JPH0827197A - Antibody recognizing cytochrome p4502a4 originated from man - Google Patents

Abstract

PURPOSE:To obtain an antibody capable of accurately and simply determining a cytochrome P450 molecule species in a living body, because of specifically recognizing the specific cytochrome P450 molecule species originated from a man. CONSTITUTION:The antibody substantially not exhibiting cross reactivity with cytochrome P450 molecule species originated from other men and recognizing the cytochrome P4503A4 originated from a man is obtained by collecting blood from a mammalian immunologically sensitized with the cytochrome P4503A4 originated from the man as an antigen, separating the antibody from the blood and subsequently purifying the antibody. The cytochrome P4503A4 originated from the man is obtained by extracting from a yeast as a transformant expressing the cytochrome P4503A4 originated from the man and subsequently purifying the extracted cytochrome P4503A4.

Description

Detailed Description of the Invention

[0001]

FIELD OF THE INVENTION The present invention relates to human-derived cytochrome P.
It relates to an antibody that recognizes 4503A4.

[0002]

2. Description of the Related Art Cytochrome P450 is a factor involved in a wide variety of reactions such as oxidative metabolism (detoxification and metabolic activation) of drugs, foreign substances and environmental pollutants taken up by the living body, biosynthesis of physiologically active substances in vivo. One is that cytochrome P450s are composed of multiple molecular species with substrate specificities that overlap with each other. It is well known that administration of a drug to a living body induces a specific cytochrome P450 molecular species. On the other hand, in the development of new drugs, early prediction and evaluation of drug metabolism, effects, and toxicity in humans are extremely important subjects. For that purpose, it is necessary to know the distribution and abundance of cytochrome P450 molecular species in the human body. And in recent years
It has become clear that cytochrome P450 has differences in animal species and races. For example, in the case of a race that genetically lacks a cytochrome P450 molecular species that metabolizes a specific drug, the effect of the drug is strong and Cases such as side effects have come to be reported. It has also become known that the amount of cytochrome P450 molecular species in the living body varies depending on the pathological condition such as hypertension and diabetes.

[0003]

Under these circumstances, in order to more accurately predict and evaluate the metabolism, effect, toxicity, etc. of drugs in humans, it is possible to quantify cytochrome P450 molecular species in vivo accurately and simply. A method is desired. In order to solve these problems, it is possible to use an antibody that recognizes a cytochrome P450 molecular species of experimental animals such as rat and rabbit. However, there are differences in the cytochrome P450 between animal species and the required cytochrome P450. Since it is not capable of specifically recognizing only a molecular species, it cannot always be an accurate evaluation.
Therefore, in order to accurately quantify human-derived cytochrome P450 molecular species, an antibody that recognizes human-derived cytochrome P450 molecular species and specifically recognizes only a specific cytochrome P450 molecular species of interest has been required. .

[0004]

In view of such circumstances, the present inventors have prepared an antibody that recognizes a human-derived cytochrome P450 molecular species and specifically recognizes only a specific cytochrome P450 molecular species of interest. In order to do recombinant D
We succeeded in obtaining the desired antibody by using NA technology, and completed the present invention. That is, the present invention collects blood from a mammal immunized with human-derived cytochrome P4503A4 as an antigen, which is extracted and purified from yeast, which is a transformant expressing human-derived cytochrome P4503A4, and collects blood from the blood. An antibody that recognizes human-derived cytochrome P450 3A4, which does not substantially cross-react with other human-derived cytochrome P450 molecular species that can be obtained by separation and purification (hereinafter referred to as the antibody of the present invention. Is provided).

The present invention will be described in more detail below. The “antibody that recognizes human-derived cytochrome P4503A4” in the present invention means human-derived cytochrome P4503A.
Other than 4, any human-derived cytochrome P450 molecular species may be obtained by any method as long as it does not substantially show cross-reactivity. The antigen used for immunizing a mammal is , Human-derived cytochrome P45
Human-derived cytochrome P450 other than 03A4, which does not substantially contaminate molecular species of human-derived cytochrome P450
It is necessary to use 3A4. Here, human-derived cytochrome P450 3A4 can be purified also from human liver, but the obtained cytochrome P450 is inevitably mixed with similar cytochrome P450 molecular species,
It is extremely difficult to purify to a single state. In the case of cytochrome P450 molecular species which is involved in the metabolism of important drugs although it is particularly small in content, purification to a single state is impossible. If such a sample is used as an antigen, it is not possible to produce an antibody that does not substantially show cross-reactivity with other human-derived cytochrome P450 molecular species other than human-derived cytochrome P450 3A4. Further, even if it could be purified to an extremely single state, the amount obtained would be so small that it would not be possible to sufficiently immunize a mammal, or that only a very low antibody titer could be obtained. Occurs. Also,
In the first place, obtaining a large amount of human liver is ethically and technically impossible and impractical. On the contrary,
The method used in the present invention is a method of extracting and purifying an antigen used for immunizing a mammal from yeast, which is a transformant expressing only a specific cytochrome P450 molecular species, by recombinant DNA technology. As a result, a human-derived cytochrome P4503A4 of high purity that does not substantially contaminate other human-derived cytochrome P450 molecular species other than human-derived cytochrome P4503A4.
Can be obtained in large quantities and easily.

Specifically, (1) a gene encoding human-derived cytochrome P4503A4 was cloned,
(2) An expression plasmid for expressing the cloned gene in yeast is constructed, (3) the constructed yeast expression plasmid is introduced into yeast, and human-derived cytochrome P45
Recombinant yeast expressing 03A4 is prepared, (4) the prepared recombinant yeast is cultured, and after crushing this, a yeast microsome fraction is prepared, and (5) the fraction is treated with a surfactant or the like. After solubilization using, the resulting solubilized supernatant was purified by various column chromatography such as octylamino sepharose column chromatography, anion exchange column chromatography, and hydroxyapatite column chromatography, and (6) purified human-derived Examples include a method of immunizing a mammal with cytochrome P4503A4 as an antigen, (7) collecting blood from the mammal, and isolating and purifying the antibody of the present invention from the collected blood.

The above-mentioned "human-derived cytochrome P4503
The base sequence of the "gene encoding A4" is shown in SEQ ID NO: 5 in the sequence listing, and human-derived cytochrome P450
The gene encoding 3A4 is c derived from commercially available human hepatocytes.
It can be isolated from a DNA library using a conventional method such as PCR.

The promoter for expressing the gene encoding human-derived cytochrome P450 3A4 in yeast is not particularly limited as long as it is a promoter used in a normal yeast expression system. For example, yeast alcohol dehydrogenase. Gene promoter (hereinafter referred to as ADH promoter), glyceraldehyde-3phosphate dehydrogenase gene promoter (hereinafter referred to as G
Examples thereof include an APDH promoter), a promoter of a phosphoglycerate kinase gene (hereinafter referred to as a PGK promoter), and the like. In addition, ADH
The promoter is, for example, a yeast expression vector pAA having the yeast ADH1 promoter and the terminator.
H5 (available from Washington Research Foundation,
Ammerer et al., Methods in Enzymology, 101 (p.192-20
It can be prepared from 1)) by a conventional gene manipulation method. The yeast ADH1 promoter is the Washington Resea
Included in US Patent No. 299,733 of the rch Foundation and requires license from the right holder for industrial or commercial use in the United States. The yeast expression plasmid containing the above-mentioned promoter for expression in yeast and the above-mentioned gene having a nucleotide sequence encoding a human-derived P450 molecular species can be constructed by a conventional gene recombination method. For example, human-derived P4
A method of constructing by inserting a cDNA encoding 50 molecular species into the HindIII site of the yeast expression vector pAAH5N having the ADH promoter and terminator described in JP-A-2-211880 and the like can be mentioned.

Recombinant yeast expressing human-derived cytochrome P450 3A4 can be obtained by introducing the constructed yeast expression plasmid into yeast by a conventional method such as the protoplast method. Examples of the yeast strain used in the system of the present invention include Saccharomyces cerevisiae. Preferred is Saccharomyces cerevisiae AH22 strain (ATCC38626).

Extraction and purification of cytochrome P450 molecular species from recombinant yeast is described, for example, in J. Biochem., Vol 9
8. No.1. Can be performed according to the usual method described in p167-175 (1985). Specifically, the produced recombinant yeast is cultured, the obtained yeast is spheroplasted with a lytic enzyme or the like, and then ultrasonically disrupted. A yeast microsome fraction was prepared by centrifugation, solubilized with a detergent and sodium cholate, etc. (precipitation with ammonium sulfate, polyethylene glycol, etc., if necessary), and then solubilized. The residue is purified by various column chromatography such as octylamino sepharose column chromatography, anion exchange column chromatography and hydroxyapatite column chromatography. It is suitable to separate and purify with a high performance liquid chromatography device.

The antibody of the present invention is prepared by immunizing a mammal with human-derived cytochrome P4503A4 thus purified, collecting blood from the mammal, and separating the antibody of the present invention from the collected blood. -Can be performed by purification. Mouse, hamster,
For immunizing mammals such as guinea pigs, chickens, rats, rabbits and dogs, for example, J.ASSOC.OFF.ANAL.CHEM 70
(6) It is carried out by using an ordinary immunization method such as WH Newsome described in 1025-1027 (1987) etc. by, for example, one or more administrations of the antigen. For example, 7 to 3
Administration on day 0, especially 2 or 3 times at intervals of 12 to 16 days is preferred. The dose may be, for example, about 0.
As a guideline, use about 05 to 2 mg. The route of administration can be selected from subcutaneous administration, intradermal administration, intraperitoneal administration, intravenous administration, intramuscular administration and the like, but injection which can be performed intravenously, intraperitoneally or subcutaneously is preferable. is there. Furthermore, a combination of subcutaneous injection and intraperitoneal injection is particularly preferable. In this case, the antigen is an appropriate buffer such as complete Freund's adjuvant (mixed with Aracel A. Bayol F. tuberculosis killed bacteria), RAS [MPL (Monophosphoryl Lipid
A) + TDM (Synthetic Trehalose Dicorynomycolate) + CWS (C
ell Wall Skeleton) Adjuvant system, sodium phosphate buffer containing one of the commonly used adjuvants such as aluminum hydroxide, physiological saline, etc., but depending on the route of administration and conditions, etc. In some cases, an adjuvant such as is not used. Here, the adjuvant means a substance that nonspecifically enhances an immune response to the antigen when administered together with the antigen. Then, after leaving the above mammals without treatment for 0.5 to 4 months, a small amount of serum of the mammals is sampled from an ear vein or the like to measure the antibody titer. When the antibody titer rises, the antigen is administered a suitable number of times depending on the situation. For example 100 μg to 1000 μg, especially 50 μg
Another dose is given at a dose of g to 500 μg of antigen. One or two months after the last administration, blood is collected from the immunized mammal by a conventional method, and the blood is subjected to, for example, centrifugation, precipitation by using ammonium sulfate or polyethylene glycol, gel filtration chromatography, Ion exchange chromatography,
By separating and purifying by a usual method such as chromatography such as affinity chromatography,
The antibody of the present invention can be obtained as a polyclonal antiserum. The serum may be treated at 56 ° C. for 30 minutes to inactivate the complement system.

Immunocompetent B cells are isolated from the immunized mammals described above, the immunocompetent B cells are fused with tumor cells capable of continuous cell division, and the resulting fusion product is isolated. , And, after selection, a hybridoma cell that produces the desired antibody is cloned, and the hybridoma cell is cultured in vitro or in vivo to produce a monoclonal antibody, whereby a human-derived cytochrome P4503A4 other than Antibodies of the invention having a high degree of specificity and affinity that do not substantially show cross-reactivity with other human-derived cytochrome P450 molecular species can also be produced.

The antibody of the present invention is human-derived cytochrome P4.
It is a novel antibody characterized by substantially not showing cross-reactivity to human-derived cytochrome molecular species other than 503A4. Here, "human-derived cytochrome P45
It does not substantially show cross-reactivity with other human-derived cytochrome P450 other than 03A4 ", and the target human-derived cytochrome P450 3A4 and a human-derived cytochrome P450 with a different molecular species are cross-reactive. It is meant that selective recognition is substantially possible such that the reactivity is less than about 1/4, preferably less than about 1/20, and more preferably less than 1/100. Here, the degree of cross-reactivity can be detected by, for example, human-derived cytochrome P4503A4 by the immunoblotting method described later, and when the substrate protein concentration is set to 1, other human-derived cytochrome molecular species are detected by the same method. If the incoming density is C, it is determined as 1 / C. Further, human-derived cytochrome P extracted and purified from yeast, which is a transformant expressing human-derived cytochrome P4503A4.
The 4503A4 Blood was collected from immunized Sakuka mammals as an antigen, the dilution of serum that is obtained by separation and purification from blood is 10 ^- cytochrome P also derived from humans in ⁴
It has the ability to recognize 450 molecular species.

The antibody of the present invention can be used by detecting the antibody of the present invention that has acted on human-derived cytochrome P450 3A4 or an antibody against the antibody, by means of a label possessed by these antibodies.
A method for immunologically detecting 3A4 can be mentioned. Specific examples include methods for analyzing human-derived cytochrome P4503A4 by immunoblotting, separation by immunoprecipitation, indirect competitive inhibition (ELISA), immunological staining of cells or tissues, and the like. it can. The analysis method is a simple and highly accurate analysis method that can be processed quickly. For example, it can be performed by the following method.

I. Immunoblotting method This is a method in which human-derived cytochrome P4503A4 present in a sample bound to a solid support is recognized by the antibody of the present invention (first antibody) and the antibody is detected. Nitrocellulose in the form of a membrane, sheet, filter or the like is generally used as a solid support for binding a sample, but the human-derived cytochrome P4503A4 antigen that has good sample adsorption and is present in the sample. There is no particular limitation as long as it does not lose the sex. When nitrocellulose is used, the binding of the sample to nitrocellulose involves spotting the solution on the nitrocellulose obtained by dissolving the sample in a suitable buffer such as phosphate buffered saline.
The amount of spots for quantification is preferably such that the amount of the antibody of the present invention (first antibody) with respect to human-derived cytochrome P4503A4, which is an antigen, becomes excessive.
Approximately 3 mm square is preferable. The nitrocellulose spotted in this way is incubated under suitable humidity conditions for about 1 minute to about 24 hours. After the incubation, in order to prevent non-specific adsorption to a site other than the spotted site, the solid support to which the sample is bound is not recognized by the antibody of the present invention (first antibody) as a high molecular weight carrier molecule, that is, the antibody of the present invention. By incubating at room temperature for about 20 minutes to about 24 hours with a solution containing a high molecular weight carrier molecule (serum albumin or skim milk of another animal such as goat or cow) which is not used in the production of (first antibody), The surface of the solid support is covered with high molecular weight carrier molecules. After the incubation, the obtained solid support material is thoroughly washed to remove the above-mentioned high molecular weight carrier molecules in a free state. The solid support material thus prepared is mixed with a preparation liquid containing the antibody of the present invention (first antibody), and then incubated with shaking for about 10 minutes to about 3 hours. The preparation containing the antibody of the present invention (first antibody) refers to a preparation which may exist in a solution such as distilled water, a buffer solution, or physiological saline in a free state of the antibody of the present invention (first antibody). Say. In this way, the human-derived cytochrome P450 3A4 present in the sample is recognized by the antibody of the present invention (first antibody). Next, a method for detecting the antibody will be described. The antibody of the present invention (first antibody) is, for example, an enzyme such as peroxidase, alkaline phosphatase, β-D-galactosidase, glucose oxidase, glucoamylase, carbonic anhydrase, acetylcholinesterase, lysozyme, malate dehydrogenase, glucose-6-phosphate dehydrogenase, etc. In the case of being labeled with, after the incubation, the free antibody of the present invention (first antibody) is removed by washing, and then the substrate of the above-mentioned labeling enzyme is allowed to act, and the reaction is measured by color development or the like. By doing so, the antibody of the present invention (first antibody) can be detected. For example, in the case of labeling with peroxidase, hydrogen peroxide is used as a substrate and diaminobenzidine or O- is used as a coloring reagent.
Combines with phenylenediamine to give a brown or yellow color. When labeled with glucose oxidase, for example, 2,2′-acid-di- (3
-Ethylbenzothiazoline-6-sulfonic acid (ABT
S) or the like is used. When a second antibody labeled with an enzyme or a radioisotope that recognizes and binds to the antibody of the present invention (first antibody) is used, the antibody of the present invention in a free state after incubation (the first antibody) ) Is removed by washing and then incubated with the second antibody.
Examples of the secondary antibody labeled with this enzyme or the like include peroxidase, alkaline phosphatase, β-D-galactosidase, glucose oxidase, glucoamylase, carbonic anhydrase, acetylcholinesterase, lysozyme, malate dehydrogenase, glucose-6-phosphate dehydrogenase, etc. An antibody to the first antibody (the antibody of the present invention) to which the enzyme of (1) is bound can be mentioned. As a specific example, when a rabbit antiserum is used as the first antibody (antibody of the present invention), an alkaline phosphatase-conjugated anti-rabbit immunoglobulin (IgG) goat immunoglobulin (IgG) is preferable as the second antibody. I can give you. The rabbit IgG and goat IgG are commercially available and can be easily obtained. For detection of the second antibody, the same method as in the case of the labeled antibody of the present invention (first antibody) can be mentioned.

II. Separation method by immunoprecipitation Human-derived cytochrome P4503A4 present in a sample is recognized by the antibody of the present invention (first antibody), and an immune complex consisting of the antibody and human-derived cytochrome P4503A4 is purified to obtain a human-derived cytochrome from the sample. Only cytochrome P4503A4 is separated, and the separated human-derived cytochrome P4503A4 is used for detection of human-derived cytochrome P4503A4 by methods such as gel electrophoresis, enzyme activity measurement, and immunoblotting. First, an immune complex is formed by mixing a sample and the antibody of the present invention (first antibody) against human-derived cytochrome P450 3A4 at, for example, about 1 to about 24 hours with stirring at 4 ° C. The mixing ratio of the sample to the antibody of the present invention (first antibody) at this time may be, for example, about 1: 8, and human-derived cytochrome P present in the sample.
It is increased or decreased by 4503A4. Next, a human-derived cytochrome P4503A which specifically binds to the antibody and binds to the antibody and the antibody in the formed immune complex
A secondary reagent capable of separating 4 from the solution is added, and the mixture is incubated to form a complex consisting of the immune complex and the secondary reagent, which is recovered. Here, examples of the secondary reagent include a bacterial cell wall protein that binds to an antibody such as protein A and protein G, or an anti-immunoglobulin antibody. In addition,
If these secondary reagents bound to an insoluble support material are used, the recovery of the complex consisting of the immune complex and the secondary reagent (centrifugation, washing, etc.) is extremely easy. Insoluble support materials have a very wide range of designs and can have very different shapes depending on the particular purpose for which they are intended. For example, beads, dishes, spheres, plates, small rods, cells, small bottles, small tubes,
Fiber, net, etc. can be mentioned. Specific examples include beads made of polysaccharides such as agarose (eg, sepharose, biogel, etc.) and transparent plastic materials such as microtiter plates made of polyvinyl chloride or polystyrene, spheres made of polystyrene and polystyrene latex, and tubes. Alternatively, a rod or the like can be used. Next, the recovered complex is subjected to a treatment such as a heat treatment to give human-derived cytochrome P45.
Release 03A4. Then, the human-derived cytochrome P4503A4 in a free state may be detected by a method such as gel electrophoresis, enzyme activity measurement, and immunoblotting.

III. Indirect competitive inhibition method (ELISA method) Basically, competition between human-derived cytochrome P4503A4, which is an antigen bound to a solid support, and human-derived cytochrome P4503A4 contained in a sample, for example, bound to a solid support. Human-derived cytochrome P, which is an antigen
It is based on competition with human-derived cytochrome P4503A4, which is the free antigen of the first antibody recognized by 4502A4 and the labeled second antibody. In this context, the binding of the antigen to the solid support can occur directly or via a spacer and / or a high molecular weight carrier molecule that is not recognized by the first antibody (ie the antibody of the invention). Here, the first antibody (that is, the antibody of the present invention)
High molecular weight carrier molecules that are not recognized by are those that are not used in the production of the first antibody. This is important when the antibody of the present invention is polyclonal. Solid supports used for direct or indirect binding of antigens include, for example, microtiter plate or test tube plastic surfaces, polystyrene, polypropylene, polyvinyl chloride, glass or plastic bead surfaces, filter paper, dextran, cellulose. Alternatively, the surface of strips of nitrocellulose or other similar material may be mentioned. Human-derived cytochrome P450, which is an antigen, is added to these solid supports.
3A4 directly or with spacer and / or first
For indirectly binding (hereinafter referred to as coating) via a high-molecular-weight carrier molecule that is not recognized by the antibody (the antibody of the present invention), for example, glutaraldehyde, cyanogen bromide, or the like is used as a solid substance by a conventional method. Activate the support material. The coating liquid used is, for example, about 10 mM containing 140 mM sodium chloride.
Examples of the buffer include mM phosphate buffer (pH = 7.4). As a coating condition, for example, the concentration of human-derived cytochrome P4503A4 as an antigen in the coating solution is preferably about 0.05 μg / ml to about 1 μg / ml. The coating time can be, for example, about 6 hours to 24 hours. As a specific example of the above, for example, a 96-well microtiter plate made of polystyrene can be used as the solid support material. The human-derived cytochrome P4503A4 that directly or indirectly binds to the solid support thus obtained is then the human-derived cytochrome P4503A4 that is the antigen to be detected contained in the sample and the first antibody (the antibody of the present invention). ) Is mixed with the test solution, and the mixture is incubated. The human-derived cytochrome P4503A4, which is the antigen to be detected, contained in the sample may be present in a free form at this time as a component such as an aqueous solution, physiological saline, a buffer solution or a biological sample. After incubation for about 10 minutes to about 2 hours, the mixture is incubated with a second antibody labeled with an enzyme or the like that recognizes and binds to the first antibody (the antibody of the present invention). Examples of the second antibody labeled with this enzyme or the like include, for example, peroxidase, alkaline phosphatase, β-
D-galactosidase, glucose oxidase, glucoamylase, carbonic anhydrase, acetylcholinesterase, lysozyme, malate dehydrogenase,
An antibody to the first antibody (the antibody of the present invention) to which an enzyme such as glucose-6-phosphate dehydrogenase is bound can be mentioned. As a specific example, when a rabbit antiserum is used as the first antibody (antibody of the present invention), as the second antibody, anti-rabbit immunoglobulin (IgG) and goat immunoglobulin (IgG) conjugated with peroxidase are preferred. be able to. The rabbit IgG and goat IgG are commercially available and can be easily obtained. When labeled with peroxidase, hydrogen peroxide is used as a substrate and diaminobenzidine or O-is used as a coloring reagent.
Combines with phenylenediamine to give a brown or yellow color. When labeled with glucose oxidase, for example, 2,2′-acid-di- (3-
Ethylbenzothiazoline-6-sulfonic acid (ABTS)
Etc. are used. The present invention also relates to human-derived cytochrome P4.
It includes a kit for immunological detection / analysis of 503A4.
The above test kit may contain, for example, the following components: (1) human-derived cytochrome P450 3A4 directly,
Alternatively, a solid support material indirectly bound through a spacer and / or a high molecular weight carrier molecule that is not recognized by the first antibody (the antibody of the present invention), (2) a reagent containing the antibody of the present invention, (3) against the antibody of the present invention A reagent containing a labeled antibody, that is, a reagent containing a second antibody labeled with an enzyme or the like that recognizes and binds to the first antibody (the antibody of the present invention). (4) Human-derived cytochrome P45
03A4 standardized solution, (5) buffer solution, (6) polypeptide that prevents non-specific adsorption and aggregate formation, additives such as surfactants, and (7) pipette, reaction vessel, calculation curve, etc. Good to include. The solid supports described above have a very wide range of designs and can have very different shapes depending on the particular purpose for which they are intended. For example, a plate, a ball, a plate, a small rod, a cell, a small bottle, a small tube, a fiber, a net and the like can be mentioned. As a specific example, a transparent plastic material such as a microtiter plate made of polyvinyl chloride or polystyrene, a small ball made of polystyrene and polystyrene latex, a tube or a rod can be used.

IV. Immunological Staining Method for Cells or Tissues A method for recognizing human-derived cytochrome P4503A4 present in fixed cells or tissue specimens by the antibody of the present invention (first antibody) and detecting the antibody. It is useful for investigating the abundance and the localized state in.
The cells or tissues to be examined are fixed, and a specimen that can be observed with an optical microscope or an electron microscope is prepared. Reagents used for fixing cells or tissues are suitable for observation under a microscope, and are human-derived cytochrome P45 that is an antigen.
There is no particular limitation as long as it does not abolish the ability of the antibody of the present invention to recognize 03A4, but 3.7% formalin solution, 100% methanol, 100% ethanol,
4% paraformaldehyde solution, 1% glutaraldehyde solution, etc. may be mentioned. Then, by incubating the fixed cell or tissue sample for about 30 minutes to about 24 hours at 4 ° C., the human-derived cytochrome P4503A4 present in the fixed cell or tissue sample is transferred to the antibody of the present invention (first antibody). To recognize. Next,
A method for detecting the antibody will be described. The antibody of the present invention (first antibody) is an enzyme such as peroxidase, alkaline phosphatase, β-D-galactosidase, glucose oxidase, glucoamylase, carbonic anhydrase, acetylcholinesterase, lysozyme, malate dehydrogenase, glucose-6-phosphate dehydrogenase, etc. If labeled with
After incubation, the antibody of the present invention in a free state (first
The antibody of the present invention (first antibody) can be detected by removing the antibody) by washing, then allowing the substrate of the above-mentioned labeling enzyme to act, and measuring the reaction by color development or the like. For example, when labeled with peroxidase, it combines with hydrogen peroxide as a substrate and diaminobenzidine or O-phenylenediamine as a coloring reagent to give a brown or yellow color. When labeled with glucose oxidase, for example, 2,2'-acid-di-
(3-ethylbenzothiazoline-6-sulfonic acid (AB
TS) or the like is used. When a second antibody labeled with an enzyme or the like that recognizes and binds to the antibody of the present invention (first antibody) is used, the free antibody of the present invention (first antibody) is washed after incubation. Removed by the second
Incubate with antibody. Examples of the secondary antibody labeled with this enzyme or the like include peroxidase, alkaline phosphatase, β-D-galactosidase, glucose oxidase, glucoamylase, carbonic anhydrase, acetylcholinesterase, lysozyme, malate dehydrogenase, glucose-6-phosphate dehydrogenase, etc. An antibody to the first antibody (the antibody of the present invention) to which the enzyme of (1) is bound can be mentioned. As a specific example, when a rabbit antiserum is used as the first antibody (antibody of the present invention), as the second antibody, anti-rabbit immunoglobulin (IgG) and goat immunoglobulin (IgG) conjugated with peroxidase are preferred. be able to. The rabbit IgG and goat IgG are commercially available and can be easily obtained. For detection of the second antibody, the same method as in the case of the labeled antibody of the present invention (first antibody) can be mentioned. Hereinafter, the present invention will be described with reference to examples, but it goes without saying that the present invention is not limited to the following examples.

[0019]

【Example】

Production Example 1 Acquisition of a gene having a nucleotide sequence encoding human-derived cytochrome P450 3A4 A commercially available human liver-derived cDNA library (Clontech
Human-derived cytochrome P described in SEQ ID NOs: 1 to 4
PCR using 450 gene cloning primers
Method for human-derived cytochrome P4503
A cDNA encoding A4 was obtained. The nucleotide sequence of the obtained cDNA and the test amino acid sequence are shown in SEQ ID NO: 5.

Production Example 2 Construction of yeast expression plasmid: p3A4 FIG. 1 shows a method for constructing a yeast expression plasmid of human-derived cytochrome P450 3A4. Using the primers shown in SEQ ID NOs: 1 to 4, the protein coding region of human-derived cytochrome P450 3A4 gene was divided into two fragments of about 0.6 kb and about 0.9 kb and amplified by PCR. The resulting about 0.6 kb fragment was cut with SacI and subcloned into the pUC118 vector. Then, it was cut with EcoRI, blunted, and introduced with an XbaI linker, and cut with XbaI and SacI to 0.9.
The kb fragment was incorporated and the two fragments were ligated. This plasmid was cleaved with SphI, blunted, and an XbaI fragment was excised from the one into which the XbaI linker had been introduced.
CANX (EcoRI site and HindIII site of the commercially available pUC19 vector were modified to NotI sites, respectively, and NotI prepared from pAAH5N was formed between NotI site and NotI site.
Xba of a vector incorporating the fragment, further blunting the HindIII site thereof, and introducing an XbaI linker)
It was inserted at the I site. This was cut out with NotI and inserted into NotA-treated pAAH5N in the same manner, and the yeast expression plasmid p3A of human-derived cytochrome P450 3A4 was inserted.
4 was built.

Production Example 3 Preparation of transformed yeast cells YPD medium (1% yeast extract, 2% polypeptone, 2%
Glucose) 1.0 ml with Saccharomyces cerevisiae A
The H22 strain was inoculated, shaken at 30 ° C. for 18 hours, and then collected by centrifugation (5000 × g, 10 minutes). The obtained bacterial cells were suspended in 1.0 ml of 0.2M LiC1 solution and then centrifuged again (5000Xg, 10 minutes) to give 2 pellets to the resulting pellet.
0 μl of 1M LiC1 solution, 30 μl of 70% polyethylene glycol 4000 solution, 10 μl of solution containing about 1.0 μg of human-derived cytochrome P450 yeast expression plasmid (p3A4) were added. After mixing this well, incubate at 30 ° C for 1 hour, then add 140μ
l of sterilized water was added and stirred. This solution was added to an SD synthetic medium plate (2.0% glucose, 0.67% nitrogen source amino acid-free (Nitrogen base w / o amino acids, manufactured by Difco), 20 μm.
g / ml histidine, 2.0% agar) and spread at 30 ° C for 3
After incubating for a day, transformed yeast cells carrying the above yeast expression plasmid were selected. In this way, a transformed yeast cell expressing human-derived cytochrome P450 3A4 in yeast was prepared.

Production Example 4 Quantification of Human-derived Cytochrome P4503A4 Expressed in Yeast Human-derived cytochrome P4 produced in Production Example 3
Culture medium of transformed yeast cells expressing 503A4 (S
D synthetic medium, cell concentration about 1.5 × 10 ⁷ cells / ml) 200
ml was collected, and the cells were suspended in 10 ml of 100 mM potassium phosphate buffer (pH 7.0), followed by centrifugation (5000 x
g, 10 minutes). The pellet obtained is newly added to 2.0 m.
It was suspended in 100 mM potassium phosphate buffer (pH 7.0) (1) and dispensed into two cuvettes in an amount of 1.0 ml each. After blowing carbon monoxide into the cuvette on the sample side, 5-10 mg of dithionite was added to both cuvettes, and after stirring, the difference spectrum of 400-500 nm was measured to determine the concentration of human-derived cytochrome P4503A4 present in yeast. It was calculated. The expression level of human-derived cytochrome P450 3A4 in the transformed yeast cells was at a level of about 10 ^{5 to} about 10 ⁶ molecules / cell.

Production Example 5 Preparation of Microsome Fraction from Transformed Yeast Cells Human-derived cytochrome P4 produced in Production Example 3
Culture medium of transformed yeast cells expressing 503A4 (S
D synthetic medium, cell concentration about 1.0 × 10 8 cells / ml) 3.8
1 was collected, and the obtained bacterial cells were mixed with 400 ml of buffer solution A (10
Suspended in mM Tris-HCl (pH 7.5), 2M sorbitol, 0.1 mM DTT, 0.2 mM EDTA), 160 mg zymolyase 100,000 (zymolyase100
T Wako Pure Chemical Industries, Ltd.) was added, and the mixture was incubated at 30 ° C. for 60 minutes. The spheroplasts obtained by centrifugation (5000 xg, 10 minutes) were suspended in 100 ml of buffer solution A and then centrifuged (5000 xg, 10 minutes). The same centrifugation operation was repeated once again to wash the spheroplasts, and then the spheroplasts were washed with 200 ml of the buffer solution (10
Suspend in mM Tris-HCl (pH7.5), 0.65M sorbitol, 0.1 mM DTT and sonicate (50
W, 5 minutes). The crushed material was centrifuged (9000 xg, 2
0 minutes) to obtain a supernatant fraction. This was further centrifuged (125,000 xg, 70 minutes) to collect the precipitate,
The microsome fraction was obtained by resuspending in 10 ml of 1M potassium phosphate buffer (pH 7.4).

Production Example 6 Purification of human-derived cytochrome P4503A4 from microsomal fraction Human-derived cytochrome P4503A obtained in Production Example 5
The microsome fraction containing 4 (about 300 mg) was added to 1 mM DT
T, 1 mM EDTA, 0.25 mM PMSF, 20% glycerol in 0.1 M potassium phosphate buffer (pH 7.
2. Diluted to 3 mg / ml with buffer solution B), sodium cholate was added dropwise to a final concentration of 0.6% and left at 4 ° C. for 30 minutes to solubilize human-derived cytochrome P4503A4. Centrifuge the solubilized solution (200000 xg, 30
Octylamino sepharose 4B equilibrated with buffer B containing 0.5% sodium cholate.
Pass through a column filled with 15 ml (Pharmacia),
Human-derived cytochrome P4503A4 was adsorbed on a carrier. The column was thoroughly washed with buffer solution B to remove non-adsorbed components, and then 0.2% polyoxyethylene nonylphenyl ether (manufactured by Kao, trade name Emulgen 91) was added to buffer solution B.
Human-derived cytochrome P45 in a buffer containing 1)
03A4 was eluted. The active fractions were collected, and 0.02 M Tris-acetate buffer solution (pH 7.2, containing 20% glycerol) was used.
It was dialyzed overnight against buffer C). Then, 0.4% polyoxyethylene nonyl phenyl ether (manufactured by Kao Corporation,
When it was applied to a DEAE-5PW (manufactured by Tosoh Corporation) HPLC column equilibrated with the buffer solution C containing the trade name Emulgen 911), human-derived cytochrome P450 3A4 was eluted in the non-adsorbed fraction. Subsequently, 0.2% polyoxyethylene nonylphenyl ether (Kao Corporation, trade name Emulgen 911), 0.2% sodium cholate, 20
It is applied to a hydroxyapatite (Koken Co.) HPLC column equilibrated with 0.01 M sodium phosphate buffer (pH 7.2 buffer D) containing 10% glycerol, and the column is thoroughly washed with buffer D for non-adsorption. After removing the portion, human-derived cytochrome P was subjected to a linear concentration gradient method of sodium phosphate.
4503A4 was eluted. Subsequently, the active fractions were collected and 2
0.01M phosphate buffer (pH 7.
2, subjected to a hydroxyapatite (manufactured by Bio-Rad) HPLC column equilibrated with buffer solution E), thoroughly washed with buffer solution E, 0.05% sodium cholate,
Human-derived cytochrome P4503A4 was eluted with a 0.35 M sodium phosphate buffer containing 20% glycerol, the active fractions were collected, and purified human-derived cytochrome P45 was collected.
03A4 was obtained.

Production Example 7 Mammary immunization step and step of obtaining antibody of the present invention Purified human-derived cytochrome P obtained in Production Example 6
4503A4 was dissolved in physiological saline to a concentration of 1 mg / ml. Add 2 ml of this aqueous solution from 42 ° C to 4
RAS [MPL (Monophosphor
yl Lipid A) + TDM (Synthetic Trehalose Dicorynomycola
te) + CWS (Cell Wall Skeleton) adjuvant system)
40 μl (Sigma) was added and mixed well. The resulting mixture was applied to New Zealand White rabbits (female, 1
(4 weeks old, average 2.4 kg) 1 ml of liquid was administered per bird. The breakdown was 100 μl each subcutaneously administered to 10 sites on the back. Then, after 3 weeks and 5 weeks, the first half amount was again administered in the same manner. During this period, a small amount of blood was sampled from the rabbit ear vein and the antibody titer was measured. Two
Since the antibody titer increased after the second administration, whole blood was collected from the carotid artery of the immunized test rabbit about 2 weeks after the second administration, and the obtained blood was put in a separapit tube (Sekisui Chemical Co., Ltd.), After incubating at 37 ° C. for 2 hours, centrifugation (3000 rpm, 20 min, room temperature) was performed and the supernatant was collected to obtain an antiserum. Furthermore, the obtained antiserum was 5
The complement system was inactivated by treatment at 6 ° C for 30 minutes. This was used as the (first) antibody in the following test.

Test Example 1 Analysis of human-derived cytochrome 3A4 by immunoblotting using the antibody of the present invention Human-derived cytochrome 3A4 obtained in Production Examples 1 to 6 and other humans obtained according to a similar method 9 types of derived cytochrome P450 molecular species (cytochrome P45
01A1, 1A2, 2A6, 2B6, 2C8, 2C9,
2C18, 2D6 and 2E1) were subjected to immunoblotting using the antibody of the present invention obtained in Production Example 7.
Human-derived cytochrome P450 1A1, 1A2, 2A
6, 2B6, 2C8, 2C9, 2C18, 2D6, 2E
0.5 to 1 pmol of each of 1 and 3A4 were electrophoresed on an SDS polyacrylamide gel (40 mA, 1 hour).
A nitrocellulose membrane was overlaid on this gel, and immersed in a transfer buffer solution (25 mM Tris, 192 mM glycine, 20% methanol) and treated with a BIO-RAD blotting device at 4 ° C, 20 mA for 15 hours. The migrated protein was transferred to a nitrocellulose membrane. The obtained nitrocellulose membrane was TBS + Tween20 solution (50 mM Tris-HCl (pH
7.5), 200 mM NaCl, 0.05% Tween20), then 3%
Incubate in TBS + Tween20 solution containing 1% gelatin for 40 minutes at 37 ℃, and then in TBS + containing 1% gelatin
The antibody of the present invention diluted 1000-fold with Tween20 solution and 37 ° C, 1
Allowed to react for hours. After the reaction, wash 4 times with TBS + Tween20 solution, then in 37% TBS + Tween20 solution containing 3% gelatin.
° C., for 20 minutes, then at TBS + Tween20 solution containing 1% gelatin, and 2500-fold diluted ^{1 2 5} I-labeled ProteinA (Amersham), 37 ° C., and allowed to react for 1 hour. After the reaction, the plate was washed 4 times with TBS + Tween20, dried in air, exposed for 15 hours on an imaging plate manufactured by Fuji Film Co., and detected by BAS2000 system manufactured by Fuji Film Co., Ltd. The antibody of the present invention specifically reacted with only 3A4 among the above 10 human-derived cytochrome P450s (see Table 1 and FIG. 2).

Comparative Example 1 Analysis of Human-derived Cytochrome P450 Molecular Species by Immunoblotting Using Comparative Example Antibodies When a commercially available rat antibody recognizing cytochrome P450 molecular species (comparative example antibody) is used, The same procedure as in Test Example 1 above was performed. The nitrocellulose membrane obtained as described above was incubated in a 4% Block Ace (Yukirushi Dairy Co., Ltd.) solution at room temperature for 1 hour, and then diluted 500-fold with a 0.4% Block Ace solution to give rat-derived cytochromes. Each antibody that recognizes P450 was reacted at room temperature for 1 hour. After the reaction, 0.1% Tween2
After washing three times with 0, 0.4% Block Ace solution, the mixture was reacted with alkaline phosphatase-labeled anti-goat IgG rabbit serum diluted 5000-fold with 0.4% Block Ace solution at room temperature for 1 hour. After the reaction, wash 3 times with 0.1% Tween20, 0.4% block ace solution, and then add AP solution (10 mM Tris-HCl (pH 9.6), 0.
Wash once with 1M NaCl, 5mM MgCl2) and then add to the same solution.
NBT (manufactured by Sigma) and BCIP (manufactured by Sigma) were added to a substrate solution for color development. Rat-derived cytochrome P
Table 1 shows the reaction cross-reactivity with each of the antibodies that recognize 450 molecular species. Rat-derived cytochrome P450 2B1
Antibodies that recognize human are 10 types of human-derived cytochrome P45.
Reacts strongly with 2 molecular species of 2A6 and 2C8 among 0
It also reacted with 3 molecular species of B6, 2C9, and 2D6. Antibodies that recognize rat-derived cytochrome P450 2C6 are 2
Reacts strongly with two molecular species of C8 and 2C9, 2A6 and 2C1
It also reacted with 3 molecular species of 8 and 2E1. Antibodies that recognize rat-derived cytochrome P450 2C11 are 2A6, 2
Reacted with 3 molecular species of C8 and 2C9. Antibodies that recognize rat-derived cytochrome P450 2C13 are 2C8, 2
Reacts strongly with 2 molecular species of C9, 2A6, 2C18, 2E
It also reacted with the three molecular species of 1. Rat-derived cytochrome P
The antibody that recognizes 4502E1 reacts strongly with 2E1,
It also reacted with 2A6. Rat-derived cytochrome P450
The antibody that recognizes 3A2 reacted strongly with 3A4. As described above, in the antibodies that recognize cytochrome P450 molecular species derived from different animal species, specific human-derived cytochrome P450
It did not react specifically with only the molecular species.

[0028]

[Table 1] 1) When ++ is defined as 100%, ++ indicates a reaction of about 25%, + indicates a reaction of about 5%, and no mark indicates a reaction of less than about 1%. 2) ND has not been tested.

Test Example 2 Analysis of Human-derived Cytochrome P450 3A4 by Indirect Competitive Inhibition Method Human-derived cytochrome P450 obtained in Production Example 6 was placed on a 96-well microtiter plate made of polystyrene.
Coating solution containing 3A4 at a concentration of 10 μg / ml (10 mM phosphate buffer solution containing sodium chloride at a concentration of 140 mg / l (NaH2 PO4 -Na2 HPO4, pH 7.4))
Was added at a rate of 0.1 ml / well and then incubated at 4 ° C. overnight. And after removing the coating liquid,
Microtiter plates coated with human-derived cytochrome P450 3A4 were washed 3 times by immersing them in 10 mM phosphate buffer (NaH2 PO4 -Na2 HPO4, pH 7.4) with the top side of the microtiter plate facing down. Moisture in the plate was removed by tapping gently on a paper towel. Next, a blocking solution (Block Ace, manufactured by Snow Brand Milk Products Co., Ltd.) was added to the microtiter plate at a rate of 0.1 ml / well, followed by incubation at room temperature for 4 hours. Then, the microtiter plate was again placed on a 10 mM phosphate buffer solution (NaH2 PO4 -Na2 HPO4, pH 7.) containing 0.05% (w / v) Tween20.
It wash | cleaned 3 times using 4). Next, the antibody (first antibody) obtained in Production Example 7 was treated with a blocking solution at 10 to 1
0 ^8-fold diluted, 0.1 ml in microtiter plates the
/ Well, and then incubated at room temperature for 1 hour. After removing the first antibody preparation, 0.05%
(w / v) Tween20 10 mM phosphate buffer (NaH
It was washed 3 times with 2 PO4 -Na2 HPO4, pH 7.4). Next, a second antibody obtained by diluting commercially available alkaline phosphatase-conjugated anti-rabbit immunoglobulin (IgG) goat immunoglobulin (IgG) (manufactured by Seikagaku Corporation) with blocking solution at a concentration of 4000 times. The prepared solution was added to the above microtiter plate at a rate of 0.1 ml / well, and then incubated at room temperature for 1 hour.
After removing the second antibody preparation, 0.05% (w / v) T
10 mM phosphate buffer containing ween 20 (NaH2 PO4
-Washed 3 times with Na2 HPO4, pH 7.4) and tapped on paper towel with the top side of the microtiter plate facing down to remove water in the plate. Next, using an alkaline phospha B-test Wako kit (manufactured by Wako Pure Chemical Industries, Ltd.), the reagent (p-nitrophenyl phosphate disodium salt) and 0.1 M carbonate buffer solution (pH 9.8) were added as described above. After adding 0.1 ml / well to each microtiter plate, the microtiter plate was incubated at room temperature for 3 times.
Incubated for 0 minutes. Then, the enzymatic reaction was stopped by adding 0.1 ml of 0.2 N sodium hydroxide solution, and the color development in the microtiter plate was measured by measuring the absorbance at 405 nm using a multi-scanning spectrophotometer (Dainippon Pharmaceutical Co., Ltd.). did. As a result, FIG.
The curve shown in was obtained.

[0030]

The present invention is directed to human-derived cytochrome P45.
Specific cytochrome P4 that recognizes 0 molecular species and is the target
An antibody that specifically recognizes only 50 molecular species is provided. The use of the antibody of the present invention has made it possible to accurately and easily quantify cytochrome P450 molecular species in vivo.

[Sequence list]

SEQ ID NO: 1 Sequence length: 32 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear sequence 1 AGTAAGGAATCTAGAAATGGCTCTCATCCCAG 32

SEQ ID NO: 2 Sequence length: 27 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear sequence 1 ACGAGCTCCAGATCGGACAGAGCTTTG 27

SEQ ID NO: 3 Sequence length: 27 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear sequence 1 CAAAGCTCTGTCCGATCTGGAGCTCGT 27

SEQ ID NO: 4 Sequence length: 33 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear sequence 1 CAAAGTAATTTGAGGTACCTGGTGTTCTCAGGC 33

SEQ ID NO: 5 Sequence length: 1512 Sequence type: Nucleic acid Number of strands: Double-stranded topology: Linear sequence 1 ATG GCT CTC ATC CCA GAC TTG GCC ATG GAA ACC TGG CTT CTC CTG 45 1 Met Ala Leu Ile Pro Asp Leu Ala Met Glu Thr Trp Leu Leu Leu 15 46 GCT GTC AGC CTG GTG CTC CTC TAT CTA TAT GGA ACC CAT TCA CAT 90 16 Ala Val Ser Leu Val Leu Leu Tyr Leu Tyr Gly Thr His Ser His 30 91 GGA CTT TTT AAG AAG CTT GGA ATT CCA GGG CCC ACA CCT CTG CCT 135 31 Gly Leu Phe Lys Lys Leu Gly Ile Pro Gly Pro Thr Pro Leu Pro 45 136 TTT TTG GGA AAT ATT TTG TCC TAC CAT AAG GGC TTT TGT ATG TTT 180 46 Phe Leu Gly Asn Ile Leu Ser Tyr His Lys Gly Phe Cys Met Phe 60 181 GAC ATG GAA TGT CAT AAA AAG TAT GGA AAA GTG TGG GGC TTT TAT 225 61 Asp Met Glu Cys His Lys Lys Tyr Gly Lys Val Trp Gly Phe Tyr 75 226 GAT GGT CAA CAG CCT GTG CTG GCT ATC ACA GAT CCT GAC ATG ATC 270 76 Asp Gly Gln Gln Pro Val Leu Ala Ile Thr Asp Pro Asp Met Ile 90 271 AAA ACA GTG CTA GTG AAA GAA TGT TAT TCT GTC TTC ACA AAC CGG 315 91 Lys Thr Val Leu Val Lys Glu Cys Tyr Ser Val Phe Thr Asn Arg 105 316 AGG CCT TTT GGT CCA GTG GGA TTT ATG AAA AGT GCC ATC TCT ATA 360 106 Arg Pro Phe Gly Pro Val Gly Phe Met Lys Ser Ala Ile Ser Ile 120 361 GCT GAG GAT GAA GAA TGG AAG AGA TTA CGA TCA TTG CTG TCT CCA 405 121 Ala Glu Asp Glu Glu Trp Lys Arg Leu Arg Ser Leu Leu Ser Pro 135 406 ACC TTC ACC AGT GGA AAA CTC AAG GAG ATG GTC CCT ATC ATT GCC 450 136 Thr Phe Thr Ser Gly Lys Leu Lys Glu Met Val Pro Ile Ile Ala 150 451 CAG TAT GGA GAT GTG TTG GTG AGA AAT CTG AGG CGG GAA GCA GAG 495 151 Gln Tyr Gly Asp Val Leu Val Arg Asn Leu Arg Arg Glu Ala Glu 165 496 ACA GGC AAG CCT GTC ACC TTG AAA GAC GTC TTT GGG GCC TAC AGC 540 166 Thr Gly Lys Pro Val Thr Leu Lys Asp Val Phe Gly Ala Tyr Ser 180 541 ATG GAT GTG ATC ACT AGC ACA TCA TTT GGA GTG AAC ATC GAC TCT 585 181 Met Asp Val Ile Thr Ser Thr Ser Phe Gly Val Asn Ile Asp Ser 195 586 CTC AAC AAT CCA CAA GAC CCC TTT GTG GAA AAC ACC AAG AAG CTT 630 196 Leu Asn Asn Pro Gln Asp Pro Phe V al Glu Asn Thr Lys Lys Leu 210 631 TTA AGA TTT GAT TTT TTG GAT CCA TTC TTT CTC TCA ATA ACA GTC 675 211 Leu Arg Phe Asp Phe Leu Asp Pro Phe Phe Leu Ser Ile Thr Val 225 676 TTT CCA TATT CTC ATC CCA ATT CTT GAA GTA TTA AAT ATC TGT GTG 720 226 Phe Pro Phe Leu Ile Pro Ile Leu Glu Val Leu Asn Ile Cys Val 240 721 TTT CCA AGA GAA GTT ACA AAT TTT TTA AGA AAA TCT GTA AAA AGG 765 241 Phe Pro Arg Glu Val Thr Asn Phe Leu Arg Lys Ser Val Lys Arg 255 766 ATG AAA GAA AGT CGC CTC GAA GAT ACA CAA AAG CAC CGA GTG GAT 810 256 Met Lys Glu Ser Arg Leu Glu Asp Thr Gln Lys His Arg Val Asp 270 811 TTC CTT CAG CTG ATG ATT GAC TCT CAG AAT TCA AAA GAA ACT GAG 855 271 Phe Leu Gln Leu Met Ile Asp Ser Gln Asn Ser Lys Glu Thr Glu 285 856 TCC CAC AAA GCT CTG TCC GAT CTG GAG CTC GTG GCC CAA TCA ATT 900 286 Ser His Lys Ala Leu Ser Asp Leu Glu Leu Val Ala Gln Ser Ile 300 901 ATC TTT ATT TTT GCT GGC TAT GAA ACC ACG AGC AGT GTT CTC TCC 945 301 Ile Phe Ile Phe Ala Gly Tyr Glu Thr Thr Ser Ser Val Leu Ser 315 946 TTC ATT ATGTAT GAA CTG GCC ACT CAC CCT GAT GTC CAG CAG AAA 990 316 Phe Ile Met Tyr Glu Leu Ala Thr His Pro Asp Val Gln Gln Lys 330 991 CTG CAG GAG GAA ATT GAT GCA GTT TTA CCC AAT AAG GCA CCA CCC 1035 331 Leu Gln Glu Glu Ile Asp Ala Val Leu Pro Asn Lys Ala Pro Pro 345 1036 ACC TAT GAT ACT GTG CTA CAG ATG GAG TAT CTT GAC ATG GTG GTG 1080 346 Thr Tyr Asp Thr Val Leu Gln Met Glu Tyr Leu Asp Met Val Val 360 1081 AAT GAA ACG CTC AGA TTA TTC CCA ATT GCT ATG AGA CTT GAG AGG 1125 361 Asn Glu Thr Leu Arg Leu Phe Pro Ile Ala Met Arg Leu Glu Arg 375 1126 GTC TGC AAA AAA GAT GTT GAG ATC AAT GGG ATG TTC ATT CCC AAA 1170 376 Val Cys Lys Lys Asp Val Glu Ile Asn Gly Met Phe Ile Pro Lys 390 1171 GGG TGG GTG GTG ATG ATT CCA AGC TAT GCT CTT CAC CGT GAC CCA 1215 391 Gly Trp Val Val Met Ile Pro Ser Tyr Ala Leu His Arg Asp Pro 405 1216 AAG TAC TGG ACA GAG CCT GAG AAG TTC CTC CCT GAA AGA TTC AGC 1260 406 Lys Tyr Trp Thr Glu Pro Glu Lys Phe Leu Pro Glu Arg Phe Ser 420 1261 AAG AAG AAC AAG GAC AAC ATA GAT CCT TAC ATA TAC ACA CCC TTT 1305 421 Lys Lys Asn Lys Asp Asn Ile Asp Pro Tyr Ile Tyr Thr Pro Phe 435 1306 GGA AGT GGA CCC AGA AAC TGC ATT GGC ATG AGG TTT GCT CTC ATG 1350 436 Gly Ser Gly Pro Arg Asn Cys Ile Gly Met Arg Phe Ala Leu Met 450 1351 AAC ATG AAA CTT GCT CTA ATC AGA GTC CTT CAG AAC TTC TCC TTC 1395 451 Asn Met Lys Leu Ala Leu Ile Arg Val Leu Gln Asn Phe Ser Phe 465 1396 AAA CCT TGT AAA GAA ACA CAG ATC CCC CTG AAA TTA AGC TTA GGA 1440 466 Lys Pro Cys Lys Glu Thr Gln Ile Pro Leu Lys Leu Ser Leu Gly 480 1441 GGA CTT CTT CAA CCA GAA AAA CCC GTT GTT CTA AAG GTT GAG TCA 1473 481 Gly Leu Leu Gln Pro Glu Lys Pro Val Val Leu Lys Val Glu Ser 491 1486 AGG GAT GGC ACC GTA AGT GGA GCC TGA 1512 496 Arg Asp Gly Thr Val Ser Gly Ala *** 504

[Brief description of drawings]

FIG. 1 is a diagram showing a method for constructing a yeast expression plasmid (p3A4) containing a human-derived cytochrome P450 3A4 gene.

FIG. 2 shows the cross-reactivity of the antibody of the present invention with human-derived cytochrome P450 molecular species. The arrow indicates a band showing a reaction with human-derived cytochrome P450 3A4. The other bands are human-derived cytochrome P45 generated during sample preparation (SDS treatment) for electrophoresis.
It is a band showing a reaction with a decomposition product of 03A4.

FIG. 3 is a graph showing the antibody titer of the antibody of the present invention that recognizes human-derived cytochrome P450 3A4. From the figure, blood was collected from a mammal immunized with human-derived cytochrome P4503A4 as an antigen, which was extracted and purified from yeast, which is a transformant expressing human-derived cytochrome P4503A4, and then separated and purified from the blood. serum dilutions obtained by 10 ^- even ⁴ is found to have sufficient ability to recognize the cytochrome P450 molecular species of human origin, it is understood that the present invention the antibody is a high titer.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification number Reference number within the agency FI Technical display location G01N 33/53 D (C12N 1/19 C12R 1: 865) (72) Inventor Koji Hayashi Takarazuka, Hyogo Prefecture 4-2-1 Takashi Ichi, Sumitomo Kagaku Kogyo Co., Ltd. (72) Inventor Yoshiyasu Yabuzaki 4-2-1 Takashi, Takarazuka-shi, Hyogo Sumitomo Kagaku Kogyo Co., Ltd.

Claims (2)

[Claims] 1. Blood is collected from a mammal immunized with human-derived cytochrome P4503A4 extracted and purified from yeast, which is a transformant expressing human-derived cytochrome P4503A4, and separated from the blood. -Other human-derived cytochrome P4 that can be obtained by purification
An antibody recognizing human-derived cytochrome P450 3A4, which does not substantially show cross-reactivity with 50 molecular species. 2. Blood is collected from a mammal immunized with human-derived cytochrome P4503A4 extracted and purified from yeast, which is a transformant expressing human-derived cytochrome P4503A4, and separated from the blood. and purified by dilution of the resulting serum is 10 ^{- 4} according to claim 1, wherein the human-derived antibodies recognizing cytochrome P4503A4 of also characterized by having the ability to recognize the cytochrome P450 molecular species derived from humans in.