JPH08256777A - Translation enhancer sequence and its use - Google Patents

Abstract

PURPOSE: To obtain a translation enhancer DNA chain useful for highly manifesting an extraneous gene in a plant, existing in the 5' reader sequence of a ferredoxin bonding subunit possessed by tobacco. CONSTITUTION: This translation enhancer DNA chain is shown by a sequence ACTTCTCTCAATCCAACTTTTCT or a sequence ACTTCTCTCAATCCAACTTTTCTATGGCCATGGCA. The chain is inserted into the 5' side of a translation initiating point of a structural gene to manifest the structural gene in a high level. The DNA chain of the translation enhancer sequence can be obtained by chemical synthesis according to a method for nucleic acid synthesis and also by a method conventional in the field of gene engineering.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD BACKGROUND OF THE INVENTION This invention, tobacco (Nicotiana sylvestris) nucleotide sequence that activates the 5 'present in the leader sequence translation of ferredoxin-binding subunit as a, i.e. translation enhancer (Translational enhancer) Strands functioning as and their use.

[0002] In the expression process of the background art gene, stage of translation potential despite believed important for, it can not be said that understanding in comparison with the transfer control is sufficiently performed. The best studied of the regulation of translation in eukaryotes is animal ferritin and 5'-aminolevulinate synthase. Their roles are each related to the storage and utilization of iron. The mRNAs of these genes have an iron responsible element (IRE) in the untranslated region (EMBO J. 10 (1991) 1903-1909). Under iron starvation conditions, IRE-binding proteins bind to this sequence (IRE).
(J. Biol. Chem. 267 (1992) 24466-24470) and inhibits its translation (Proc. Natl. Acad. Sci. USA 84 (1987) 847.
8-8482).

In plants, the mRN of certain plant viruses
It is known that A is translated more efficiently than the mRNA of the host plant, and such a phenomenon is considered to be due to the structure of the 5'leader sequence of those mRNAs. For example, such phenomena are known for tobacco mosaic virus, alfalfa mosaic virus RNA4, bromomosaic virus RNA3, potato virus X, and tobacco etch virus (Annu. Rev. Plant Physio.
L. Plant Mol. Biol. 44 (1993) 985-994). In these examples, a translation enhancer sequence is present in the leader sequence, but the mechanism by which it is regulated is not clear. On the other hand, in the cells of the host plant, it is almost unknown whether the mRNA has a translation enhancer sequence.

On the other hand, the psaDb gene is Nicotiana sy.
Photosystem I complex of photosynthesis found in Lvestris (P
SI) is a nuclear-controlled gene encoding a subunit (Plant Mol. Biol. 22 (1993) 985-994), and the product, PSI-D subunit, is a soluble ferredoxin that is reduced by PSI. Are connected. recent years,
When the leader sequence of the Arabidopsis ferredoxin gene fedA was linked to a reporter gene and a transient assay was performed, it was reported that it had an effect of amplifying gene expression, but that amplification affects the translation process. It is not known whether or not (Plant J. 3 (1993)
161-174).

[0005]

SUMMARY OF THE INVENTION The present inventors have analyzed the expression pattern of a reporter gene in transgenic tobacco by the presence of an enhancer sequence having a common structure with the leader sequence of fedA in the leader sequence of the psaDb gene. Found out by doing.

Therefore, the present invention activates the expression of this structural gene when inserted 5'to the structural gene,
Its purpose is to provide a translation enhancer sequence. The present invention also provides a DNA comprising the above enhancer sequence.
Its purpose is to provide chains. A further object of the present invention is to provide a host transformed with the above DNA chain, and a method for highly expressing a structural gene using this host.

[0007] Specifically, the translation enhancer sequence according to the present invention is the sequence shown in SEQ ID NO: 1 or 2 and its equivalent sequence. The DNA chain according to the present invention comprises the above-mentioned translation enhancer, and more specifically, it is incorporated into a structural gene and a 5'leader site of the structural gene so as to enhance the expression efficiency of the structural gene. And a translation enhancer sequence described above. Further, the transformed host according to the present invention is one transformed with the above DNA chain. Furthermore, a method for highly expressing a structural gene according to the present invention is a method comprising culturing or cultivating the transformed host so that the structural gene can be expressed.

[0008]

Detailed Description of the Invention Translation Enhancer Sequence The translation enhancer sequence according to the present invention is shown in SEQ ID NO: 1 or SEQ ID NO: 2. This array is
By inserting into the 5 ′ side of the translation initiation point of the structural gene, the structural gene is expressed at a high level. That is, it has a property as a translation enhancer sequence. Therefore, it can be used to enhance the expression efficiency of structural genes, especially foreign genes.

When the sequence of SEQ ID NO: 1 is used, its leader sequence is not translated, but is translated from the start codon immediately thereafter. On the other hand, when the sequence of SEQ ID NO: 2 is used, 12 bases on the 3'side are translated into amino acids (Met-Ala-Met-Ala), and thus fusion with the target gene further on the 3'side is achieved. Become a protein.

The sequence according to the present invention also includes SEQ ID NO: 1
Alternatively, an equivalent sequence of the base sequence shown in SEQ ID NO: 2 is also included. Here, "the equivalent sequence" means SEQ ID NO: 1
Or the nucleotide sequence shown in 2 in which some bases have been inserted, substituted, or deleted, or added to both ends, and still retain their translation activation activity. I shall. Retaining the activity of translation activation in the equivalent sequence means that in the actual use mode utilizing the activity, almost the same use as the base sequence having all the sequences shown in SEQ ID NO: 1 or 2 is performed under the same conditions. It means that the activity is maintained to the extent possible. It is obvious that those skilled in the art can select and produce such an “equivalent sequence” by referring to the sequence shown in SEQ ID NO: 1 or 2 without any particular difficulty. The host cell in which the translation enhancer sequence according to the present invention is preferably used is a plant cell. Preferred examples thereof include plants of the Solanaceae family to which the tobacco isolated from the enhancer sequence according to the present invention belongs, for example, tomato,
Potatoes, eggplants, bell peppers, as well as useful plants of other families in which transformation has been reported, such as plant cells of chrysanthemum, cotton, soybean, rapeseed, rice, wheat, corn and the like.

According to the present invention, there is further provided a DNA strand comprising SEQ ID NO: 1 or 2 or an equivalent sequence thereof.

A specific form of the DNA strand according to the present invention may be, for example, a form in which the sequence of SEQ ID NO: 1 or 2 is inserted as a member of a plasmid or phage DNA. Further, it may be a form existing in a microorganism (particularly bacteria) or a phage particle or a plant in the form of being inserted into a plasmid or a phage or genomic DNA. Here, it goes without saying that the bacteria include Escherichia coli and Agrobacterium.

The preferred existence form of the DNA strand according to the present invention is a promoter, SEQ ID NO: 1 or 2 according to the present invention or its equivalent so that the structural gene for which a protein is to be expressed can be stably expressed in a plant. A sequence, a structural gene DNA chain, a translation stop codon, and a terminator are integrally bound to each other, which is present in a plant in a form of being inserted into the genome. Known promoters, translation stop codons, and terminators can be used in appropriate combination. Specific examples of those considered to be available include, for example, the cauliflower mosaic virus 35S promoter, the nopaline synthase promoter, the ribulose diphosphate carboxylase / oxygenase small subunit promoter, and the terminator. , Nopaline synthase terminator, octopine synthase terminator and the like.

Acquisition of DNA Strand The sequence of SEQ ID NO: 1 or 2 according to the present invention can be obtained by chemically synthesizing the DNA strand according to the method of nucleic acid synthesis. The length of this DNA chain is 23 bp for the sequence of SEQ ID NO: 1, and 35 bp (SEQ ID NO: 2) for the sequence of SEQ ID NO: 2 to which the nucleotide sequence corresponding to the N-terminal 4 amino acids of psaDb is added. It can be synthesized using a DNA synthesizer without any particular difficulty. Furthermore, the above-mentioned DNA chain containing these sequences can be produced by a method commonly used in the field of genetic engineering.

Utilization / transformation of nucleotide sequences The sequences represented by SEQ ID NOS: 1 and 2 have uses as translation enhancer sequences. These arrays are
It is preferably used in the form of the DNA chain according to the present invention.

By transforming a host cell with such a DNA chain and culturing the host cell, a structural gene containing a foreign gene can be highly expressed.

[0017] Preferable examples of the host include cells of the above-mentioned types of plants, and more specific plant materials include leaf pieces, stem pieces, tuber pieces, protoplasts, callus, pollen, pollen tubes and the like.

As a method for introducing a foreign gene into a host, various methods that have been reported and established can be used. Preferred examples thereof include a method using a Ti plasmid of Agrobacterium as a vector and a method of introducing a gene into plant protoplasts by electroporation ('Plant ge
netic transformation and gene expression; a labora
tory manual ', Draper, J. et. al. eds., Blackwell
See Scientific Publication, 1988).

The expression product of the highly expressed gene may be isolated and purified from the culture by a method suitable for the expression product, when it is desired to isolate and utilize the gene itself. In addition, the presence or absence of the expression product causes growth or growth of the host cell,
Furthermore, when the properties of the cells are modified, by culturing such a host, or when the host is a dedifferentiated plant, cultivating the plant, the expression product of the target gene is expressed. Is highly expressed.

[0020]

The present invention will be described in more detail by the following examples, but the present invention is not limited to these examples. Example 1 : Acquisition of leader sequence of psaDb gene According to the method of Yamamoto et al. (Plant Mol. Biol. 17 (1991) 1251-1254), cDNA of psaDa gene was isolated. This c
Using a DNA fragment labeled with [α- ³² P] dCTP as a probe, a library of genomic DNA of Nicotiana sylvestris was screened. As a result, psaD
A genomic clone similar in structure to a was obtained. The structure of this gene was analyzed by the dideoxy method (Molecular Cloni
ng; A laboratory manual, 2nd ed. Sambrook et al. e
ds., Cold Spring Harbor Laboratory Press, 1989), and the transcription initiation point was determined by the primer extension method (Plant Mol. Biol. 22 (1993) 985-994).
It was confirmed that the obtained psaDa-like gene was the psaDb gene. The leader sequence was as shown in Figure 1A.

Example 2 : Construction of chimeric GUS gene A reporter gene, beta-glucuronidase (GU)
S) and a chimeric gene of the leader sequence of the mRNA of the psaDb gene, specifically the chimeric genes CaMV :: GUS, CaMV :: psaDb-G shown in FIG. 1B.
US 'and CaMV :: GUS' were constructed. Ca
MV :: GUS is EMBO J. 6 (1) as pBI121.
987) 3901-3907. CaMV :: psa
Db-GUS ' was prepared as follows. First, after annealing the following two types of oligonucleotides,
It was inserted between the XbaI and BamHI restriction enzyme cleavage sites of pBI221, and its nucleotide sequence was confirmed by sequencing. 5'-CTAGACTTCTCTCAATCCAACTTTTCTATGGCCATGGCAC-3 '5'-GATCGTGCCATGGCCATAGAAAAGTTGGATTGAGAGAAGT-3' The chimeric gene created in this way is the restriction enzyme Eco.
CaMV :: psaDb-GU was excised with RI and HindIII and treated with a combination of the same enzymes to treat the plasmid lacking promoter pBI101 as a derivative plasmid from pBI101 containing chimeric GUS.
S'was created. CaMV :: GUS ' was prepared by annealing two kinds of oligonucleotides shown below,
It was created by inserting into pBI101 in the same manner as 2). 5'-CTAGATGGCTATGGCTC-3 '5'-GATCGAGCCATAGCCAT-3'

Here, the leader sequence of psaDb mRNA is a DNA chain consisting of an untranslated sequence of 23 bases, and there is a sequence capable of forming two palindromic sequences near the translation initiation point. Chimeric gene C
aMV :: psaDb-GUS 'is a sequence in which CaMV :: GUS is added at the same time to the 23-base sequence and the base sequences corresponding to the four N-terminal amino acids. However, it was also considered that the extra amino acid sequence affects the specific activity and stability of the enzyme.
CaMV :: GUS 'was created lacking the leader sequence of p. This control plasmid CaMV :: GUS '
And CaMV :: psaDb-GUS ', the amino acid sequences are the same, but the translation initiation AT
The 6th and 12th bases from G have changed.
As a result, the proteins encoded by the two chimeric genes were the same, but the palindromic sequence predicted near the translation start site was disrupted in CaMV :: GUS '(the position indicated by the arrow in Fig. 1C). ).

Example 3 : Transformation of tobacco and measurement of GUS activity The binary vector having the chimeric GUS gene obtained in Example 2 was introduced into Agrobacterium LBA4404. Next, tobacco (Nicotiana taba
cum cv Petit Havana SR1) was transformed into a leaf disk (Plant molecular biology manual (Gelvin, S.
B. et. Al. (1988) pp. A5 / 1-A5 / 9, Kluwer Academic P
ublishers, Dordrecht). The plants were cultivated at 25 ° C. for 24 hours photoperiod. The redifferentiated transformant (M0 generation) was grown in a culture vessel (Sigma Co .; Magenta GA-7). After that, it is harvested, frozen in liquid nitrogen, crushed,
It was stored in a freezer kept at -80 ° C. Part of it is G
For US activity measurement (EMBO J.6 (1987) 3901-3907),
A portion was used for RNA extraction. The amount of protein was measured according to the method of Bradford, and the GUS activity was converted per amount of protein (Anal. Biochem. 72 (1976) 248-25.
Four). The result was as shown in FIG.

As is clear from FIG. 2, G in the steady state
When the US activity was measured for each tobacco individual into which each chimeric gene was introduced, control plants (CaMV :: G
PsaDb compared to US and CaMV :: GUS ')
With the sequence of (CaMV :: psaDb-GU
In S ') much higher GUS activity was detected.

Example 4 : RNA analysis RNA was extracted from the powder sample obtained as described above by the AGPC method (Anal. Biochem. 162 (1987) 156-159),
Phenol / chloroform extraction 3 times, LiCl
By selectively precipitating high molecular weight RNA with
The NA fraction was obtained. GUS gene-specific primer (5 '
-GTCGAGTTTTTTGATTTCACGGGTTGGGGTTTCTA-3 ') was labeled with ³² P at the 5'end and subjected to primer extension analysis (Plant Mol. Biol. 22 (1993) 985-994).
The product was electrophoresed on a 6% polyacrylamide gel containing 8M urea, and its autoradiography was performed using Fujix BA.
S2000 Image Analyzer (Fuji Photo Inc, Japa
n) was analyzed.

The increase in GUS activity found in Example 3 was
In addition to the increase in translational activity, the mechanism is considered to be that the cis factor that increases transcriptional activity is in its leader sequence and that the transcript is stabilized. Therefore, first, the amount of mRNA of each chimeric gene in the steady state was determined by the above primer extension. The result is shown in Figure 3.
Was as shown in.

As is apparent from FIG. 3, the size of the extension product differs depending on the structure of the chimeric gene, but specific bands were detected except in the non-transformant (SR1).

Next, for each transformant, GUS activity and m
By examining the ratio of RNA, G per mRNA
US translation efficiency was sought. The result was as shown in FIG.

As shown in FIG. 4, surprisingly C
aMV :: psaDb-GUS 'is CaMV :: GU
It was found to be 14 times more efficient than S'on average. As described above, it was revealed that the 23-base leader sequence of psaDb or the palindromic sequence predicted near the translation start point significantly enhances the translation efficiency of GUS ′ mRNA. Also, CaMV :: GUS and Ca
Comparing MV :: GUS ', the latter showed GUS activity of 5 times or more on average. This means that 25 bases that are not translated into protein are followed by 12 bases that are translated (4
(Corresponding to amino acid) suggests that the stability of the protein following the 3'side, such as GUS, or the enzymatic activity is increased, or that two methionines in the four amino acids increase the translation efficiency ( Biochemistry 29 (199
0) 10562-10566, and Mol. Gen. Genet. 238 (1993).
59-64).

Example 5 : Recently, caspers and quails were Ar
5'of the ferredoxin gene (fedA) of abidopsis
An untranslated region increases gene expression in a transient assay using Arabidopsis seedlings (Pla
nt J. 3 (1993) 161-174). It is not clear whether this increase is due to its effect on the transcriptional stage or its effect on post-transcriptional processes. However, since it was imagined that this gene and the leader sequence of psaDb might enhance the translation efficiency of the reporter gene by a similar mechanism, both leader sequences were compared (Fig. 5). As a result, a common motif was detected at two positions, and it was found that the combination of the two occupies more than half of the psaDb leader sequence. These two motifs are assigned to LM1 (TCTCAA) and LM2 (CAACTT, respectively).
T).

In order to examine whether or not these two sequences actually function as enhancer sequences for translation, a chimeric gene (CaMV :: psaDbLM-GUS ') was prepared by replacing these sequences with other sequences. . Specifically, the following two types of oligonucleotides were annealed and then inserted into pBI101 in the same manner as 2) to prepare. 5'-CTAGACTTCGAGACCTCACCAGGGTCTATGGCCATGGCAC-3 '5'-GATCGTGCCATGGCCATAGACCCTGGTGAGGTCTCGAAGT-3'

Then, in the same manner as in Example 3, a transformant was obtained and the GUS activity in this transformant was examined. The result was as shown in FIG. 7.

As is clear from FIG. 7, when the two motifs were replaced with other nucleotide sequences, the translation efficiency (GUS activity per mRNA) was reduced to 1/20. This clearly shows that both or one of these two motifs LM1 and LM2 is an essential component as a translation enhancer.

Example 6 Expression Mode In any of the chimeric genes analyzed, cotyledons, true leaves, and roots were used to examine the organ specificity of expression by the primer extension method. As a result, the same expression pattern was shown in all organs.

[0035]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 23 Sequence type: Nucleic acid Number of strands: Double-strand Topology: Linear Sequence type; Genomic DNA Origin: Organism name: Tobacco strain name: Nicotiana sylvestris Sequence: ACTTCTCTCA ATCCAACTTT TCT 23

SEQ ID NO: 2 Sequence length: 35 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type; Genomic DNA Origin: Organism name: Tobacco strain Name: Nicotiana sylvestris Sequence: ACTTCTCTCA ATCCAACTTT TCTATGGCCA TGGCA 35

[Brief description of drawings]

FIG. 1 is a diagram outlining a method for constructing a chimeric gene of a reporter gene, beta-glucuronidase (GUS), and a leader sequence of psaDb mRNA. (A)
Indicates the leader sequence of psaDb mRNA, +1
Indicates the transcription start point. Arrows indicate palindromic sequences. The predicted amino acid sequence is shown below the base sequence. (B) shows a schematic diagram of the chimeric GUS gene, and the arrow indicates the transcription start point. CaMV :: GUS is the plasmid pBI121 itself, which is the underlying genetic makeup. CaMV :: psaDb-GUS 'is CaM
It was prepared by inserting the psaDb leader sequence shown in (A) into the V :: GUS untranslated leader sequence. CaMV :: GUS ′ is CaMV :: psaDb-G except that it lacks the 23 bp leader sequence of psaDb and has a two base substitution as shown in (C).
Same as US '. (C) shows a nucleotide sequence downstream of the recognition sequence (TCTAGA) of the restriction enzyme XbaI, and GU
The positions are aligned and displayed at the N-terminus of the S protein. The underlined portion shows the inserted psaDb sequence, and the black squares show the positions of base substitutions that would disrupt the predicted palindromic sequence.

FIG. 2 is a diagram showing that GUS activity was increased in transgenic tobacco by inserting a leader sequence derived from psaDb. The activity was measured using mature tobacco leaves, and the activity is shown logarithmically in the figure.

[Fig. 3] mR in tobacco introduced with chimeric GUS gene
It is a figure showing NA level. Non-transformed tobacco (SR
1) and the total RNA prepared from the transformed tobacco were subjected to the primer extension analysis. The numbers indicate the same transformation line numbers as in Fig. 2, and the asterisks indicate m of the chimeric GUS gene.
The position of the band corresponding to RNA is shown. No specific signal was detected from the non-transformant (SR1).

FIG. 4 shows the ratio of GUS activity and GUS mRNA. (A) GUS activity and mRN of the transformed tobacco into which CaMV :: GUS was introduced was set to 1
The ratio of A was determined for each transformant. The numbers represent the same transformed tobacco numbers as in FIG. (B) shows the average value and standard error for each chimeric gene.

FIG. 5: N. sylvestris psaDb and A
FIG. 3 shows comparison of 5 ′ leader sequences of fedA gene of rabidopsis. The two conserved motifs LM-1 and LM-2 are underlined.

FIG. 6 is a diagram illustrating the replacement of the base sequences of the two leader sequences LM1 and LM2 with another sequence. In the chimeric gene CaMV :: psaDb-GUS ',
By replacing the base sequences of the two leader sequences LM1 and LM2 with another sequence (shaded sequence),
New chimeric gene CaMV :: psaDbLM-GU
S'was created.

FIG. 7 shows the ratio of GUS activity and mRNA as CaM
V :: psaDb-GUS 'or CaMV :: psa
It is a figure which shows the average value for every transformed tobacco which introduce | transduced DbLM-GUS ', and for every chimera.

Claims (7)

[Claims] 1. The sequence shown in SEQ ID NO: 1 and its equivalent sequence. 2. The sequence shown in SEQ ID NO: 2 and its equivalent sequence. 3. A DNA strand comprising the sequence according to claim 1 or 2. 4. The DNA according to claim 3, comprising a structural gene and the sequence according to claim 1 or 2 incorporated into the 5'leader site of the structural gene so as to enhance the expression efficiency of the structural gene. chain. 5. A host transformed with the DNA chain according to claim 4. 6. The host according to claim 5, wherein the host is a plant cell. 7. A method for highly expressing a foreign gene in a plant, which comprises culturing or cultivating the host according to claim 6 so that the structural gene can be expressed.