JPH08143598A - Anti-tie monoclonal antibody and hybridoma - Google Patents

Abstract

PURPOSE: To obtain a new anti-Tie monoclonal antibody capable of specifically recognizing the extracellular domain of Tie, a receptor protein activating an intracellular tyrosine kinase active domain, and useful for detecting/quantifying Tie, diagnosing leukemia, separating hematopoietlc cells, etc. CONSTITUTION: mRNA is separated from human megakaryoblast-based leukemia cell strain VT-7, and using the mRNA as template, cDNA is synthesized, and then a cDNA library is made by conventional means; the library is then screened by RT-PCR by using a primer having a base sequence preserved intensely in a tyrosine kinase domain to obtain the Tie gene, which is, in turn, incorporated into a vector and manifested in host cells to prepare human Tie extracellular domain protein, which is then administered together with an adjuvant to mice to effect immunization; the splenocytes of the mice are extracted and fused with mouse myeloma cells, an antibody-productive strain is selected and cloned, and the resultant hybridoma are cultured, thus obtaining the objective new monoclonal antibody capable of specifically recognizing Tie extracellular domain.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a monoclonal antibody that specifically recognizes the extracellular domain of Tie, and a hybridoma producing the anti-Tie monoclonal antibody. Tie is a type of receptor protein whose intracellular domain having tyrosine kinase activity is activated when its extracellular domain binds to a ligand. Focusing on its enzymatic activity and unique domain structure, Tie
ne kinase-Immunoglobulin
like domain-EGF (epidermal growth factor: ep
normal growth factor) hom
It is named from the logic domain.
As used herein, “Tie” means the protein,
The gene encoding Tie is referred to as "tie gene".

[0002]

2. Description of the Related Art The human tie gene was cDNA cloned from human erythroleukemia cells (HEL cells) (Parta
nen J., et al., Mol. Cell. Biol., 12, 1698-1707, 1992: WO
93/14124). Its gene product, human Tie, is a single-transmembrane receptor protein having a tyrosine kinase domain in its intracellular domain, and is considered to be a member of the receptor tyrosine kinase family because of its structural characteristics. Factors involved in cell proliferation, such as P
DGF (platelet-derived growth factor: platelet-de
driven grow factor), EGF
(Epidermal growth factor: epidermal growth
factor), FGF (fibroblast growth factor: fib
roblast grow factor), IG
F-1 (insulin-like growth factor-1: insulin-
like growth factor-1), NGF
(Nerve growth factor: nerve growfact
or), VEGF (vascular endothelial growth factor: vascula)
r endotherial growth facto
r), SCF (stem cell growth factor: stem cellf)
The majority of the receptors such as the (actor) are receptor tyrosine kinases (B. Alberts et al., Molecular Bi
ology of The Cell, 3rd ed, Garland, 1994, pp 760-761).
However, the ligand for Tie has not been identified,
The function of Tie in vivo is unknown.

Conventionally, the expression of the tie gene in vivo has mainly been carried out by tie mRNA using the Northern blotting method.
It has been confirmed at the transcription level by the detection of As a result, it has been shown that tie mRNA is mainly present in vascular endothelial cells, specific leukemia cell lines, etc. (Schnurch
H., and Risau W., Development 119,957-968,1993; Sa
to TN., et al., Proc Natl Acad Sci USA., 90,9355-935
8,1993; Maisonpierre PC., Et al., Oncogene, 8,1631-1
637,1993; Armstrong, E., et al., Leukemia, 7,1585-159.
1, 1993). However, since the regulatory mechanism of Tie expression at the translational level and the stability of its protein have not been elucidated, the Northern blotting analysis only gives an indirect suggestion of the expression level of Tie. Therefore, in order to quantify the expression of Tie for histological and biochemical studies of Tie, and further for diagnostic purposes, it is necessary to directly measure the amount of expressed protein. For that purpose, it is necessary to prepare an antibody that specifically recognizes Tie.

As an antibody that specifically recognizes Tie, a rabbit polyclonal antibody that recognizes the intracellular domain of Tie has been reported (Partanen J., et.
al., Mol. Cell. Biol., 12, 1698-1707, 1992: WO93 / 14124).
. However, this polyclonal antibody cannot be used for detection of Tie expressed on the cell membrane of living cells because of its property of recognizing only intracellular domain. Further, since it is a polyclonal antibody, it is difficult to obtain a homogeneous standard sample with good reproducibility and in large quantities.

[0005]

SUMMARY OF THE INVENTION Therefore, an object of the present invention is to provide a monoclonal antibody capable of specifically recognizing the extracellular domain of Tie and a hybridoma producing the monoclonal antibody.

[0006]

The present invention relates to a monoclonal antibody that specifically recognizes the extracellular domain of Tie. The present invention also relates to a hybridoma producing the above monoclonal antibody.

Hereinafter, the present invention will be described in detail. Examples of the immunogen used for obtaining the anti-Tie monoclonal antibody according to the present invention include an antigen protein consisting of the full-length sequence or partial sequence of Tie (particularly, extracellular domain or its partial sequence). Tie is preferably human Tie, but Tie derived from another mammal can also be used. For example, various synthetic peptides consisting of a partial sequence of the extracellular domain of Tie (for example, CNKG
DTAVLSARVHKE (SEQ ID NO: 1 in Sequence Listing), C
PPLLLEKDDRIV (SEQ ID NO: 2 in Sequence Listing), C
VDRPEETST (SEQ ID NO: 3 in Sequence Listing), CSIE
LRKPDGT (SEQ ID NO: 4 in the sequence listing) and the like: the above is a one-letter code for amino acids) themselves or KL
Immobilized on a carrier such as H (keyhole lympet hemocyanin), TP expressing a large amount of tie mRNA
A (12-O-tetradecanoylphorb
13-acetate) -treated UT-7 cells (human megakaryoblastic leukemia cell line; Cancer res., 51, 341, 199).
1) The antigen itself can be prepared or recombinant Tie can be prepared. It is preferable to use pure Tie as an antigen.

The Tie antigen can be expressed in large amounts in animal cells (Cos cells or CHO cells, etc.), yeast, Escherichia coli, etc. by gene recombination technology (Goeddel, DVe
d.Method in Enzymology, vol185, Academic Press, 199
0). As a host for expressing Tie, it is preferable to use animal cells such as Cos cells or CHO cells.
To produce the anti-Tie antibody of the present invention, the full-length protein of Tie may be used as an antigen. However, in order to efficiently obtain an antibody that recognizes only the extracellular domain, full-length Tie is used.
It is desirable to use the extracellular domain protein of Tie in which the intracellular domain has been removed from the ie by genetic recombination technology as an antigen. T consisting of full-length sequence or partial sequence
In order to construct an expression vector for expressing IE, pcDLSRα296 (BglII) used in Examples described later was used.
And pYMNeo, as well as pcDNA3 (Invit
rogen) and pREP9 (Invitrogen) can also be used. In order to facilitate the purification of the antigen, a specific Tag sequence [eg, Fl
ag sequence (Hopp, ETet.al.Biotechnology, 6,1205,198
8), poly-His, or poly-Lys] may be added. The expressed recombinant Tie can be purified by appropriately combining known biochemical techniques such as salting out, ion exchange, gel filtration, affinity chromatography (Harris, ELV and Angal, S., Protein purification met).
hods, IRL Press, (1989); Harris, ELV and Angal, S., Pr
otein purification applications, IPL Press (199
0)).

Next, a conventional method for producing a monoclonal antibody, for example, J. Immunol. Method, 39, 285-308 (1980).
Ed., The Biochemical Society of Japan, sequel to biochemistry laboratory 5, Tokyo Kagaku Dojin (1986) pp66-77; Harlow, E. and Lane, E., Antibodie
s, A Laboratory Manual, Cold Spring Harbor Laborator
According to the method described in y (1988) etc., the monoclonal antibody of the present invention can be prepared. That is, the above immunogen is used to immunize a mammal.
The mammal to be immunized is not limited as long as it is a non-human animal such as pig, cow, rabbit, goat, horse, mouse, rat, etc., but myeloma cells to be a cell fusion partner are usually mice. Because it comes from
It is particularly preferable to immunize mice. Immunization was carried out by using an immunogen such as Tie extracellular domain prepared by the above method,
It is carried out by subcutaneous injection or intraperitoneal injection in mice together with complete Freund's adjuvant by a conventional method.
Boost if necessary.

A few days after the final immunization, the spleen containing antibody-producing lymphocytes is excised from the immunized mouse. The lymphocytes then confer a proliferative capacity that allows them to be passaged semipermanently. As the method, for example, a method of infecting lymphocytes with EB virus for transformation, or in the presence of Sendai virus or polyethylene glycol,
There is a method of cell fusion of certain types of cancer cells and lymphocytes. In order to continue stable antibody production, cancer cells of the same type of animal as the immunized animal, for example, cancer cells derived from a mouse of the same species as the immunized mouse, such as mouse myeloma cells, are used as partners for fusing with lymphocytes. It is preferably used.

Cell fusion is carried out, for example, in the presence of polyethylene glycol, so that only hybridoma can grow.
Grow in AT medium. When hybridoma colonies become visible, the antibodies in the culture are screened. The screening of the antibody in the culture broth is carried out, for example, by measuring the specific binding of the antibody to the Tie antigen by an ELISA method (for example, edited by the Biochemical Society of Japan, Zokusei Chemistry Laboratory 5, Tokyo Kagaku Dojin, 1986, pp62-65) Can be carried out. In this case, an antigen expressed in a prokaryotic cell (eg Escherichia coli) or a synthetic peptide containing a partial sequence of Tie may be used as an antigen for detection, but extracellular of Tie expressed in an animal cell (eg Cos cell). It is preferred to use domain proteins. This is because the extracellular domain of Tie has 29 Cys and 5 N-glycosylation addition sites (Asn-X-Ser / Th).
Since r) is present, it is difficult for Tie produced by Escherichia coli or peptide synthesis to take a natural higher-order structure. Furthermore, the natural T expressed on the human cell membrane
This is because it becomes possible to detect ie.

[0012] The anti-Tie monoclonal antibody selected using the antigen-antibody reaction by the above-mentioned ELISA is then transformed into an animal cell transformed with the full-length tie cDNA,
For example, the ability to specifically bind to fibroblasts and pre-B cells
For example, it is preferable to carry out the secondary screening by analyzing by a flow cytometry (FCM) method or an immunochemical tissue staining method. Thus, an antibody capable of specifically recognizing the natural Tie expressed on the animal cell membrane can be selected. A hybridoma producing the desired antibody can be finally obtained as a colony consisting of a single hybridoma (clone) by repeating the limiting dilution method in a conventional manner. The monoclonal antibody produced by this hybridoma clone can be separated and purified from the cell culture medium, but since the antibody titer is generally high, the supernatant can be used as it is depending on the purpose. It is also possible to use ascites produced by injecting a hybridoma into the abdominal cavity of a mouse pretreated with pristane.
These antibodies are further subjected to salting out, ion exchange, gel filtration,
It can be purified by appropriately combining known biochemical techniques such as affinity chromatography (edited by The Biochemical Society of Japan, Sequel Biochemistry Laboratory 5, Tokyo Kagaku Dojin (1986) pp.
11-31).

The hybridoma according to the present invention which produces the above-mentioned monoclonal antibody can be subcultured in any known medium, for example, RPMI1640 or DMEM (Dulbecco's modified Eagle) medium, like ordinary hybridomas. In the case of in vitro, the hybridoma of the present invention is cultured in a DMEM medium containing 10% fetal bovine serum, and in the case of in vivo, for example,
The mouse can be cultured in the abdominal cavity to produce a monoclonal antibody.

The monoclonal antibody of the present invention thus obtained specifically recognizes the extracellular domain of Tie (eg, human or other mammalian Tie). Therefore, since it can specifically bind to the Tie extracellular domain of cells expressing Tie, the Tie-expressing cells can be specifically recognized and detected. Further, since it specifically binds to soluble Tie in body fluid, it can be used for detection of soluble Tie present in a biological sample (eg, blood, serum, plasma, or urine).

The fragment containing the antigen-binding site of the monoclonal antibody according to the present invention has the same specific binding ability as described above. These fragments are, for example, fragments having a binding activity to Tie according to a conventional method of digesting the monoclonal antibody according to the present invention with a proteolytic enzyme such as pepsin or papain according to a conventional method, and then following a conventional method of protein isolation and purification. It can be obtained as a certain Fab, Fab ′, F (ab ′) ₂ or Fv [for example, edited by The Biochemical Society of Japan, sequel to biochemistry experimental course 5, Tokyo Kagaku Dojin (1986) pp89-10.
1].

The anti-Tie monoclonal antibody according to the present invention is directly reacted with an antigen, and as a secondary antibody, a fluorescent substance such as fluorescein isothiocyanate (FITC), an enzyme such as alkaline phosphatase and peroxidase, and a radioactive isotope such as ¹²⁵ I. By further reacting the anti-immunoglobulin labeled with, it can be used to confirm the presence of the antigen. Further, the anti-Tie monoclonal antibody itself according to the present invention can be used after being labeled with a fluorescent substance such as fluorescein isothiocyanate, an enzyme such as alkaline phosphatase and peroxidase, and a radioactive isotope such as ¹²⁵ I.

The monoclonal antibody according to the present invention is Tie
After reacting with the expressing cells, for example, by using a method such as flow cytometry (FCM) or immunochemical tissue staining, Ti
Cells expressing e (for example, megakaryoblastic leukemia cells and vascular endothelial cells) can be identified and separated. Fluorescent labeling of antibodies, cell preparation methods, cell staining methods with labeled antibodies, etc. are described in, for example, Kazuo Ota, flow cytometry, Cancer and Chemotherapy, 1990; supervised by Matsumura Hiro et al., Introduction to flow cytometry, medical science. It can be carried out by referring to Shoin, 1989 and the like.

Furthermore, the monoclonal antibody of the present invention reacts with a megakaryoblast-like cell line isolated from a patient with acute myelogenous leukemia. Therefore, using the monoclonal antibody of the present invention, leukemia cells derived from megakaryotic (blast) cells can be detected. In the treatment of leukemia, it is important to know the predominant cell type (tumor cell attribution) and the stage of differentiation in determining the treatment policy. Therefore, the monoclonal antibody of the present invention is also useful in the diagnosis and treatment of leukemia. .

Further, the monoclonal antibody according to the present invention surprisingly reacts with a part of hematopoietic stem cells derived from bone marrow. Therefore, the cells recognized by the monoclonal antibody of the present invention are treated with FACS (fluorescence ac
Undifferentiated hematopoietic stem cells can be enriched by selecting using a activated cell sorter. Incidentally, the monoclonal antibody of the present invention, a conventionally known antibody against an antigen specific to the surface of hematopoietic stem cells,
For example, CD34 antibody, c-kit antibody or Sca-I
When used in combination with an antibody (system cell antigen-I), CD34 antibody, c-kit antibody or Sca
The concentration efficiency is remarkably improved as compared with the case where the -I antibody is used alone.

[0020]

The present invention will be described in detail below with reference to examples, but these do not limit the scope of the present invention. Example 1: Human Tie extracellular domain tamper as an antigen
Preparation of click quality (a) tie isolated human megakaryoblastic system leukemia cell line UT-7 gene [Cancer Res., 5
1,341- (1991)], acid guanidine isothiocyanate phenol chloroform method [Analytical Biochemistr
y 162,156-159 (1987)] was used to extract total RNA. Poly (A) ⁺ RNA was prepared from total RNA using oligo dT-added latex (Oligotex-dT30: Takara Shuzo). From the obtained poly (A) ⁺ RNA, a cDNA synthesis system plus (Amersham)
Was used to synthesize cDNA. Bs in the obtained cDNA
After adding tX1 adapter (Takara Shuzo), restriction enzyme B
pCDM8 vector cleaved with stX1 (Invitrogen)
And T4 DNA ligase (Takara Shuzo) were used for the binding reaction. E. coli MC1061 / P3 (Invitroge
n) was transformed to consist of 1 × 10 ⁵ clones of UT-7.
A cDNA library was obtained.

Based on the literature, base sequences strongly conserved in a series of tyrosine kinase domains were selected and two kinds of synthetic oligonucleotide primers were prepared. That is, the 5'-primer 5'-GGGACCTGGCTGCCCGCAATGTGC-3 '(SEQ ID NO: 5 in the sequence listing) and the 3'-primer 5'-CGGTCAAACAAGGCCTC-3' (SEQ ID NO: 6 in the sequence listing) were used as a nucleic acid synthesizer (Model 394 DNA / RNA Synthesizer:
Synthesized by Applied Biosystems), oligonucleotide purification column (OPC cartridge: Applied Biosystems)
It was purified using. In the following procedures of this example and the examples described later, oligonucleotides were prepared by synthesizing and purifying in the same manner as described above. Using the poly (A) ⁺ RNA as a template, the 5 '
-Using a primer and a 3'-primer [Proc
Natl Acad Sci USA 87 8913- (1990)] RT-P
CR was performed to obtain a 160 bp DNA fragment (JTK-4 fragment). This JTK-4 fragment was labeled with a DNA labeling kit (random
It was labeled with [α ³² P] dCTP using a primer kit (Amersham). Using this labeled DNA fragment as a probe,
When the UT-7 cDNA library was screened, a 3933 bp cDNA clone ptk-1 was obtained.
When the nucleotide sequence of this cDNA was determined, it was found to encode a novel tyrosine kinase receptor consisting of a coding region of 3414 bp and consisting of 1138 amino acid residues. Later this gene was described in Mol. Cell. Biol. 12 1698.
-1707 (1992), it was found to be the same as the human tie gene except for a part of the nucleotide sequence. The different base sequences are the base sequences corresponding to 3242 to 3244 in the base sequence numbers in the paper, and the base sequence in the paper is CTG, whereas in the ptk-1 obtained in this Example, the GCT there were.

In order to subclone ptk-1 into an expression vector, the following operation was carried out for the purpose of adding an appropriate cloning site to the 5'end. The operation procedure from here is shown in FIG. That is, a synthetic oligonucleotide having a base sequence of 5'-CTGGTACCGCCTCTGGAGTATGGTCT-3 '(SEQ ID NO: 7 in the sequence listing) as a sense primer and 5'-TCAGCCCCAAAATGACCAGG-3' (SEQ ID NO: 8 in the sequence listing) as an antisense primer Synthesize a synthetic oligonucleotide with a base sequence,
Purified. RT-PCR was carried out using the above-mentioned ptk-1 as a template and a sense primer and an antisense primer to obtain cD of about 1000 bp corresponding to the 5'side of the tie gene.
I got NA. The conditions of RT-PCR are 94 ° C. for 1 minute, 55
The reaction was carried out for 40 cycles, with one cycle consisting of 2 minutes at ℃ and 3 minutes at 72 ℃. PCR products with restriction enzymes KpnI and Hi
cleaved with ndIII and plasmid pBluescriptIISK (−) (ST
RATAGENE) and the obtained plasmid BS-5 'was cleaved with restriction enzymes HindIII and XbaI. The fragment thus obtained and the fragment (2.7 kbp) obtained by cleaving ptk-1 with HindIII and XbaI were ligated using a DNA ligation kit (Takara Shuzo). Escherichia coli JM109 was transformed with this reaction product. A plasmid was prepared from the resulting colonies and the restriction enzymes KpnI and Xb
A fragment having a length of 3.9 kbp and 2.9 kbp when cleaved with aI, that is, t between the restriction enzyme cleavage sites of KpnI and XbaI which are cloning sites of pBluescriptIISK (-).
The target plasmid p in which the full-length gene is integrated
BS-full was selected.

(B) Construction of Tie extracellular domain expression vector The extracellular domain of Tie and an anti-Flag antibody (Eastman) were used.
A plasmid for expressing a fusion protein with an epitope peptide (Flag peptide) of Kodak) was prepared by the following method. That is, an oligonucleotide oligo-1 (5'-GATCTGGTACCTAACACCAGGTGAG consisting of 69 bases
GCGTGCCTCGGTAGACTACAAGGACGACGATGACAAATGATAAA-3 ')
(SEQ ID NO: 9 in the sequence listing) and an oligonucleotide oligo-2 (3'-ACCATGGATTGTGGTCC, which also consists of 69 bases.
ACTCCGCACGGAGCCATCTGATGTTCCTGCTGCTACTGTTTACTATTTCT
AG-5 ') (SEQ ID NO: 10 in the sequence listing) was synthesized. oli
go-1 (300 pmol) and oligo-2 (300
pmol) and phosphorylation buffer solution (1.5 nmol ATP, 100 μl buffer solution containing 20 units of polynucleotide kinase)
And was reacted at 37 ° C. for 1 hour. After treatment with phenol-chloroform, precipitation with ethanol was performed to recover the oligonucleotide. Phosphorylated oligo-1
(100 pmol) and phosphorylated oligo-2 (1
00 pmol) and annealing buffer (10 mM Tris-HC
l, 50mM NaCl, 10mM MgCl ₂ , pH7.5) and mixed at 80 ℃ for 5 minutes, 55 ℃ for 5 minutes, 37 ℃ for 30 minutes, and room temperature for 30 minutes to prepare a flag linker. did.

On the other hand, the plasmid vector pcDLSRα296
[Mol.Cell.Biol., 8,466-472 (1988)] was digested with restriction enzymes PstI and KpnI, blunt-ended with T4 DNA polymerase (Takara Shuzo), and then BglII linker (Takara Shuzo) was added to the DNA ligation kit (ligation Kit). : Takara Shuzo)
The vector pcDL introduced with BglII site
SRα296 (BglII) was prepared. The obtained vector pcDLSRα
296 (BglII) (10 μg) was cleaved with a restriction enzyme BglII and treated with alkaline phosphatase (BAP: Takara Shuzo). Bpc-treated vector pcDLSR after digestion with restriction enzyme BglII
0.0296 pmol of α296 (BglII) and 0.03 pmol of flag linker were ligated using a DNA ligation kit.
Escherichia coli JM109 was transformed with the reaction solution. A plasmid was prepared from the resulting colonies, and the desired plasmid pSRα-f, which had the cut pieces of 2.5 kbp and 0.87 kbp when cut with the restriction enzymes KpnI and HindIII, was selected.

The plasmid pBS prepared in the above (a)
-Full (10 μg) was digested with restriction enzymes KpnI and AlwNI. The resulting reaction solution was agarose gel (Sea Kem GTG
: Fragment A corresponding to 2.3 kbp after electrophoresis with FMC Products) and a centrifuge tube with a DNA recovery filter (supr
ec 01: Takara Shuzo). Fragment A (0.
03 pmol) and the plasmid pSRα-f described above were double-cut with the restriction enzymes KpnI and DraIII (0.0
3 pmol) and DNA ligation kit (ligati
on kit: Takara Shuzo). Escherichia coli JM109 was transformed with the obtained reaction solution. A plasmid was prepared from the resulting colony, and pSRα-tie-f, which is an expression vector of the Tie extracellular domain, was obtained, which had cleavage fragments of 4.1 kbp and 1.7 kbp when cleaved with the restriction enzyme HindIII.

(C) Expression and purification of Tie extracellular domain Tie extracellular domain expression vector pSRα-tie
-F (240 mg) was measured by DEAE-dextran method [Genetic Engineering Handbook, p194-199, Yodosha (1991)] to give 2.4 x 10 ⁷
COS-7 cells (ATCC CRL1651) were transfected. After culturing in DMEM medium containing 10% FCS for 24 hours, it was cultured in DMEM medium containing 0.2% FCS for 4 to 7 days. The culture supernatant was collected, centrifuged (1500 × g), and then passed through a 0.22 μm membrane filter. Anti-flag antibody affinity gel (Anti-FLAG M2 Affinity Ge
l: Eastman Kodak) and purified according to the protocol to obtain 4.2 mg of Tie extracellular domain.

Example 2: Preparation of hybridoma (a) Immunization 50 cells of the purified Tie extracellular domain prepared in Example 1 were used.
The mixture was mixed with the same volume of Freund's complete adjuvant at a dose of μg / 100 μl / mouse to emulsify and then administered intraperitoneally four times every two weeks. Two weeks after the fourth immunization, 0.2 ml of physiological saline containing purified Tie extracellular domain 50 μg / mouse was intraperitoneally administered (final immunization). Three days after the final immunization, spleen cells were collected from one mouse and suspended in DMEM medium. Simultaneously with the collection of spleen cells, whole blood was collected to prepare an antiserum, which was used in the assay of Example 2 (d) described below.

(B) Preparation of hybridoma 1.25 × 10 ⁸ splenocytes prepared in the above Example 2 (a) and mouse myeloma cells P3 × 63Ag8 · U1 (ATCC CRL 1597)
2.5 × 10 ⁷ pieces (hereinafter referred to as P3U1) were fused by the method of Koehler and Milstein [Nature, 256, 495 (1975)]. That is, after splenocytes and P3U1 cells were washed several times with DMEM, both were placed in a 50 ml plastic test tube and mixed thoroughly. Then centrifuge to remove the medium,
1m DMEM containing 50% (w / v) polyethylene glycol (Sigma, average molecular weight 3640) kept at 37 ℃
1 was added slowly with stirring over 1 minute. Next, 10 ml of DMEM kept at 37 ° C was added dropwise to terminate the cell fusion reaction. After centrifuging the reaction solution and removing the supernatant,
HAT medium [DMEM medium containing 10% fetal bovine serum supplemented with hypoxanthine (1 × 10 ^-4 M), aminopterin (4 × 10 ^-7 M), thymidine (1.6 × 10 ^-5 M)] In addition, the spleen cell concentration was adjusted to 6 × 10 ⁵ cells / ml. Add this suspension to a 96-well plastic plate for 200
μl (1.2 × 10 ⁵ splenocytes) was dispensed. Half of the medium was removed by suction every 4 days, and the HAT medium was added. After exchanging the medium twice, the antibody activity in the culture supernatant was measured by the following ELISA method.

(C) Antibody assay method using ELISA Amino acid sequence: (N-terminal side) Cys-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys
(C-terminal side) (SEQ ID NO: 11 in the Sequence Listing) was used as a flag peptide
It was chemically synthesized according to 0A). The peptide synthesizer (ABI,
The peptide was purified according to the manual attached to 430A). Carrier Protein Binding Kit (Activated Immunoge
n Conjugation Kit: PIERCE) was used to prepare a conjugate (BSA-Flag) with bovine serum albumin (hereinafter referred to as BSA). The binding activity of the antibody in the culture supernatant to Tie depends on the Tie extracellular domain or BS.
E using A-Flag coated microplate
It investigated by the LISA method. Since the Tie extracellular domain used for immunization has a sequence (Flag sequence) other than Tie, it has binding activity to the Tie extracellular domain, and
An antibody having no SA-Flag binding activity was selected by the following method. 0.45 μg of Tie extracellular domain
/ Ml, BSA-Flag was dissolved in 0.05M sodium carbonate (pH 9.6) so as to be 1.3 μg / ml, and 100 μl of the solution was added to a 96-well microtiter plate. After overnight incubation at 4 ° C., the solution was discarded, 200 μl of 1% BSA-containing Tris buffer (10 mM Tris-HCl, sodium chloride 9 g / l, pH 7.5: hereinafter referred to as TBS) was added, and the mixture was allowed to stand at room temperature for 1 hour. Let stand for hours. After standing, TBS containing 0.05% Tween 20 (TBS / Tw
It was washed well with the een) solution. 0.25% BS of culture supernatant
TBS / Tween including A (BSA / TBS / Twe
en) solution was diluted 100-fold, 100 μl of the diluted solution was added to each well, and the reaction was carried out at 4 ° C. overnight. TBS / T
After washing with a ween solution, BSA / TBS / Tween
Biotinylated-sheep anti-mouse I diluted 2000-fold with n-solution
100 μl of gG antibody (Amersham) was added and reacted at room temperature for 2 hours. After washing with TBS / Tween solution, 100 μl of streptavidin-biotinylated horseradish peroxidase (HRP) complex (Amersham) diluted 2000 times with BSA / TBS / Tween solution was used.
Each 1 liter was added and reacted at room temperature for 2 hours. After the reaction,
After adding a coloring kit for peroxidase (Sumitomo Bakelite) and reacting for 15 minutes at room temperature, the amount of coloring pigment is measured at a wavelength of 450 nm using a microplate reader (THERMO max: Molecular Devices) to determine the antibody activity. did. Of the 845 wells assayed, 24 were positive in the Tie extracellular domain coated ELISA,
Moreover, the ELISA coated with BSA-Flag was negative.

(D) Cloning The 24 kinds of antibodies having Tie binding activity obtained in Example 2 (c) above were cloned by the limiting dilution method. That is, the hybridoma was suspended in a cloning medium [10% hybridoma cloning supplement (Boehringer Mannheim), 15% fetal calf serum-containing DMEM medium] so that the hybridoma was 5 cells / ml, and the suspension was suspended.
200 μl of each was dispensed into a 96-well microtiter plate and cultured. After about 2 weeks, the culture supernatant of the cells in which cell proliferation was observed was collected, and the presence or absence of antibody activity was examined by the ELISA method described in (c) above. As a result, 19 of the 24 hybridomas tested (that is, hybridomas HT7-7, HT
8, HT9, HT50, HT9-6, HT29, HT1
1-6, HT28, HT31, HT20, HT25, H
T11, HT4-50, HT39, HT40, HT9-
7, HT10-7, HT41, and HT2-6) culture supernatants showed antibody activity. Hybridoma HT40
And HT50 have been deposited with the Institute of Biotechnology and Industrial Technology.
The deposit number is FERM P- for hybridoma HT40.
14527 and hybridoma HT50 is FERM
P-14528.

(E) Production and Purification of Monoclonal Antibodies The 19 hybridomas cloned according to the above Example 2 (d) and having antibody activity in the culture supernatant were
The cells were cultured in DMEM medium containing 10% fetal bovine serum. The culture was continued so that the cell concentration was in the range of 1 × 10 ⁵ cells / ml to 1 × 10 ⁶ cells / ml, and finally the culture was performed with 20 ml of the culture solution. Centrifuge the culture solution (1000 xg, 5 minutes)
Then, the culture supernatant was collected. This culture supernatant was used in Example 2 after determining the antibody concentration in Example 2 (f) described below.
The FCM assay of (h) was used to identify the subclass of Example 3 (b). Half of the collected culture supernatant is
Salting out was performed with 50% saturated ammonium sulfate. PB of the precipitated fraction
After dissolving in S, it was dialyzed against PBS. The antibody (concentrated antibody) dissolved in this PBS was used for immunoprecipitation, BIAcore,
It was used for SDS-PAGE, etc. The above hybridomas HT7-7, HT8, HT9, HT50, HT9-
6, HT29, HT11-6, HT28, HT31, H
T20, HT25, HT11, HT4-50, HT3
9, HT40, HT9-7, HT10-7, HT41,
Monoclonal antibodies produced by HT2-6 and HT2-6 are monoclonal antibodies HT7-7, HT8, HT9,
HT50, HT9-6, HT29, HT11-6, HT
28, HT31, HT20, HT25, HT11, HT
4-50, HT39, HT40, HT9-7, HT10
-7, HT41, and HT2-6.

(F) Mouse IgG using ELISA method
Quantification of Concentration The antibody concentrations of the culture supernatant obtained in Example 2 (e) above and the antibody dissolved in PBS were determined by the following ELISA method. That is, 0.05M sodium carbonate (pH
9.6) with goat anti-mouse IgG antibody (TAGO) at 1 μg / m
Dissolve the solution so that it becomes 1 l, and add 100 μl of the resulting solution to each
Added to 6-well microtiter plate. After overnight incubation at 4 ° C., the solution was discarded, 200 μl of TBS containing 1% BSA was added, and the mixture was allowed to stand at room temperature for 1 hour.
After standing, it was thoroughly washed with a TBS / Tween solution. The culture supernatant and the concentrated antibody are in a dilution series of 10 ² to 10 ⁵ (fold dilution), and the standard mouse IgG (Bettil) is 2 to 14
(Ng / ml) dilution series, BSA / TBS
/ Tween solution, 100 μl of each diluted solution was added to each well, and the reaction was carried out at 4 ° C. overnight. T
After washing with BS / Tween solution, BSA / TBS /
100 µl of HRP-goat anti-mouse IgGF (ab ') ₂ antibody (TAGO) diluted 5000 times with Tween solution was added, and the mixture was reacted at room temperature for 2 hours. After washing with TBS / Tween solution, a coloring kit for peroxidase (Sumitomo Bakelite) was added and reacted at room temperature for 15 minutes, and then a wavelength of 45 using a microplate reader (THERMO max).
The amount of color-developing dye was measured at 0 nm to determine the antibody activity. A standard curve was created from the results of reaction with standard mouse IgG, and the concentration of each antibody was determined. The antibody concentrations of the culture supernatant and the concentrated antibody determined from the standard curve are shown in Table 1 below.

[0033]

[Table 1] Antibody concentration (μg / ml) Hybridoma culture supernatant Concentrated antibody HT7-7 56 368 HT8 43 300 HT9 47 291 HT50 84 727 HT9-6 60 499 HT29 27 208 HT11-6 46 329 HT28 65 340 HT31 −− 942 HT20 66 326 HT25 53 532 HT11 52 350 HT4-50 57 427 HT39 48 315 HT40 35 329 HT9-7 47 466 HT10-7 30 292 HT41 65 521

(G) Binding Affinity of Monoclonal Antibody to Tie Monoclonal monoclonal antibody produced by 14 hybridomas among the 19 hybridomas cloned in Example 2 (d) and having antibody activity in the culture supernatant. For antibodies, ELISA for affinity to Tie extracellular domain
I looked it up. That is, 0.1 μg of Tie extracellular domain
0.05M sodium carbonate (pH 9.6)
Dissolve in 100 mL of 96-well microtiter plate.
μl was added to each. After overnight incubation at 4 ° C,
The solution was discarded, 200 μl of TBS containing 1% BSA was added, and the mixture was allowed to stand at room temperature for 1 hour. TBS / Tw after standing still
Washed well with een solution. Culture supernatant of each hybridoma and control IgG (IgG ₁ , IgG _2a , I
gG _2b ) was diluted with a BSA / TBS / Tween solution so that a dilution series with an IgG concentration of 0.01 to 30 (μg / ml) was made, and 100 μl of the obtained diluted solution was added to each well. The reaction was carried out overnight at ° C. TBS / Twee
After washing with n solution, 100 μl of biotinylated-sheep anti-mouse IgG antibody (Amersham) diluted 2000-fold with BSA / TBS / Tween solution was added to each well and reacted at room temperature for 2 hours. After washing with TBS / Tween solution, B
Streptavidin-biotinylated HRP complex (Amersham) diluted 2000 times with SA / TBS / Tween solution
100 μl each was added, and the mixture was reacted at room temperature for 2 hours. After the reaction was completed, a coloring kit for peroxidase (Sumitomo Bakelite) was added and allowed to react at room temperature for 15 minutes, and then a microplate reader (THERMO max: Molecular Devices)
Was used to measure the amount of coloring pigment at a wavelength of 450 nm to determine the antibody activity. The results are shown in FIGS.

(H) Construction of Tie-expressing cells The plasmid pBS-full prepared in Example 1 (a) was treated with restriction enzymes KpnI and XbaI, and the tie gene fragment was used as a vector.
Subcloned into the KpnI-XbaI site of pUC18 (Takara Shuzo). The resulting recombinant vector was digested with the restriction enzymes EcoRI and
It was treated with XbaI and the resulting fragment was used as plasmid pBluescriptI.
It was subcloned into the EcoRI-XbaI site of IKS (-) (STRATAGENE). The obtained recombinant plasmid was digested with the restriction enzyme Ec.
EcoR of plasmid pYMNeo treated with oRI and NotI
By subcloning into the I-NotI site, a plasmid pYMNeo-Tie expressing the full length Tie was obtained. This plasmid pYMNeo-Tie was transformed into mouse fibroblasts by the calcium phosphate method [J. Virol., 31: 360- (1979)].
Balb / 3T3 (ATCC CCL163) and Ba / F3 (RCB0805
). Geneticin (G418: G
The infected cells were cultured in a medium containing 0.4 mg / ml of IBCO) and the propagated infected cells were cloned. Clones expressing Tie were selected using flow cytometry (FCM). That is, about 1 × 10 ⁵ infected cells were diluted 100-fold with FCM buffer (2% FCS, 0.02% NaN ₃ , PBS) to prepare anti-Tie antiserum [prepared in Example 2 (a)] 20 μm.
It was suspended in 1 l and reacted at 4 ° C. for 30 minutes. FITC (fluorescein isothiocyanate) -labeled anti-mouse I, which was prepared by washing cells with FCM buffer and diluting 50 times with FCM buffer.
Suspend the cells in 50 μl of g antibody (Amersham) and
The reaction was carried out at 30 ° C for 30 minutes. After completion of the reaction, the cells were washed with FCM buffer and suspended in 400 μl of FCM buffer. The fluorescence intensity bound to the cells was measured with a flow cytometer (profile: Coulter). Infected cells expressing Tie on the cell surface (Balb / 3T3-Tie and BaF3-Ti
e) can be selected and used for the assay in Example 2 (i).

(I) Antibody Assay Method Using Flow Cytometry The monoclonal antibody obtained from the hybridoma of which the binding activity to Tie was positive in Example 2 (d) was bound to Tie expressed on the cell surface. Antibodies having the activity to select were selected using a flow cytometer (FCM). That is, the infected cells prepared in Example 2 (h) above
Balb / 3T3-Tie with various anti-Tie concentrations of 3 μg / ml
FC containing monoclonal antibody or control IgG
The suspension was suspended in 20 μl of M buffer and reacted at 4 ° C. for 30 minutes. F
The cells were washed with CM buffer and suspended with 50 μl of FITC-labeled anti-mouse Ig antibody diluted 50 times with FCM buffer,
The reaction was carried out at 4 ° C for 30 minutes. After the reaction was completed, the cells were washed with FCM buffer and suspended in 400 μl of FCM buffer. The fluorescence intensity bound to the cells was measured with a flow cytometer (profile: Coulter). The results are shown in FIGS.

(J) Immunoprecipitation of Tie expressed in cells Balb / 3T3-Ti infected cells prepared in Example 2 (h) above
e and BaF3-Tie, and human megakaryoblastic leukemia cells
Strain UT-7 [Cancer Research 51 341-348 (1991)]
By law 3 × 10⁷ It was cultured up to about individual pieces. Hepes buffer (50
mM Hepes pH7.2, 150 mM NaCl, 1 mM Na₃VO_Four) Wash the cells with
Lysis solution (50 mM Hepes pH7.4, 1% Triton X-100, 10%
 glycerol, 10mM sodium pyrophosphate, 100mM NaF, 2
mM Na₃VO _Four, 4mM EDTA, 50 μg / ml aprotinin, 100
μM leupeptin, 25 μM pepstatinA, 1mM PMSF) 1.5 m
1 was added, and the mixture was reacted on ice for 30 minutes. Centrifuge at 4 ℃
After (1000 × g, 10 minutes), the supernatant is further centrifuged at 4 ° C.
(1000 × g, 10 minutes). Add 200 μl of the supernatant to each well.
Dispense into a Pendorf test tube and add Protein G (Pharma
A) Add 10 μl and stir gently at 4 ℃ for 1 hour.
It was made to react. After centrifuging (1000 xg, 1 minute),
Monoclonal antibody HT prepared in Example 2 (e)
50 concentrated antibodies to a final concentration of 10 μg / ml
In addition, the reaction was carried out at 4 ° C. for 1 hour with gentle stirring.
Add 10 μl of Protein G (Pharmacia) to the reaction mixture.
Eat, react at 4 ℃ for 1 hour, and centrifuge (1000 × g, 1 minute
(Pause) Rinse the precipitate thoroughly with lysate and sample SDS
Buffer solution (0.06M Tris-HCl pH6.8, 2% SDS, 10% glycerol,
 0.025% Bromphenol Blue, 5% 2-mercaptoethanol) 20
Add μl and incubate at 95 ℃ for 5 minutes.
SDS polyacrylamide with gel (Daiichi Pure Chemicals)
Gel electrophoresis was performed. After electrophoresis, PV
Electroblotting on DF membrane (Millipore)
Was. After the reaction is completed, the PVDF membrane is blocked with a blocking agent (block
(Dainippon Pharmaceutical Co., Ltd.) at 4 ° C. overnight. TBS / T
After washing the membrane with ween, TBS obtained by the following method
Rabbit Anti-Tie Polychrome diluted 2000 times with Tween / Tween
Internal antibody was reacted at room temperature for 1 hour. TBS / Twe
After washing the membrane with EN, dilute 5000 times with TBS / Tween
HRP-labeled anti-rabbit IgG antibody (Amersham)
The reaction was carried out at the temperature for 1 hour. Wash the membrane with TBS / Tween
Western blotting detection system (ECL
Western blotting detection
n reagents (Amersham)
The reaction was allowed to proceed, and an X-ray film was exposed and developed. That
As a result, it corresponds to Tie at the position of the molecular weight of about 150 kDa.
Band detected, anti-Tie monoclonal antibody HT5
0 showed that Tie was immunoprecipitated.

Rabbit anti-Tie polyclonal antibody was prepared by the following method. That is, amino acid sequence (N-terminal) -Cys-Glu-Asn-Phe-Thr-Tyr-Ala-Gly-Ile-Asp
-Ala-Thr-Ala-Glu-Glu-Ala (C-terminal) (SEQ ID NO: 12 in the sequence listing) was added to the peptide having the C-terminal sequence of Tie (AG7),
It was chemically synthesized by a peptide synthesizer (ABI, 430A). Carrier Protein Binding Kit (Activated ImmunogenConjuga
conjugate kit (KLH-AG7) with KLH was prepared using a kit (PIERCE). KLH-AG7 was mixed with the same dose of Freund's complete adjuvant to emulsify, and then subcutaneously administered at a dose of 100 μg / rabbit every 2 weeks for a total of 4 doses. Whole blood was collected one week after the fourth immunization. After blood collection, the mixture was allowed to stand at room temperature for 1 hour and then at 4 ° C. overnight, centrifuged at 3000 × g for 10 minutes, and the supernatant was collected to give a rabbit anti-Tie polyclonal antibody.

Example 3: Physical Chemistry of Monoclonal Antibodies
Properties (a) Molecular Weight SDS polyacrylamide gel electrophoresis was carried out under reducing conditions using a 4-20% gradient gel to give monoclonal antibodies HT40, HT9-7, HT11, HT25,
The molecular weights of HT9-6 and HT50 were estimated. As a result, monoclonal antibodies HT40, HT9-7, HT1
For 1 and HT25, the molecular weight is 55 ± 3 kilodaltons (KDa
), An H chain and a L chain band at a molecular weight of 28 ± 3 KDa were observed, and in the monoclonal antibodies HT50 and HT9-6,
An H chain band was observed at a molecular weight of 53 ± 3 KDa, and an L chain band was observed at a molecular weight of 28 ± 3 KDa.

(B) IgG Subclass The IgG subclass of each anti-Tie monoclonal antibody was determined by the ELISA method. That is, with 0.05M sodium carbonate (pH 9.6), goat anti-mouse IgG antibody (TAGO)
Was dissolved to 1 μg / ml and the resulting solution was
0 μl was added to a 96-well microtiter plate. After overnight incubation at 4 ° C, discard the solution,
200 μl of TBS containing 1% BSA was added and reacted at room temperature for 1 hour. After completion of the reaction, it was thoroughly washed with a TBS / Tween solution. The culture supernatant of each hybridoma is BSA /
The mixture was diluted with a TBS / Tween solution, 100 μl of the diluted solution was added to each well, and the reaction was carried out at 4 ° C. overnight. TB
After washing with S / Tween solution, BSA / TBS / T
an anti-mouse IgG ₁ antibody diluted 5000 times with a ween solution,
Anti-mouse IgG _2a antibody, anti-mouse IgG _2b antibody, anti-mouse IgG ₃ antibody, anti-mouse IgM antibody, anti-mouse κ chain antibody, and anti-mouse λ chain antibody (all Amersham) 100 μ
l of each was added and the mixture was reacted at room temperature for 1 hour. TBS / Tw
After washing with een solution, BSA / TBS / Tween
100 μl of biotin-labeled anti-goat IgG antibody (Amersham) diluted 5000 times with the solution was added, and reacted at room temperature for 1 hour. After washing with TBS / Tween solution, BSA / T
100 μl each of horseradish peroxidase-labeled streptavidin-biotin complex diluted 5000 times with a BS / Tween solution was added and reacted at room temperature for 2 hours. After washing with TBS / Tween solution, add peroxidase coloring kit (Sumitomo Bakelite)
After reacting at room temperature for minutes, the amount of color-developing dye was measured at a wavelength of 450 nm using a microplate reader (THERMO max) to determine the antibody activity. The subtype of the antibody produced by each hybridoma was determined from the reactivity with the secondary antibody that specifically recognizes the mouse Ig subtype. As a result, the monoclonal antibodies HT7-7, HT8, HT9,
HT50, HT9-6, HT29 and HT11-6 are I
gG ₁ , monoclonal antibodies HT28, HT31 and H
T20 is IgG _2a , monoclonal antibodies HT25, HT
11, HT4-50, HT39, HT40, HT9-
7, HT10-7 and HT41 were IgG _2b. L
All chains were kappa chains.

(C) Epitope analysis Representative monoclonal antibodies HT40 and H according to the present invention
For T50, the identity of the epitope was examined by a binding competitive inhibition experiment with Tie extracellular domain using BIAcore (Pharmacia). The purified Tie extracellular domain was immobilized on a BIAcore sensor chip (Pharmacia) according to the Pharmacia protocol. 35 μg / ml of the culture supernatant of the hybridoma HT40 containing the monoclonal antibody HT40 was applied to the sensor chip until the resonance unit (RU) value reached equilibrium. Next, a hybridoma HT50 containing the monoclonal antibody HT50
30-60 μg / ml of the culture supernatant of the above was flown on the sensor chip. As a result, the RU value was further increased. on the other hand,
Instead of monoclonal antibody HT50, monoclonal antibodies HT40, HT4-50, HT28, HT39, and HT
Since no such increase in RU value was observed in the culture supernatant containing 10-7, it was found that the epitopes of monoclonal antibody HT40 and monoclonal antibody HT50 are different.

Example 4: Megakaryocytes of monoclonal antibodies
Reaction to System Cultured Cells (a) Biotin Labeling of Anti-Tie Monoclonal Antibody Hybridoma HT40 or HT50 producing anti-Tie monoclonal antibody HT40 or HT50 was cultured in DMEM medium containing 10% fetal bovine serum, respectively. The culture was continued so that the cell concentration was in the range of 1 × 10 ⁵ to 1 × 10 ⁶ cells / ml, and finally the culture was performed in 500 ml of the medium. The culture solution was centrifuged (1000 × g, 5 minutes), the culture supernatant was collected, and the antibody was purified using a protein A column (Bio-Rad) and a protein G column (Pharmacia). The buffer solution containing the purified antibody was applied to a biotinylated buffer solution (50 mM Bor) using a PD-10 column (Pharmacia).
ate). Biotin labeling kit (Amersham)
Was used to carry out the biotinylation reaction of the antibody at room temperature for 1 hour. After the reaction was completed, the reaction solution was replaced with PBS from the biotinylation buffer using PD-10 column.

(B) Reaction of monoclonal antibody with human cell line Human megakaryocytic cell line K562 (ATCC CCL 243)
And CMK [Blood 7442-48 (1989)], and human promyelocytic leukemia cell line HL60 (ATCC CCL 240) were cultured. TPA-treated cells had a final concentration of 10 ng during the culture.
Add TPA (Sigma) to the medium so that it becomes / ml,
Cultured for 48 hours. Each cell (untreated with TPA, treated with TPA) was collected by centrifugation (400 xg, 5 minutes) and stained with a staining medium (5% fetal bovine serum, 0.01% NaN ₃ , PBS) or a biotinylated anti-Tie monoclonal antibody (HT50). ) 5 μg / ml
The cells were suspended in a staining medium containing and reacted on ice for 30 minutes. Wash the cells twice with staining medium and then 100 with staining medium.
FITC-labeled streptavidin (CALTA
The cells were suspended in G) and reacted on ice for 30 minutes. After washing the cells twice, the cells were suspended in a staining medium and analyzed using a flow cytometer (FACSvantage: Becton Dickinson) to measure the fluorescence intensity bound to the cells. The results are shown in FIG. 9 (K562), FIG. 10 (CMK) and FIG. 11 (HL60). In K562 cells, anti-Tie antibody bound to TPA-treated cells, and Tie expression became positive. In CMK cells, anti-Tie antibody bound to both TPA-untreated and TPA-treated, and Tie expression became positive. In HL60, the anti-Tie antibody did not bind to both TPA-untreated and TPA-treated, and the expression of Tie was negative.
That is, the anti-Tie antibody specifically bound to the megakaryocytic cell line. As a control antibody, standard mouse Ig (Bettyl) was used.

Example 5: Human-made monoclonal antibody
Reaction to blood stem cells (a) Separation of human bone marrow cells by flow cytometry Human bone marrow cells were collected and diluted with PBS, and Ficoll-Metri
Overlaid on zamide (Nyegaad). Centrifugal operation (400 xg,
After 30 minutes), the mononuclear cell fraction was collected and suspended in a staining medium. The cells were collected by centrifugation and the biotinylated anti-Tie monoclonal antibody HT50 prepared in Example 4 (a) was used.
(5 μg / ml) was reacted on ice for 30 minutes. After washing twice with staining medium, 20-fold diluted allophycocyanin (A
(PC) labeled streptavidin (Becton Dickinson) was reacted on ice for 30 minutes. In addition, 2 in staining medium
After washing twice, 10 μg / ml of FITC-labeled anti-CD34 antibody (Nichirei) or 10 μg / ml of FITC-labeled anti-kit antibody (Nichirei) was reacted on ice for 30 minutes. After the reaction was completed, the cells were washed twice with a staining medium, suspended in the staining medium, and sorted by a flow cytometer (FACSvantage: Becton Dickinson). Anti-Tie antibody and anti-CD34 antibody, and anti-Tie antibody and anti-c
The cells double-stained with the -kit antibody were treated with FITC and APC.
From the fluorescence intensity of Tie positive fraction (Tie +), CD3
4 positive fraction (CD34 +), c-kit positive fraction (c-
I decided kit +). The results of flow cytometry are shown in FIG. Cell fraction that becomes CD34 + and Tie +,
Cell fraction that becomes CD34 + and Tie-negative fraction (Tie-), cell fraction that becomes c-kit + and Tie +, c-
The cell fraction that became kit + and Tie- was separated by sorting.

(B) Colony formation assay of cells separated by anti-Tie antibody 1000 cells of each sorted according to Example 5 (a) or human bone marrow cell mononuclear cell fraction (BM) 2 × 10 ⁴ cells were used. , 30% fetal bovine serum (Flow Laboratories), 10 ng / ml IL-3
(Genetics Institute), 100 ng / ml stem cell factor (Amgen), 2 units / ml erythropoietin (Snow Brand Milk Products), 1% bovine serum albumin (Sigma), 5 × 10 ^-5
It was plated on 1 ml of Iscove's modified Dulbecco's medium (GIBCO) containing M β-mercaptoethanol (Sigma) and 1.4% methylcellulose (Aldrich Chemical). 5% CO ₂ ,
The cells were cultured at 37 ° C. for 14 days, and the number of colonies that appeared was counted for each of granulocyte-macrophage colonies (GM) and erythroid burst (E). The results of the two experiments are shown in Table 2 as they are. From the results, it was found that the cells separated by the anti-Tie antibody had many colony forming cells.

[0046]

Table 2 GM E CD34 + / Tie + 71, 73 67, 64 CD34 + / Tie− 45, 39 45, 51 c-kit + / Tie + 123, 120 22, 19 c-kit + / Tie− 44, 49 18, 18 Total BM 86, 81 61, 55

INDUSTRIAL APPLICABILITY Since the anti-Tie monoclonal antibody according to the present invention can specifically recognize the extracellular domain of Tie, it is possible to detect and quantify Tie and soluble Tie. By using this antibody, megakaryoblastic leukemia cells and hematopoietic stem cells expressing Tie on the cell membrane can be identified, and can be used for diagnosis of leukemia and separation / enrichment of hematopoietic stem cells.

[0047]

[Sequence list]

SEQ ID NO: 1 Sequence length: 16 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Cys Asn Lys Gly Asp Thr Ala Val Leu Ser Ala Arg Val His Lys Glu 1 5 10 15

SEQ ID NO: 2 Sequence length: 13 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Cys Pro Pro Leu Leu Leu Glu Lys Asp Asp Arg Ile Val 1 5 10

SEQ ID NO: 3 Sequence length: 10 Sequence type: Amino acid Topology: Linear Sequence type: Peptide

SEQ ID NO: 4 Sequence length: 11 Sequence type: Amino acid Topology: Linear Sequence type: Peptide

SEQ ID NO: 5 Sequence length: 24 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Primer DNA sequence GGGACCTGGC TGCCCGCAAT GTGC 24

SEQ ID NO: 6 Sequence length: 17 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Primer DNA Sequence CGGTCAAACA AGGCCTC 17

SEQ ID NO: 7 Sequence Length: 26 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid Primer DNA Sequence CTGGTACCGC CTCTGGAGTA TGGTCT 26

SEQ ID NO: 8 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Primer DNA Sequence TCAGCCCCAA AATGACCAGG 20

SEQ ID NO: 9 Sequence length: 69 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GATCTGGTAC CTAACACCAG GTGAGGCGTG CCTCGGTAGA CTACAAGGAC 50 GACGATGACA AATGATAAA 69

SEQ ID NO: 10 Sequence length: 69 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GATCTTTATC ATTTGTCATC GTCGTCCTTG TAGTCTACCG AGGCACGCCT 50 CACCTGGTGT TAGGTACCA 69

SEQ ID NO: 11 Sequence length: 9 Sequence type: Amino acid Topology: Linear Sequence type: Peptide

SEQ ID NO: 12 Sequence length: 16 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Cys Glu Asn Phe Thr Tyr Ala Gly Ile Asp Ala Thr Ala Glu Glu Ala 1 5 10 15

[Brief description of drawings]

FIG. 1 is an explanatory view showing a production process of pSRα-tie-f, which is an expression vector of Tie extracellular domain, performed in Example 1.

FIG. 2 is a graph showing the difference between the five types of monoclonal antibodies of the present invention and a control IgG ₁ antibody in the comparative test of binding affinity to Tie performed in Example 2 (g).

FIG. 3 is a graph showing the difference between the two types of monoclonal antibodies of the present invention and the control IgG _2a antibody in the comparative test of binding affinity to Tie performed in Example 2 (g).

FIG. 4 is a graph showing the difference between the seven types of monoclonal antibodies of the present invention and the control IgG _2b antibody in the comparative test of binding affinity to Tie performed in Example 2 (g).

FIG. 5 is a graph showing the difference between the monoclonal antibody of the present invention and a control IgG antibody in the antibody assay method using flow cytometry performed in Example 2 (i).

FIG. 6 is a graph showing the difference between the monoclonal antibody of the present invention and a control IgG antibody in the antibody assay method using flow cytometry performed in Example 2 (i).

FIG. 7 is a graph showing a difference between the monoclonal antibody of the present invention and a control IgG antibody in the antibody assay method using flow cytometry performed in Example 2 (i).

FIG. 8 is a graph showing a difference between the monoclonal antibody of the present invention and a control IgG antibody in the antibody assay method using flow cytometry performed in Example 2 (i).

FIG. 9: Human megakaryocytic cell line K performed in Example 3 (b)
It is a graph which shows the difference of the reactivity of the monoclonal antibody of this invention with respect to 562, and a control antibody.

FIG. 10 is a graph showing the difference in reactivity between the monoclonal antibody of the present invention and the control antibody against the human megakaryocytic cell line CMK performed in Example 3 (b).

FIG. 11 is a graph showing the difference in reactivity between the monoclonal antibody of the present invention and the control antibody against the human promyelocytic leukemia cell line HL60 performed in Example 3 (b).

FIG. 12 is a graph showing the results of separation of human bone marrow cells by flow cytometry performed in Example 5 (a).

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical display location G01N 33/53 DY 33/577 B // C12N 15/02 ZNA (C12P 21/08 C12R 1: 91) (72) Inventor, Yasuaki Shimizu 35-402, Kasuga, Tsukuba, Ibaraki Prefecture 35-2 402 (72) Inventor, Susumu 880-102, Higashifukai, Nagareyama City, Chiba Prefecture (72) Inventor, Yasuhiko Masuho 5-19, Higashimachi, Koganei City, Tokyo −15

Claims (7)

[Claims] 1. A monoclonal antibody which specifically recognizes the extracellular domain of Tie. 2. A mouse hybridoma HT7-7, HT
8, HT9, HT50, HT9-6, HT29, HT1
1-6, HT28, HT31, HT20, HT25, H
T11, HT4-50, HT39, HT40, HT9-
Mouse monoclonal antibodies HT7-7, HT8, HT9, HT5 produced from hybridomas selected from the group consisting of 7, HT10-7, HT41, and HT2-6.
0, HT9-6, HT29, HT11-6, HT28,
HT31, HT20, HT25, HT11, HT4-5
0, HT39, HT40, HT9-7, HT10-7,
The monoclonal antibody according to claim 1, which is HT41 or HT2-6. 3. A mouse hybridoma HT40 (FER
MP-14527) produced by the monoclonal antibody HT40 or mouse hybridoma HT50 (FER
The monoclonal antibody according to claim 1, which is the monoclonal antibody HT50 produced from MP-14528). 4. A fragment of the monoclonal antibody according to claim 1, which comprises an antigen-binding site. 5. The fragment according to claim 4, which is Fab, F (ab ′) ₂ or Fv. 6. A hybridoma which produces the monoclonal antibody according to claim 1. 7. A mouse hybridoma HT40 (FER
MP-14527) or mouse hybridoma HT5
The hybridoma according to claim 6, which is 0 (FERM P-14528).