JPH08259595A - Platelet anti-aggregation medicine, preventive for thrombus formation, and hemostatic agent - Google Patents

Abstract

PURPOSE: To obtain a new polypeptide comprising a tripeptide of alanine- histidine-lysine having blood platelet aggregation inhibiting properties in a low conc. and blood platelet aggregation properties in a high conc. and (the tripeptide)20 -alanine-leucine, useful as a medicine, a nutritional supplementary food. CONSTITUTION: This medicine comprises a tripeptide of alanine-histidine-lysine having blood platelet aggregation inhibiting properties in a low conc. and blood platelet aggregation properties in a high conc. and (the tripeptide)20 -alanine- leucine, and is useful as a medicine, a nutritional supplementary food, and also useful as an antithrombotic, a preventive for thrombus formation and a hemostatic agent, a nutritional supplementary food and for preservation of plasma or various kinds of bases for containers used for preserving plasma. The polypeptide is obtained by successively bounding protected amino acids to a carrier resin by using a peptide automatic synthetic device by a peptide solid-phase synthetic method using the carrier resin to synthesize a peptide chain, eliminating the peptide from the carrier resin, deprotecting and purifying the peptide by a reversed phase column.

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a substance exhibiting platelet anti-aggregation, prevention of thrombus formation and hemostatic action, and a drug having a function of anti-aggregation of platelets and prevention of thrombus formation and a hemostatic function using the same. , Dietary supplements, and usage as food.

[0002]

2. Description of the Related Art Many blood vessels are distributed in a living body such as a human being, and if these blood vessels are damaged or cracked at the time of a disaster, it is very dangerous for the living body unless the large bleeding can be stopped. In addition to these, there are various types of diseases in which bleeding cannot be stopped due to a decrease in blood platelets and fibrinogen, and various diseases in which bleeding is caused by decreased consumption of blood coagulation factors due to various infections, malignant tumors, vascular inflammation, etc. . On the other hand, the formation of a thrombus associated with blood coagulation due to the excessive action of the hemostatic mechanism has caused many diseases such as cerebral infarction and myocardial infarction. These are caused by the formation of blood clots in blood vessels in arteries and veins, which clog brain blood vessels and coronary arteries that carry oxygen and various nutrients to the brain and heart. That is, it is important that blood coagulation and thrombus formation and thrombolysis be well balanced, and in the case of hemostasis, thrombus is generated at the site of vascular damage to suppress bleeding, and usually there is an anticoagulant state where thrombus etc. do not occur, It is necessary to always maintain the blood flow promptly.

Until now, tranexamic acid, epsilon aminocaproic acid, organ extract and some peptides having antiplasmin activity have been developed as hemostatic agents, and a local drug vitamin not directly related to blood coagulation mechanism. K, gelatin sponge, oxidized cellulose, etc. have been developed. These have the drawback that if they are used in excessive amounts, they tend to coagulate preferentially. On the other hand, the platelet aggregation reaction caused by activation of platelets is one of the main causes of thrombus formation. Therefore, as a substance having platelet anti-aggregating activity, for example, heparin and its oligosaccharides, various peptides and acyl derivatives thereof, urokinase and streptokinase, etc., other aspirin and its derivatives and ticlovidin, etc., and prostaglandins and The derivative etc. were developed and these have been used for the treatment and prevention of thrombus. However, some of these substances have problems in sustaining their effects, those that cannot be used orally,
The effect is drastically reduced by the production of antibodies, the platelet function itself is reduced due to excessive use, side effects such as bleeding tendencies occur, the effect varies depending on sex, and the detoxification and degradability in the living body is poor. Etc. Therefore, there has been a widespread demand for a safe substance which has good biodegradability and has both anti-aggregation and aggregation of platelets, that is, hemostasis depending on the concentration.

[0004]

DISCLOSURE OF THE INVENTION The present invention is an inexpensive and industrially useful platelet anti-aggregation which is safe for the human body.
It is intended to provide a substance for prevention of thrombus formation and hemostasis.

[0005]

DISCLOSURE OF THE INVENTION As a result of extensive research conducted by the present inventors, the tripeptide of alanine-histidine-lysine and (alanine-histidine-lysine) ₂₀ -alanine-
The present inventors have found that a substance containing a polypeptide consisting of leucine as an active ingredient has a platelet anti-aggregation action and a platelet aggregation action, and completed the present invention. The present invention will be described in more detail below.

That is, the present invention relates to an alanine-histidine-lysine tripeptide and (alanine-histidine-
The present invention provides a substance having a polypeptide comprising lysine) ₂₀ -alanine-leucine as an active ingredient and having antiplatelet aggregation, prevention of thrombus formation, and hemostatic action.

Alanine-histidine-lysine tripeptide and (alanine-histidine-lysine) according to the invention
_The polypeptide consisting of ₂₀ -alanine-leucine refers to a substance that can be synthesized chemically or recombinantly. The alanine-histidine-lysine tripeptide can also be procured as a natural product. The alanine-histidine-lysine tripeptide of the present invention exhibits a platelet anti-aggregating effect and a thrombus formation preventing action, and has a repeating structure thereof (alanine-histidine-lysine) ₂₀ -alanine-
A polypeptide consisting of leucine exhibits a platelet anti-aggregating effect and a thrombus formation preventing effect at a low concentration. On the other hand, the hemostatic effect was remarkable at a high concentration of (alanine-histidine-lysine) ₂₀ -alanine-leucine.

Alanine-histidine-lysine tripeptide is an antioxidant peptide whose sequence is found in many proteins such as egg white, is useful as a functional food material, and has a repeating structure (alanine- A polypeptide consisting of histidine-lysine) ₂₀ -alanine-leucine is also a substance with extremely high safety, which has been confirmed to be decomposed by plasma factor Xa and the like.
In addition, the high-concentration platelet aggregation action is also effective as an adjunct to hemostasis in an emergency. Furthermore, since it can be prepared chemically as a raw material or by gene recombination, it is a substance that can be produced in a large amount with a certain quality and can be further purified to a high degree of purity.

Polypeptide consisting of alanine-histidine-lysine tripeptide and (alanine-histidine-lysine) ₂₀ -alanine-leucine, which is used as an active ingredient of the platelet anti-aggregating agent, thrombosis preventing agent and hemostatic agent of the present invention. Among them, alanine-histidine-lysine tripeptide is already known to have activity such as antioxidative action on lipids, etc., but its content is extremely low, and antiplatelet action on platelets and prevention of thrombus formation. And it is not known at all to show a hemostatic effect.

The alanine-histidine-lysine tripeptide and the polypeptide consisting of (alanine-histidine-lysine) ₂₀ -alanine-leucine, which are the active ingredients of the platelet anti-aggregation, anti-thrombogenic agent and hemostatic agent of the present invention, are In use, it may be used in combination with other antiplatelet antiplatelet agent, antithrombotic agent and hemostatic agent.

A polypeptide consisting of alanine-histidine-lysine tripeptide and (alanine-histidine-lysine) ₂₀ -alanine-leucine can be produced by chemical synthesis and gene recombination. By any of the above methods, these substances are separated and fractionated, or components other than the above substances from the product, such as enzymes, proteins,
It is desirable to use a product from which microorganisms and various ions have been removed.

When used as a prophylactic agent for platelet anti-aggregation and thrombus formation according to the present invention, the concentration of alanine-histidine-lysine tripeptide is in the range of 0.1% to 0.5%, (alanine-histidine-lysine) _20. -The concentration of the polypeptide consisting of alanine-leucine is from 0.005% to 0.0
The range of 01% is desirable. Further, when a polypeptide consisting of (alanine-histidine-lysine) ₂₀ -alanine-leucine is used as a hemostatic agent, it is preferably 0.01% or more. Structure- and concentration-dependent effects were observed for the anti-aggregating effect on platelets, the preventive effect on thrombus formation, and the hemostatic effect.

[0013]

It is known that most of the blood coagulation process occurs on the solid phase surface such as the platelet surface by several mechanisms, which triggers platelet aggregation, thrombus formation and hemostasis. The mechanism of action of the platelet anti-aggregating agent, antithrombotic agent, and hemostatic agent of the product of the present invention is not known, but the effect as a hemostatic agent is (alanine-histidine-lysine) ₂₀ -alanine-leucine polypeptide. Is bound to platelets and promotes aggregation, or acts as an inhibitor of the thrombolytic enzyme plasmin, and is expected to promote fibrin production. Alternatively, since this substance has the property of a basic polypeptide, it is considered that it binds to an acidic anticoagulant factor and promotes coagulation.

On the other hand, the platelet anti-aggregation and thrombosis-preventing actions of the alanine-histidine-lysine tripeptide and the polypeptide composed of (alanine-histidine-lysine) ₂₀ -alanine-leucine at low concentrations are involved in the blood coagulation process. Factors consisting of various proteins or enzymes that complement calcium ions that are involved in or that are involved in many blood coagulation processes express their actions through lysine residues, but the product of the present invention consists of basic amino acids. It inhibits blood coagulation by competitively blocking it by a substance, or antagonistically inhibits the action of high molecular weight kininogen having a site where histidine is extremely concentrated to suppress the subsequent blood coagulation process. Is expected to exist. From this, it is considered that the platelet anti-aggregating agent and the thrombus formation preventing agent of the present invention exert their effects.

Hereinafter, the present invention will be described in detail with reference to examples, but the present invention is described for the purpose of illustration only, and the present invention is not limited to these examples.
The abbreviations used in the following examples are IUPAC- for biochemical names.
IUB Commission (IUPAC-IUB Commission on Biochemical Nom
enclature) (Biochemistry, 11, 1726, 1972)
Obeyed. The following abbreviations mean the following nucleotide bases (G: guanosine, A: adenosine, T: thymidine, C:
Cytidine). The following abbreviations mean restriction endodeoxyribonuclease enzymes (BamH I, EcoR I, Avi II, Sc
a I, Sma I, NcoI; Boehringer Mannheim and Eco4
7 III, Bal I; Takara Shuzo). The following abbreviations mean polydeoxyribonucleotide synthase (T4 DNA ligase). The following abbreviations mean plasmids (pUC19 and pUC19
GEX-3X).

The following abbreviations mean the following amino acids (Al
a or A: alanine, His or H: histidine, Lys or K: lysine, Ile: isoleucine, Leu or L: leucine, Arg: arginine, Met: methionine). The following abbreviations mean side chain protected amino acids (Fmoc-Lys (Boc); N
α-9-fluorenylmethylcarbonyl-Nε-t-butyloxycarbonyl-L-lysine, Fmoc-His (Trt);
Nα-9-fluorenylmethylcarbonyl-Nim-trityloxycarbonyl-L-histidine, Fmoc-Ala; N
α-9-fluorenylmethylcarbonyl-L-alanine, Fmoc-Leu; Nα-9-fluorenylmethylcarbonyl-L-leucine). The following abbreviations mean reaction solvents and reaction reagents (DMF; N, N-dimethylformamide,
NMP; N-methyl-2-pyrrolidone, HOBt; N-
Hydroxybenzotriazole hydrate, DIPCI;
N, N'-diisopropylcarbodiimide, TFA; trifluoroacetic acid, EDT; 1,2-ethanedithiol,
EMS; ethyl methyl sulfide).

[0017]

Example 1 Preparation of Ala-His-Lys tripeptide and (Ala-His-Lys) ₂₀ -Ala-Leu polypeptide by gene recombination method

Method for preparing gene encoding (Ala-His-Lys) ₂₀ -Ala-Leu

(Ala-His-Lys) 5'-GATCCGTGCGCATAAAGCTCACAAGGCGCACAAG as a DNA chain encoding _5- Ala-Leu
GCACATAAGGCTCACAAAGCGCTCTAAG (AHK5 + strand) and its complementary DNA strand 5'-AATTCTTAGAGCGCTTTGTGAGCCTTATGTGC
CTTGTGCGCCTTGTGAGCTTTATGCGCACG (AHK5-chain) is a phosphoramidite method (Beaucage, SL and Caruthers,
MH, Tetrahedron Letters 22, 1959-1862, 1981) DNA synthesizer (Applied Biosystems 391 type)
Was used for chemical synthesis, and a fragment purified by a reverse phase column was obtained.

Plasmid pUC19 (Takara Shuzo, 2 micrograms) was treated with BamHI (10 units) and EcoRI (10 units) in 50 mM Tris-HCl buffer containing 100 mM sodium chloride, 10 mM magnesium chloride and 1 mM dithiothreitol. Digested in (pH7.5) for 2 hours at 37 ℃, and agarose gel electrophoresis from BamHI site of pUC19 to Eco
The fragment excised from the RI site was purified. Then AHK5 + chain and AH
Each K5-strand was heated at 95 ° C. for 5 minutes in 50 mM Tris-hydrochloric acid buffer (pH 7.4) containing 10 mM magnesium chloride at a concentration of 2 pmol / microliter, and then allowed to stand at room temperature for double-stranded DNA (AHK5-AL strand). And) are formed. 1 mM ATP, 10 mM dithiothreitol and 10
To 30 microliters of 50 mM Tris-HCl buffer (pH 7.4) containing mM magnesium chloride, 1 picomole of AHK5-Ala-Leu chain, 0.1 picomole of a fragment obtained by excising EcoR I site from BamH I site of pUC19 and T4 DNA ligase 350. A unit was added and reacted at 16 ° C. for 12 hours to be linked. The reaction mixture was used to transform Escherichia coli DH5 strain. Whether or not it is transformed is 100 mg /
Apply to LB agar medium containing 1 liter of ampicillin,
Selected as a colony showing ampicillin resistance, pUC19
Whether or not the target gene has been inserted from the BamHI site to the EcoR I site is confirmed by a restriction enzyme digestion test of the plasmid and a nucleotide sequencer (Hitachi SQ5500 type), and the target plasmid (pAHK5- AL)).

Subsequently, Avi II and Ec contained in the AHK5-AL chain
Using the o47 III and EcoR I sites, the (Ala-Hi
A gene was constructed in which only the part encoding s-Lys) ₅ was tandemly duplicated.

That is, 3 micrograms of pAHK5-AL was
II and EcoR I using 8 units and 6 units respectively, 100m
50 mM Tris-hydrochloric acid buffer solution (pH containing M sodium chloride, 10 mM magnesium chloride and 1 mM dithiothreitol)
Avi II-EcoRI containing pAHK5-AL to AHK5-AL chains by agarose electrophoresis after digestion for 2 hours at 37 ° C in 7.5).
The fragment was purified. On the other hand, 0.5 microgram of pAHK5-AL was used with 8 units and 6 units of Eco47 III and EcoRI, respectively, to obtain 50 mM sodium salt / 10 mM magnesium chloride / 1 mM.
The fragment was digested in dithiothreitol-containing 50 mM Tris-HCl buffer (pH 7.5) at 37 ° C. for 2 hours, and the fragment obtained by excision of pAHK5-AL from Eco47 III site to EcoR I site was purified by agarose electrophoresis. Avi containing AHK5-AL chain
One nanogram of II-EcoR I fragment and Eco47 III of pAHK5-AL
Using 2 nanograms of the fragment excised from the site to the EcoRI site, this was treated with T4 DNA ligase 35 in 50 mM Tris-HCl buffer (pH 7.4) containing 1 mM ATP, 10 mM dithiothreitol and 10 mM magnesium chloride.
0 unit was added and reacted at 16 ° C. for 12 hours. The reaction mixture was used to transform Escherichia coli DH5 strain. The transformed strain was spread on LB agar medium containing 100 mg / liter of ampicillin and selected as a colony showing ampicillin resistance. Whether or not the target gene had been inserted was determined by a plasmid restriction enzyme cleavage test and a nucleotide sequencer ( The sequence was confirmed by Hitachi, Ltd. SQ5500 type) to obtain a target plasmid (designated pAHK10-AL) containing a gene encoding (Ala-His-Lys) ₁₀ -Ala-Leu.

By repeating the above procedure for pAHK10-AL, only the gene portion encoding (Ala-His-Lys) ₁₀ was duplicated (Ala-His-Lys) ₂₀ -Ala-Le.
A plasmid pAHK20-AL containing the gene of u was obtained, and similarly, a plasmid pAHK40-AL containing the gene of (Ala-His-Lys) ₄₀ -Ala-Leu, and further (Ala-His-Lys) ₈₀ -Ala-.
A plasmid pAHK80-AL containing the Leu gene was obtained.

Next, in order to introduce a Met residue into the N-terminal of the gene encoding (Ala-His-Lys) ₂₀ -Ala-Leu, pAH
3 micrograms of K20-AL was digested with 10 units of Avi II and EcoR I in 50 mM Tris-HCl buffer (pH 7.5) containing 100 mM sodium chloride, 10 mM magnesium chloride and 1 mM dithiothreitol at 37 ° C. for 2 hours. Then, agarose gel electrophoresis was performed on pAHK20-AL (Ala-His-
Lys) _20- Ala-Leu gene-containing AviII-EcoRI fragment was purified. Next, 1 microgram of NcoI linker consisting of 5'-GCCATGGC sequence was added to 18 mM magnesium chloride, 5
50 mM imidazole-hydrochloric acid (pH, containing mM dithiothreitol and 6% polyethylene glycol 6,000)
In 6.3), 10 nmole ATP and 10 units of T4 polynucleotide kinase were used to react at 37 ° C. for 2 hours to phosphorylate the 5 ′ end of the Nco I linker. pAHK20-
Using Avi II-EcoR I fragment of AL and 5'-phosphorylated Nco I linker at 0.1 microgram respectively, 1 mM ATP, 1
350 units of T4 DNA ligase was added to 50 mM Tris-hydrochloric acid buffer (pH 7.4) containing 0 mM dithiothreitol and 10 mM magnesium chloride, reacted at 16 ° C. for 12 hours, and Met- (Ala-His-Lys) ₂₀ -Ala. A desired fragment containing the sequence encoding -Leu (designated as Met-AHK20-AL) was obtained. By performing the same treatment on pAHK40-AL and pAHK80-AL, Met-AHK40-AL and Met-A respectively
A gene fragment of HK80-AL was obtained.

Method for expressing polypeptide consisting of (Ala-His-Lys) ₂₀ -Ala-Leu

In order to express the polypeptide consisting of (Ala-His-Lys) ₂₀ -Ala-Leu in Escherichia coli, the expression plasmid pGEX-3X (Pharmacia LKB Biotechnology Co., Ltd.) was modified, and glutathione-S-of the plasmid was modified. A plasmid was prepared by excising the BalI site to the ScaI site in the transferase gene. That is, 2 micrograms of pGEX-3X was added to Bal I in a 20 mM Tris-hydrochloric acid buffer solution (pH 8.5) containing 7 mM magnesium chloride, 1 mM dithiothreitol and 0.01% bovine serum albumin.
Was used for 2 hours at 37 ° C. 65 ° C, 1
After inactivating BalI by heating for 0 minutes, 150 mM sodium chloride,
2 units of Sca I was added to 6 mM Tris-HCl buffer (pH 7.5) containing 6 mM magnesium chloride, 6 mM 2-mercaptoethanol and 0.01% bovine serum albumin, and the mixture was allowed to react at 37 ° C. for 30 minutes for partial decomposition. A fragment excised from the Bal I site to the Sca I site in the glutathione-S-transferase gene was purified by agarose electrophoresis. 0.5 microgram of this fragment was then used to add 1 mM ATP, 10 mM dithiothreitol and 10 mM dithiothreitol.
350 units of T4 DNA ligase was added in 50 mM Tris-hydrochloric acid buffer (pH 7.4) containing mM magnesium chloride, reacted at 16 ° C. for 12 hours, and Escherichia coli DH5 strain was transformed with the reaction solution. The target strain is LB containing 100 mg / liter of ampicillin.
Apply to agar medium, select as colonies showing ampicillin resistance, confirm the sequence with a plasmid restriction enzyme digestion test and nucleotide sequencer (Hitachi SQ5500 type), and use the desired expression plasmid pGEX-3XΔBS. Got

Next, Met- (Ala-His-Lys) ₂₀ -Ala-Leu
A Met-AHK20-AL fragment encoding pGEX-3XΔBS
-To insert at EcoR I site, 2.5 micrograms of pGEX-3XΔBS was used with 10 units each of Sma I and EcoR I,
Digested in 50 mM Tris-hydrochloric acid buffer solution (pH 7.5) containing 50 mM sodium chloride, 10 mM magnesium chloride and 1 mM dithiothreitol for 2 hours at 37 ° C., and agarose gel was used to analyze the Sma I-EcoR I site of pGEX-3XΔBS. The excised fragment was purified. 0.1 microgram of each of the purified fragment and the Met-AHK20-AL fragment was added to 1 mM ATP and 10 m.
T in 50 mM Tris-HCl buffer (pH 7.4) containing M dithiothreitol and 10 mM magnesium chloride.
350 units of 4 DNA ligase was added and reacted at 16 ° C. for 12 hours. Using the reaction mixture, E. coli Escherichia co
The li JM109 strain was transformed. The target strain was selected as a colony showing ampicillin resistance on LB agar medium containing 100 mg / liter of ampicillin, and the target gene was inserted in both directions by a plasmid restriction enzyme cleavage test and a nucleotide sequencer (Hitachi SQ5500 type). From the target plasmid pGEX.
-3XΔBS-Met-AHK20-AL was obtained.

Method for separating and purifying a polypeptide consisting of (Ala-His-Lys) ₂₀ -Ala-Leu

The JM109 strain carrying the plasmid pGEX-3XΔBS-Met-AHK20-AL was inoculated into 100 ml of LB medium containing 100 mg / liter of ampicillin,
The cells were cultured with shaking at 37 ° C., and when the absorbance at 650 nm reached 0.5, IPTG was added to a final concentration of 1 mM. After culturing for 3 hours, the cells were collected, and the cells were suspended in 10 ml of a buffer for cell disruption, PBS (pH 7.3) containing 2 mM EDTA and 1 mM dithiothreitol, and ultrasonically disrupted, followed by precipitation. collected. Precipitate 1% Triton X
The cells were washed with 20 ml of a cell disruption buffer containing -100, and then with 20 ml of a cell disruption buffer. After that, the precipitate was dissolved in 2 ml of a buffer solution for cell disruption containing 6 M guanidine-hydrochloric acid to remove insoluble matter by centrifugation, the supernatant was dialyzed against water, and the resulting precipitate was collected and freeze-dried. This gives 4.65 milligrams of (Ala-His-Ly
s) A fusion peptide containing _20- Ala-Leu was obtained.

Next, 4.65 mg of the fusion peptide was added to 7
Dissolve in 100 microliters of 0% formic acid, add 100 microliters of 5 mg of cyanogen bromide-containing 70% formic acid to the mixture, and allow to react at 22 ° C. for 20 hours in the dark.
(Ala-His-Lys) _20- Ala-Leu was released from the fusion peptide. After the reaction, 1.8 ml of distilled water was added and freeze-dried. The dried product was dissolved in 5 microliters of 50% formic acid, 4 ml of distilled water and 0.2 ml of 1M ammonium formate were added thereto, and the mixture was adsorbed on 2 ml of CM-cellulose equilibrated with 50 mM ammonium formate. The peptide of interest (Ala-His-Lys) ₂₀ -Ala-Leu was eluted with ammonium formate, followed by washing with 10 ml of 0.2M ammonium formate, followed by 20 ml of 1M ammonium formate. The eluted fraction was freeze-dried and then C18 reverse phase HPLC (Tosoh Corporation)
ODS120T, 4.6 × 250mm, 5-40% acetonitrile / 0.1
% TFA), further purified, 20% acetonitrile / 0.1%
Fractions eluting with TFA were collected and lyophilized to obtain 0.4 mg of purified (Ala-His-Lys) ₂₀ -Ala-Leu.
Amino acid composition analysis in 5.7M hydrochloric acid under reduced pressure at 110 ℃,
After reacting for 20 hours, it was carried out by an amino acid analyzer (Jeol JCL-300). As a result, the amino acid molar ratio was Ala21 (21) / His2.
0.2 (20) /Lys20.4 (20) /Leu1.1 (1) (Theoretical values are in parentheses)
Regarding the amino sequence, the sequence of (Ala-His-Lys) ₂₀ -Ala-Leu was determined by the Edman method using a protein primary structure analyzer (Model PPSQ-10 manufactured by Shimadzu Corp.).

Method for preparing Ala-His-Lys from fusion peptide

5.0 milligrams of (Ala-His-Lys) ₂₀
A fusion peptide containing -Ala-Leu was suspended in 50 mM Tris-hydrochloric acid buffer (pH 8.0), 1.7 mg of trypsin dissolved in 1 mM hydrochloric acid was added thereto, and the mixture was added at 25 ° C, 5 ° C.
Digested for hours. After heat treatment at 95 ° C for 10 minutes, C18
Reversed-phase chromatography (Tosoh ODS120T, 4.6 x 250 mm, 5%
Acetonitrile / 0.1% TFA), lyophilize,
0.5 mg of purified Ala-His-Lys was obtained. Amino acid composition analysis was performed in 5.7 M hydrochloric acid at 110 ° C. under reduced pressure for 2
After reacting for 0 hours, it was carried out by an amino acid analyzer (Jeol JCL-300). As a result, the amino acid molar ratio was Ala1.0 (1) /His1.0.
(1) /Lys1.0 (1) (theoretical values are in parentheses), and regarding amino sequences, Ala by Edman method using a protein primary structure analyzer (PPSQ-10 type manufactured by Shimadzu Corp.) -His-Lys sequence was determined.

[0033]

Example 2 Ala-His-Lys and (Ala-His-Lys) by chemical synthesis method
Preparation method of _20- Ala-Leu

The tripeptides Ala-His-Lys and (Ala-Hi
s-Lys) _20- Ala-Leu is synthesized by Advanced ChemTech
Using ACT MODEL 90 peptide synthesizer manufactured by K.K., using reagents and solvents manufactured by Kokusan Kagaku Co., Ltd., it was automatically synthesized by a synthesis program of Advanced Chem Tech. The condensation reaction of amino acids is Fm
oc method "Basics and experiments of peptide synthesis, Nobuo Izumiya et al. (199
1, Maruzen) ”under standard conditions.

Preparation Method of Tripeptide Ala-His-Lys by Chemical Synthesis

According to the synthesis program of Advanced Chemtech, 1.0 g of carrier resin having 0.66 mmol of Fmoc-Lys (Boc) bound thereto was placed in the reactor of the automatic synthesizer, and the following operations were carried out. (A) 10 ml of piperidine was added and the mixture was stirred for 2 minutes, the solution was discharged, 10 ml of piperidine was added again and stirred for 12 minutes, and the solution was discharged. (B) The carrier resin was washed 5 times with DMF to obtain a Lys (Boc) -bonded carrier resin. (C) Fmoc-H on this carrier resin
NMP solution containing 2.64 mmol of is (Trt) (HOBt of 0.6
12 ml (containing 0.8 mmol and DIPCI) and stirred for 45 minutes and the solution was drained. (D) 2 with NMP
Washed once. Thus Fmoc-His (Trt) -Lys (Boc)
Was synthesized on a carrier. Next, after performing the deprotection steps of (a) and (b) above, Fmoc-Ala is added in the step of (c) to perform a condensation reaction, and then the washing step of (d) is performed to (a).
Then, Ala-His (Trt) -Lys (Boc) was synthesized on the carrier resin to obtain 1.2 g of the carrier resin.

0.4 g of the carrier resin obtained was used, to which a deprotection solution (93% TFA, 1% EDT, 3% Anis) was added.
ol and 3% EMS) (5 ml), and the mixture was stirred at room temperature for 2 hours. The obtained carrier resin was filtered, 30 ml of diethyl ether was added, and the mixture was ice-cooled. The above solution was centrifuged at 3,000 rpm for 20 minutes in a centrifuge to obtain a precipitate. The precipitate was washed 5 times with diethyl ether, dried with an evaporator, redissolved in 1M acetic acid and then freeze-dried. This crude product was applied to a reverse phase column (Tosoh ODS
120T, 7.8 × 300 mm) was purified by HPLC with a linear concentration gradient using 0.1% TFA and 0-50% acetonitrile, lyophilized, and 60.5 mg of Ala-His-lys. Got As for the amino acid composition, after reacting in 5.7 M hydrochloric acid at 110 ° C. under reduced pressure for 20 hours and then using an amino acid analyzer (Jeol JCL-300), the amino acid molar ratio was Ala1.0 (1) /His1.1 ( It was 1) /Lys1.0 (1) (theoretical value in parentheses). Regarding the amino sequence,
The sequence of Ala-His-Lys was determined by the Edman method using a protein primary structure analyzer (PPSQ-10, manufactured by Shimadzu Corporation).

By chemical synthesis (Ala-His-Lys) ₂₀ -Ala
-How to prepare Leu

According to a synthesis program of Advanced Chemtech, 1.0 g of a carrier resin having 0.52 mmol of Fmoc-Leu bound thereto was placed in a reactor of an automatic synthesizer, and the following operation was performed. (A) 10 ml of piperidine was added and the mixture was stirred for 2 minutes, the solution was drained and piperidine 10 was added again.
After adding milliliter and stirring for 12 minutes, the solution was discharged. (B) The carrier resin was washed 5 times with DMF to obtain a carrier resin having Leu bound thereto. (C) Fmoc-Ala was added to this carrier resin.
12 ml of an NMP solution containing 64 mmol (containing 0.6 mmol of HOBt and 0.8 mmol of DIPCI) was added, stirred for 45 minutes, and the solution was discharged. (D) 2 with NMP
Washed once. Hereinafter, in the steps (c), (d), (a) and (b), Fmoc-Lys as an amino acid derivative in order.
The synthesis was repeated using (Boc), Fmoc-His (Trt) and Fmoc-Ala to finally obtain 3.6 g of a carrier resin having a protected peptide bound thereto. Using 1 gram of the obtained carrier resin,
To this, 15 ml of a deprotection solution (93% TFA, 1% EDT, 3% Anisol and 3% EMS) was added, and the mixture was stirred at room temperature for 2 hours. The carrier resin thus obtained was filtered, 90 ml of diethyl ether was added, and the mixture was ice-cooled. The above solution was centrifuged at 3,000 rpm for 20 minutes in a centrifuge to obtain a precipitate, which was washed 5 times with diethyl ether, dried by an evaporator, redissolved in 1M acetic acid, and freeze-dried. This crude product was applied to a reverse phase column (Tosoh ODS12
Purified with 0T, 7.8 × 300 mm, 0-50% acetonitrile / 0.1% TFA, and 405.5 mg of (Ala-
His-Lys) ₂₀ -Ala-Leu was obtained. The amino acid composition analysis was carried out in 5.7 M hydrochloric acid at 110 ° C. under reduced pressure for 20 hours and then carried out with an amino acid analyzer (Jeol JCL-300). As a result, Ala21 (21) /His20.2 (20) / Lys20. 4 (20) / Leu1.
It was 1 (1) (theoretical value in parentheses). Regarding the amino sequence, the sequence of (Ala-His-Lys) 20-Ala-Leu was determined by Edman method using a protein primary structure analyzer (Shimadzu PPSQ-10).

[0040]

Example 3 Method for measuring platelet anti-aggregation action and aggregation promotion action

Blood injection syringes containing 1 ml of 0.038% sodium heparin sodium saline solution (50 units / ml) were used for two types of rats (SD; Sprague-
Dawley and SHR; spontaneously hypertensive rats) were sampled with 9 ml of blood and mixed at 1,300 rpm,
The supernatant after centrifugation for 10 minutes and the plasma containing a large amount of platelets (platelet-rich plasma) were prepared, and the transmittance was 0% with a platelet aggregometer.
(Aggregation rate 100%). Next, add this plasma to 3,500
Supernatant after centrifugation at rpm for 10 minutes, that is, plasma containing platelets in a relatively low concentration (platelet-poor plasma) was prepared, and the transmittance was set to 100% (aggregation rate 0%) using a platelet aggregometer, and these were controlled. And Next, in 180 microliters of platelet-rich plasma, a polypeptide consisting of Ala-His-Lys tripeptide or (Ala-His-Lys) ₂₀ -Ala-Leu was dissolved in phosphate buffered saline, and 20 microliters (final The concentration was adjusted to 0.1% to 0.001%), and after reacting for about 1 minute, collagen was used in the blood system of SD rat (final concentration 0.35 microgram as an inducer to coagulate platelets while stirring). / Ml), ADP (adenosine 5'-diphosphate) (final concentration of 0.
25 micromol / liter) was added and mixed, and then the transmittance was measured with a platelet aggregometer. The platelet aggregation inhibition rate (platelet anti-aggregation ability) was calculated from (control aggregation rate-sample aggregation rate) x 100 / control aggregation rate. Regarding the ability to promote platelet aggregation, which is a measure of the hemostatic effect, platelets can be formed into a spiral by stirring for 1 minute without adding an inducer (collagen or ADP) to the same system as the method for measuring anti-aggregation ability described above. It was judged by the size of the aggregate. Table 1 shows the results of platelet anti-aggregation action and platelet aggregation promotion action.

[0042]

[Table 1] When platelet-rich plasma of SD rat is used and collagen is used as the inducer, tripeptide of Ala-His-Lys is 0.1%.
The addition of the compound showed a moderate platelet anti-aggregation effect. (Ala-H
is-Lys) _20- Ala-Leu, 0.001% showed a weak platelet anti-aggregation effect on platelets, 0.002% a moderate platelet anti-aggregation effect, and 0.005% a strong platelet anti-aggregation effect. It showed an anti-aggregation effect. When ADP was used as the inducer, they showed weak platelet anti-aggregation action. further,
(Ala-His-Lys) ₂₀ -Ala-Leu has a concentration of 0.01%.
And 0.1% showed a strong platelet aggregation promoting action without adding an inducing substance and produced aggregates.

[0043]

INDUSTRIAL APPLICABILITY The anti-aggregation property and the aggregation-promoting property on platelets are very important because they can prevent thrombosis and hemostasis, respectively. Various anticoagulant, antithrombotic agents and hemostatic agents have been developed so far, but safer substances are required from the viewpoint of side effects and degradability. The polypeptide consisting of the alanine-histidine-lysine tripeptide and (alanine-histidine-lysine) ₂₀ -alanine-leucine of the present invention has two contradictory actions of platelet anti-aggregation action and aggregation action. The effect is concentration and repeat structure dependent. In the case of an alanine-histidine-lysine tripeptide, this peptide motif has a platelet anti-aggregating action, and is considered to have a stronger anti-aggregating action at a higher concentration, and moreover, its action increases when its repeating structure increases. May be amplified. On the other hand, it is considered that, when the number of these repeating structures increases, the contradictory platelet aggregation actions increase as the concentration increases. The peptide of the present invention can be freely adjusted in chain length and synthesized by chemical synthesis or gene recombination, and can be produced in large quantities and stably supplied. Further, since it is decomposed by an enzyme in the living body, such as factor Xa which is a blood coagulation factor, it is safe because it has no residue. Furthermore, unlike conventional substances,
Drugs such as prophylactic and therapeutic agents that have both platelet anti-aggregation and aggregation promoting or hemostasis effects depending on the concentration,
It is a substance that can be used in various ways such as dietary supplements and foods, and is extremely useful in industry.

 ─────────────────────────────────────────────────── ─── Continuation of the front page (72) Inventor Junji Ichida Aomori City, Aomori City, Yatsu, Ashiya 202-4 Ashiya, Aomori Industrial Technology Development Center (72) Inventor Shinya Yamaguchi Aomori City, Aomori City, Yatsu Ashiya 202-4, Aomori Prefectural Industrial Technology Development Center (72) Inventor, Hitoshi Matsue Aomori City, Aomori Prefectural Yatsu Katsushi Ashiya 202-4, Aomori Prefectural Industrial Technology Development Center (72) Inventor Shigemitsu Kudo Aomori, Aomori Prefecture Large number Hamada 202 Tamagawa 202 Kanesa Co., Ltd. (72) Inventor Makoto Tanaka Large Aomori City Aomori Prefecture Hamada character Tamagawa 202 Kanesa Co., Ltd. (72) Inventor Takashi Imura Aomori City Aomori City Hamada Address No. 202, Kanesa Co., Ltd. (72) Inventor, Kanazawa Martial Arts, 5 Fuyucho, Hirosaki City, Aomori Prefecture Hirosaki University School of Medicine

Claims (2)

[Claims] 1. A polypeptide comprising alanine-histidine-lysine tripeptide and (alanine-histidine-lysine) ₂₀ -alanine-leucine, which has platelet anti-aggregation and platelet aggregation properties. 2. Pharmaceuticals, dietary supplements and foods containing the substance according to claim 1 as an active ingredient.