuation of front page (51) Int.Cl. ⁶ Identification number Office reference number FI Technical display location C12N 9/00 101 15/09 ZNA // (C12N 9/16 C12R 1:19) (C12N 1/21 C12R 1 : 19) (C12N 15/09 ZNA C12R 1:01) C12R 1:01)

Claims (24)

[Claims] 1. The following double-stranded DNA sequence is cleaved at the position indicated by the arrow, and in CTAC or its complementary strand,
Novel endonuclease 2 which produces a cleavage site for the 4 base 3'overhang of GTAG. 2. The endonuclease 2 according to claim 1, which has a molecular weight of about 62 Kda. 3. The endonuclease 2 according to claim 1, which is prepared from a hyperthermophilic archaeon. 4. The endonuclease 2 according to claim 1, which is produced by using a recombinant host cell. 5. The endonuclease 2 according to claim 1, which contains the amino acid sequence set forth in SEQ ID NO: 3 in the sequence listing. 6. The following double-stranded DNA sequence is cleaved at the position indicated by the arrow, and in CTAC or its complementary strand,
Pyrococcus furiosus KO, which produces a cleavage site for the 4 ′ 3 ′ overhang of GTAG
An endonuclease 2 having a molecular weight of about 62 Kda prepared from strain D1. 7. The following double-stranded DNA sequence is cleaved at the position indicated by the arrow, and in CTAC or its complementary strand,
The molecular weight produced by using a recombinant host cell transformed with a recombinant expression vector in which a DNA encoding an endonuclease 2 for generating a cleavage site of 4 bases of GTAG 4'is inserted is about 62 Ka. Endonuclease 2. 8. The following double-stranded DNA sequence is cleaved at the position indicated by the arrow, and in CTAC or its complementary strand,
An isolated DNA encoding endonuclease 2 which produces a cleavage site for the 4 base 3'overhang of GTAG. 9. The isolated DNA encoding the endonuclease 2 according to claim 8, which contains a base sequence encoding the amino acid sequence set forth in SEQ ID NO: 3 in the Sequence Listing. 10. The isolated DNA encoding the endonuclease 2 according to claim 8, which contains the base sequence shown in SEQ ID NO: 2 in the Sequence Listing. 11. A DNA recombinant vector in which the DNA according to claim 8 is inserted into a vector. 12. A DNA recombinant expression vector in which the DNA according to claim 8 is inserted into an expression vector. 13. The DN according to claim 12, wherein the expression vector is a pET-8c-derived vector.
A recombinant expression vector. 14. A recombinant host cell transformed with the DNA recombinant expression vector according to claim 12. 15. The recombinant host cell according to claim 14, wherein the host cell is Escherichia coli. 16. D encoding endonuclease 2
A host cell is transformed with a DNA recombinant expression vector in which NA is inserted in a vector, the resulting recombinant host cell is cultured, and endonuclease 2 is collected from the culture. A method for producing nuclease 2. 17. D encoding endonuclease 2
The method for producing the endonuclease 2 according to claim 16, wherein NA contains a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 3 in the Sequence Listing. 18. D encoding endonuclease 2
The method for producing the endonuclease 2 according to claim 16, wherein NA contains the base sequence shown in Sequence Listing / SEQ ID NO: 2. 19. A method for purifying endonuclease 2 comprising the following steps. (A) A recombinant host cell transformed with a DNA recombinant expression vector in which a DNA encoding the endonuclease 2 is inserted into the expression vector is cultured. (B) The recombinant host cells are collected and then crushed to prepare a cell extract. (C) The impure protein derived from the host cell is removed. 20. D encoding endonuclease 2
The method for purifying endonuclease 2 according to claim 19, wherein NA contains a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 3 in the sequence listing. 21. D encoding endonuclease 2
20. The method for purifying endonuclease 2 according to claim 19, wherein NA contains the base sequence shown in SEQ ID NO: 2 in the sequence listing. 22. The method for purifying endonuclease 2 according to claim 19, wherein the method for disrupting the host cell is sonication. 23. The method for purifying endonuclease 2 according to claim 19, wherein the step of removing the impure protein is a high temperature heat treatment. 24. The method for purifying endonuclease 2 according to claim 23, wherein the high temperature heat treatment condition is 70 ° C. or higher, preferably 90 ° C. or higher.