JPH0823966A - Bacterium cell excessive in amino acid secretion - Google Patents

Abstract

PURPOSE: To obtain a new bacterium cell with an incorporated DNA inversion gene, hypersecreting an amino acid, and further to provide a method for producing the cell, and a method for producing an amino acid from the cell.

CONSTITUTION: This bacterium cell is obtained by directly introducing a DNA inversion gene (especially cin gene of bacteriophage P1, gin gene of bacteriophage mu, hin gene of Salmonella typhimurium and pin gene of Escherichia coli) via a proper prophage or a vector having temperature sensitivity to a host cell (Escherichia coli) capable of producing the objective amino acid (phenylalanine, tyrosine or methionine) and transformed by a vector having pheA34 gene to enable the hypersecreting of the amino acid.

COPYRIGHT: (C)1996,JPO

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION The present invention relates generally to methods and materials for the active (extracellular) secretion of amino acids that are the expression products of bacterial cells.

Amino acid hypersecretion (hyp) from bacterial cells
Erscretion) is obviously important in large-scale production of amino acids in industrial processes. To date, no means has been reported for making cells that actively secrete large amounts of amino acids as compared to wild-type cells. Previous attempts to increase the extracellular presence of amino acids have focused on reducing amino acid uptake, for example by introducing mutations in the phenylalanine uptake metabolic pathway. However, such a technique results in only a slight increase in efflux by reducing the active uptake by the cells of amino acids already lost to the medium by diffusion. For the purposes of this application, hypersecretion means active secretion by the host cell of more amino acids than is passively diffused from the corresponding wild-type cell.

It is known in the art to secrete large amounts of amino acids as compared to the corresponding wild-type cells in order to promote the production of amino acids and mitigate the high intracellular levels of toxic and inhibitory effects of amino acids. There is a need for capable host cells. The present invention provides a novel bacterial cell capable of hypersecreting amino acids.

SUMMARY OF THE INVENTION The present invention provides novel bacterial cells capable of hypersecreting amino acids. In a preferred embodiment of the invention, the hypersecreted amino acid is tyrosine, methionine or phenylalanine and the bacterial cell is an E. coli cell.

In a preferred embodiment of the present invention, DNA
The inversion gene is introduced into cells capable of producing the amino acid of interest. D
NA inversion gene (or invert (invert)
(also referred to as "asses"), especially the cin gene of bacteriophage P1, the gin of bacteriophage mu.
Gene, Salmonella typhimurium
ll. typhimurium) and the E. coli pin gene. Any invertase is introduced directly into a host cell capable of producing the amino acid of interest to allow hypersecretion of the amino acid via a suitable prophage or vector.

In a preferred embodiment of the invention, in order to produce a lysogen of the target host cell,
The invertase gene is introduced into the host cell by the incorporation of an appropriate prophage. Most preferably, cin is introduced by introducing P1 prophage into a host cell.
The gene is incorporated, and the gin gene is incorporated by introducing mu prophage into the host cell.

In a preferred embodiment of the present invention, any invertase is transformed with a suitable transformation vector, which is preferably a plasmid having a temperature-sensitive copy number, most preferably plasmid pHSG415. Be introduced through.

In another aspect of the invention, E. coli cells capable of hypersecreting phenylalanine to provide higher levels of phenylalanine efflux resulting from transformation with invertase alone are pheA34.
It is further transformed with the plasmid containing the gene.

In a preferred embodiment of the invention, the invertase is transiently present or transiently active in the host bacterial cell, which is fixed in the hypersecretory mode.

In yet another aspect of the invention, a method of producing a bacterial cell capable of hypersecreting amino acids is disclosed, wherein the bacterial cell is transformed or transfected with a vector containing prophage or invertase. To be done. The transformed or transfected bacterial cells are then selected and spread on medium fed an E. coli strain that is unable to synthesize the hypersecreted amino acid. Bacterial cells that hypersecrete amino acids but no longer contain the vector are then isolated.

In a preferred embodiment of the above method, the bacterial cell is an E. coli cell, the hypersecreted amino acid is tyrosine, methionine or phenylalanine, and the invertase is transiently incorporated into the host cell.

In yet another aspect of the present invention there is provided a method of producing an amino acid, wherein bacterial cells capable of hypersecreting an amino acid are fermented in a suitable medium, and the amino acid which is then secreted is the medium. Taken from.

The above-mentioned hypersecretory phenotype is induced by incorporating a member of the resolvase family into bacterial cells in a manner essentially similar to the method described in Invertase. Resolved bases include Tn3, gamma delta, TN501, Tn21 and Tn171. This resorbase gene is derived from the Tn3 family of transposons and has substantial sequence homology with the Invertase family. Incorporation of the resorbase, or a vector consisting of the resorbase, into bacterial cells hypersecretes one or more amino acids.

Many additional aspects and advantages of the present invention will be apparent to those of ordinary skill in the art in view of the detailed description of the invention that follows.

DETAILED DESCRIPTION OF THE INVENTION The following detailed description relates to the production and use of bacterial cells capable of hypersecreting amino acids. Such cells may be transformed or transfected with Invertase, or Invertase and p in an appropriate vector.
It is the result of transformation or transfection with the heA34 gene. In general, cells with inverted uptake therein exhibit a 1% reversion to the wild-type secretion pattern and a 1% reinversion (ie reversion to hypersecretion mode) ratio. Invertase was transiently introduced into bacterial cells to remove or inactivate it in order to “lock” the target bacterial cells in hypersecretory mode in order to compensate for the aforementioned reversal to the wild-type secretion rate. Any cell that is also in hypersecretory mode is selected to be a cell of the invention.

Example 1 provides a means for incorporating P1 prophage into host bacterial cells. Example 2 is the same as Example 1.
Reported that the lysogens produced in E. coli hypersecrete amino acids. Example 3 relates to the incorporation of Invertase into a plasmid vector. Example 4 provides a means of incorporating plasmids containing invertase into bacterial cells and provides the results of tests to confirm the presence of a hypersecretory phenotype. Example 5 relates to phenotypic stabilization and Example 6 is further confirmation of the hypersecretory phenotype with quantitative data.

Example 1 The various DNA inversion genes (invertases) described above are involved in switching on the expression of the hypersecretory phenotype. For illustration, P1 prophage containing the cin gene of bacteriophage P1 was directly incorporated into E. coli cells. It will be apparent to those skilled in the art that other invertases can be incorporated into bacterial cells by using similar methods and that the P1 prophage exemplified here is for illustration only. Bacteriophage P
1, P1 cml cir strain was used for transfection into E. coli cells. The source of the cml cir strain of P1 is A Short Course In Bacte
Escherichia coli CSH128 strain described in Rial Genetics Strain Kit, which is Miller, A Short Course.
In Bacterial Genetics (Cold Spring Harbor Laboratory Press (Cold
Spring Harbor Laboratory
Press), 1992) as an accessory to Cold Spring Harbor Laboratory Press (Cold Sp)
ring Harbor Laboratory Pr
ess). The P1 strain produces temperature-sensitive lysogens, with about 30-35 ° C being most useful for lysogen formation. Prophage P1 was prepared from an E. coli lysogen strain called HW1107 for incorporation into the E. coli test strain HW1089 (ATCC Deposit No. 55371). However, for the preparation of P1 prophage, P1 cml cl
Any E. coli strain that is lysogenic to r can be used. HW1
107 cells were treated with 25 ml of LB broth medium (GIBCO / B at 32 ° C.) until the density reached 2 × 10 ⁸ cells / ml.
Growing with aeration in RL, Paisley, Scotland. The cells were then grown at 40 ° C for an additional 90 minutes. Next, culture
Cells were removed by centrifugation at pm for 10 minutes. Take 1 ml of the supernatant containing the P1 prophage suspension and add sterile 1.5
It was placed in a ml polypropylene test tube, and 10 μl of chloroform was added thereto. The suspension was stored at 4 ° C.

The suspension containing the promoter prophage was then added to 25 ml containing 2.5 mM CaCl _2.
Was aerated with HW1089 cells that had been grown until the culture density reached 2 × 10 ⁸ cells / ml with aeration. Then 100 μl HW
1089 cells were harvested and combined with 2 μl of the P1 phage suspension described above in a 10 ml polypropylene tube. The mixture was incubated in a 37 ° C. water bath for 20 minutes without agitation and spread on LB agar plates containing 10 μg / ml chloramphenicol. P1 prophage carries the chloramphenicol resistance marker. 32 ° C
After overnight incubation at 37 ° C., lysogens were isolated as chloramphenicol resistant colonies and tested for their ability to hypersecrete phenylalanine and tyrosine as described in Example 2.

Example 2 The above-mentioned lysogen of HW1089 cells was mixed with kanamycin.
Selected on LB agar plates. Pool colony
0.2% glucose, 100 μM CaCl ₂1
mM MgSO_Four, And 5 μg / ml vitamin B1
M9 minimal salt medium supplemented with (Roberts
s) et al., Studies of Biosynthes
is in E. coli, page 607, Carnegie Inn
Carnegie Inst, 1955)
Having cross-feeding
ng) Spread on an agar plate. These plates are about 10₇Fine
Cells / ml of E. coli HW1012 strain or E. coli HW10
It also contained 11 strains. The former strain is phenylara for growth
The latter strain has a mutation that requires supplementation with nin.
Larvae that require supplementation with tyrosine and phenylalanine for breeding
It contains mutations. These strains are referred to herein as examples.
Used for indicating. HW1011 and HW1012
For the cross-feeding experiment,
Many nutritional requirements that require phenylalanine and tyrosine
One of ordinary skill in the art will recognize that the body is available.

HW108 hypersecreting phenylalanine
The presence of 9 lysogens indicates that the HW1089 colonies around the HW
The presence of HW1089 lysogens that hypersecrete tyrosine and phenylalanine was determined by the presence of halos from HW1011 cells, as determined by the presence of halos due to the proliferation of 1012 cells. The presence of such a halo indicates that HW1011 or HW1012 cells have HW108
9 indicates that these cells proliferated due to the utilization of phenylalanine or tyrosine that was hypersecreted by the lysogen.

Wild-type (ie non-transformant) HW10
89 cells are the surrounding HW1012 cells or HW101
It does not secrete sufficient amounts of phenylalanine or tyrosine to support very limited growth of one cell.

About 1 HW1089 lysogen per plate
Diluted and spread to give 00 colonies. HW10
The 11 and HW1012 cell halos were clearly seen around the HW1089 lysogen, indicating that the lysogen hypersecreted phenylalanine and tyrosine. Example 3 shows that the same phenomenon is demonstrated when introducing Invertase into E. coli via a transformation vector.

Example 3 Next, the cin gene of bacteriophage P1 was incorporated into a plasmid vector for use in transformation of bacterial cells. Induction of hypersecretion was here demonstrated by reporting the results obtained by using the cin gene to induce hypersecretion of phenylalanine and tyrosine. However, one of ordinary skill in the art can readily recognize that any of the aforementioned families of Invertase function similarly to induce hypersecretion of phenylalanine, tyrosine and methionine in appropriate bacterial cells. Let's do it.

PLG338, which is a multicopy plasmid vector, was used as a vehicle for introducing the cin gene into an E. coli test strain.
Plasmid PLG338 is a stalker
r) et al., Gene, 18: 355-341 (1982).
Are disclosed in detail, the disclosure content of which is incorporated herein by reference. To produce a copy of the cin gene for incorporation into PLG338,
DNA consisting of the cin gene was PCR-amplified from bacteriophage P1 using primers: MB1176, 5 ′ CCGGAATTCGAGCATTATTGTGAAATCAC 3 ′ (SEQ ID NO: 1) and MB1177, 5 ′ CGCGGATCCCGAGTTCTCTTAAACCAAGGTTTA 3 ′ (SEQ ID NO: 2). The amplified cin gene DNA (the sequence of which is described in SEQ ID NO: 3) is composed of the coding region and promoter region of the gene. Amplification by PCR was performed using 0.2 ml MicroAmp ^™ reaction tubes (Perkin Elmer, Norwalk, Conn.), Where 100 ng of P1 DNA (1 μl); 5
μl of 10 nm / ml of each primer; 2 μl of each dA
TP, dGTP, dCTP, dTTP (10 mM each);
15 mM MgCl ₂ , 500 mM KCl ₂ , 100
10 μl buffer consisting of mM Tris (pH 8.3) and 0.01% gelatin; taq DNA polymerase (5 u / μl 0.5 μl, AmpriTak (Amp
litaq ^™ )); and distilled water was added to a final volume of 100 μl. Cap the test tube and use Perkin Elmer 9600 ^™ P
CR Thermal Cycler (Perkin Elmer (Perk
in Elmer)). After preheating at 94 ° C for 3 minutes, 25 cycles of denaturation at 94 ° C for 30 seconds, annealing at 50 ° C for 30 seconds, and extension at 72 ° C for 1 minute were performed for amplification. The reaction mixture was then stored at 4 ° C.

About 1 μg of the PCR-amplified fragment was digested with restriction enzyme E
Digested with coRI and BamHI to create cohesive ends with a single EcoRI and BamHI sites within the primer sequence. Also, approximately 1 μg of plasmid pLG338 was cleaved at a single EcoRI site and BamHI site. The next larger (approximately 7.1 kb) plasmid fragment was isolated by gel electrophoresis in low melting agar and prepared with the Prep-A-Gene ^™ kit (Bio-Rad, Richmond, Calif.). (R
ichmond)) according to the manufacturer's instructions. The PCR-amplified fragment was then treated with 50 mM Tris pH 7.8, 10 mM MgCl ₂ , 20 mM DT.
T, 1 mM ATP, 50 mg / ml BSA, and 400 units of DNA ligase (New England Biolabs,
The plasmid fragments were ligated in a 20 μl ligation mixture consisting of Beverly, Massachusetts. The resulting plasmid (designated PIF906) was introduced into E. coli and then examined for hypersecretory phenotype as described in Example 4.

Example 4 Bacterial cells which produce hypersecreted amino acids are the preferred host cells of the present invention. A specific bacterial cell line (ie E. coli HW1089 strain) was used to demonstrate phenylalanine and tyrosine hypersecretion. However, it will be apparent to those skilled in the art that other suitable bacterial cells can be used and that amino acids other than phenylalanine and tyrosine (particularly methionine) are also hypersecreted by the method of the invention.

The plasmid PI created as described above
F906 is a capacitance (capacitance)
e) Bio-Rad Gene Pulser (Bio-Rad Gene Pulse) set at 2.5 kv at 25 μF
r ^™ ) and a 200 ohm resistance set bio-rad pulse controller (Bio-Rad pulse c
E. coli H by electrophoresis using a
It was introduced into W87 strain. The cells were placed in a Bio-RadGen pulsar (Bio-RadGen) with a 0.2 cm gap.
e Pulser ^™ ) cuvette. HW87
The strain is Nelms, App. Enviro
n. Microbiol. , 58: 2592-2598.
(1992), the disclosures of which are incorporated herein by reference.

The transformed E. coli cells had an optical density of 6
Grow to 0.7 at 00 nm. Then 10,0
Collect cells by centrifugation at 00g for 5 minutes, then 30m
Washed in 1 of deionized distilled water. The cells were centrifuged again and resuspended in 200 μl deionized distilled water,
0 μl of cells were mixed with 2 μl of the binding mixture described above and 8 μl of deionized distilled water and placed in an electrophoresis cuvette. Single pulse the cuvette with 500 μl S
OC medium (GIBCO / BRL, Gaithersburg, MO) was added and mixed with the cell suspension. Cuvette contents 20 ml p
Transferred to vc tube and incubated at 30 ° C. for 30 minutes. The cells were then spread on the appropriate medium described above. Additional transformation procedures are known and available to those of skill in the art.

In order to increase the probability of identifying correctly synthesized PCR products, all positive transformants were pooled and the plasmid DNA was isolated from the Burnboy and Dolly (Bi).
rnboim, H .; C. and Doly, K .; ), N
ucleic Acids Res, 7: 1513-15
23 (1979). Then, the E. coli HW1089 strain (ATCC deposit no.
Isolated and pooled plasmid DNA was used to transform 5371) cells separately. HW1089
Strains show deficient uptake of phenylalanine and tyrosine.
Due to these deficiencies, they secrete less secreted phenylalanine and tyrosine, respectively, than their wild-type counterparts.

HW1089 positive transformants were again selected on LB agar plates containing kanamycin. Colonies were pooled, 0.2% glucose, 100 μM C
M9 minimal salt medium supplemented with aCl ₂ , 1 mM MgSO ₄ , and 5 μg / ml vitamin B1 (Roberts (R
Oberts) et al., Studies of Biosy
nthesis in E. coli, page 607, Carnegie Inst, 19
55) containing cross-feeding (cross-
spreading on an agar plate. These plates also contain E. coli HW1012 strain or E. coli HW101.
One strain contained about 10 ⁷ cells / ml. As mentioned above, the former strain has a mutation requiring complementation of phenylalanine for growth and the latter strain contains a mutation requiring complementation of tyrosine and phenylalanine for growth. Other suitable phenylalanine and / or tyrosine auxotrophs are available as cross-feeding cells.

HW108 hypersecreting phenylalanine
The presence of 9 cells indicates that HW1 around HW1089 colonies
The presence of HW1089 cells that oversecrete tyrosine and phenylalanine was determined by the presence of halos due to proliferation of 012 cells and the presence of HW1011 cells. The presence of such halos indicates that the HW1011 or HW1012 cells utilized phenylalanine and / or tyrosine hypersecreted by HW1089 cells, thus proliferating these cells.

Wild-type (ie non-transformant) HW10
89 cells are the surrounding HW1012 cells or HW101
It does not secrete sufficient amounts of phenylalanine or tyrosine to support very limited growth of one cell.

Transformed HW1089 cells were diluted and expanded to give approximately 100 colonies per plate. H identified as hypersecreting phenylalanine
W1089 cell colonies were purified again on M9 minimal medium plates without HW1011 and HW1012 cells,
Retested on cross-feeding plates as above. These cells continued to secrete high levels of phenylalanine, but consistently about 1% of the cells returned to wild type.
About 1% of this 1% reverted to the hypersecretory phenotype. This 1% conversion is the same as that observed with the switch mechanism regulated by the cin gene in the P1 prophage described above. This indicated that the cloned cin gene was involved by switching on (turning off in the case of conversion) the hypersecretory gene (probably by causing rearrangement of the DNA encoding the hypersecretory phenotype). .

Now that the hypersecretory cells have been successfully created and the mechanism by which the hypersecretory phenotype is switched on has been identified, the phenotype was altered as described in Example 5 to avoid reverting to the wild type secretion pattern. It was preferable to stabilize.

Example 5 Invertase is removed when cells are in hypersecretion mode H
Transient introduction of Invertase into W1089 is one means to stabilize cells transformed in the hypersecretory mode, which can eliminate the 1% conversion mentioned above. The same effect can be obtained by inactivating invertase.

The transient introduction of the cin gene was carried out using the plasmid pSC101. The derivative, Plasmid HSG415 (Hashimoto Goto (Hashimo
To-Gotoh), Gene, 16: 227-235.
(1981)) is stable only in E. coli cells at temperatures of 34 ° C or lower. When the temperature rises above 34 ° C., HSG415 becomes unable to replicate and is lost as the host cell divides. By transforming HW1089 cells with the plasmid HSG415 containing the cin gene, identifying the hypersecretory form, and raising the temperature above 34 ° C, at least some of the progeny of the original HW1089 cells were fixed in hypersecretory mode. Will

To do this, plasmid pLG33
The cin gene was introduced into the plasmid HSG415 by the method described above for the introduction of the cin gene into Escherichia coli 8. The method for cloning the cin gene into HSG415 is as follows.
It was almost the same as that described for the cloning of cin into pLG338. The plasmid HSG415 was cut at the EcoRI and BamHI sites within the plasmid. Largest produced by HSG415 (approximately 4.
8 kb) fragment was isolated and prepared beforehand with EcoRI site and B
It was ligated to the cin gene that had been cut at the amHI site. Ligation of the cin fragment to the HSG415 fragment and introduction of the product obtained in E. coli was done as described for pIF906. The resulting construct was named pIF907. Since HSG415 has an ampicillin resistance marker, positive transformants were identified on LB agar plates containing 100 μg / ml ampicillin. Pool the live colonies and isolate the plasmid DNA,
It was used to transform HW1089 cells as described above. These transformants were pooled again and the H
Spread on W1012 and HW1011 cross-feeding plates. The plates were incubated at 32 ° C. About 39% of the colonies are cross-fed (HW10
12 or HW1011) cells were identified as cross-feeding by the presence of halos.

One of the colonies identified as cross-feeding colonies was selected and purified on a cross-feeding plate. The colonies showed almost complete stability of the hypersecretory phenotype. This was unexpected as the colonies were grown at an acceptable temperature (32 ° C). However, by spreading cells from the selected colonies onto another LB plate, it was determined that this plasmid had already disappeared from the cells (ie the cells were no longer resistant to ampicillin). This was due to the fact that the plasmid was unstable, even at low temperatures, and host cells did not readily allow replication of copies of the cin gene. That is, the plasmid, which was in the hypersecretory mode, disappeared from some cells because it did not maintain replication at the same rate as the host cells. Since the plasmid disappeared, these cells were fixed in hypersecretory mode. These "fixed" hypersecretory cells were then tested to quantify phenylalanine production. The results are shown in Example 6.

Example 6 HW1089 cells fixed in the hypersecretory mode as described above were designated as CF1. These cells were further purified by streaking twice from single colonies on LB agar plates. Derivatives of hypersecretory HW1089 cells were also made. These cells (designated CF2) have pheA34
Plasmid pJN3 with allele
It was essentially the same as CF1 except that it had 07. This allele causes deregulation of phenylalanine biosynthesis.

Untransformed HW1089 cells or
Of HW1089 cells transformed only with pJN307
Phenylara in CF1 and CF2 cells compared to control strains
A proliferation test was performed to compare the amount of nin production. Do this
For each test strain (CF1, CF2, HW1089, HW
1089 and pJN307) were streaked on a MA agar plate,
It was cultured overnight to form a single colony. 1 liter
35 ml of each test strain colony in a shake flask
MA medium culture solution (K of 13.0 g / l₂HPO_Four,
2.0 g / l KH₂PO_Four, 1.0 g / l MgSO
_Four・ 7H₂O, 4.0 g / l (NH_Four)₂HPO_Four,
0.24 g / l ammonium ferricitrate (fer
ric ammonium citrate), 0.1
g / l yeast extract, and 35 g / l glucose)
And incubate at 32 ° C in a shaking incubator.
Was. Contain 1 ml of culture medium for phenylalanine analysis.
Samples were taken at 24 and 48 hours. 1 ml each
Dilute the sample to 10 ml with water and autoclave for 5 minutes
Completely lysed all cells. Then lysate 0 _.2
It was collected by filtration with a μm filter. Ion pairing reverse phase H
Presence of phenylalanine in 1 ml sample by PLC
Was detected. 10 μl of the prepared meat juice sample
Whatman Partisil at Puller
rtisil) 5 ODS-3 2.1 x 10 cm
I ran it. Mobile phase is 94% water, 5% acetonite
Ril and 1% PIC-B5 ion pairing reagent
I was The flow rate is 1.5 ml / min and U at 214 nm.
V detection was performed. The sample flow time is 10 minutes and L
-Phenylalanine eluted at about 6 minutes. Phenyla
The area of the lanine peak was measured and the prepared L-phenylene
It was quantified relative to the concentration of the Lanin standard. Culture of each strain
Duplicate measurements were performed on the liquid.

CF2 is 0.459 g / l and 0.175 g
/ L (2 different experiments), and 1 sample (HW1
089 + pJNB307) showed phenylalanine at a concentration of 0.027 g / l, but all samples had undetectable levels of phenylalanine. These results demonstrate that the difference in phenylalanine efflux between CF2 and HW1089 + pJNB307 is approximately 7-15 fold. As expected, uptake of the pheA34 gene further increased phenylalanine production in CF2 cells by increasing phenylalanine synthesis by this gene. The results are shown in Table 1 below. pJN30
CF1 cells introduced with 7 were designated as CF2.

[Table 1]

As shown in Table 1, introduction of pJN307 increased CF2 cell hypersecretion. Due to the limit of the sensitivity of the assay, the level of phenylalanine production that can be detected only by CF2 cells was shown. However, it has been confirmed that CF1 cells hypersecrete phenylalanine by the more sensitive cross-feeding assay described above.

Therefore, both CF1 cells alone and CF2 produced higher amounts of phenylalanine than wild type control cells. As will be apparent to those skilled in the art, ci
Cells can be transformed to secrete other amino acids by the introduction of the n gene. That is, the examples showing phenylalanine hypersecretion herein are intended to exemplify the preferred embodiments of the invention, the scope of which is limited only by the following claims.

Sequence Listing (1) General Information 1) Applicants: Fosselingham, Ianton, Jennifer Higgins, Chris (Fotheringham, Ia)
n Ton, Jennifer Higgins, Ch
ris) 2) Title of the invention: Material and method of amino acid hypersecretion 3) Number of sequences: 3 4) Contact address: a) Recipients: Marshall, Otule, Gerstein, Murray and Bicknell (Marshall, O ') Too
le, Gerstein, Murrray & Bick
nell) b) street: 20 South Clark, Suite 2000
(South Clark Suite 2000) c) City: Chicago d) State: Illinois e) Country: United States f) Zip Code: 60603-18205 5) Computer readable: a) Medium: Floppy disk b) Computer: IBM PC compatible c ) Operating system: PC-DOS / MS-
DOS d) Software: PatenIn Rele
ase # 1.0, version # 1.25 6) Application data: a) Application number: b) Application date: c) Classification: 8) Patent attorney / agent information: a) Name: Gruber, L.S.
Lewis S. ) B) Registration number: 30,060 c) Reference / Document number: 27129/30991 9) Telegraphic information: a) Telephone: 312 / 346-5750 b) Fax: 312 / 984-9740

(2) Information of SEQ ID NO: 1) 1) Sequence characteristics: a) Length: 29 base pairs b) Type: nucleic acid c) Strand: single strand d) Form: linear 2) Molecular type: DNA 11) Sequence: SEQ ID NO: 1: CCGGAATTGG AGCATTATTG TGAAATCAC

(2) Information of SEQ ID NO: 2: 1) Sequence characteristics: a) Length: 33 base pairs b) Type: nucleic acid c) Strand: single strand d) Form: linear 2) Molecular type: DNA 11) Sequence: SEQ ID NO: 2: CGCGGATCCC GAGTTCTCTT AAACCAAGGT TTA

(2) Information of SEQ ID NO: 3: 1) Sequence characteristics: a) Length: 751 base pairs b) Type: nucleic acid c) Strand: single strand d) Form: linear 2) Molecular type: DNA 11) Sequence: SEQ ID NO: 3:

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical display location // C12N 15/09 ZNA (C12N 1/21 C12R 1:19) (C12P 13/12 C12R 1: 19) (C12P 13/22 C12R 1:19) (72) Inventor Christopher Higgins Oxford Eaton, Water Eaton, Pipal Cottage (no address)

Claims (15)

[Claims] 1. A bacterial cell hypersecretes amino acids.
DNA reversal gene (inve)
Bacterial cell consisting of rion gene). 2. A bacterial cell that hypersecretes amino acids, DN.
A bacterial cell consisting of a prophage having an A-inverted gene. 3. Bacterial cells hypersecrete amino acids, DN
Bacterial cells transformed or transfected with a vector containing the A inversion gene (invertase). 4. The bacterial cell according to claim 3, wherein the vector is a plasmid having a temperature-sensitive copy number. 5. The vector is plasmid pHSG415.
The bacterial cell according to claim 4, which is 6. The bacterial cell according to claim 1, 2, 3, 4, or 5, wherein the bacterial cell is further transformed or transfected with a vector containing the pheA34 gene. 7. The amino acid is selected from the group consisting of phenylalanine, tyrosine and methionine.
The bacterial cell according to. 8. The bacterial cell is Escherichia coli.
ia coli) cell, The bacterial cell according to claim 6. 9. The DNA inversion gene is a cin gene of bacteriophage P1 and a gin gene of bacteriophage mu.
Gene, Salmonella typhimurium
lla typhimurium), and the Escherichia coli pin gene.
The bacterial cell according to claim 6. 10. The bacterial cell according to claim 6, wherein the DNA inversion gene is transiently active in the bacterial cell. 11. A method of producing a bacterial cell having a phenotype of hypersecreting an amino acid, which comprises the step of transforming or transfecting a bacterial cell with a vector containing a DNA inversion gene, the transformed or transfected bacterial cell. To
A method as described above, which comprises the steps of spreading on a plate inoculated with an Escherichia coli strain which is incapable of synthesizing the hypersecreted amino acid, and isolating the bacterial cell which is hypersecreting the amino acid and no longer contains the vector. 12. The method of claim 11, wherein the bacterial cell is an E. coli cell and the hypersecreted amino acid is selected from the group consisting of phenylalanine, tyrosine and methionine. 13. The DNA inversion gene is a cin gene of bacteriophage P1 and a gi of bacteriophage mu.
n gene, Salmonella typhimurium (Salmon
ella typhimurium) hing gene,
12. The method of claim 11, selected from the group consisting of and the E. coli pin gene. 14. The method according to claim 11, wherein bacterial cells that hypersecrete amino acids and no longer contain the vector are further transformed with a vector consisting of the pheA34 gene. 15. A method for producing an amino acid, which comprises the step of fermenting the bacterial cell of claim 1 in a suitable medium, and the step of collecting the hypersecreted amino acid from this medium.