JPH08205896A - Method for testing specific bond using ribozyme as label and reagent used for the same method for testing - Google Patents

Abstract

PURPOSE: To provide a method for simply detecting a trace amount of the objective substance and further simultaneously detecting plural kinds of the objective substances. CONSTITUTION: A specific bond reagent having a ribozyme 32 as a label is used as a testing reagent and the detection results of the objective substance is amplified by carrying out a substrate chain cleaving step for cleaving a substrate chain 31 which is a nucleic acid molecule having ribozyme cleavage sites 21, 22 and 25 in at least a part of the molecule from the ribozyme 32 in the labeled part and providing cleaved nucleic acids and a nucleic acid detecting step for detecting the cleaved nucleic acids.

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method for detecting a target substance to be inspected by using a substance that specifically binds to the substance, and in particular, it can detect the target substance with high sensitivity even in a small amount. The present invention relates to a specific binding assay.

[0002]

2. Description of the Related Art Conventionally, in order to identify and quantify a target substance with high sensitivity, a specific binding test method (specifing method) using a substance that binds to the target substance with high specificity (specific binding substance)
ic binding assay) is used. In this specific binding test method, for example, a label is given to a specific binding substance in advance, the labeled specific binding substance is allowed to bind to a target substance in the analyte, and unreacted substances are separated and removed from the analyte. After that, there is a method in which the target substance bound to the specific binding substance having the label is detected by detecting the label present in the subject. Among these specific binding tests, immunoassays (immunoassays) that use an antigen-antibody reaction as a specific binding reaction are widely performed.

This immunoassay method includes a turbidimetric immunoassay (TIA) for optically detecting a precipitate or an aggregate formed by an antigen-antibody reaction, and an antibody or an antigen labeled with a substance that can be easily detected by fractionation. It is roughly classified into a labeled immunization method using.

Looking at the tests currently used, T
Those using the IA method include transferrin, which is a protein in serum, and C-reactive pro
tein: CRP), immunoglobulin (IgG, IgA, Ig)
M) and tests for rheumatoid factors, which are substances related to autoimmunity. In addition, hematological tests by the TIA method include quantitative analysis of plasminogen, antithrombin II.
Examples include quantitative analysis of I.

On the other hand, the labeled immunoassay has various systems depending on the labeled substance, and a typical example is a radioimmunoassay (RIA) in which a label containing a radioisotope is used as a label. Enzyme immunoassay (EIA) using an enzyme as a label, fluorescent antibody techniq using a fluorophore as a label
ue: FAT) etc. The RIA method includes endocrinology tests (eg, erythropoietin, prostaglandin, etc.) to virology tests (eg, hepatitis B surface antigen (he
patitis B surface antigen (HBs) antibody, hepatitis C virus (HCV) antibody test, tumor-related test (eg AFP, CEA etc.), biochemical test (eg trypsin etc.) Has been applied to. The EIA method is a hematology test (eg, protein S, FPA, etc.), an immunoserologic test (eg, immune complex, microglobulin, etc.), and the FAT method is a viral antibody (eg, Epstein-Barr virus (Epstein-Barr virus)).
stein-barr virus (EBV) antibody, herpes virus antibody, etc.) and immunoserologic tests (eg, antinuclear antibody).

[0006]

As described above, the immunoassay method is widely used in clinical tests and the like. Among these immunoassay methods, the EIA method and FIA method have a problem that the sensitivity is not sufficient and the use thereof may be limited in this respect. Therefore, the RIA method is often used to detect the target substance with particularly high sensitivity. However, this RIA method has a problem that handling of radioisotope is dangerous and a reagent has a short shelf life.

Therefore, immuno PCR (polymerase chain)
reaction) method has been proposed. This immuno-PCR method secures high sensitivity by using DNA (deoxyribonucleic acid) as a label and utilizing the self-proliferating ability of this DNA to amplify the test result. That is,
In the immuno-PCR method, a specific binding substance having a DNA (deoxyribonucleic acid) fragment as a label is used, and the specific binding substance is reacted with a target to obtain a complex. This complex contains a DNA fragment that is a label. Therefore, after the complex is separated, the DNA fragment contained in the complex is used as a template to enzymatically DNA
The amplified detection result can be obtained by replicating and propagating the fragment and detecting the amplified DNA fragment. However, this immuno-PCR method has a problem in that it requires strict temperature control accompanied by temperature change at regular time intervals in order to grow DNA, resulting in high equipment cost. Such strict temperature control is always necessary not only in the immuno PCR method but also in the test method involving the proliferation of DNA itself, which is an obstacle to a simple and inexpensive test.

The present invention has been made in view of such problems, and a first object thereof is to detect a target substance easily and with high sensitivity.

Further, the above-mentioned RIA method has a problem that a plurality of kinds of target substances existing in the same sample cannot be simultaneously detected. By using the EIA method and the FIA method, it is possible to simultaneously detect a plurality of types of target substances. However, not only is there a problem with sensitivity as described above, but in order to perform simultaneous detection of multiple types of target substances, a fractionation device for reaction products and an analyzer for spectral distribution of fluorescence and luminescence are required. There is also a problem that the device cost becomes high, and the type of detection target is considerably limited in terms of fractionation capability.

Further, a labeling substance such as a fluorescent substance, a light-absorbing substance and an enzyme is enclosed in a liposome to which an antibody is bound, and an antibody-antibody reaction between the antibody bound to the liposome and an antigen in a sample and a second antibody is produced. There is a method in which complement is allowed to act on an object to destroy the bound liposome, the encapsulated labeling substance is washed away, and the labeling substance that has flowed out is detected. But,
Even when this method is used, there are the same problems as in the above-mentioned FIA method in order to simultaneously measure many kinds of antigens. Further, in this method, in order to improve the sensitivity, an enzyme capable of amplifying the test substance after the outflow is used, but in this case, there is a problem that the cost of the reagent is high.

Therefore, a second object of the present invention is to simultaneously and conveniently detect a plurality of types of target substances contained in the same sample with high sensitivity.

[0012]

To achieve the above object, in the present invention, a detection reagent having a specific binding moiety having a property of specifically binding to a target substance and a labeling moiety in a molecule, A complex formation step of forming a complex by binding with the target substance in the sample, and the presence or absence of the target substance in the sample using the labeling moiety in the complex and / or
Alternatively, in the specific binding test method comprising a detection step of estimating the amount, the labeled portion is a ribozyme, and the detection step comprises a ribozyme cleavage sequence which is a base sequence cleaved by the ribozyme in at least a part of the molecule. A substrate chain, which is a nucleic acid molecule having, is cleaved by the ribozyme of the labeling moiety to obtain a cleaved nucleic acid, and a nucleic acid detection step of detecting the cleaved nucleic acid. A specific binding assay method is provided. The ribozyme cleavage sequence includes a base sequence that is a means for binding the substrate chain molecule and the ribozyme molecule, and a base sequence for the ribozyme molecule to identify the cleavage point.

As the substance which specifically binds, an antigen or a hapten and an antibody, a physiologically active substance and a receptor for the physiologically active substance, a nucleic acid and a nucleic acid having a nucleotide sequence complementary to the nucleic acid, a polysaccharide and a lectin, immunity Globulin G
And Protein A, and any of these combinations can be used as a combination of the target substance and the specific binding moiety in the present invention. Here, the physiologically active substance includes hormones, vitamins, drugs and the like.

It is desirable that each molecule of the substrate chain has a ribozyme cleavage sequence at a predetermined position in the molecule, and one molecule of the substrate chain having the ribozyme cleavage sequence has the ribozyme cleavage sequence by the ribozyme. If the two nucleic acid molecules produced by cleavage have the same nucleotide sequence lengths as each other, the number of molecules of the nucleic acid after cleavage will be twice the number of molecules of the substrate chain before cleavage. preferable.

Further, in order to achieve the above-mentioned second object, in the present invention, when there are a plurality of types of target substances, a plurality of types of detection reagents are used according to the target substances, and each type of detection reagent is
A reagent is used in which the specific binding moieties each have the property of specifically binding to the corresponding target substance, and the labeling moieties are ribozymes that cleave different sequences for each corresponding target substance.

In this case, plural kinds of substrate chains may be used depending on each ribozyme, or one kind of substrate chain may be used.

When a plurality of types of substrate chains are used, each type of substrate chain has a corresponding ribozyme cleavage sequence of the above ribozyme in the molecule. It is desirable that each type of substrate chain does not have a ribozyme cleavage sequence of another ribozyme that is simultaneously synthesized. Further, the position of the ribozyme cleavage sequence in each type of substrate chain is predetermined for each corresponding ribozyme, the nucleotide sequence length of the nucleic acid generated by cleavage by the corresponding ribozyme, for each corresponding ribozyme It is desirable that the positions are different from each other.

When a plurality of types of target substances are detected with one type of substrate chain, a substrate chain having a ribozyme cleavage sequence of the ribozyme of each of the above detection reagents is used as the substrate chain. Also in this case, the position of the ribozyme cleaving sequence in the substrate chain is predetermined for each ribozyme, and it is desirable that the nucleotide sequences of the nucleic acids cleaved by the ribozymes have different base sequence lengths.

The complex of the target substance and the detection reagent is
It may be immobilized on a solid phase. This has the effect of facilitating the separation of the unreacted reagent and the complex. Therefore, the complex forming step may include a step of immobilizing the target substance in the sample on a solid-phase carrier, and a step of binding the detection reagent to the immobilized target substance. In this way, since the target substance is fixed on the solid phase, the complex is also fixed on the solid phase. Alternatively, the detection reagent may be immobilized on a solid-phase carrier. In this case as well, the target substance is bound to the immobilized detection reagent, so that the resulting complex is immobilized on the solid phase.

The binding of the labeled portion and the specific test portion in the detection reagent can be realized by various methods.
For example, in addition to the case where the labeled portion and the specific test portion are directly bound, a method of retaining the ribozyme molecule inside the liposome bound to the specific test portion can be mentioned. In this case, the detection step precedes the substrate strand scission step
A liposome disruption step of disrupting the liposome to release the molecule of the ribozyme retained therein.
Have more.

When the target substance is an antigen and the specific binding portion is an antibody against the target substance, the antibody-target substance (antigen) -detection reagent complex is treated with the antibody in the liposome destruction step. It can be carried out by acting complement on the.

The present invention also provides a method for amplifying the detection result in two steps by using the ribozyme in two steps. That is, the substrate chain further has a ribozyme base sequence, and in the substrate chain cleavage step, when the substrate chain is cleaved, the base sequence portion of the ribozyme is released to become a second ribozyme, and the detection step is Between the substrate chain cleavage step and the nucleic acid detection step, a second substrate chain that is a nucleic acid molecule having a ribozyme cleavage sequence that is a base sequence that is cleaved by the second ribozyme in at least a part of the molecule, The method further comprises a second substrate chain cleavage step of cleaving with the second ribozyme to obtain a cleaved nucleic acid, wherein the cleaved nucleic acid detected by the nucleic acid detection step is obtained by the second substrate chain cleavage step. A specific binding test method is provided, which is a cleaved nucleic acid.

Here, the substrate chain is immobilized on an immobilization carrier, and the ribozyme cleavage sequence of the ribozyme that is the labeling moiety is present between the immobilization carrier and the base sequence of the second ribozyme. It is desirable to do. The immobilization of the substrate chain facilitates the separation of the unreacted substrate chain from the second ribozyme generated by cleavage.

Further, the present invention provides a reagent used in the above-mentioned test method.

Firstly, as a specific binding reagent which can be used as the above-mentioned detection reagent, a specific binding reagent characterized by comprising a specific binding portion for a predetermined substance to be inspected and a ribozyme is provided. . The specific binding reagent may further include a liposome bound to the specific binding portion so that the ribozyme is retained inside the liposome. Alternatively, the ribozyme may be connected to the specific binding moiety via an avidin-maleimide linker.

Secondly, in the preparation of the above described detection reagent,
As a labeling reagent that can be used for labeling the specific binding portion, a connecting portion with a specific binding substance for a predetermined test substance, and a single-stranded ribonucleic acid having a ribozyme sequence, A labeling reagent is provided. Here, the connecting portion is, for example, the biotinylated poly-A chain portion at the 5 ′ end of the single-stranded ribonucleic acid.
Further, a sequence that is cleaved by a restriction enzyme or a ribozyme may be further provided between the connecting portion and the ribozyme sequence. This is because it is easy to cleave and release the ribozyme portion from the immobilized complex.

[0027]

In the present invention, ribozyme is used as a label. Ribozyme is a molecule that has a enzymatic function even though it is a nucleic acid, and depending on its structure, a nucleic acid having a predetermined base sequence (hereinafter, a predetermined base sequence that is cleaved by this ribozyme Cleavage of a nucleic acid having a "substrate strand") at a predetermined position (hereinafter referred to as "break point") with respect to a predetermined base sequence (hereinafter referred to as "cleavage target sequence") It is a catalytic nucleic acid molecule that functions as a catalyst for the reaction. When this ribozyme is allowed to act on a substrate chain having a sequence that is cleaved by the ribozyme, the substrate chain is cleaved at a predetermined position to form a nucleic acid having a small molecular weight. Therefore, by detecting and measuring this cleaved nucleic acid, the target substance in the sample can be detected qualitatively or quantitatively.

First, the ribozyme will be described.
As functional molecules that act on nucleic acid fragments, restriction enzymes, ligases, etc. have been conventionally known, and they are often used according to their purposes. The restriction enzyme has a function of cleaving the nucleic acid fragment, and the ligase has a function of binding the nucleic acid fragment. As described above, although many kinds of enzymes that act on nucleic acid fragments are known, all of them recognize and process a double-stranded nucleic acid sequence of a substrate. These enzymes are proteins,
A great deal of time and cost must be spent on its preparation.

On the other hand, in recent years, a molecule "ribozyme" has been found which is a nucleic acid molecule but has a function of cleaving a nucleic acid fragment. The basic structure of a ribozyme is essentially an RNA (ribonucleic acid) molecule. However, in order to enhance its function, a so-called chimera-type molecule artificially constituted by a hybrid of deoxyribonucleotide and oxyribonucleotide has been prepared. In the present specification, "cleaving a nucleic acid" means cleaving the phosphodiester bond of the nucleic acid.

The ribozyme has two binding sites for a substrate and a catalytic loop site located between those binding sites. That is, the ribozyme is represented as "5'-substrate binding part (hereinafter referred to as binding part A) -catalytic loop part-substrate binding part (hereinafter referred to as binding part B) -3 '". It comprises a nucleic acid sequence.

The binding sites A and B are sites that bind to the substrate by forming a base pair. Therefore, the ribozyme cleaves a nucleic acid having a base sequence that forms a base pair with the sequences of the binding sites A and B and binds. The binding parts A and B are usually oligonucleotides composed of about 5 to 10 nucleotides.

The catalyst loop portion is a molecular chain capable of forming a specific loop and incorporating magnesium ions as a ligand. Examples of the catalyst loop portion include those having a base sequence represented by 5'CUGAUGAGUCCGUGAGGACGAAAC3 '. In addition, in this specification, the base sequence is described according to a conventional notation, such as G, C,
A and U represent guanine, cytosine, adenine, and uracil, respectively.

On the other hand, the substrate cleaved by this ribozyme is "5'-catalyst binding site (hereinafter referred to as binding site B ')-cleave target sequence-catalyst binding site (hereinafter binding site A'). ) -3 '". The cleavage target sequence is, for example, -GUX (break point)-. Here, X is any one of C, U and A.

In the substrate and the ribozyme, the binding site A'of the substrate and the binding site A of the ribozyme form a base pair, and the binding site B'of the substrate and the binding site B of the ribozyme form a base pair. By combining, In this state, when the conditions for functional activation of the ribozyme are satisfied, X of the GUX site of the substrate is
The bond between the 3'end and the binding portion A'is cleaved. As described above, the ribozyme is a catalytic nucleic acid molecule having a function of enzymatically cleaving a nucleic acid fragment while being a nucleic acid molecule. In the present specification, the free catalytic nucleic acid molecule itself may be referred to as a “ribozyme”, and a portion functioning as a ribozyme in the molecule may be referred to as a “ribozyme”.

The test method of the present invention uses a detection reagent that specifically binds to a target substance, separates a complex in which the detection reagent and the target substance are bound, and amplifies the amount of the target substance to give a trace amount of the target substance. Is a specific binding test method for detecting with high sensitivity. In the specific binding test method, as a detection reagent, a specific binding substance that specifically binds to a target substance and is provided with a label is often used, but in the present invention, a ribozyme is used as the label.

That is, in the present invention, first, a substance which is provided as a ribozyme label and has a specific binding property to the target substance is used as a detection reagent, and this is reacted with the target substance in the sample to detect the target substance. A complex with the reagent is obtained. Since the specific binding substance is used as the detection reagent, the target substance in the sample binds to the detection reagent with very high specificity. Therefore, if the complex and the unreacted detection reagent are separated (B / F separation: binding / free separation),
The substance of interest is obtained in the form of a complex with the detection reagent.

The number of molecules of the obtained complex is very small, like the target substance contained in the sample. For example, if the bond between the target substance and the detection reagent is 1: 1, the number of molecules of the target substance is the same. Therefore, it is necessary to amplify this number of molecules in order to improve the detection sensitivity.

Therefore, in the present invention, the detection result is amplified by cleaving the substrate chain with the ribozyme separated in the form bound to the complex. Since the ribozyme itself is a catalyst, one molecule of ribozyme sequentially cleaves a plurality of cleavage points. Therefore, the number of molecules of the nucleic acid having a small molecular weight produced by cleavage is the amplified number of molecules of the ribozyme.

Further, the molecular weight of the substrate chain is extremely changed by being cleaved. Therefore, the nucleic acid, which is a fragment of the cleaved substrate chain, and the unreacted substrate chain can be easily distinguished by the difference in the molecular weight. The detection of the low molecular weight nucleic acid produced by the cleavage of the substrate chain can be easily performed by using an analytical method such as electrophoresis or chromatography.

As the substrate chain used for amplification of the test result, it is desirable to use a nucleic acid fragment having a base sequence which allows easy analysis of the nucleic acid after being cleaved by the ribozyme. Examples of such a nucleic acid fragment are those in which the sequence to be cleaved is arranged at a predetermined position from one end of the nucleic acid fragment, or a plurality of sequences to be cleaved are arranged at equal intervals from the ends. And so on. This is because a nucleic acid chain having a constant length or an integer multiple of the constant length can be obtained after cleavage with ribozyme, and thus the amount of the cleaved substrate chain can be easily analyzed.

If a reagent immobilized on a solid phase is used as the detection reagent, the complex bound to the target substance is also immobilized on the solid phase. Immobilizing the complex on the solid phase in this manner is preferable because it facilitates B / F separation. When the complex is immobilized on a solid phase, a step of releasing the label from the complex may be added in order to increase the reactivity of the ribozyme as the label.

As a method for releasing the label, for example,
It is conceivable that the ribozyme is released from the detection reagent by cleaving the bond connecting the label ribothyme to the detection reagent with a restriction enzyme. In this case, a substance in which the specific binding portion and the ribozyme are bound via a base sequence cleaved by a restriction enzyme is used as a detection reagent. If a detection reagent having a site cleaved by such a restriction enzyme is used, after B / F separation,
Since the restriction enzyme can act to cleave between the binding site for the specific binding substance and the site serving as the template for the ribozyme, the reactivity of the ribozyme can be increased.

When the ribozyme is encapsulated in the liposome, the internal ribozyme is allowed to flow out by breaking the liposome, which is a lipid membrane, so that the ribozyme can act as a catalyst for the cleavage reaction of the substrate chain. can do. As a method for breaking the liposome, for example, when the target substance is an antigen, an antibody bound to the liposome is used as a detection reagent, and the target substance (antigen) and the detection reagent (antibody) are complexed with each other, ie, an antigen-antibody complex. The body is further bound with an antibody not bound to the liposome to form an antibody-antigen-antibody complex, and this antibody-antigen-antibody complex is
A method of destroying the liposome by allowing the complement of the antibody to act can be used.

Furthermore, according to the present invention, even when there are many kinds of target substances, the simultaneous detection of them can be easily performed as follows.

In the case of simultaneously detecting each target substance in a sample in which a plurality of target substances are mixed, each target substance has a specific binding property to the target substance, and each target substance has a specific binding property as a label. A detection reagent comprising ribozymes having different sequences is used. Regarding the substrate chain cleaved by the ribozyme, a plurality of kinds of nucleic acids are prepared, each containing one cleavage target sequence of the ribozyme synthesized by the labeled DNA. It should be noted that each type of substrate chain has such a sequence that the nucleic acid after cleavage has a different base sequence length depending on the type. In this way, since each labeled ribozyme has a function of cleaving different sequences, it is possible to know the amount of each target substance by analyzing the nucleotide sequence length of the cleaved substrate chain and its amount. You can

It should be noted that the base sequence has a binding sequence and a cleavage sequence of each ribozyme in one molecule, and even if it is cleaved at any combination of cleavage points, the lengths of the cleaved fragments are not the same. When a nucleic acid having a base sequence is used, the presence of a plurality of types of ribozymes can be detected by using a single type of base chain without using a plurality of types of base chains as described above.

Analysis of the cleaved substrate chain can be performed by gel electrophoresis, for example. The substrate chain after cleavage is
When gel electrophoresis is carried out, the gel pattern is localized in different places depending on its molecular weight. Therefore, if the localized nucleic acid is stained with ethidium bromide and the fluorescence is observed, the cleaved substrate chains of each molecular weight (base sequence length) can be easily distinguished at the same time. Therefore, the presence of a plurality of target substances can be simultaneously detected. In addition, since the amount of each nucleic acid can be measured by measuring the fluorescence intensity,
It is possible to measure not only the presence or absence of a plurality of target substances, but also the amount thereof.

In addition to the method for measuring fluorescence, quantification by spectroscopic analysis such as measurement of absorbance may be carried out without staining the substrate chain, and the gel in the localized region of the nucleic acid is taken out, The amount of cleaved nucleic acid can also be known by quantifying the amount of nucleic acid contained therein by a known method.

Further, even when the chromatographic method is used, each target substance in a sample in which a plurality of target substances are mixed can be easily detected as in the case of the gel electrophoresis method.

When a gel electrophoresis method, a thin layer chromatography method, a column chromatography method or the like is used, a localized sample (gel plate, column, etc.) of the cleaved nucleic acid, which is the detection result, can be preserved as it is. This also has the advantage that the data can be rechecked at any time later. Further, when the gel electrophoresis method is used, there is an advantage that the samples can be easily compared with each other with a single migration pattern.

As a method of using a ribozyme as a label, for example, there is a method in which a ribozyme molecule is directly bound to a specific binding substance and used as a detection reagent. There is also a method in which a liposome is bound to a specific binding substance instead of directly binding the ribozyme, and the ribozyme is encapsulated in this liposome to obtain a detection reagent.

When a detection reagent provided with a ribozyme is used by any method, a specific binding substance for each target substance is prepared if a plurality of types of target substances are to be detected. A ribozyme that cleaves nucleic acids having different base sequences is added as a label to the specific binding substance to obtain a detection reagent. That is, for each target substance,
Specific substances with ribozymes that cleave different base sequences are used as detection reagents.

In this way, a complex containing one or more ribozymes different for each target substance is formed. Therefore,
As described above, by cleaving the substrate chain with this ribozyme and detecting the cleaved substrate chain, the presence or absence of the ribozyme and its amount can be detected. Can be estimated. Ribozymes can be easily obtained because they can be chemically synthesized by an automatic synthesizer of nucleic acids. Therefore, the cost of the detection reagent
It can be kept relatively inexpensive.

When a detection reagent which is an antibody bound to a liposome holding a ribozyme is used, if the target substance is an antigen, the detection reagent and the antibody not bound to the liposome are the target substance (antigen) in the sample. The complement is allowed to act on the complex with and the liposome of the complex is destroyed, and the ribozyme retained inside is released. That is, when an antigen, which is a target substance, is present in the sample, an antigen-antibody reaction complex is generated on the surface of the liposome, and the liposome is destroyed by the reaction between the complex and the antigen, and the ribozyme retained therein flows out. Since a large amount of ribozyme can be encapsulated in the liposome, the detection signal can be greatly amplified at this stage.

Furthermore, as described above, by cleaving the substrate chain by the effluxed ribozyme and detecting the cleaved substrate chain, the detection signal is further amplified, and in addition to the extreme Detection is facilitated by generating nucleic acids having different sequence lengths.

When the above-mentioned liposome is used, the detection result is amplified by encapsulating a large amount of ribozyme in the liposome, but when the ribozyme molecule is bound to the molecule of the specific binding substance to be used as the detection reagent. If the amount of the target substance is extremely small, the amount of the obtained complex is extremely small, so that the amount of nucleic acid cleaved by the ribozyme contained in the complex may be very small. In such a case, it is desirable to use RNA as the substrate chain and to include a reverse transcriptase promoter sequence in the sequence.

In this way, the nucleic acid produced by the cleavage contains the reverse transcriptase promoter sequence, so that the reverse transcriptase can act on this nucleic acid to synthesize a large amount of DNA fragments. . Therefore, the detection result is amplified as a large amount of DNA fragments, and the D
By detecting the NA fragment, even a trace amount of the target substance can be detected with high sensitivity.

The detection result can be amplified in two steps by cleaving the substrate with ribozyme in two steps.

That is, a substance that specifically binds to a target substance is labeled with a first ribozyme as a detection reagent, and a substrate chain for the first ribozyme (referred to as a first substrate chain) is added to a solid phase. , A second ribozyme bound via a base sequence cleaved by the first ribozyme is used, and the second ribozyme is used as a substrate chain for the second ribozyme (referred to as the second substrate chain). A nucleic acid having a base sequence to be cleaved is used.

In this case, the complex formed by the specific binding reaction between the target substance and the detection reagent contains one or more first ribozymes. After the complex is separated by B / F and purified, and the complex is reacted with the first substrate chain which is an amplifying material, the first substrate chain is cleaved and the second ribozyme is separated from the solid phase. To be free. At this time, the first ribozyme cleaves a plurality of substrate chains, so that the first-stage amplification occurs.

Next, when the second substrate chain is reacted with the second ribozyme, the second substrate chain is cleaved to produce a nucleic acid having a small molecular weight. Detects this small molecular weight nucleic acid,
The presence or absence and / or the amount of the target substance is estimated by measuring, but in the reaction of the ribozyme in the second step, the second step amplification occurs. Second
This is because the ribozyme of cleaves multiple substrate chains.

If the complex containing the first ribozyme is immobilized on the solid phase, B / F separation will be facilitated. However, immobilizing the complex on the solid phase in this manner may reduce the chance of the first ribozyme and the first substrate coming into and out of the solid phase, and thus the reaction rate may not increase. Therefore, if such a situation is expected, it is desirable to interpose a base sequence cleaved by the second ribozyme in the specific binding portion of the detection reagent molecule and the binding portion of the first ribozyme. In this way, the first ribozyme
The second ribozyme released by cleaving the substrate chain of cleaves the bond fixing the first ribozyme in the complex and releases the first ribozyme,
This is because the substrate chain cleavage reaction of the first ribozyme will be accelerated.

Although the method of amplifying the detection result by using the ribozyme reaction in two steps has been described here, further amplification may be achieved by using the ribozyme reaction in three or more steps. Further, the detection result may be amplified by using a method other than the method exemplified here. For example, amplification by various methods such as synthesizing an enzyme using a nucleic acid generated by cleavage of a substrate chain as a template and detecting a reaction product of the reaction by the enzyme can be considered.

[0064]

【Example】

<Example 1> A carcinoembryonic antigen (hereinafter abbreviated as CEA) and α-fetoprotein (hereinafter abbreviated as AFP) present in a trace amount in a sample were respectively detected using a detection reagent including a liposome encapsulating a ribozyme. An example of quantitative analysis will be described. In this example, CEA antibody and AFP antibody were used as the specific binding substances.

A. Preparation of Test Reagent In this example, a liposome-labeled antibody that is a detection reagent for specifically binding to a target substance and facilitating its detection, and a substrate chain for amplifying the test result are used. Detect the target substance. Therefore, first, a liposome-labeled antibody and a substrate chain were prepared.

(A-1) Synthesis of Ribozyme First, in order to obtain a ribozyme-encapsulated liposome-labeled antibody, a ribozyme which is a single-stranded RNA was synthesized by a well-known method using an automatic nucleic acid synthesizer. In this embodiment,
Since two types of target substances are detected, two types of ribozymes were correspondingly synthesized. These ribozymes are called ribozyme a and ribozyme b, and are shown in (a) and (b) of FIG.

In the present specification and the drawings, the structure of a nucleic acid is represented by the abbreviations (G, T, C, A, U) of the nucleotide bases constituting the nucleic acid according to the custom. Where "G", "T", "C", "A", "U"
Are guanine, thymine, cytosine, adenine,
It represents uracil, "*" represents that a base pair is formed, and "N" represents any nucleotide. Regarding double-stranded DNA, the structure thereof is expressed by the nucleotide sequence of the non-transcribed strand, and 3'and 5'are
Each represents the 3'end and the 5'end of the nucleic acid.

As shown in FIG. 1 (a), the ribozyme a of this example has a first binding site 11 with the substrate, a catalytic loop site 15, and a second site with the substrate chain in order from the 5'end. The binding site 12 of First binding site 11 with substrate chain
Is 5'GCCCC3 ', the sequence of the catalytic loop site 15 is 5'CUGAUGAGUCCGUGAGGACGAAAC3', and the sequence of the second binding site 12 with the substrate is 5'CCG3 '.

In addition, the ribozyme b of this example is shown in FIG.
As shown in (b), the substrate is provided with a first binding site 13 for the substrate, a catalytic loop site 15, and a second binding site 14 for the substrate in order from the 5 ′ end. The base sequence of the first binding site 11 with the substrate chain is 5'AUUUU3 ', the sequence of the catalytic loop site 15 is 5'CUGAUGAGUCCGUGAGGACGAAAC3', and the sequence of the second binding site 12 with the substrate chain is 5 '. It is UUA3 '.

That is, the ribozyme a and ribozyme b of this Example are provided with a common catalytic loop site 15,
The breakpoints are the same, but the binding sites for the substrate are different.

(A-2) Preparation of ribozyme-encapsulated liposome Next, a liposome encapsulating the ribozyme obtained in (A-1) was prepared.

Chloroform-methanol (volume ratio 2:
1) of dipalmitoylphosphatidylethanolamine (DPPE) dissolved in 1) and N-succinimidyl-3- (2-pyridyldithio) propionate (SPDP) in a molar ratio of about 20% with respect to DPPE in an amount of 0.1 mol / mol. 1 in the presence of triethylamine, and mixed with pyridyldithiopropionyl palmitoylphosphatidylethanolamine (PDP-
DPPE), purified by silica gel column, PDP-DPPE
I got

0.05 μmol of the obtained PDP-DPPE and 0.5 μm of dipalmitoylphosphatidylcholine (DPPC)
ol, cholesterol 0.5 μmol, (A-1)
0.1 mol of ribozyme a synthesized in Section 1 was mixed and suspended to form a lipid thin film.
fferd saline) was added and stirred with a Vortex mixer to prepare liposomes.

Free ribozyme was removed from the obtained suspension of liposomes by a centrifugal precipitation method, and the obtained liposomes were washed with NaCl (0.15 mol / l) and N-2-hydroxyethylpiperazine-N'-2-. Ethanesulfonic acid (HEPES) (0.
01 mol / l) mixed solution (pH 7.45) 0.5 m
to obtain a suspension of liposomes encapsulating ribozyme a.

Further, ribozyme b was used instead of ribozyme a, and a suspension of liposomes encapsulating ribozyme b was obtained in the same manner.

(A-3) Preparation of detection reagent 0.1 mmol was added to 1 ml of 2 mg / ml anti-CEA antibody dialyzed against 0.01 mol / l HEPES solution in advance.
SPDP was added so that the amount became 1 / l, and the mixture was reacted for 30 minutes at room temperature with occasional stirring.

As the reaction solution, a Sephadex G-25 column (manufactured by Pharmacia) was used, and the mobile phase was a 0.1 mol / l acetic acid buffer solution containing 0.15 mol / l NaCl (pH 4.
It was purified by gel filtration described in 5).

Further, the obtained reaction product was added with 50 mm
Dithiothreitol was added as a solid so that it became ol / l and reacted at room temperature for 30 minutes.
Using a phadex G-25 column (manufactured by Pharmacia), purification was performed by gel filtration using HEPES buffer as a mobile phase to obtain a thiolated antibody.

Next, the obtained antibody solution (1 mg / m 2
l) In 10 ml, 0.1mo obtained by (A-2)
The liposome suspension encapsulating 1 ribozyme a was added, and the mixture was slowly stirred for 15 hours. After that, the reaction solution was sterilized with gelatin barbital buffer (GVB) 3-4.
After centrifugation and washing, ribozyme a-encapsulated anti-CEA antibody-bound liposomes were obtained and suspended in 10 ml of GVB to give C
A suspension of the detection reagent for EA was obtained.

Next, instead of anti-CEA antibody, anti-AFP
A suspension of the detection reagent for AFP, which is an anti-AFP antibody-bonded liposome encapsulating ribozyme b, was obtained by using an antibody and using a liposome encapsulating ribozyme b in place of the liposome encapsulating ribozyme a.

(A-4) Synthesis of Substrate Chain Next, a substrate chain for confirming liberation of ribozyme was prepared.
Two types were synthesized so as to correspond to the two types of ribozymes.
The synthesis was performed by a well-known RNA synthesis method using an automatic nucleic acid synthesizer. These substrate chains are called substrate chain a and substrate chain b, and are shown in (a) and (b) of FIG.

As shown in FIG. 2 (a), the substrate chain a has a base sequence length of 400 bps and has a sequence (hereinafter referred to as a ribozyme cleavage sequence) that is cleaved by ribozyme a at only one site. . Sequence 25 is a sequence used by ribozymes a and b to specify the cleavage point,
Here, it is called a cutting point array. Further, the sequence in the substrate chain on which ribozyme acts is a binding site sequence and a cleavage point sequence, which are collectively called a ribozyme cleavage sequence.

The sequences of the substrate chain a represented by α and α'in FIG. 2 (a) are arbitrary nucleotide sequences not containing the ribozyme cleavage sequences of ribozyme a and ribozyme b.
Remaining sequence (sequence represented as β in FIG. 2 (a))
Is a site that acts on ribozyme a (ribozyme cleavage sequence of ribozyme a), and the sequence is 5'CGGGUCGGGGC.
3 '. Of these, the sequence "GGGGGC" at the 3'end side
21 and the sequence "CGG" 22 on the 5'end side are sequences that form a base pair with the binding sites 11 and 12 of the ribozyme a for binding to the substrate, and the sequences sandwiched between these binding site sequences 21 and 22. "GUC" 25 is a sequence by which ribozyme a identifies a breakpoint (breakpoint sequence). That is, the ribozyme cleavage sequence of ribozyme a in the base sequence of substrate chain a is sequences 21, 22, and 25.

FIG. 3 shows ribozyme a31 and substrate chain a32.
The binding state with and is typically shown. In addition, ribozyme a32
Has a base sequence length of 32 bps.

In the substrate chain a31, the sequence 21 forms a base pair with the first binding site sequence 11 of the ribozyme a, and the sequence 2
2 forms a base pair with the second binding site sequence 12 of ribozyme a, and thus binds to the ribozyme molecule as shown in FIG. When the catalytic conditions are satisfied in this bound state, the sequence 25 of the substrate chain a is cleaved by the catalytic loop site sequence 15 of the ribozyme a.

The cleavage point sequence of ribozyme a is "G
UX (X is any one of C, U and A) ", but the substrate chain a has the sequence" GUC "as the breakpoint sequence 25.
It has. The breakpoint of this sequence is at the 3'position of C of the sequence "GUC". In the substrate chain a, the base sequence length from the 3 ′ end to the cleavage point of the substrate chain a and the base sequence length from the 5 ′ end to the cleavage point of the substrate chain a are both 20
It is 0 bps. Therefore, the substrate chain a by ribozyme a
Is cleaved, a 200-bps nucleic acid will be produced.

Further, as shown in FIG. 2 (b), the substrate chain b has a base sequence length of 300 bps and has a ribozyme cleavage sequence of ribozyme b at only one position.

The sequences of the substrate chain b represented by γ and γ ′ in FIG. 2 (b) are arbitrary nucleotide sequences not containing the ribozyme cleavage sequences of ribozyme a and ribozyme b.
Remaining sequence (sequence represented as δ in FIG. 2 (b))
Is a site that interacts with ribozyme b (ribozyme cleaving sequence of ribozyme b), and its sequence is 5'UAAGUCAAAAU.
3 '. Of these, the sequence "AAAAU" on the 3'end side
23 and the sequence "UAA" 24 on the 5'-end side are sequences that form a base pair with the binding sites 13 and 14 for binding the substrate of ribozyme b, and the sequences sandwiched between these binding site sequences 23 and 24. “GUC” 25 is a sequence by which ribozyme b identifies a breakpoint (breakpoint sequence). That is, in the base sequence of the substrate chain b, the ribozyme cleaving sequences of ribozyme b are sequences 23 to 25.

FIG. 4 shows ribozyme b52 and substrate chain b51.
The binding state with and is typically shown. The base sequence length of ribozyme b52 is 32 bps.

In the substrate chain b51, the sequence 23 forms a base pair with the first binding site sequence 13 of the ribozyme b, and the sequence 2
4 forms a base pair with the second binding site sequence 14 of ribozyme a, and thus binds to the ribozyme molecule as shown in FIG. When the catalytic conditions are satisfied in this bound state, the sequence 25 of the substrate chain b is cleaved by the catalytic loop site sequence 15 of the ribozyme b.

The cleavage point sequence of ribozyme b was also "G
UX (X is any one of C, U and A) ”, but in the present example, the sequence“ GUC ”is provided, and like the above-mentioned ribozyme a, the cleavage point is C of the sequence“ GUC ”. It is the 3'th place. In the substrate chain b, the base sequence length from the 3 ′ end of the substrate chain b to the cleavage point and the base sequence length from the 5 ′ end of the substrate chain b to the cleavage point are both 150 bp.
s. Therefore, when the substrate b is cleaved by the ribozyme b, a 150 bps nucleic acid is produced.

B. Preparation of Calibration Curve First, GVB containing various known concentrations of the target substances CEA and AFP (for example, 50 nmol / l each) was prepared and used as a standard sample. For each standard sample, using the detection reagent and substrate chain prepared as described above,
The following processes (B-1) to (B-4) were performed, and from the results, as shown in (B-5) described later, a calibration curve for quantitative analysis of the target substance was prepared.

(B-1) Formation of antibody-antigen-antibody complex and destruction of liposomes 25 μl of a standard sample was placed in the well of a titer plate, and 1 ml of the ribozyme-encapsulated antibody-bound liposome suspension prepared in (A-3). , Anti-CEA antibody and anti-AFP antibody (7 μg / ml each of 25 μl), anti-CEA antibody complement and anti-AFP antibody complement (7 mg / ml each of 2 μl)
5 μl) and mixed and incubated at 37 ° C. for 1 hour, and then the reaction was stopped with 10 mmol / l ethylenediaminetetraacetic acid (EDTA) -GVB.

As a result, only the liposome of the detection reagent bound to the target substance as an antigen was destroyed, and the ribozyme retained inside flowed out.

(B-2) Recovery of ribozyme After the reaction solution obtained in the above (B-1) was treated with phenol / chloroform, ethanol was added to precipitate and collect the liberated ribozyme.

(B-3) Cleavage of substrate chain 50 mmol / l Tris-HCl buffer (pH 8.
1) each of the substrate chains a and b prepared in (A-4) and the total amount of the ribozyme obtained in (B-2) were added to 1 ml of a solution obtained by adding MgCl ₂ to 0) to 25 mmol / l. As a ribozyme reaction solution. This ribozyme reaction solution was incubated at 37 ° C. for 3 hours. As a result, the substrate chain was cleaved by the action of ribozyme. The reaction solution was treated with phenol / chloroform, ethanol was added to precipitate the nucleic acid, and the nucleic acid was collected by filtration to obtain a nucleic acid mixture containing a ribozyme, an unreacted substrate chain, and a cleaved substrate chain.

(B-4) Detection 0.5 ml of the whole amount of the nucleic acid mixture obtained in (B-3) was detected.
Urea-EDTA solution (5mmo in 8N urea solution)
Dissolved EDTA (pH 1 / l)
7)), and 0.05% of sucrose / pigment solution (20% sucrose aqueous solution with 5 mmol / l of EDTA dissolved therein, pH 7).
Bromophenol blue and 0.05% xylene cyanol FF) were added. This solution
Electrophoresis was performed on acrylamide gel containing 8.3 mol / l urea aqueous solution and stained with ethidium bromide. In addition to the band due to ribozyme and the band due to unreacted substrate chain, it was further cleaved. A migration pattern was obtained with bands due to the different substrate chains.

As an example of the obtained migration pattern, CEA
FIG. 5 shows the migration patterns of the samples in which the concentrations of AFP and AFP were each 0.01 μmol / l. In the detection result of this sample, five bands 41 to 45 perpendicular to the migration direction 46 were seen on the gel plate 40. The base sequence lengths of the bands are 400 pbs for band 44, 300 bps for band 43, and 42 for band 42 in the order of increasing migration distance.
Is 200 bps, band 41 is 150 bps, band 4
5 was 32 bps. Therefore, the band 44 is the band of the unreacted substrate chain a, the band 43 is the band of the unreacted substrate chain b, the band 42 is both the bands obtained by cleaving the substrate chain a, and the band 41 is It is considered that both bands are obtained by cleavage of the substrate chain b, and band 45 is a ribozyme band.

Therefore, the stained nucleic acid 1 of each nucleotide sequence length
The fluorescence intensity per mol is obtained in advance, the amount (mol) of the cleaved substrate chain a is determined from the fluorescence intensity of the band 42 of the cleaved substrate chain a, and the cleaved substrate chain b
The amount (mol) of the cleaved substrate chain b was determined from the fluorescence intensity of the band 41 of 1. The amount of the cleaved substrate chain was determined by quantitatively analyzing the RNA contained in the gel of the band of the cleaved substrate chain from the gel plate 40 by a known method such as an absorbance method. You may ask.

(B-5) Preparation of calibration curve (B-1) to (B-
Performing the detection procedure in 4), the concentration of each antigen in the standard sample (μ
(mol / l) and the amount of the cleaved substrate chain (μmol) were plotted, and the calibration curve shown in FIG. 6 was obtained. In addition,
In the example of the calibration curve shown in FIG. 6, the calibration curve in which the target substance is CEA and the calibration curve in which the target substance is AFP match.

C. Quantitative analysis of target substance The amount of the cleaved substrate chain was measured by performing the above-mentioned operations (B-1) to (B-4) on a sample containing the target substance at a known concentration (this concentration is called the true concentration). Was determined and the concentration of the target substance in the sample was determined from the calibration curve prepared in (B-5) based on the substrate chain amount. The determined concentration of the target substance matches the true concentration. did. As you can see from this,
According to the inspection method of this embodiment, a trace amount of the target substance can be accurately detected.

D. Effect of Example 1 According to Example 1, since the detection result is amplified by using a large amount of ribozyme encapsulated in the liposome, even if the amount of the target substance is small, it is sensitive and easy. Can be detected. Further, according to the present Example 1, a plurality of types of target substances existing in the same sample can be qualitatively / quantitatively analyzed by one detection operation. In this example,
Although the electrophoresis method was used for fractionation of the substrate chain after cleavage, the substrate chain can be similarly fractionated by the chromatography method.

<Example 2> In Example 2, as in Example 1, CEA and AFP present in a trace amount in a sample were detected by using a detection reagent including liposomes encapsulating ribozyme.
And were quantitatively analyzed. However, in Example 1,
As substrate chains for confirming the release of ribozyme, two types of substrate chains were used corresponding to two types of ribozymes.
In Example 2, two kinds of target substances are analyzed by using one kind of substrate chain.

A. Preparation of Test Reagent (A-1) Synthesis of Ribozyme to (A-3) Synthesis of Detection Reagent In the same manner as in Example 1, a liposome-labeled antibody in which ribozyme a was encapsulated and a liposome-labeled in which ribozyme b was encapsulated were labeled. Antibodies were prepared.

(A-4) Preparation of Substrate Chain Next, as a substrate chain for confirming the release of ribozyme, a substrate chain having two ribozyme cleavage sequences in one molecule so as to correspond to two types of ribozymes. Was synthesized.
The synthesis was performed by a well-known RNA synthesis method using an automatic nucleic acid synthesizer. The substrate chain of Example 2 is called substrate chain c, and its structure is shown in FIG.

The substrate chain c has a base sequence length of 450 bps and has a ribozyme cleavage sequence of ribozyme a and a ribozyme cleavage sequence of ribozyme b at one position. The sequences represented by ε, ε ′ and ε ″ in the substrate chain c in FIG. 7 are arbitrary base sequences that do not include the ribozyme cleavage sequences of ribozyme a and ribozyme b. Of the remaining sequences, the sequence represented by ζ Is the ribozyme cleavage sequence of ribozyme a, and the sequence represented by η is the ribozyme cleavage sequence of ribozyme b.

The base sequence length from the 3'end to the first cleavage point (the cleavage point of ribozyme b) in the substrate chain c is 150 bps, and from the 5'end to the first cleavage point (the cleavage point of ribozyme a). Has a base sequence length of 200 bps. The base sequence length between the cleavage point of ribozyme a and the cleavage point of ribozyme b is 100 bps.

Therefore, when the substrate chain c is cleaved only by the ribozyme a, two kinds of nucleic acids of 200 bps and 250 bps are produced, and when the substrate chain c is cleaved only by the ribozyme b, two of 300 bps and 150 bps are produced. Types of nucleic acids are produced. Further, when the substrate chain c is cleaved by both ribozyme a and ribozyme b, 100 bps, 150 b
Three types of nucleic acids, ps and 200 bps, are produced.

B. Preparation of Calibration Curve In the same manner as in Example 1, standard samples containing the target substance at various known concentrations were prepared, and the cleavage amount of the substrate was measured for each of them to prepare a calibration curve.

(B-1) Immune complex formation and liposome destruction- (B-3) Substrate chain cleavage For each standard sample, (B-1) to (B- in Example 1).
In the same manner as 3), an antibody-antigen-labeled antibody complex (labeled immune reaction complex) was formed, the ribozyme contained in the complex was recovered, and the substrate chain was cleaved. However, (B
As a substrate chain to be cleaved in -3), in this example, 1 mmol of the substrate chain c was used instead of 1 mmol of each of the substrate chains a and b in Example 1.

(B-4) Detection The nucleic acid mixture obtained in (B-3) of this Example 2 was electrophoresed and stained in the same manner as in Example 1. As a result, a band due to ribozyme A migration pattern was obtained with a band due to the cleaved substrate strand in addition to the band due to the substrate strand of the reaction.

As an example of the obtained migration pattern, CEA
FIG. 8 shows the electrophoretic patterns of the samples in which the concentrations of AFP and AFP were each 0.01 μmol / l. In the detection result of this sample, seven bands 71 to 77 perpendicular to the migration direction 78 were seen on the gel plate 70. The base sequence length of each band is 450 pbs for band 76, 300 bps for band 75, and 74 for band 74 in the order of increasing migration distance.
Is 250 bps, band 73 is 200 bps, band 7
2 was 150 bps, band 71 was 100 bps, and band 77 was 32 bps.

Therefore, the band 76 is the band of the unreacted substrate chain c, the band 75 is the band that appears only when the substrate chain c is cleaved by the ribozyme b, and the band 74 is the substrate chain c of the ribozyme. It is a band that appears only when it is cut into only a. Also, band 7
3 is a band indicating that the substrate chain c has been cleaved by at least ribozyme a, band 72 is a band indicating that the substrate chain c has been cleaved by at least ribozyme b, and band 71 indicates that the substrate chain c is It is considered to be a band indicating that it was cleaved by both ribozymes a and b. Band 77 is a ribozyme band.

Therefore, the stained nucleic acid 1 of each nucleotide sequence length
The fluorescence intensity per mol was obtained in advance, and the amount (mol) of the substrate cleaved by each ribozyme was obtained from the fluorescence intensity of each band 71 to 75. The amount of substrate cleaved by ribozyme a is determined by the sum of the base mass of band 74 and the base mass of band 71. Further, the amount of the substrate cleaved by ribozyme b is determined by the total of the mass of the band 75 and the mass of the band 71.

(B-5) Preparation of calibration curve In the same manner as in Example 1, the concentration of each antigen (μmol / l) in each standard sample and the amount of cleaved substrate chain (μmo)
When the relationship with 1) was plotted and a calibration curve was created, the same calibration curve as in FIG. 6 was obtained.

C. Quantitative analysis of target substance Regarding the sample containing the target substance at a known concentration (this concentration is called the true concentration), (B-1) to
The operation of (B-4) is performed to obtain the amount of the cleaved substrate chain, and the target in the sample is determined from the calibration curve prepared in (B-5) of Example 2 based on the amount of the substrate chain. When the concentration of the substance was obtained, the obtained concentration of the target substance was in agreement with the true concentration, as in Example 1. As you can see from this,
According to the inspection method of the second embodiment, a trace amount of the target substance can be accurately detected.

D. Effects of Example 2 According to Example 2, as in Example 1, the detection result is amplified by using a large amount of the ribozyme encapsulated in the liposome, so that the amount of the target substance is small. In addition, it is possible to detect with high sensitivity and with ease, and further, it is possible to perform qualitative / quantitative analysis of a plurality of types of target substances with one detection operation. Further, in the present Example 2, since two kinds of target substances can be detected using one kind of substrate chain, the cost for preparing the substrate chain can be kept low.

In the second embodiment, an example in which two kinds of antigens are quantified as target substances has been shown, but even when three or more kinds of antigens are used as target substances, each target substance is different. By using ribozymes and making the lengths of RNAs produced by cleavage by the ribozymes different from each other, individual target substances can be easily quantified.

Example 3 In this Example 3, a specific binding substance to which a ribozyme was directly bound was used as a detection reagent, and the target substances CEA and AFP present in a trace amount in the sample were
Quantify each simultaneously.

A. Preparation of Test Reagent In the present Example 3, a ribozyme-labeled antibody that is a detection reagent, a solid-phased antibody for immobilizing a target substance on a solid phase to facilitate B / F separation, and a test result are amplified. The target substance is detected using the substrate chain for So, first,
A ribozyme-labeled antibody, a solid-phased antibody, and a substrate chain were prepared.

(A-1) Synthesis of biotinylated ribozyme for labeling In Example 1, free ribozyme was encapsulated in a liposome for labeling, but in Example 3, the ribozyme was used as an antibody and an avidin-maleimide linker. Labeled by directly binding via. Therefore, in the present Example 3, a biotinylated ribozyme having a biotinylated poly A chain portion, which is a connecting portion with an antibody, at the 5 ′ end was synthesized as a label. That is, in the present Example 3, as shown in FIGS. 9 (a) and 9 (b), the structures of ribozyme a and ribozyme b were provided, and biotinylated poly A as a connecting portion with the antibody was added at the 5 ′ end. The biotinylated ribozyme having the chain portion 10 was synthesized by an automatic nucleic acid synthesizer using a well-known RNA synthesis method.

(A-2) Synthesis of Avidinylated Antibody As described above, in this example, the ribozyme and the antibody are bound via the avidin-maleimide linker. Therefore, an avidinylated antibody was synthesized.

That is, first, 3.4 mg of avidin was added to 0.3 ml of a sodium phosphate buffer solution (pH 7.
0, 0.1 mol / l), 1.2 mg there
(3600 nmol) N-succinimidyl-4-
(N-maleimidomethyl) cyclohexane-1-carboxylate was added to N, N-dimethylformamide 0.03 m.
What was melt | dissolved in 1 was added, and it was made to react at 30 degreeC for 1 hour,
The unreacted maleimide compound that had precipitated was removed by centrifugation, and the supernatant was collected. In this example, the amount of N-succinimidyl-4- (N-maleimidomethyl) cyclohexane-1-carboxylate added was 1.2 mg, but 0.8 to 1.6 mg (2400 to 4800 nm).
ol).

This supernatant was equilibrated with 0.1 mol / l sodium phosphate buffer (pH 6.0) to Sephadex G-2.
Using 5 columns (Pharmacia), the mobile phase was 0.1
Purification was performed by gel filtration using a mol / l sodium phosphate buffer (pH 6.0), and about 0.3 ml of a fraction containing a maleimide compound as a reaction product was collected.

Next, EDTA was dissolved in a sodium phosphate buffer solution at a concentration of 5 mmol / l to prepare an EDTA-containing sodium phosphate buffer solution.
About 2.0 mg of anti-CEA antibody was dissolved in ml to obtain an antibody solution.

0.3 ml of a fraction containing the above reaction product (maleimide compound) was added to 0.3 ml of this antibody solution, mixed and incubated at 4 ° C. for 20 hours. Using 1 mol / l sodium phosphate buffer (pH 6.5) as a mobile phase, 0.1 mol / l
Ul equilibrated with sodium phosphate buffer (pH 6.5)
Avidin-conjugated anti-CEA purified by gel filtration using trogel AcA 44 column (manufactured by LKB Products)
An antibody (avidinylated CEA antibody) was obtained.

Instead of 2.0 mg of anti-CEA antibody, anti-A
In the same manner, 2.0 mg of FP antibody was used to obtain an anti-AFP antibody to which avidin was bound (avidinated AFP antibody).

(A-3) Synthesis of Ribozyme-Labeled Antibody Next, the avidin-labeled antibody was reacted with a biotinylated ribozyme to bond the antibody with the ribozyme to obtain a ribozyme-labeled antibody.

That is, the avidinated CEA antibody obtained in (A-2) of this Example 3 was added to (A-1) of this Example 3.
After adding the labeled ribozyme solution (containing 1 mg of biotinylated ribozyme a) prepared in step 1 to the reaction, the reaction solution was added with 0.1 mol / l sodium phosphate buffer (pH
Sephadex G-2 equilibrated with 0.1 mol / l sodium phosphate buffer (pH 6.0) using 6.0) as a mobile phase.
Purify by gel filtration using 5 columns to obtain the desired
An anti-CEA antibody having ribozyme a bound thereto (ribozyme a labeled CEA antibody) was obtained.

Using biotinylated ribozyme b1 mg instead of biotinylated ribozyme a1 mg, avidinylated anti-C
An avidinylated anti-AFP antibody was used instead of the EA antibody, and an anti-AFP antibody to which ribozyme b was bound (ribozyme b-labeled AFP antibody) was obtained in the same manner.

(A-4) Synthesis of Substrate Chain Substrate chain a and substrate chain b were synthesized in the same manner as in Example 1.

(A-5) Preparation of immobilized antibody 0.1 mol / l sodium phosphate buffer (pH 7.
2) About 1.0 mg of the anti-CEA antibody and about 4.0 mg of the anti-AFP antibody were dissolved in 1.0 ml and placed in each well of the microtiter plate, and the mixture was allowed to stand at 4 ° C. for 1 hour.
Incubated overnight. This immobilized both antibodies in each well of the microtiter plate. Therefore, the liquid on the microtiter plate is discarded, and the microtiter plate is washed with sodium phosphate buffer (pH 7.
After washing in 2), solid-phased antibodies that were anti-CEA antibody and anti-AFP antibody immobilized on a microtiter plate were obtained. In addition, this microtiter plate was provided with a plurality of wells that were recesses that could be used as reaction vessels, and the antibody was immobilized on the inner wall of each well.

B. Preparation of Calibration Curve First, GVB containing various known concentrations of the target substances CEA and AFP (for example, 50 nmol / l each) was prepared and used as a standard sample. Each of the standard samples is subjected to the following treatments (B-1) to (B-3) using the detection reagent, the immobilized antibody and the substrate chain prepared as described above, and the results will be described later. As shown in (B-4),
A calibration curve was prepared for the quantitative analysis of the target substance.

(B-1) Formation of Labeled Immune Reaction Complex In order to facilitate B / F separation, it is preferred that either the detection reagent or the target substance is immobilized on a solid phase. . Therefore, in this example, first, the target substance is immobilized on the solid phase, and then the detection reagent is bound to the immobilized target substance. By doing so, the complex of the target substance and the detection reagent becomes a solid-phased antibody-antigen-labeled antibody complex (labeled immune reaction complex) and is immobilized, so that B /
F separation and washing become easier.

First, 5 ml of the standard sample was added to the wells of the antibody-immobilized microtiter plate prepared in (A-5) of Example 3 and incubated at room temperature for 2 hours. As a result, the target substances (CEA and AFP), which are antigens, were bound to the immobilized antibody. In order to create a calibration curve, a plurality of standard samples having different concentrations are measured using the same microtiter plate. In this case, different wells are used for each standard sample.

Then, the liquid was removed from the well to which the target substance was bound, and the well was washed with sodium phosphate buffer (pH
After washing in 7.2), two types of ribozyme-labeled antibodies, which are the detection reagents synthesized in (A-3) of this Example 3 were added to the well with a 0.1 mol / l sodium phosphate solution. 1.0 ml of a solution diluted to 50 μmol / l was added and incubated at room temperature for 1 hour. As a result, the labeled antibody bound to the antigen bound to the immobilized antibody.

Finally, after removing the liquid from the well, the well is washed with a sodium phosphate buffer (pH 7.2) to remove the unreacted detection reagent, and the immobilized antibody-antigen (C
EA) -labeled antibody complex (labeled immune reaction complex) was obtained.

(B-2) Cleavage of substrate MgC was added to the well so as to be 25 mmol / l in 50 mmol / l Tris-HCl buffer (pH 8.0).
1 ml of the solution to which ₁₂ was added was added, and (A-
1 mmol of each of the substrate chains a and b prepared in 4) (as a result, the concentration of each substrate chain becomes 1.0 μmol / l) was added to prepare a ribozyme reaction solution. This ribozyme reaction solution was incubated at 37 ° C. for 3 hours.
As a result, the substrate chain was cleaved by the action of ribozyme.
The reaction solution was treated with phenol / chloroform, ethanol was added to precipitate the nucleic acid, and the nucleic acid was collected by filtration to obtain a nucleic acid mixture of an unreacted substrate chain and a cleaved substrate chain.

(B-3) Detection The total amount of the nucleic acid mixture obtained in (B-3) of Example 3 was adjusted to 5 mmol / l in 0.5 ml of urea-EDTA solution (8N urea aqueous solution). Dissolved in EDTA (pH 7)), and an equal amount of sucrose / dye solution (20% sucrose aqueous solution, 5 mmol /
To a solution (pH 7) in which EDTA was dissolved to give
0.05% Bromophenol Blue and 0.05%
Xylene cyanol FF) was added). This solution was electrophoresed on an acrylamide gel containing 8.3 mol / l urea aqueous solution and stained with ethidium bromide. As a result, in addition to the band due to the ribozyme and the band due to the unreacted substrate chain, , A migration pattern having bands due to the further cleaved substrate strand was obtained.

As an example of the obtained migration pattern, CEA
FIG. 10 shows the migration patterns of the samples in which the concentrations of AFP and AFP were each 0.01 μmol / l. In the detection result of this sample, four bands 101 to 104 perpendicular to the migration direction 105 were seen on the gel plate 100. The base sequence length of each band is 400 pbs for band 104 and 300 bp for band 103 in order from the one having the shortest migration distance.
s, band 102 is 200 bps, band 101 is 15
It was 0 bps. Therefore, the band 104 is the band of the unreacted substrate chain a, the band 103 is the band of the unreacted substrate chain b, the band 102 is both the bands obtained by cleaving the substrate chain a, and the band 101 is It is considered that both bands are obtained by cutting the substrate chain b.

Therefore, the stained nucleic acid 1 of each nucleotide sequence length
The fluorescence intensity per mol is obtained in advance, the amount (mol) of the cleaved substrate chain a is determined from the fluorescence intensity of the band 102 of the cleaved substrate chain a, and the band 101 of the cleaved substrate chain b is obtained. From the fluorescence intensity of the cleaved substrate chain b
The amount (mol) of was determined.

(B-4) Preparation of calibration curve For each standard sample of known concentration, (B-1) to (B-
After performing the detection procedure in 3), the concentration of each antigen (μ
(mol / l) and the amount (μmol) of the cleaved substrate chain were plotted to obtain a calibration curve similar to that shown in FIG.

C. Quantitative analysis of target substance Based on the calibration curve prepared as described above, for the sample containing the target substance of known concentration (this concentration is called the true concentration), the above (B-1) to (B-3 ), The amount of the cleaved substrate chain is determined, and based on the amount of the substrate chain, (B
When the concentration of the target substance in the sample was determined from the calibration curve prepared in -4), the determined concentration of the target substance was in agreement with the true concentration. As can be seen from this, the third embodiment
According to this inspection method, a trace amount of the target substance can be accurately detected.

D. Effects of Example 3 According to Example 3, the test result is amplified by the action of the ribozyme as a catalyst, so that even a small amount of the target substance can be detected with high sensitivity and easily. Also,
According to the third embodiment, by using different ribozymes for each target substance, it is possible to perform qualitative / quantitative analysis of a plurality of types of target substances existing in the same sample by one detection operation.

<Example 4> In Example 4, as in Example 2, an antibody to which a ribozyme was directly bound was used as a detection reagent to quantitatively analyze CEA and AFP present in a trace amount in a sample. did. However, in Example 3, two types of substrate chains corresponding to two types of ribozymes were used as the substrate chains for confirming the release of the ribozyme, but in Example 4, two types of substrate chains were used for one type of substrate chain. Analyze a variety of target substances.

A. Preparation of Test Reagent (A-1) Synthesis of Ribozyme to (A-3) Synthesis of Detection Reagent In the same manner as in Example 3, a ribozyme a-labeled antibody and a ribozyme b-labeled antibody were prepared.

(A-4) Synthesis of Substrate Chain Substrate chain c was synthesized in the same manner as in Example 2.

(A-5) Preparation of immobilized antibody An immobilized antibody was prepared in the same manner as in Example 3.

B. Preparation of Calibration Curve In the same manner as in Example 3, standard samples containing the target substance at various known concentrations were prepared, and the cleavage amount of the substrate was measured for each of them to prepare a calibration curve.

(B-1) Formation of Labeled Immune Reaction Complex-
(B-2) Cleavage of substrate chain For each standard sample, (B-1) to (B- in Example 3)
In the same manner as 2), a solid-phased antibody-antigen-labeled antibody complex was formed, a substrate chain was added, and this was cleaved. However, as the substrate chain to be cleaved in (B-2), this Example 4
Then, 1 mmol each of the substrate chains a and b in Example 3
Substrate chain c1 mmol was used instead of.

(B-3) Detection The nucleic acid mixture obtained in (B-2) of this Example 4 was electrophoresed and stained in the same manner as in Example 3. As a result, a band due to ribozyme A migration pattern was obtained with a band due to the cleaved substrate strand in addition to the band due to the substrate strand of the reaction.

As an example of the obtained migration pattern, CEA
FIG. 11 shows the migration patterns of the samples having the concentrations of 0.01 μmol / l and AFP, respectively. In the detection result of this sample, six bands 111 to 116 perpendicular to the migration direction 117 were seen on the gel plate 110. The base sequence length of each band is 450 pbs for band 116 and 300 bp for band 115 in order from the one having the shortest migration distance.
s, band 114 is 250 bps, band 113 is 20
0 bps, band 112 is 150 bps, band 111
Was 100 bps.

Therefore, the band 116 is the unreacted substrate chain c.
Band 115 is a band that appears only when the substrate chain c is cleaved only by ribozyme b, and band 114 is a band that appears only when the substrate chain c is cleaved only by ribozyme a. . Band 113 is a band showing that the substrate chain c has been cleaved by at least ribozyme a.
Is a band indicating that the substrate chain c has been cleaved by at least ribozyme b. Band 111 indicates the substrate chain c
Is considered to be a band showing that it was cleaved by both ribozymes a and b.

Therefore, the stained nucleic acid 1 of each nucleotide sequence length
The fluorescence intensity per mol was obtained in advance, and the amount (mol) of the substrate cleaved by each ribozyme was obtained from the fluorescence intensity of each band 111 to 115. The amount of substrate cleaved by ribozyme a is determined by the sum of the mass of the band 114 and the mass of the band 111. The amount of substrate cleaved by ribozyme b is
It is determined by the sum of the basic mass of the band 115 and the basic mass of the band 111.

(B-4) Preparation of calibration curve In the same manner as in Example 3, the concentration of each antigen (μmol / l) in each standard sample and the amount of cleaved substrate chain (μmo)
When the relationship with l) was plotted and a calibration curve was created, the same calibration curve as in Example 3 was obtained.

C. Quantitative Analysis of Target Substance Regarding the sample containing the target substance at a known concentration (this concentration is called the true concentration), (B-1) to
The procedure of (B-2) is performed to obtain the amount of the cleaved substrate chain, and the target in the sample is determined from the calibration curve prepared in (B-3) of Example 4 based on the substrate chain amount. When the concentration of the substance was obtained, the obtained concentration of the target substance was in agreement with the true concentration, as in Example 3. As you can see from this,
According to the inspection method of Example 4, a trace amount of the target substance can be accurately detected.

D. Effect of Example 4 According to Example 4, as in Example 3, even if the target substance is in a small amount, it can be detected easily with high sensitivity.
In addition, multiple types of target substances present in the same sample
Qualitative / quantitative analysis can be performed with a single detection operation.

As in Example 2, even when three or more types of antigens are used as target substances, different ribozymes are used for each target substance, and the length of RNA cleaved by each ribozyme is By making them different from each other, individual target substances can be easily quantified respectively.

Example 5 Next, an example in which the test result is amplified using an amplification material to which a ribozyme is bound will be described. In Example 5, the specific binding substance having the first ribozyme bound thereto as a label was used as the detection reagent, and the first ribozyme bound to the complex of the detection reagent and the target substance was used to generate the second ribozyme in the amplification material. The bond between the (hammerhead type ribozyme) and the immobilized carrier is cleaved to release the second ribozyme, and the liberated second ribozyme cleaves the amplification substrate chain, and the cleaved amplification substrate chain The CEA present in a trace amount in the sample is quantitatively analyzed by detecting.

A. Preparation of test reagent First, a ribozyme-labeled antibody, an amplifying material, a substrate chain, and a solid-phased carrier were prepared. The ribozyme used as the label of the detection reagent in Example 5 is called ribozyme d, and the ribozyme used for amplifying the test result is called ribozyme e.

(A-1) Synthesis of Labeling Nucleic Acid Fragment First, in order to obtain a ribozyme-labeled antibody, a single-stranded RNA for labeling was synthesized by a known method using an automatic nucleic acid synthesizer.

As shown in FIG. 12, the labeling RNA of Example 5 had biotinylated poly A chain 10,
It comprises a ribozyme cleavage sequence 121 of ribozyme e, a first binding site 16 with the substrate chain, a catalytic loop site 15, and a second binding site 17 with the substrate chain. First with substrate chain
Of the binding site 16 is 5'UAAAA3 ', the sequence of the catalytic loop site 15 is 5'CUGAUGAGUCCGUGAGGACGAAAC3', and the sequence of the second binding site 17 with the substrate chain is 5'AAU3 '.
Is. In addition, biotinylated poly A for connection with antibody
The sequence of chain 10 is 5'AAAAAAAA3 'and the ribozyme cleavage sequence 121 of ribozyme e is 5'GCCGUCCCCCG3'.

Ribozyme cleavage sequence 121 of ribozyme e
Among them, the sequence “GCCCC” 26 on the 3′-terminal side and the sequence “CCG” 27 on the 5′-terminal side are binding sites for ribozyme e, and the central sequence “CUG” 25 is a cleavage point sequence. The cleavage point is between the cleavage point sequence 25 and the sequence 26 on the 3'end side. The cleavage point sequence of ribozyme e is
“GUX (X is one of C, U and A)”. In this Example 5, a portion of the RNA on the 3′-end side of the ribozyme e cleavage point, that is, the sequences 26, 16,
The portions of 15 and 17 are called the ribozyme d portion.
Ribozyme d is obtained by releasing this portion.

(A-2) Synthesis of Ribozyme-Labeled Antibody Instead of ribozyme a or b, (A-) of Example 5 was used.
Using the labeling RNA synthesized in 1), (A-
In the same manner as 2) to (A-3), an anti-CEA antibody labeled with ribozyme d was obtained.

(A-3) Synthesis of nucleic acid fragment for amplification material Single-stranded RNA for amplifying the detection result was synthesized by a well-known method using an automatic nucleic acid synthesizer.

As shown in FIG. 13, the RNA for amplification material of Example 5 had biotinylated poly A chain 2 in order from the 5 ′ end.
0, a ribozyme cleavage sequence 131 of ribozyme d, a first binding site 18 with a substrate chain, a catalytic loop site 15, and a second binding site 19 with a substrate chain. The base sequence of the first binding site 18 with the substrate chain is 5'CGGGG3 ',
The sequence of the catalytic loop site 15 is 5'CUGAUGAGUCCGUGAGGACGAA
AC 3'and the sequence of the second binding site 19 to the substrate chain is 5 '
It is GGC3 '. The sequence of biotinylated poly A chain 20 for connection with the antibody is 5'AAAAAAAAAAAAAAAAAAAAAAAAA3 '.
And the ribozyme cleavage sequence 131 of ribozyme d is 5 '
It is AUUGUCUUUUA3 '.

Of the ribozyme cleavage sequence 131 of this RNA for amplification material, the 3′-terminal side sequence “AUUUU” 28 and the 5′-terminal side sequence “UUA” 29 are binding sites for ribozyme d and are located at the center. Sequence "CUG" 25 is the breakpoint sequence. This cleavage point sequence 25 and the sequence 28 on the 3'end side
The break point is between and. The cleavage point sequence of ribozyme d is "GUX (X is any one of C, U and A)". In the present Example 5, a portion of the RNA on the 3 ′ end side of the ribozyme d cleavage point, that is, the sequence 2
Portions 8, 18, 15, and 19 are referred to as the ribozyme e portion. Ribozyme e is obtained by releasing this portion.

(A-4) Preparation of Amplifying Material Next, the amplifying RN obtained in (A-3) of this Example 5 was used.
A was immobilized on beads and used as an amplifying material.

1.0 mg of "Dynabeads oligo (d
T) 25 "(DYNABEADS Oligo (dT) 25: manufactured by Dynal)
Binding buffer (100 mmol / l Tris-H
LiCl was added to a Cl buffer (pH 8.0) so as to be 400 mmol / l, and further 20 mmol / l
To 200 μl of EDTA-containing solution), the amplification RNA prepared in (A-3) was added, and the mixture was gently stirred, and then allowed to stand at room temperature. The beads were collected after 3 to 5 minutes, and 100 mmol / l of Tris-HCl was collected.
After washing twice with a buffer solution (pH 8.0), ribozyme e
An amplification material, which was a bead immobilized via the ribozyme cleavage sequence of ribozyme d and the biotinylated poly A chain, was obtained.

(A-5) Synthesis of Substrate Chain Next, a substrate chain e which is a substrate chain for confirming the release of ribozyme e was synthesized. The synthesis was performed by a well-known RNA synthesis method using an automatic nucleic acid synthesizer. Substrate chain e
As shown in FIG. 14, has a base sequence length of 400 bps and has only one ribozyme cleavage sequence of ribozyme e.

The sequences of the substrate chain e represented by θ and θ ′ in FIG. 14 are arbitrary base sequences which do not include the ribozyme cleavage sequence of ribozyme e. The remaining sequence (sequence represented as ι in FIG. 14) is the ribozyme cleavage sequence of ribozyme e, and the sequence is 5′GCCGUCCCCG3 ′.
Of these, 3'terminal sequence "CCCCG" 26 and 5 '
The terminal side sequence "GCC" 27 is a sequence that forms a base pair with the binding sites 18 and 19 of the ribozyme e for binding to the substrate, and the sequence "GUC" 25 sandwiched between these binding site sequences 21 and 22. Is a sequence by which ribozyme a identifies a cleavage point (cleavage point sequence). That is, the ribozyme cleavage sequence of ribozyme a in the base sequence of substrate chain a is sequences 21, 22, and 25.

FIG. 15 shows ribozyme e152 and substrate chain e.
151 schematically shows the binding state with 151. Substrate chain e151
The sequence 26 forms a base pair with the first binding site sequence 18 of the ribozyme e152, and the sequence 27 forms the ribozyme e152.
By forming a base pair with the second binding site sequence 19 of 152, it binds to the molecule of ribozyme e151 as shown in FIG. When the catalytic conditions are satisfied in this bound state, the sequence 25 of the substrate chain e is cleaved by the catalytic loop site sequence 15 of the ribozyme e.

The cleavage point sequence of ribozyme e is "G
UX (X is any one of C, U and A) ”, and the cleavage point sequence“ GUC ”25 and the sequence 26 of the substrate chain e.
The disconnection point is between “CCCCG”. As shown in FIG. 14, in the substrate chain e, the base sequence length from the 3 ′ end of the substrate chain e to the cleavage point and the base sequence length from the 5 ′ end of the substrate chain e to the cleavage point are 200 bps for both
Is. Therefore, when the substrate chain e is cleaved by the ribozyme e, a 200 bps nucleic acid is produced.

(A-6) Preparation of solid-phased antibody In the same manner as in Example 3, a solid-phased antibody which is a microtiter plate having an antibody immobilized in each well was prepared.
However, in Example 3, the anti-CEA antibody and the anti-AFP antibody were used, but in Example 5, the anti-CEA antibody was about 4.0.
Only mg was used.

B. Preparation of Calibration Curve First, GVB containing CEA as a target substance at various known concentrations (for example, 50 nmol / l each) was prepared and used as a standard sample. For each of these standard samples, using the detection reagent, immobilized antibody and substrate chain prepared as described above,
The following processes (B-1) to (B-4) were performed, and from the results, as shown in (B-5) described later, a calibration curve for quantitative analysis of the target substance was prepared.

(B-1) Formation of labeled immune reaction complex In the same manner as in Example 3, a solid-phased antibody-antigen-labeled antibody complex was obtained. However, as the immobilized antibody, this Example 5
Using the one prepared in (A-6) of, as a standard sample,
The sample prepared in Example 5 (without AFP) was used, and the labeled antibody synthesized in (A-2) of Example 5 was used.

(B-2) Release of Ribozyme for Amplification The well prepared in (B-1) of Example 5 and having a complex on the surface was prepared in (A-4) of this example. Ribozyme reaction solution containing the entire amount of the labeled nucleic acid beads (50 mm
ol / l Tris-HCl buffer (pH 8.0),
MgCl ₂ was dissolved therein so that the concentration became 25 mmol / l, and the mixture was incubated at 37 ° C. for 3 hours. As a result, the ribozyme cleavage sequences of the complex and the amplification material were cleaved, and ribozymes d and e were released. That is, the ribozyme d portion of the complex and the free ribozyme d cleave the ribozyme cleavage sequence 131 of the amplification material to release the ribozyme e, and the ribozyme e portion of the amplification material and the released ribozyme e form the immune complex. Ribozyme cleavage sequence 121 was cleaved to release ribozyme d.

After the reaction, the beads were removed from the well to obtain a ribozyme reaction solution containing liberated ribozymes d and e.

(B-3) Cleavage of substrate chain 50 mmol / l Tris-HCl buffer (pH 8.
0) to MgCl ₂ at 25 mmol / l, the substrate chain e prepared in (A-4) of this Example 3 was added.
Is dissolved to 1 μmol / l, and the substrate chain e
It was a solution.

1 ml of this substrate chain e solution was placed in the well holding the reaction solution containing the free ribozyme obtained in (B-2) of Example 5 and incubated at 37 ° C. for 3 hours. As a result, the substrate chain e was cleaved by the action of ribozyme e. After the reaction solution is treated with phenol / chloroform, ethanol is added to precipitate the nucleic acid, which is then collected by filtration.
A nucleic acid mixture of ribozymes d and e, unreacted substrate chain e, and cleaved substrate chain was obtained.

(B-4) Detection When the whole amount of the nucleic acid mixture obtained in (B-3) of this Example 5 was used and subjected to electrophoresis and staining in the same manner as in Example 3, it was attributed to ribozyme. A migration pattern was obtained with bands and bands due to unreacted substrate strands, as well as bands due to further cleaved substrate strands.

As an example of the obtained migration pattern, CEA
FIG. 16 shows the migration pattern of the sample having a concentration of 0.01 μmol / l. In the detection result of this sample, three bands 161 to 163 perpendicular to the migration direction 164 were seen on the gel plate 160. The base sequence length of each band is 40 in the order from the shorter migration distance.
0 pbs, band 161 is 300 bps, band 163
Was 37 bps. Therefore, it is considered that the band 162 is the band of the unreacted substrate chain e, and the band 161 is both the bands of the substrate chain e cleaved. The base sequence lengths of the ribozymes d and e are the same as those of the connection sites 26, 28 of the ribozyme cleavage sequences 121, 131.
The band 163 is a band of ribozymes d and e, since it is considered to be 37 bps since it contains.

The fluorescence intensity per 1 mol of the stained nucleic acid of each base sequence length was obtained in advance, and the amount of the cleaved substrate chain e (mol was calculated from the fluorescence intensity of the band 161 of the cleaved substrate chain e). ) Was asked.

(B-5) Preparation of calibration curve (B-1) to (B-
Performing the detection procedure in 4), the concentration of each antigen in the standard sample (μ
(mol / l) and the amount of the cleaved substrate chain (μmol) were plotted, and the calibration curve shown in FIG. 17 was obtained.

C. Quantitative Analysis of Target Substance Based on the calibration curve prepared as described above, for the sample containing the target substance of known concentration (this concentration is called the true concentration), the above (B-1) to (B-4 ), The amount of the cleaved substrate chain is determined, and based on the amount of the substrate chain, (B
When the concentration of the target substance in the sample was obtained from the calibration curve prepared in -5), the obtained concentration of the target substance was in agreement with the true concentration. As can be seen from this, Example 5
According to this inspection method, a trace amount of the target substance can be accurately detected.

D. Effects of this Example According to this Example 5, since the ribozyme is used in two stages and the detection result is amplified in two stages, a trace amount of the target substance can be accurately detected. Even when the ribozyme is used in two steps as in Example 5, by using different ribozymes for each target substance as in Example 3 or 4, it is possible to obtain a plurality of types of objectives present in the same sample. The substance can be qualitatively / quantitatively analyzed with a single detection operation.

[0187] In Example 5, ribozyme d and ribozyme c were provided between the ribozyme d and the antibody, and between the ribozyme e and the immobilization carrier, respectively. e are each other,
It is designed to release each other. Thus, in Example 5, reaction inhibition such as steric hindrance due to the binding of the ribozyme to the complex or the immobilization carrier is avoided, and thus the reaction of liberating the ribozyme e by the ribozyme d is smoothly performed. Good amplification can be realized.

In Example 5, RNA having a structure in which the cleavage point by ribozyme e was located exactly in the center
Is used as the substrate chain. In this way, if the cleavage point is at the center, the base sequences of two nucleic acids produced by the cleavage will have the same base sequence length, so the number of molecules of the nucleic acid having the base sequence length after cleavage will be the same as that of the cleaved substrate chain. Double the number.
On the other hand, when a substrate chain having no cleavage point in the center is used, the base sequence lengths of the two nucleic acids after cleavage are different from each other, so the base sequence lengths after cleavage are two types, and the number of each molecule is It will correspond to the number of molecules in the chain. Therefore, when separating according to the base sequence length by electrophoresis or chromatography etc., it is better to use a substrate with a cleavage point in the center rather than a substrate chain without a cleavage point in the center. Since the signal of 2 is doubled, it can be detected with a better S / N ratio (ratio of signal to noise).

[0189]

As described above, according to the present invention, a trace amount of a target substance can be detected easily and with high sensitivity. Further, according to the present invention, a plurality of types of target substances existing in the same sample can be simultaneously detected.

[Brief description of drawings]

FIG. 1 is a nucleotide sequence diagram showing a constitutional example of a ribozyme.

FIG. 2 is a nucleotide sequence diagram showing a constitutional example of a substrate chain having one ribozyme cleavage sequence.

FIG. 3 is a schematic diagram showing a binding state between a ribozyme and a substrate chain.

FIG. 4 is a schematic diagram showing a binding state between a ribozyme and a substrate chain.

FIG. 5 is a schematic diagram showing an example of an electrophoretic pattern obtained in Example 1.

FIG. 6 is a graph showing a calibration curve obtained in Example 1.

FIG. 7 is a nucleotide sequence diagram showing a constitutional example of a substrate chain having two ribozyme cleavage sequences.

FIG. 8 is a schematic diagram showing an example of the migration pattern obtained in Example 2.

FIG. 9 is a nucleotide sequence diagram showing a constitutional example of a ribozyme having a biotinylated poly A chain portion.

FIG. 10 is a schematic diagram showing an example of an electrophoretic pattern obtained in Example 3.

FIG. 11 is a schematic diagram showing an example of the migration pattern obtained in Example 4.

FIG. 12 is a nucleotide sequence diagram showing a constitutional example of a ribozyme having a biotinylated poly A chain portion and a ribozyme cleavage sequence.

FIG. 13 is a nucleotide sequence diagram showing a constitutional example of RNA for an amplification material used in Example 5.

FIG. 14 is a nucleotide sequence diagram showing a constitutional example of a substrate chain having one ribozyme cleavage sequence used in Example 5.

FIG. 15 is a schematic diagram showing a binding state between a ribozyme and a substrate chain.

16 is a schematic diagram showing an example of the migration pattern obtained in Example 5. FIG.

FIG. 17 is a graph showing a calibration curve obtained in Example 5.

[Explanation of symbols]

α, α ', γ, γ', ε, ε'ε ”, θ, θ ... Arbitrary base sequence, β, δ, ζ, η, ι, 121, 131 ... Ribozyme cleavage sequence, 10, 20 ... Biotinylation Poly A chain part, 1
1 to 14, 16 to 19 ... Binding site base sequence with substrate, 1
5 ... Base sequence of catalytic loop site, 21-24, 26-29
... base sequence of binding site with ribozyme, 25 ... cleavage sequence, 31 ... substrate chain a, 32 ... ribozyme a, 40, 7
0,100,110,160 ... Gel plate, 41-45,7
1-77, 101-104, 111-116, 161-
162 ... Nucleic acid bands, 46, 78, 105, 117,
163 ... Migration direction, 51 ... Substrate chain b, 52 ... Ribozyme b, 151 ... Substrate chain e, 152 ... Ribozyme e.

─────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] February 28, 1995

[Procedure Amendment 1]

[Document name to be amended] Statement

[Correction target item name] 0073

[Correction method] Change

[Correction content]

0.05 μmol of the obtained PDP-DPPE and 0.5 μm of dipalmitoylphosphatidylcholine (DPPC)
ol, cholesterol 0.5 μmol, (A-1)
0.1 mol of ribozyme a synthesized in Section 1 was mixed and suspended to form a lipid thin film.
ffered saline) was added and the mixture was stirred with a Vortex mixer to prepare liposomes.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical display location C07K 14/42 8517-4H 14/705 8517-4H 16/00 8517-4H C12N 15/09 ZNA G01N 33/53 JN 33/535

Claims (21)

[Claims] 1. A complex is formed by binding a detection reagent having a specific binding moiety having a property of specifically binding to a target substance and a labeling moiety in one molecule and the target substance in a sample. And a detection step of estimating the presence and / or amount of the target substance in the sample by using the labeled portion in the complex, the labeled portion is a ribozyme. In the detection step, a substrate chain that is a nucleic acid molecule having a ribozyme cleavage sequence that is a base sequence that is cleaved by the ribozyme in at least a part of the molecule is cleaved by the ribozyme of the labeling moiety to be cleaved. And a nucleic acid detection step of detecting the cleaved nucleic acid. 2. The combination of the target substance and the specific binding moiety according to claim 1, wherein an antigen or a hapten and an antibody, a physiologically active substance and a receptor for the physiologically active substance, a nucleic acid and a complementary to the nucleic acid. A specific binding test method, which is one of a nucleic acid having a unique base sequence, a polysaccharide and a lectin, and an immunoglobulin G and a protein A. 3. The specific binding test method according to claim 1, wherein each molecule of the substrate chain is provided with the ribozyme cleavage sequence at a predetermined position in the molecule. 4. The ribozyme cleavage sequence according to claim 3, wherein two nucleic acid molecules produced by cleavage of one molecule of the substrate chain having the ribozyme cleavage sequence by the ribozyme have the same base sequence length. Specific binding test method characterized by existing at various positions. 5. The target substance according to claim 1, wherein the target substance is a plurality of types, the detection reagent is used in a plurality of types according to the target substance, and the specific binding moieties of the respective types of detection reagents correspond to each other. Which has a property of specifically binding to a target substance, the labeled portion of each type of detection reagent is a ribozyme that cleaves a different sequence for each corresponding target substance, and the substrate chain is bound to the ribozyme. A plurality of different types are used according to the present invention, and each type of substrate chain has a ribozyme cleavage sequence of the corresponding ribozyme in the molecule. 6. The specific binding test method according to claim 5, wherein the substrate chains of each type do not have a ribozyme cleavage sequence of another ribozyme that is simultaneously synthesized. 7. The position of the ribozyme cleavage sequence in each of the above types of substrate chains is determined in advance for each corresponding ribozyme, and the position of the nucleic acid cleaved by the corresponding ribozyme is determined. A specific binding test method characterized in that base sequence lengths are different from each other for each corresponding ribozyme. 8. The target substance according to claim 1, wherein a plurality of types of the target substance are used, and a plurality of types of the detection reagents are used according to the target substance, and the specific binding moieties of the respective types of detection reagents correspond to each other. Has a property of specifically binding to a target substance, and the labeling moiety of each type of detection reagent is a ribozyme that cleaves a different sequence for each corresponding target substance. A specific binding test method characterized by having a ribozyme cleavage sequence of the ribozyme of each of the above detection reagents. 9. The position of the ribozyme cleavage sequence in the substrate chain according to claim 8, which is predetermined for each ribozyme, and the nucleotide sequences of nucleic acids cleaved by the ribozymes have different nucleotide sequence lengths from each other. A specific binding test characterized by being present. 10. The complex formation step according to claim 1, wherein the target substance in the sample is immobilized on a solid-phase carrier, and the detection reagent is bound to the immobilized target substance. A specific binding test method comprising: 11. The specific binding test method according to claim 1, wherein the detection reagent is immobilized on a solid-phase carrier. 12. The detection reagent according to claim 1, further comprising a liposome portion, wherein a ribozyme which is a labeling portion of the detection reagent is retained inside the liposome, and the detection step comprises the substrate chain. The specific binding test method further comprising, before the cleavage step, a liposome disruption step of disrupting the liposome to release the molecule of the ribozyme retained therein. 13. The target substance according to claim 12, wherein the target substance is an antigen, the specific binding moiety is an antibody against the target substance, and the complex further comprises an antibody against the target substance-target substance- A method for detecting specific binding, which is a detection reagent complex, wherein the destruction of the liposome in the liposome destruction step is performed by causing the complement of the antibody to act on the antibody-target substance-detection reagent complex. 14. The substrate chain according to claim 1, further comprising a ribozyme base sequence, and when the substrate chain is cleaved in the substrate chain cleavage step, the base sequence portion of the ribozyme is released. Second
The detection step has a ribozyme cleavage sequence, which is a base sequence cleaved by the second ribozyme, in at least a part of the molecule between the substrate chain cleavage step and the nucleic acid detection step. A second substrate chain cleaving step of cleaving the second substrate chain which is a nucleic acid molecule with the second ribozyme to obtain a cleaved nucleic acid is further provided, and the cleaving detected by the nucleic acid detecting step is performed. The specific binding test method is characterized in that the nucleic acid is a nucleic acid cleaved by the second substrate chain cleavage step. 15. The substrate chain according to claim 14, wherein the substrate chain is immobilized on an immobilization carrier, and the ribozyme cleavage sequence of the ribozyme that is the labeling moiety is the immobilization carrier and the base sequence of the second ribozyme. A specific binding test characterized by being present between the. 16. A specific binding reagent comprising a specific binding portion for a predetermined substance to be tested and a ribozyme. 17. The specific binding reagent according to claim 16, further comprising a liposome bound to the specific binding portion, wherein the ribozyme is retained inside the liposome. 18. The specific binding reagent according to claim 16, wherein the specific binding portion and the ribozyme are directly bound via a chemical bond. 19. The specific binding reagent according to claim 18, wherein the chemical bond is avidin-maleimide bond. 20. A labeling reagent, which is a single-stranded ribonucleic acid having a predetermined connecting portion with a specific binding substance for a substance to be inspected and a ribozyme sequence. 21. The sequence according to claim 20, wherein a sequence cleaved by a restriction enzyme or a ribozyme is provided between the connecting portion and the ribozyme sequence.
A labeling reagent, further comprising: