JPH08143597A - Human neurotensin receptor protein, its production and use - Google Patents

Abstract

PURPOSE: To obtain a new human neurotensin receptor protein having a specific amino acid sequence, useful for e.g. screening human neurotensin receptor agonists or antagonists, thus to be used for e.g. developing preventive/therapeutic agents for depression, dementia, obnubilation, etc. CONSTITUTION: This new protein has an amino acid sequence including an amino acid sequence of the formula. This protein is used for e.g. screening human neurotensin receptor agonists or antagonists, being useful for the early development of preventive/therapeutic agents as agonists for Parkinson's disease, depression, dementia, hyperkinetic syndrome and obnubilation, and as antagonists for enteritis, pancreatltls, ulcer, stomach cancer, enterocarcinoma, insanity etc. This protein is obtained by making a cDNA library by using mRNAs extracted from human colon cancer culture cells, screening the library with a probe and then by manifesting the resultant human neurotensin receptor gene in host cells.

Description

Detailed Description of the Invention

[0001]

The present invention relates to a human neurotensin receptor protein, a partial peptide of the human neurotensin receptor protein, a DNA encoding the human neurotensin receptor protein, a vector containing the DNA, and a vector containing the vector. Transformant, method for producing human neurotensin receptor protein, method for screening human neurotensin receptor agonist / antagonist using human neurotensin receptor protein, said screening kit, agonist or antagonist obtained by said screening method, and It relates to a pharmaceutical composition containing the agonist or antagonist.

[0002]

BACKGROUND OF THE INVENTION Neurotensin is a peptide consisting of 13 amino acids originally isolated from the bovine hypothalamus [Caraway, R. and Leeman, SE Journal of.
Biological Chemistry (J. Biol. Chem.) 24
8, 6854-6861 (1973)], and its strong hypotensive action and intestinal action emphasized the hormone aspect [Berelowlts, M. et al. Journal of Neurochemistry (J. Neurochem. ) 31, 751-753 (1978),
Carraway, R. and Leeman, SE Journal of Biological Chemistry (J. Biol. Chem.) 250,
1907-1911 (1975)]. However, the localization of neurotensin in the central nervous system has been clarified [Kobayashi, RM
et al. Brain Research (Brain Res.) 122, 578-5
81 (1977)], and excitability to a single neuron [Miletic, V. and Randic, M. Brain Research (B
rain Res.) 169, 600-604 (1979)] or inhibition [M
aCarthy, PS et al. General Pharmacology (G
en. Pharmacol.) 10, 331-333 (1979)], and its potential as a neurotransmitter has been suggested. In addition, substantia nigra and ventral tegmental area (A9, A
It is known that neurotensin coexists with the dopaminergic nerve present in 10) [Hokfelt, T. et.
al. Journal of Comparative Neurology 222, 543-559 (198)
4)], It is noted that neurotensin controls dopamine neurons.

Recently, it has been shown that, like growth factors such as NGF, neurotensin is taken up into the cell through its receptor and is retrogradely transported to the nerve cell body in the nerve axon [. Castel, MN et al. Journal of Neurochemistry (J. Neurochem.) 56,
1816-1818 (1991), Castel, MN et al. Neuroscience 36, 425-430 (1990)]. Also,
It has been reported that neurotensin functions as a neurotrophic factor or a maintenance factor, and has received attention. On the other hand, the neurotensin receptor protein has been shown to be present in the substantia nigra, ventral tegmental area and diagonal zone nucleus in the central nervous system by binding autoradiography using radioligands [Moyse , E. et al.
Neuroscience 22, 525-536 (19
87)]. In particular, the dopaminergic nerves in the substantia nigra-striatum have neurotensin-binding sites [Masuo,
Y. et al. Brain Res. 510, 20
3-210 (1990)], it is considered that neurotensin activates dopaminergic nerve activation activity through these receptors. In the periphery, it is present in the intestinal tracts such as the duodenum, small intestine, and colon, and is said to be involved in the secretion of water and electrolytes. Recently, it was revealed that a large number of neurotensin receptor proteins are expressed in various human colorectal cancer-derived cells [Maoret,
J.-J. et al. Biochemical and Biophysical Research Communications (Biochem. Bio
Phys. Res. Commun.) 203, 465-471 (1994)], and it was also reported that neurotensin promotes the growth of some colorectal cancers [Yoshinaga, K. et al. Surgeon Oncology. (Surg. Oncol.) 1, 127-134 (199
2)]. From these, it is considered that the development of a drug that enhances or blocks the action of neurotensin is effective for various diseases.

In general, when developing an agonist or an antagonist of a physiologically active substance, a compound having a high affinity with a receptor to which the physiologically active substance specifically binds is searched for. As the neurotensin receptor protein, the whole brain membrane fraction of bovine or rat is currently used. However, since the animal species are different, the compound having high affinity for the membrane fraction is There is no guarantee that it will have a high affinity for the neurotensin receptor. As a human neurotensin receptor protein, a membrane fraction of human colon adenocarcinoma HT-29 cells is used. This cell has a low expression level of neurotensin receptor and many other receptors such as VIP receptor. Because it is expressed,
Not suitable for screening agonists and antagonists, but not the human neurotensin receptor protein in pure form. The rat neurotensin receptor protein cDNA has been cloned and its expression in COS cells has been reported [Tanaka
K. et al. Neuron 4, 847-854 (199)
0)], there is no guarantee that an agonist / antagonist screened using the rat neurotensin receptor protein will also be effective in humans.

The human neurotensin receptor protein cDNA has also been cloned and its expression in COS-7 cells has been reported [Vita, N. et al. FEBS Lett. 317, 139]. -142 pages (199
3)], the expression level of the human neurotensin receptor protein is low and the expression is transient, so that it is considered unsuitable for screening. As described above, the human neurotensin receptor protein produced by the conventional method has been insufficient as a receptor preparation for use in screening. Therefore, it has been desired to establish a more practical method for producing a neurotensin receptor protein. If human neurotensin receptor proteins can be used to screen for human neurotensin receptor agonists / antagonists, the disadvantages of using laboratory animals (eg, due to different species cannot exert effects on humans) It is expected that the possibility of obtaining a compound) can be overcome and the effective drug development for humans can be efficiently performed.

[0006]

DISCLOSURE OF THE INVENTION The present invention provides a human neurotensin receptor protein, a partial peptide of the human neurotensin receptor protein, a DNA encoding the human neurotensin receptor protein, and the DNA.
Carrying a vector, a transformant carrying the vector, a method for producing a human neurotensin receptor protein, a method for screening a human neurotensin receptor agonist / antagonist using the human neurotensin receptor protein, the screening kit, It is an object to provide an agonist or antagonist obtained by the screening method, and a pharmaceutical composition containing the agonist or antagonist.

[0007]

Means for Solving the Problems The inventors of the present invention have conducted extensive studies in view of the above problems, and as a result, have the same amino acid sequence as the amino acid sequence of a known rat neurotensin receptor protein. We have succeeded in cloning a DNA encoding a novel human neurotensin receptor protein having an amino acid sequence different from that of the neurotensin receptor protein. The 200th amino acid of the known amino acid sequence of human neurotensin receptor protein is Thr, while the 200th amino acid of the human neurotensin receptor protein of the present invention (SEQ ID NO: 1 and FIG. 1). The amino acid at position th is Ala. Further, among the nucleotide sequences of DNAs encoding known human neurotensin receptor proteins, the nucleotide sequences encoding the 63rd and 200th amino acids of the human neurotensin receptor protein are ⁶³ Lys (AAA) and ²⁰⁰ T
In contrast to hr (ACG), it encodes the 63rd and 200th amino acids of the human neurotensin receptor protein of the nucleotide sequence of the DNA encoding the human neurotensin receptor protein of the present invention. The base sequences are ⁶³ Lys (AAG) and
²⁰⁰ Ala (GCG).

Furthermore, the present inventors have found that COS- which expresses a known human neurotensin receptor protein.
7 cells (Vita, N. et al. Febs Letter (FEBS Let
t.) 317, pp. 139-142 (1993)), it succeeded in producing a cell line which expresses the human neurotensin receptor protein of the present invention in a much larger amount. Then, they have found that a human neurotensin receptor agonist / antagonist can be screened efficiently and reliably by using the cell line or the human neurotensin receptor protein of the present invention or a partial peptide thereof. The present inventors have completed the present invention as a result of further research based on these findings.

That is, the present invention provides (1) SEQ ID NO: 1
A human neurotensin receptor protein or a salt thereof, which comprises the amino acid sequence represented by: (2) a partial peptide of the human neurotensin receptor protein or a salt thereof according to (1), (3) DNA containing DNA encoding the human neurotensin receptor protein according to item (1), (4) DNA having the nucleotide sequence represented by SEQ ID NO: 2, (5) item (3) (6) A vector containing the DNA described in (6), a transformant carrying the vector described in (5) above, and a transformant described in (7) above (6).
DNA encoding neurotensin receptor protein
The method for producing a human neurotensin receptor protein according to item (1), which comprises culturing under conditions that allow expression of the protein, and (8) containing the human neurotensin receptor protein according to item (1) Cells or cell membrane fractions thereof, (9) the human neurotensin receptor protein or salt thereof according to item (1), the partial peptide or salt thereof according to item (2), or the cell according to item (8). Alternatively, a method for screening a human neurotensin receptor agonist or antagonist characterized by using a cell membrane fraction thereof,

(10) The human neurotensin receptor protein or salt thereof according to item (1), the partial peptide or salt thereof according to item (2), or the cell or cell membrane fraction thereof according to item (8). A kit for screening a human neurotensin receptor agonist or antagonist, comprising: (1
1) The screening method according to item (9) or item (1)
Human neurotensin receptor agonist obtained by using the screening kit according to item (0), (1
2) The screening method according to item (9) or item (1)
0) A human neurotensin receptor antagonist obtained by using the screening kit according to item 0),
(13) A prophylactic / therapeutic agent or an anorexia-inducing agent for Parkinson's disease, depression, dementia, hyperactivity syndrome or consciousness disorder, which comprises the human neurotensin receptor agonist according to (11) , (14) Prevention of retrograde esophagitis, enteritis, pancreatitis, ulcer, gastric cancer, intestinal cancer, psychosis, Huntington's disease or mania, which comprises the human neurotensin receptor antagonist according to (12) A therapeutic agent, an anxiolytic agent or a hypnotic sedative agent, and (15) the human neurotensin receptor protein according to item (1) or a salt thereof or the antibody against the partial peptide according to claim 2 or a salt thereof.

More specifically, in the present invention, the (16) partial peptide is a partial peptide of the human neurotensin receptor protein molecule described in (1), which is exposed outside the cell membrane. 2) the partial peptide according to item
(17) The vector according to item (5), wherein the vector is an expression vector for human neurotensin receptor protein designated by pTS861, and (18) the transformant is CH.
The transformant according to item (6), which is an O cell, (19) C.
HO cells are CHO / pTS861-1-2E6 or CH
The CHO cell according to item (16), which is a CHO cell represented by O / pTS861-24-2C5, and (20) the cell is CHO / pTS861-1-2E6 or CHO / pTS.
The cell or cell membrane fraction thereof according to item (8), which is a CHO cell represented by 861-24-2C5.

(21) (i) When human neurotensin receptor protein or the salt thereof described in (1) or the partial peptide or salt thereof described in (2) is contacted with neurotensin, ii) To compare with the case where the human neurotensin receptor protein or its salt described in (1) or the partial peptide or its salt described in (2) is contacted with neurotensin and a test compound. (22) A method for screening a human neurotensin receptor agonist or antagonist according to (9),
(I) labeled neurotensin is contacted with the human neurotensin receptor protein or salt thereof according to item (1), or the partial peptide or salt thereof according to item (2), and (ii) labeled Labeled neurotensin in the case where the neurotensin and the test compound are contacted with the human neurotensin receptor protein or its salt according to (1) or the partial peptide or its salt according to (2)・
(23) (i) A method for screening a human neurotensin receptor agonist or antagonist, which comprises measuring and comparing the amount of binding to a neurotensin receptor protein, a partial peptide thereof or a salt thereof. ) Contacting the labeled neurotensin with the cell or the cell membrane fraction thereof according to item (8), and (ii) labeling the neurotensin and the test compound with the cell or cell membrane fraction according to item (8) And a method for screening a human neurotensin receptor agonist or antagonist according to item (9), characterized in that it is compared with the case of contacting

(24) (i) The labeled neurotensin is brought into contact with the cell or the cell membrane fraction thereof described in (8), and (ii) the labeled neurotensin and the test compound are added to the (8) Item 9. The human according to Item (9), wherein the amount of labeled neurotensin bound to the cell or the cell membrane fraction thereof when contacted with the cell or the cell membrane fraction thereof is measured and compared.・
A method for screening a neurotensin receptor agonist or antagonist, (25) (i) when the neurotensin is contacted with the cell or the cell membrane fraction thereof, and (ii) the neurotensin and the test compound are Recombinant human neurotensin receptor-mediated cell-stimulating activity (eg, dopamine release, arachidonic acid release, acetylcholine release, intracellular Ca) when contacted with the cell or the cell membrane fraction thereof described in (8). ²⁺ concentration fluctuation, intracellular cAMP generation, intracellular cGMP generation, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-fos activation, pH decrease, cell migration activity, etc. are promoted. (9) Item (9), characterized in that the activity or suppressing activity) is measured and compared. Method for screening human neurotensin receptor agonist or antagonist, (26) Prophylactic / therapeutic agent for neurotensin receptor protein deficiency comprising the DNA according to item (3), and (27) Neurotensin receptor The preventive / therapeutic agent according to item (24), wherein the protein deficiency is Parkinson's disease.

The human neurotensin receptor protein of the present invention includes all human tissues (for example, stomach,
Derived from pituitary gland, pancreas, brain (whole brain, substantia nigra, etc.), kidney, liver, gonad, thyroid, gallbladder, bone marrow, adrenal gland, skin, muscle, lung, digestive tract, blood vessel, heart, etc.) or cells Any human neurotensin receptor protein may be used, so long as it contains an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 1. That is, as the human neurotensin receptor protein of the present invention, in addition to the protein containing the amino acid sequence represented by SEQ ID NO: 1 and the like, the amino acid sequence represented by SEQ ID NO: 1 and about 90 to 99.9 are contained.
Contains an amino acid sequence with% homology, SEQ ID NO:
Examples thereof include a protein having substantially the same activity as the protein containing the amino acid sequence represented by 1. Examples of substantially the same activity include ligand binding activity and signal transduction. "Substantially the same quality" means that the ligand binding activity and the like are qualitatively the same.
Therefore, strength and weakness such as strength of ligand binding activity and quantitative factors such as molecular weight of receptor protein may be different.

More specifically, examples of the human neurotensin receptor protein of the present invention include human-derived human neurotensin receptor protein characterized by containing the amino acid sequence represented by SEQ ID NO: 1. To be The human neurotensin receptor protein of the present invention has an amino acid sequence represented by SEQ ID NO: 1 in which one or more amino acids are deleted, or an amino acid sequence represented by SEQ ID NO: 1 Alternatively, an amino acid sequence in which two or more amino acids are added, a protein containing an amino acid sequence in which one or two or more amino acids in the amino acid sequence represented by SEQ ID NO: 1 are replaced with other amino acids, and the like are also included. further,
In the human neurotensin receptor protein of the present invention, Met at the N-terminus is protected by a protecting group (for example, C _1-6 acyl group such as formyl group and acetyl group), and the N-terminal side of Glu is produced. Those which have been cleaved in the body and whose Glu has been converted to pyroglutamine, and the side chains of amino acids in the molecule have suitable protecting groups (for example, C such as formyl group and acetyl group).
_1-6 acyl groups, etc.), or complex proteins such as so-called glycoproteins to which sugar chains are bound.

However, a human neurotensin receptor protein [Vita, N. et al. Febs Letter (FEBS Let) having an amino acid sequence in which the 200th Ala of the amino acid sequence represented by SEQ ID NO: 1 is replaced with Thr.
t.) 317, 139-142 (1993)] is excluded from the scope of the human neurotensin receptor protein of the present invention. As the salt of the human neurotensin receptor protein of the present invention, a physiologically acceptable acid addition salt is particularly preferable. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid), or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid). , Tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like. The human neurotensin receptor protein of the present invention or a salt thereof can be produced from a tissue or cell of a warm-blooded animal by a method of protein purification known per se, or a DNA encoding the human neurotensin receptor protein described below can be prepared. It can also be produced by culturing the transformant containing it. It can also be produced according to the peptide synthesis method described below.

As the partial peptide of the human neurotensin receptor protein of the present invention, for example, a portion of the human neurotensin receptor protein molecule of the present invention which is exposed outside the cell membrane is used. Specifically, it is a peptide containing a portion analyzed as an extracellular region (hydrophilic site) in the hydrophobicity plot analysis of the human neurotensin receptor protein of the present invention. Further, a peptide partially containing a hydrophobic (Hydrophobic) site can also be used. A peptide containing each domain individually may be used, but a peptide of a part containing a plurality of domains at the same time may be used. As the salt of the partial peptide of the human neurotensin receptor protein of the present invention, a physiologically acceptable acid addition salt is particularly preferable. Examples of such salts include salts with inorganic acids (for example, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid),
Alternatively, organic acids (eg, acetic acid, formic acid, propionic acid,
Fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid,
Malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like salts are used.

The partial peptide of the human neurotensin receptor protein of the present invention or a salt thereof is produced according to a method known per se for peptide synthesis, or by cleaving the human neurotensin receptor protein of the present invention with an appropriate peptidase. be able to. The peptide synthesis method may be either a solid phase synthesis method or a liquid phase synthesis method. That is, the target peptide can be produced by condensing a partial peptide or amino acid that can form the protein of the present invention with the remaining portion and removing the protecting group when the product has a protecting group.
Examples of known condensation methods and elimination of protective groups include the methods described in the following (1) to (3). M. Bodanszky and MA Ondetti, Peptide Synthesis, Interscience Publisher
s, New York (1966) Schroeder and Luebke, The Peptide,
Academic Press, New York (1965) Nobuo Izumiya et al., Fundamentals and experiments of peptide synthesis, Maruzen Co., Ltd.
(1975) Haruaki Yajima and Shunpei Sakakibara, Laboratory for Biochemistry 1, Protein Chemistry IV, 205, (1977) Supervised by Haruaki Yajima, Development of Pharmaceuticals Volume 14 Peptide Synthesis Hirokawa Shoten The protein of the present invention can be purified and isolated by a combination of purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization and the like. When the protein obtained by the above method is a free form, it can be converted into an appropriate salt by a known method, and conversely, when it is obtained with a salt, it can be converted into a free form by a known method. it can.

As the DNA encoding the human neurotensin receptor protein of the present invention, a human neurotensin receptor protein containing an amino acid sequence substantially the same as the amino acid sequence of SEQ ID NO: 1 of the present invention (provided that the sequence is No. 20 of the amino acid sequence represented by 1
Human neurotensin receptor protein having an amino acid sequence in which 0th Ala is replaced by Thr [Vita,
N. et al. FEBS Lett. 317, 139-1
42 (1993)]). Further, it may be any of genomic DNA, tissue / cell-derived cDNA, and synthetic DNA. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, from tissue / cell, mR
Direct reverse transcribing using prepared NA fraction
ptase Polymerase Chain Reaction (hereinafter RT-PCR
Abbreviated as law. ). More specifically, D encoding a human neurotensin receptor protein containing the amino acid sequence of SEQ ID NO: 1
As NA, DNA having the base sequence represented by SEQ ID NO: 2 or the like is used. Cloned human
DNA encoding neurotensin receptor protein
Can be used as it is, or if desired, after digestion with a restriction enzyme or addition of a linker. The DNA may have ATG as a translation initiation codon at the 5′-terminal side and TAA, TGA or TAG as a translation termination codon at the 3′-terminal side. These translation initiation codon and translation termination codon can be added using an appropriate synthetic DNA adaptor.

The vector (particularly an expression plasmid) containing the human neurotensin receptor protein DNA of the present invention includes, for example, (a) a DNA fragment of interest from the DNA encoding the human neurotensin receptor protein of the present invention. It can be produced by cutting out and (b) ligating the DNA fragment downstream of the promoter in an appropriate expression plasmid. As the vector, a plasmid derived from Escherichia coli (eg, pBR322, pBR32
5, pUC12, pUC13), a plasmid derived from Bacillus subtilis (eg, pUB110, pTP5, pC194), a plasmid derived from yeast (eg, pSH19, pSH15), bacteriophage such as λ phage, retrovirus, vaccinia virus, baculovirus, etc. Animal viruses are used. The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. When the host for transformation is Escherichia, the trp promoter, lac promoter, recA promoter,
λP _L promoter, lpp promoter, etc., when the host is a Bacillus genus, SPO1 promoter, S
When the host is yeast such as PO2 promoter and penP promoter, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter and the like are preferable.

When the host is an animal cell, SV40
Origin promoter, retrovirus promoter,
Metallothionein promoter, heat shock promoter, cytomegalovirus (CMV) promoter, SRα promoter, etc. can be used respectively. The use of enhancers for expression is also effective. Also,
If necessary, a signal sequence suitable for the host is added to the N-terminal side of human neurotensin receptor protein. When the host is a bacterium of the genus Escherichia, alkaline phosphatase signal sequence, OmpA signal sequence, etc., when the host is a bacterium of the genus Bacillus, α-amylase signal sequence, subtilisin signal sequence, etc., the host is yeast When the host is an animal cell, for example, an insulin signal sequence, an α-interferon signal sequence, an antibody molecule / signal sequence, etc., respectively. Available.

Further, among the vectors containing the human neurotensin receptor protein DNA of the present invention, a preferred method for constructing an expression plasmid will be shown below. As plasmids, pAKKO 1.11 (sometimes referred to as pA1-11), pRc / CMV, pRc / RSV
Etc. are used, among which pAKKO1.11 (pA1-
11) and the like are preferable. As the promoter, any promoter can be used so long as it functions efficiently in the host cell,
SV40 early promoter, CMV promoter, HS
Examples thereof include V-TK promoter, SRα promoter, RSV promoter, etc. Among them, CMV promoter, SRα promoter and the like are preferable, and SRα promoter is particularly preferable. It is preferable to use an expression plasmid containing an enhancer, a splicing signal, a poly A addition signal, a selection marker and the like in addition to the above. Examples of the selectable marker include dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene, neomycin phosphotransferase (hereinafter sometimes referred to as neo gene), and the like. The dhfr gene confers methotrexate (MTX) resistance and the neo gene confers G-418 resistance. In particular, when the dhfr gene is used as a selection marker using CHO cells deficient in the dhfr gene, selection can be performed using a thymidine-free medium.

As a preferred expression plasmid carrying the DNA encoding the human neurotensin receptor protein of the present invention, specifically, the above promoter (particularly SRα) is provided upstream of the DNA encoding the human neurotensin receptor protein. Promoter), preferably the SV early gene poly A addition signal is inserted downstream of the DNA encoding the human neurotensin receptor protein, and the dhfr gene, ampicillin resistance gene, etc. are inserted downstream of the poly A addition signal. Those inserted are preferable. More specifically, for example, the SRα promoter is inserted upstream of the human neurotensin receptor protein DNA, the SV early gene poly A addition signal is inserted downstream of the DNA encoding the human neurotensin receptor protein, and the downstream thereof is inserted. dh
An expression plasmid designated by pTS861 in which the fr gene has been inserted, and an ampicillin resistance gene has been inserted further downstream thereof (FIG. 4) and the like are preferable. By introducing the expression plasmid containing the thus-produced human neurotensin receptor protein DNA into a host cell, a cell capable of highly expressing the DNA encoding the human neurotensin receptor protein can be produced.

The host cells into which the vector containing the human neurotensin receptor protein DNA of the present invention is introduced are, for example, Escherichia spp, Bacillus spp,
Yeast, insects, animal cells, etc. are used. Specific examples of Escherichia and Bacillus include Escherichia
Escherichia coli K12 DH1 [Proc. Natl. Proc. Of the National Academy of Sciences of the USA]
Acad. Sci. USA), 60, 160 (1968)],
JM103 [Nukuirek Acids Research, (Nu
cleic Acids Research), Volume 9, 309 (1981)],
JA221 [Journal of Molecular Biology], 120
Vol. 517 (1978)], HB101 [Journal of Molecular Biology, Vol. 41, 459 (1)
969]], C600 [Genetic (Genetic
s), 39 volumes, 440 (1954)] and the like.
Examples of the bacterium of the genus Bacillus include Bacillus subtilis MI114 [Gene, 24,
255 (1983)], 207-21 [Journal of Biochemistry],
95, 87 (1984)] and the like. Examples of yeast include Saccharomyces cerevisiae (Saccar
^{omyces cerevisiae) AH22, AH22R -,} NA87
-11A, DKD-5D, 20B-12, etc. are used.

As the insects, for example, silkworm larvae are used [Maeda et al., Nature, 315].
Vol., 592 (1985)]. Examples of animal cells include monkey cells COS-7, Vero cells, Chinese hamster cells CHO, dhfr gene-deficient Chinese hamster cells CHO (dhfr ^- CHO cells), human F
L cell, 293 cell, L cell, myeloma cell, C12
7 cells, Balb / c3T3 cells, Sp-2 / O cells and the like are used. For transformation of Escherichia, for example, Proc. Natl. Acad. Sci. USA, 69.
Volume, 2110 (1972) and Gene, Volume 17, 1
07 (1982) and the like.
Transformations of Bacillus include, for example, Molecular and General Genetics (Molecula).
r & General Genetics), 168, 111 (197)
It is performed according to the method described in 9) or the like. To transform yeast, for example, the Procedures of the National Academy of Sciences of
The USA (Proc. Natl. Acad. Sci. USA),
Vol. 75, 1929 (1978). For transforming insect cells, for example, Bio / Technology, 6, 47-55 (1988))
And the like. For transforming animal cells, for example, Virology, 5
Volume 2, 456 (1973).

Among the above host cells, the human
As the host cell of the expression plasmid containing the neurotensin receptor protein DNA, animal cells and the like are particularly preferable, and examples thereof include 293 cells, CHO cells, L cells,
Examples include myeloma cells, C127 cells, Balb / c3T3 cells, Sp-2 / O cells, among which CHO
Cells or Sp-2 / O cells are preferred, and especially CH
O cells and the like are preferable. Furthermore, among CHO cells, CHO cells lacking the dhfr gene (hereinafter,
CHO (dhfr ⁻ ) cell), C
HOK-1 cells and the like are preferred. When the dhfr gene is inserted as a selection marker in the expression plasmid, CHO (dhfr ⁻ ) cells and the like are suitable. As the combination of the expression plasmid and the host cell, a preferable combination can be appropriately selected, for example,
Suitable host cells for the expression plasmid [FIG. 4] designated by pTS861 are, for example, CHO (dhfr ⁻ ) cells. As a method for introducing this expression plasmid into animal cells, known methods such as calcium phosphate method [Graham, FL and van der Eb, AJ Virology
(Virology) 52, 456-467 (1973)], electroporation (Neuma
nn, E. et al. EMBO J., 1, 841-8
45 (1982)] and the like are used. As described above, a transformant transformed with the vector containing the human neurotensin receptor protein DNA is obtained. In addition, a transformant transformed with an expression plasmid containing human neurotensin receptor protein DNA can produce human neurotensin receptor protein.

The cells capable of highly expressing the human neurotensin receptor protein can be obtained by clonally selecting the cells in which the above-mentioned expression plasmid has been integrated into the chromosome. Specifically, first, a transformant is selected using the above selection marker as an index. Furthermore, by repeatedly carrying out clone selection on the transformant obtained using the selectable marker in this manner, a cell line stably having a high expression level of human neurotensin receptor protein can be obtained. . Also, d
When the hfr gene is used as a selection marker, by gradually increasing the concentration of methotrexate (MTX) and culturing to select resistant cells, the transgene is amplified in the cells to obtain a cell line with higher expression. You can also Even when CHO (dhfr ⁻ ) cells are used as the host, for example, since the dhfr gene has been introduced into the expression plasmid designated by pTS861 [FIG. 4], the expression plasmid designated by pTS861 should be used. The CHO (dhfr ⁻ ) cells containing, as a result,
It has a dhfr gene. In the present specification, an expression plasmid containing the dhfr gene (eg, pTS861) is CHO (dhfr ⁻ )
The CHO cells obtained by including them in the cells are referred to as "CHO (d
hfr ⁺ ) cells ".

In the present invention, the transformant capable of highly expressing human neurotensin receptor protein DNA is, for example, pTS86 obtained in Example 2 described later.
The expression plasmid indicated by 1 was CHO (dhfr ⁻ )
Examples thereof include CHO (dhfr ⁺ ) cells obtained by containing them in cells. Specifically, CHO / pTS861
-1-2E6 labeled CHO (dhfr ⁺ ) cells, C
CHO indicated by HO / pTS861-24-2C5
(Dhfr ⁺ ) cells and the like. These CHO
(Dhfr ⁺ ) cells are COS-7 cells expressing a known human neurotensin receptor protein [Vita, N.
et al. FEBS Lett. 317, 139-142
(1993)], a tissue capable of expressing a large amount of human neurotensin receptor protein and further containing a natural human neurotensin receptor protein (eg, human adenocarcinoma HT-29 cells)
It has a receptor activity (for example, ligand binding activity) about 10 to 100 times, preferably about 100 times that of the above. Therefore, these CHO (dhf
r ⁺ ) cells are effective for the screening method for human neurotensin receptor agonist / antagonist described later.

The human neurotensin receptor protein of the present invention and cells containing the human neurotensin receptor protein of the present invention contain a vector (particularly, an expression plasmid) containing the human neurotensin receptor protein DNA of the present invention. To a human neurotensin receptor protein encoding D
It can also be produced by culturing under conditions in which NA can be expressed. When culturing a transformant whose host cell is a bacterium of the genus Escherichia or Bacillus, a liquid medium is suitable as a medium used for the culture, and among them, a carbon source necessary for the growth of the transformant. , Nitrogen sources, inorganic substances, etc. are included. Examples of the carbon source include glucose, dextrin, soluble starch and sucrose, and examples of the nitrogen source include ammonium salts, nitrates,
Inorganic or organic substances such as corn steep liquor, peptone, casein, meat extract, soybean meal, and potato extract, examples of the inorganic substance include calcium chloride, sodium dihydrogen phosphate, magnesium chloride and the like.
In addition, yeast, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5-8. As a medium for culturing Escherichia, for example, M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molar Genetics (Journal of Experiments in Mo
lecular Genetics), 431-433, Cold Spring Ha
rbor Laboratory, New York 1972] is preferred. If necessary, a drug such as 3β-indolylacrylic acid can be added to the promoter so as to work efficiently.

When the host cell is a bacterium of the genus Escherichia, the culture is usually carried out at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring can be added. When the host cell is a bacterium of the genus Bacillus, the culture is usually performed at about 30 to 40 ° C for about 6 to 2
It is performed for 4 hours, and aeration and stirring can be added if necessary. When culturing a transformant whose host cell is yeast,
Examples of the medium include Burkholder.
r) Minimal medium [Bostian, KL, et al., "Proc. Natl. Acad., Proc. of the National Academy of Sciences of the USA.
Sci. USA), 77, 4505 (1980)] and 0.5.
SD medium containing% casamino acid [Bitter, GA et al.
"Proc. Natl. Acad. Sci. USA", Vol. 81, 533. "Procedures of the National Academy of Sciences of the USA".
0 (1984)]. The pH of the medium is about 5-8
It is preferable to adjust Cultivation is usually about 20 ° C to 35 ° C
For about 24 to 72 hours, and aeration and stirring are added if necessary. When culturing a transformant whose host cell is an insect,
Grace's Insect Medium (Grace, TC
C., Nature, 195, 788 (1962)) to which appropriate additives such as inactivated 10% bovine serum are added. The pH of the medium is preferably adjusted to about 6.2 to 6.4. Culturing is usually performed at about 27 ° C for about 3 to 5 days,
Add aeration and agitation as needed.

When culturing a transformant in which the host cell is an animal cell, the medium is, for example, MEM medium containing about 0.5 to 20% fetal bovine serum [Science (Seienc
e), 122, 501 (1952)], DMEM medium [Virology, 8, 396 (195).
9)], RPMI 1640 medium [The Journal of the American Medical Association (The Jo
unal of the American Medical Association) 199
Vol. 5, 519 (1967)], 199 medium [Proceeding of the Society for the Society for the Society for the Society for the
Biological Medicine), 73, 1 (1950)], α-
A MEM medium or the like is used. In particular, CHO (dhfr
^- ) When cells and dhfr selectable marker gene are used, it is preferable to use DMEM medium or α-MEM medium containing dialyzed fetal bovine serum containing almost no thymidine. The pH is preferably about 6-8. Culturing is usually carried out at about 30 to 40 ° C. for about 15 to 200 hours, and if necessary, medium exchange, aeration, stirring, etc. are added. In this manner, cells containing the human neurotensin receptor protein can be produced from the transformants carrying the vector (particularly, the expression plasmid) containing the DNA encoding the human neurotensin receptor protein. The human neurotensin receptor protein or its partial peptide can be separated and purified from the culture of cells containing the human neurotensin receptor protein of the present invention described above, for example, by the following method.

First, when the human neurotensin receptor protein is extracted from the cultured bacterial cells or cells, after the culture, the bacterial cells or cells are collected by a known method, suspended in a suitable buffer solution, ultrasonicated, After disrupting the cells or cells by lysozyme and / or freeze-thawing, a method of obtaining a crude extract of human neurotensin receptor protein by centrifugation or filtration can be appropriately used. A protein denaturing agent such as urea or guanidine hydrochloride or Triton X-100 (registered trademark.
Sometimes abbreviated as TM. ) Or the like may be included. These known separation and purification methods include methods utilizing solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis, and the like. Method using difference in charge, method using charge difference such as ion exchange chromatography, method using specific novelty such as affinity chromatography, use of difference in hydrophobicity such as reversed-phase high-performance liquid chromatography And a method utilizing the difference in isoelectric points such as isoelectric focusing. When the human neurotensin receptor protein thus obtained is obtained in a free form,
The salt can be converted into a salt by a method known per se or a method analogous thereto, and conversely, when a salt is obtained, it can be converted into a free form or another salt by a method known per se or a method analogous thereto.

Incidentally, the human neurotensin receptor protein produced by the recombinant is treated with an appropriate protein-modifying enzyme before or after purification to arbitrarily modify or partially remove the polypeptide. You can also Examples of the protein-modifying enzyme include trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like. The activity of the human neurotensin receptor protein thus produced can be measured by a binding experiment with a labeled neurotensin or the like and an enzyme immunoassay using a specific antibody. In the above method, in place of the DNA encoding the human neurotensin receptor protein of the present invention, a DNA encoding a known human neurotensin receptor protein [Vita, N.
et al. FEBS Lett. 317,139-142
(1993)], cells that highly express the recombinant human neurotensin receptor protein or recombinant human neurotensin receptor protein can be isolated. A known human neurotensin receptor protein is expressed in COS-7 [Vita, N. et.
al. FEBS Lett. 317, 139-142 (1
993)], the expression level in COS-7 is generally small. However, according to the method of constructing the expression plasmid of the present invention, not only cells (particularly CHO cells) that highly express the human neurotensin receptor protein of the present invention but also well-known human neurotensin receptor protein are highly expressed. Cells (especially CHO cells) can be produced.

The cell membrane fraction of cells containing the human neurotensin receptor protein of the present invention is the human
It refers to a fraction containing a large amount of cell membranes obtained by a method known per se after disrupting cells containing the neurotensin receptor protein. As a method of crushing cells,
For example, a method of crushing cells with a Potter-Elvehjem type homogenizer, a Waring blender or a polytron (Kine
matica), ultrasonic crushing, crushing by ejecting cells from a thin nozzle while pressurizing with a French press, etc. For the fractionation of the cell membrane, a fractionation method by centrifugal force such as a fractionation centrifugation method or a density gradient centrifugation method is mainly used. For example, the cell lysate is centrifuged at low speed (500 rpm to 3000 rpm) for a short time (usually about 1 minute to 10 minutes), and the supernatant is further centrifuged at high speed (15000 rpm to 30000 rpm) for usually 30 minutes to 2 hours to obtain The precipitate is used as the membrane fraction. The membrane fraction is rich in the expressed human neurotensin receptor protein and membrane components such as cell-derived phospholipids and membrane proteins. The cells containing the human neurotensin receptor protein of the present invention or humans in the cell membrane fraction thereof.
The amount of neurotensin receptor protein is preferably 10 ³ to 10 ⁸ molecules per cell, and 10 ⁵ to 10 ⁷
It is preferably a molecule. The higher the expression level, the higher the ligand binding activity (specific activity) per membrane fraction,
Not only will it be possible to construct a highly sensitive screening system, but it will also be possible to measure a large number of samples in the same lot.

The human neurotensin receptor protein of the present invention, the partial peptide of the human neurotensin receptor protein, and the DNA encoding the human neurotensin receptor protein are available as an antibody and antiserum, and a recombinant receptor protein expression system. , Development of a receptor binding assay system using the same expression system, screening of drug candidate compounds, drug design based on comparison with structurally similar ligands and receptors, preparation of probes and PCR primers for gene diagnosis , Gene therapy, etc. In particular, human-specific human neurotensin receptor agonists or antagonists can be screened by a receptor binding assay system using the expression system of the human neurotensin receptor protein of the present invention, and the agonist or antagonist can be used as a neurotensin receptor. It can be used as a prophylactic / therapeutic agent for various diseases caused by. The use of the DNA encoding the human neurotensin receptor protein, the human neurotensin receptor protein partial peptide, or the human neurotensin receptor protein of the present invention will be described in more detail below.

(1) Method for Screening Human Neurotensin Receptor Agonist or Antagonist The human neurotensin receptor protein of the present invention or a salt thereof, a partial peptide of the human neurotensin receptor protein of the present invention or a salt thereof, or the present invention A cell containing the human neurotensin receptor protein or a cell membrane fraction thereof is useful for screening a human neurotensin receptor agonist or antagonist. That is, the present invention provides the human neurotensin receptor protein of the present invention or a salt thereof, the partial peptide of the human neurotensin receptor protein of the present invention or a salt thereof, or the human neurotensin receptor protein of the present invention.
Provided is a method for screening a human neurotensin receptor agonist or antagonist, which comprises using a cell containing a neurotensin receptor protein or a cell membrane fraction thereof.

More specifically, the present invention relates to (I) (i) the case where the human neurotensin receptor protein of the present invention, a partial peptide thereof or a salt thereof is contacted with neurotensin, and (ii) the present invention. Invention human
A method for screening a human neurotensin receptor agonist or antagonist, which comprises comparing a neurotensin receptor protein, a partial peptide thereof or a salt thereof with that in contact with neurotensin and a test compound, and (II) (I) when a cell containing the human neurotensin receptor protein of the present invention or a cell membrane fraction thereof is contacted with neurotensin; and (ii) the human neurotensin receptor protein of the present invention
Disclosed is a method for screening a human neurotensin receptor agonist or antagonist, which comprises performing a comparison with a case where a cell containing a neurotensin receptor protein or a cell membrane fraction thereof is contacted with a neurotensin and a test compound.

Specifically, in the screening methods (I) and (II) of the present invention, for example, in the case of (i) and (ii), for example, the human neurotensin receptor protein, a partial peptide thereof or a salt thereof is used. , Or C containing the human neurotensin receptor protein
It is characterized in that the binding amount of neurotensin to HO cells or the cell membrane fraction thereof, cell stimulating activity, etc. are measured and compared. More specifically, the present invention provides (Ia) (i) labeled neurotensin in contact with the human neurotensin receptor protein of the present invention, a partial peptide thereof or a salt thereof, and (ii) labeled Labeled human neurotensin and the test compound are contacted with the human neurotensin receptor protein of the present invention, a partial peptide thereof or a salt thereof, the labeled neurotensin receptor protein,
A method for screening a human neurotensin receptor agonist or antagonist, which comprises measuring the amount of binding to a partial peptide or a salt thereof and comparing the amounts.

(IIa) (i) When labeled neurotensin is contacted with cells containing the human neurotensin receptor protein of the present invention or a cell membrane fraction thereof, and (ii) labeled neurotensin and a test compound Is contacted with a cell containing the human neurotensin receptor protein of the present invention or a cell membrane fraction thereof, the binding amount of labeled neurotensin to the cell or cell membrane fraction thereof is measured and compared. A method for screening a human neurotensin receptor agonist or antagonist, and (IIb) (i) contacting a cell containing a human neurotensin receptor protein of the present invention or a cell membrane fraction thereof with , (Ii) Neurotensin and testing When a substance is contacted with cells containing the human neurotensin receptor protein of the present invention or a cell membrane fraction thereof, cell stimulating activity via human neurotensin receptor (for example, dopamine release, arachidonic acid release, Acetylcholine release,
Fluctuation of intracellular Ca ²⁺ concentration, intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-fos activation, p
The present invention provides a method for screening human neurotensin receptor agonists or antagonists, which comprises measuring and comparing H reduction, activity promoting or suppressing cell migration activity and the like).

In the above screening method (Ia) or (IIa), the compound that binds to the human neurotensin receptor protein and inhibits the binding between neurotensin and the human neurotensin receptor protein is the human neurotensin receptor. It can be selected as an agonist or an antagonist. In addition, (II
In the screening method of b), it binds to a human neurotensin receptor and cell-stimulating activity (eg, dopamine release, arachidonic acid release, acetylcholine release, fluctuation of intracellular Ca ²⁺ concentration, intracellular cAMP) via the receptor. Production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-fos activation, pH lowering, activity promoting or suppressing cell migration activity, etc.) The compound having can be selected as a human neurotensin receptor agonist. On the other hand, in the above-mentioned screening method (Ia) or (IIa), among the test compounds found to have the activity of inhibiting the binding between neurotensin and human neurotensin receptor protein,
A compound having no cell stimulating activity can be selected as a human neurotensin receptor antagonist.

Before the cells containing the human neurotensin receptor protein of the present invention were obtained, there were no cells capable of highly expressing the human neurotensin receptor protein. Therefore, it is possible to efficiently screen for neurotensin receptor agonists or antagonists. could not. A detailed description of the screening method of the present invention is given below. As the neurotensin used as a ligand, a commercially available one or the like can be used. Further, known neurotensin receptor agonists or antagonists can be used instead of neurotensin. As the labeled neurotensin, for example, neurotensin labeled with [ ³ H], [ ¹²⁵ I], [ ¹⁴ C] or the like can be used, and further, [ ³ H], [ ¹²⁵ I], [ ¹²⁵ I], Known neurotensin agonists or antagonists labeled with ¹⁴ C] or the like can also be used. For example, [ ¹²⁵ I] -labeled neurotensin (Amersham) and the like are preferable. Examples of test compounds include peptides, proteins,
Examples include non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, etc. These compounds may be novel compounds or known compounds. .

Specifically, the above (1a) or (2
In order to carry out the screening method of a), first, cells containing the human neurotensin receptor protein of the present invention or a cell membrane fraction thereof, or human neurotensin receptor protein or its partial peptide are
Prepare a receptor preparation by suspending it in a buffer suitable for screening. The buffer may be any buffer that does not inhibit the binding between neurotensin and the receptor, such as a phosphate buffer having a pH of about 4 to 10 (desirably, a pH of about 6 to 8) and a Tris-hydrochloric acid buffer. Further, for the purpose of reducing non-specific binding, a surfactant such as CHAPS, Tween-80 ^™ (Kao-Atlas), digitonin and deoxycholate can be added to the buffer. In addition, protease inhibitors such as PMSF, leupeptin, bacitracin, aprotinin, E-64 (manufactured by Peptide Laboratories), pepstatin and the like can be added for the purpose of suppressing the decomposition of the receptor and ligand by protease. Then, the test compound was suspended in the same buffer at 10 ⁻⁴ M to 1
A 0 ^-10 M test compound solution is placed in the reaction tube and 0.01 ml to ¹⁰ ml of the receptor solution is added.

Furthermore, a fixed amount (for example, 2000 Ci /
In the case of mmol, about 10,000 cpm to 1,000,000
cpm) labeled neurotensin (eg [ ¹²⁵
I] Neurotensin) is added. A reaction tube containing a large excess of unlabeled neurotensin is also prepared in order to know the non-specific binding amount (NSB). The reaction is carried out at 0 ° C to 50 ° C, preferably 4 ° C to 37 ° C for 20 minutes to 24 hours, preferably 30 minutes to 3 hours. After the reaction, the mixture is filtered with glass fiber filter paper or the like, washed with an appropriate amount of the same buffer, and then the radioactivity remaining in the glass fiber filter paper (for example, [(
The amount of ¹²⁵ I]) is measured with a liquid scintillation counter or a γ-counter. A manifold or a cell harvester can be used for filtration, but it is preferable to use a cell harvester in order to increase efficiency.
When the count (B ₀ -NSB) obtained by subtracting the nonspecific binding amount (NSB) from the count (B ₀ ) when there is no substance to be antagonized is 100%, the specific binding amount (B-NSB) is, for example, Test compounds that give 50% or less of the count (B ₀ -NSB) can be selected as agonist or antagonist candidate compounds.

Specifically, the operation is performed in the following procedure. (I) 50 mM Tris-HCl, 5 mM MgCl ₂ ,
Make a reaction buffer of 500 μM orthophenanthroline, 200 μM bacitracin, 0.2% BSA, pH 7.4. (Ii) 2 μl of a test compound solution prepared by suspending a test compound in a reaction buffer is put in a reaction tube on ice. The final concentration of test compound is adjusted to 100 μM. (Iii) The cell membrane fraction containing human neurotensin receptor protein freeze-dried at −80 ° C. is returned to room temperature, vortexed lightly, and then diluted to an appropriate concentration,
Prepare a cell membrane fraction solution (eg, 1.5 mg protein / ml (bovine brain membrane fraction), 100 μg protein / ml)
(Human adenocarcinoma HT-29 cell membrane fraction) and the like).
After passing this cell membrane fraction solution through a cell strainer, 200 μl of the solution is placed in a reaction tube with a dispenser. (Iv) [ ¹²⁵ I] Neurotensin (IM-163, Amersham Co.) diluted in reaction buffer (2 μl) is put in a reaction tube on ice. (V) Perform the reaction at 25 ° C. for 90 minutes. (Vi) Perform B / F separation using a manifold. Filter used at this time (GF / F, Whatman)
Is a PEI solution (20 mM Tris-HCl,
Soak for 1 hour or more in 0.3% polyethylene imide), pH 7.4). (Vii) Count the filter with a γ-counter.
Compounds that inhibited specific binding by 40 to 50% or more were ± 5
Compounds that inhibit 0% or more are evaluated as +.

Further, in order to carry out the screening method of the above (2b), cell stimulating activity mediated by human neurotensin receptor protein (eg, dopamine release, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ concentration) Fluctuation, intracellular cAMP production, intracellular cGM
P production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-fos activation, pH decrease, activity promoting or suppressing cell migration activity, etc.) by known methods or commercially available It can be measured using the measurement kit. Specifically, first,
Cells containing the neurotensin receptor protein are cultured in a multiwell plate or the like. For screening, the medium was exchanged with a fresh medium or an appropriate buffer that did not show toxicity to cells in advance, and after adding a test compound or the like and incubating for a certain period of time, cells were extracted or supernatant was collected to generate The product is quantified according to the respective method. When the production of a substance that serves as an index of cell stimulating activity (for example, arachidonic acid) is difficult to assay by the degrading enzyme contained in the cell, an inhibitor for the degrading enzyme may be added to the assay. Further, the activity of suppressing cAMP production and the like can be detected as a production suppressing action on cells in which the basic production amount of cells has been increased by forskolin or the like.

The screening kit of the present invention comprises the human neurotensin receptor protein of the present invention or a salt thereof, a partial peptide of the human neurotensin receptor protein of the present invention or a salt thereof, or the human neurotensin receptor protein of the present invention. Cells containing or a cell membrane fraction thereof. Examples of the screening kit of the present invention include the following. [Screening Reagent] Measurement Buffer and Washing Buffer A DMEM medium containing 0.01% bovine serum albumin, 1 mM orthophenanthroline and 20 mM HEPES, adjusted to pH 7.0 with sodium hydroxide. It may be sterilized by filtration with a filter having a pore size of 0.22 μm and stored at 4 ° C., or may be prepared before use. Human Neurotensin Receptor Protein Standard Preparation Human neurotensin receptor protein-containing cells were subcultured on a 12-well plate at 5 × 10 ⁵ cells / well and 3
Cultured at 7 ° C., 5% CO ₂ , 95% air until confluent. Labeled neurotensin A commercially available neurotensin solution labeled with [ ³ H], [ ¹²⁵ I], [ ¹⁴ C] or the like is stored at 4 ° C or -20 ° C,
When using, dilute to 1 μM with measurement buffer. Neurotensin standard solution Neurotensin is dissolved in sterilized water to 10 ⁻⁴ M and stored at −20 ° C.

[Measurement method] Cells containing human neurotensin receptor protein cultured in a 12-well tissue culture plate were washed with 1 ml of the measurement buffer about 1 to 2 times and then cooled to 4 ° C. 1 ml of buffer solution was added and kept at 4 ° C. for 10 minutes. After sucking out the measurement buffer, cool it to 4 ℃ 10 ^-3
After adding 5 μl of a test compound solution of ^{-10 -10} M,
A measurement buffer containing 0 pM labeled neurotensin was added to a concentration of 0.
Add 5 ml and react at 4 ° C. for 3 hours. To determine the amount of non-specific binding, 1 μM neurotensin was added together with the test compound. The reaction solution is removed, and the well is washed 3 times with 1 ml of a washing buffer cooled to 4 ° C. Labeled neurotensin bound to cells was stripped with 0.5 ml of 0.2N NaOH, and then γ-
Measure radioactivity with a counter and measure Percent of Maximum B
The inding (PMB) is calculated by the following formula [Equation 1].

[Equation 1] PMB: Percent of Maximum Binding B: Value when a sample is added NSB: Non-specific Binding B ₀ : Maximum binding amount

In the above screening method and screening kit, a cell containing the human neurotensin receptor protein of the present invention, a partial peptide thereof and the human neurotensin receptor protein of the present invention or a cell membrane fraction thereof is used instead. In addition, known human neurotensin receptor protein DNA [Vi
ta, N. et al. FEBS Lett. 317, 1
39-142 (1993)] and the like, a recombinant human neurotensin receptor protein produced from DNA, a partial peptide thereof or a recombinant human. A cell containing a neurotensin receptor protein or a cell membrane fraction thereof can also be used.

By using the screening method or the screening kit of the present invention, a compound having the property of inhibiting the binding between the neurotensin and the human neurotensin receptor protein of the present invention, specifically, via the neurotensin receptor Thus, a compound having a cell stimulating activity or a salt thereof (so-called human neurotensin receptor agonist) or a compound having no cell stimulating activity or a salt thereof (so-called human neurotensin receptor antagonist) can be found. The human neurotensin receptor agonist has all or part of the physiological activity possessed by neurotensin, and is therefore useful as a safe and low-toxic pharmaceutical composition depending on the physiological activity. On the other hand, a human neurotensin receptor antagonist can suppress all or part of the physiological activity of neurotensin, and is therefore useful as a safe and low-toxic pharmaceutical composition for suppressing the physiological activity. Specifically, human neurotensin receptor agonist is useful as a prophylactic / therapeutic agent for Parkinson's disease, depression, dementia, hyperactive childhood syndrome or consciousness disorder, an anorexic inducer, and the like,
The human neurotensin receptor antagonist is useful as a prophylactic / therapeutic agent for anterograde esophagitis, enteritis, pancreatitis, ulcer, gastric cancer, intestinal cancer, psychosis, Huntington's disease or mania, anxiolytic, hypnotic sedative and the like.

When the agonist or antagonist obtained by using the screening method or the screening kit of the present invention is used as the above-mentioned pharmaceutical composition,
It can be carried out in a conventional manner. For example, orally as tablets, capsules, elixirs, microcapsules, etc., optionally sugar-coated, or aseptic solution with water or other pharmaceutically acceptable liquid, or suspension It can be used parenterally in the form of injections such as. For example, a physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative, or the like of the compound or a salt thereof,
It can be prepared by mixing with stabilizers, binders and the like in a unit dose form generally required for accepted pharmaceutical practice. The amount of active ingredient in these preparations is such that a suitable amount within the indicated range can be obtained. Additives that can be mixed with tablets, capsules, etc. include, for example, gelatin, corn starch, tragacanth, binders such as gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid, etc. Puffing agents, lubricating agents such as magnesium stearate, sweetening agents such as sucrose, lactose or saccharin, flavoring agents such as peppermint, red oil or cherry are used. When the unit dosage form is a capsule, a liquid carrier such as fat may be included in addition to materials of the above type. Sterile compositions for injection can be formulated according to conventional pharmaceutical practices such as dissolving or suspending the active substance in a vehicle such as water for injection, naturally occurring vegetable oils such as sesame oil, coconut oil, etc. .

Examples of the aqueous solution for injection include physiological saline, isotonic solution containing glucose and other adjuvants (for example, D-sorbitol, D-mannitol, sodium chloride, etc.) and the like. You may use together with adjuvants, such as alcohol (for example, ethanol), polyalcohol (for example, propylene glycol, polyethylene glycol), a nonionic surfactant (for example, polysorbate 80 (TM), HCO-50) and the like. Examples of the oily liquid include sesame oil and soybean oil, which may be used in combination with solubilizing agents such as benzyl benzoate and benzyl alcohol. In addition, buffers (eg, phosphate buffer, sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), preservation Agents (eg, benzyl alcohol,
(Eg, phenol), antioxidant, etc.
The adjusted injection solution is usually filled in a suitable ampoule. Since the preparation thus obtained is safe and has low toxicity, for example, warm-blooded mammals (for example, rat, rabbit,
It can be administered to sheep, pigs, cows, cats, dogs, monkeys, humans, etc., especially humans). The dose of the agonist or antagonist varies depending on the symptoms, but in the case of oral administration, it is generally about 0.1 to 100 mg per day for an adult (as 60 kg),
Preferably about 1.0 to 50 mg, more preferably about 1.
It is 0 to 20 mg. In the case of parenteral administration, the single dose varies depending on the administration subject, target organ, symptoms, administration method, etc., but in the case of an injection, for example, in an adult (60 kg), the daily dose is about 1 day. 0.01
~ 30 mg, preferably about 0.1-20 mg,
More preferably, about 0.1 to 10 mg is conveniently administered by intravenous injection. 60 for other animals
An amount converted per kg can be administered.

(2) Preventive / therapeutic agent for neurotensin receptor protein deficiency The DNA encoding the human neurotensin receptor protein of the present invention can be used as a preventive / therapeutic agent for neurotensin receptor protein deficiency. For example, in the case where there is a patient in whom the physiological action of neurotensin cannot be expected because the human neurotensin receptor protein of the present invention is reduced in vivo, (a)
The DNA encoding the human neurotensin receptor protein of the present invention is administered to the patient, and the human neurotensin receptor protein is expressed in vivo, or (b) human neurotensin of the present invention in brain cells or the like. The amount of human neurotensin receptor protein in the brain cells of the patient by inserting the DNA encoding the receptor protein, expressing the human neurotensin receptor protein, and then transplanting the brain cells into the patient. And the action of neurotensin can be fully exerted. Therefore, the DNA encoding the human neurotensin receptor protein of the present invention can be used as a safe and less toxic prophylactic / therapeutic agent for the neurotensin receptor protein deficiency (for example, Parkinson's disease).

When the DNA of the present invention is used as the above-mentioned prophylactic / therapeutic agent, the DNA is inserted into an appropriate vector such as a retrovirus vector, an adenovirus vector or an adenovirus associated virus vector, and then the conventional method is used. It can be carried out according to the means. For example, orally as tablets, capsules, elixirs, microcapsules, etc., optionally sugar-coated, or aseptic solution with water or other pharmaceutically acceptable liquid, or suspension It can be used parenterally in the form of injections such as. For example, the DNA of the present invention is admixed with physiologically acceptable carriers, flavoring agents, excipients, vehicles, preservatives, stabilizers, binders and the like in a unit dose form generally required for the implementation of the formulation. Can be manufactured by. The amount of active ingredient in these preparations is such that a suitable amount within the indicated range can be obtained.

Additives which can be mixed with tablets, capsules and the like include, for example, gelatin, corn starch, tragacanth, binders such as gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid and the like. Such as a leavening agent, a lubricant such as magnesium stearate, a sweetener such as sucrose, lactose or saccharin, and a flavoring agent such as peppermint, red oil or cherry. When the unit dosage form is a capsule, a liquid carrier such as fat may be included in addition to materials of the above type. Sterile compositions for injection can be formulated according to conventional pharmaceutical practices such as dissolving or suspending the active substance in a vehicle such as water for injection, naturally occurring vegetable oils such as sesame oil, coconut oil, etc. . Examples of the aqueous solution for injection include physiological saline, isotonic solution containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.), and a suitable solubilizing agent such as alcohol. (Eg ethanol), polyalcohol (eg propylene glycol, polyethylene glycol), nonionic surfactant (eg polysorbate 80 (TM), HCO-50) and the like may be used in combination. Examples of the oily liquid include sesame oil and soybean oil, which may be used in combination with solubilizing agents such as benzyl benzoate and benzyl alcohol.

Also, a buffering agent (eg, phosphate buffer,
Sodium acetate buffer), soothing agent (eg benzalkonium chloride, procaine hydrochloride etc.), stabilizer (eg human serum albumin, polyethylene glycol etc.), preservative (eg benzyl alcohol, phenol etc.), antioxidant You may mix with an agent etc. The adjusted injection solution is usually filled in a suitable ampoule. Since the preparation thus obtained is safe and has low toxicity, it can be administered to, for example, warm-blooded mammals (eg, rat, rabbit, sheep, pig, cow, cat, dog, monkey, human, especially human). can do. Although the dose of the DNA varies depending on the symptoms and the like, in the case of oral administration, it is generally about 0.
1 mg to 100 mg, preferably about 1.0 to 50 mg,
More preferably, it is about 1.0 to 20 mg. In the case of parenteral administration, the single dose varies depending on the administration subject, target organs, symptoms, administration method, etc., but in the case of an injection, for example, in an adult (60 kg), the daily dose is about 1 day. 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 1
It is convenient to administer about 0 mg intravenously. In the case of other animals, the dose converted per 60 kg can be administered.

(3) Method for quantifying neurotensin The human neurotensin receptor protein of the present invention or a salt thereof, or the partial peptide of the present invention or a salt thereof has a binding property to neurotensin, The concentration of neurotensin in the body can be quantified with high sensitivity. That is, the present invention provides a method for quantifying a neurotensin concentration in a subject, which comprises contacting the subject with the human neurotensin receptor protein of the present invention or a salt thereof or the partial peptide of the present invention or a salt thereof. I will provide a. The quantification method of the present invention can be used, for example, in combination with a competitive method. Specifically, for example, it can be used according to the method described below or the like or a method similar thereto. Hiroshi Irie "Radioimmunoassay" (Kodansha, Showa 4
(Published in 1997) edited by Hiroshi Irie "Radioimmunoassay" (Kodansha, published in 1979) Furthermore, the method for quantifying neurotensin of the present invention is a disease caused by an increase or decrease in neurotensin concentration (for example, Parkinson's disease, depression, dementia). , Hyperactive childhood syndrome, consciousness disorder,
Anorexia nervosa, retrograde esophagitis, enteritis, pancreatitis, ulcer, gastric cancer, intestinal cancer, psychosis, Huntington's disease, mania, anxiety, etc.).

(4) Production of human neurotensin receptor protein of the present invention or a salt thereof, an antibody against a partial peptide of human neurotensin receptor protein of the present invention or a salt thereof, or antiserum Human neurotensin receptor protein of the present invention Alternatively, an antibody (for example, a polyclonal antibody, a monoclonal antibody) or an antiserum to a salt thereof, a partial peptide of the human neurotensin receptor protein of the present invention or a salt thereof is used as the human neurotensin receptor protein of the present invention or a salt thereof or the present invention. The human
Using a partial peptide of the neurotensin receptor protein or a salt thereof as an antigen, it can be produced according to a method known per se for producing an antibody or antiserum. For example,
The monoclonal antibody can be produced according to the method described below. [Preparation of Monoclonal Antibody] (a) Preparation of Monoclonal Antibody-Producing Cell Human neurotensin receptor protein of the present invention or a salt thereof, or partial peptide of human neurotensin receptor protein of the present invention or a salt thereof (hereinafter referred to as human neuron (In some cases, abbreviated as tensin receptor), it is administered to warm-blooded animals at a site where antibody production can be performed by administration, or itself or with a carrier or diluent. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered to enhance the antibody-producing ability upon administration. Administration is usually once every 2 to 6 weeks for a total of 2
It is performed about 10 times. The warm-blooded animals used are:
Examples thereof include monkeys, rabbits, dogs, guinea pigs, mice, rats, sheep, goats, and chickens, and mice and rats are preferably used.

In the preparation of monoclonal antibody-producing cells, warm-blooded animals immunized with an antigen, for example, an individual with an antibody titer was selected from mice, and spleens or lymph nodes were collected 2 to 5 days after the final immunization. By fusing the antibody-producing cells contained therein with myeloma cells, a monoclonal antibody-producing hybridoma can be prepared. The antibody titer in the antiserum is measured, for example, by reacting the labeled human neurotensin receptor described below with the antiserum and then measuring the activity of the labeling agent bound to the antibody. The fusion operation is a known method, for example, the method of Koehler and Milstein [Nature, 256,
495 (1975)]. Examples of the fusion promoter include polyethylene glycol (PEG) and Sendai virus, but PEG is preferably used. Examples of myeloma cells include NS-1, P3U1, SP2
/ 0, AP-1 and the like, but P3U1 is preferably used. The preferred ratio of the number of antibody-producing cells (spleen cells) to the number of myeloma cells used is about 1: 1 to 20: 1, and PEG (preferably PEG1000 to PEG) is used.
6000) is added at a concentration of about 10-80%,
Cell fusion can be efficiently carried out by incubating at -40 ° C, preferably 30-37 ° C for 1-10 minutes.

Various methods can be used for screening the anti-human neurotensin receptor antibody-producing hybridoma. For example, the hybridoma culture is carried out on a solid phase (eg, a microplate) in which the human neurotensin receptor antigen is directly or adsorbed with a carrier. The supernatant is added, and then an anti-immunoglobulin antibody labeled with a radioactive substance or an enzyme (if the cells used for cell fusion is a mouse, an anti-mouse immunoglobulin antibody is used) or protein A is added to the solid phase. Method for detecting bound anti-human neurotensin receptor monoclonal antibody, human neurotensin receptor labeled with radioactive substance or enzyme by adding hybridoma culture supernatant to a solid phase on which anti-immunoglobulin antibody or protein A is adsorbed And bind to the solid phase. A method of detecting an anti-human neurotensin receptor monoclonal antibodies and the like. The anti-human neurotensin receptor monoclonal antibody can be selected according to a method known per se or a method analogous thereto. It is usually carried out in a medium for animal cells supplemented with HAT (hypoxanthine, aminopterin, thymidine). As a medium for selection and breeding, any medium can be used as long as it can grow a hybridoma. For example, RPMI 1640 medium containing 1 to 20%, preferably 10 to 20% fetal bovine serum, GIT medium containing 1 to 10% fetal bovine serum (Wako Pure Chemical Industries, Ltd.) or serum-free for hybridoma culture. A culture medium (SFM-101, Nissui Pharmaceutical Co., Ltd.) or the like can be used. The culture temperature is usually 20 to 40 ° C, preferably about 37 ° C. Cultivation time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks. Culturing is usually performed under 5% carbon dioxide gas. The antibody titer of the hybridoma culture supernatant can be measured in the same manner as the above-mentioned measurement of the anti-human neurotensin receptor antibody titer in the antiserum.

(B) Purification of monoclonal antibody The isolation and purification of the anti-human neurotensin receptor monoclonal antibody is carried out in the same manner as the usual isolation and purification of a polyclonal antibody [eg, salting out, alcohol precipitation, Isoelectric focusing method, electrophoresis method, adsorption / desorption method using ion exchanger (eg, DEAE), ultracentrifugation method, gel filtration method, antigen-binding solid phase or active antibody such as protein A or protein G Specific purification method of collecting and dissociating the bond to obtain an antibody]. Since the human neurotensin receptor antibody of the present invention produced according to the above methods (1) and (2) can specifically recognize the human neurotensin receptor, human neurotensin in a test solution is It can be used for quantification of a receptor, particularly by a sandwich immunoassay. That is, the present invention provides, for example, (i) an antibody that reacts with the human neurotensin receptor of the present invention, a test solution and a labeled human neurotensin receptor in a competitive reaction,
A method for quantifying human neurotensin receptor in a test solution, which comprises measuring the proportion of labeled human neurotensin receptor bound to the antibody, (2) an antibody insolubilized on the test solution and a carrier, and In the method for quantifying human neurotensin receptor in a test solution, the activity of the labeling agent on the insolubilized carrier is measured after simultaneous or continuous reaction with a labeled antibody, Human neurotensin in a test solution, wherein the antibody is an antibody that recognizes the N-terminal portion of the human neurotensin receptor and the other antibody is an antibody that reacts with the C-terminal portion of the human neurotensin receptor A method for quantifying a receptor is provided.

The human neurotensin receptor can be assayed using the monoclonal antibody of the present invention that recognizes the human neurotensin receptor (hereinafter sometimes referred to as anti-human neurotensin receptor antibody), and tissue staining, etc. Can also be detected.
For these purposes, the antibody molecule itself may be used,
In addition, F (ab ′) ₂ , Fab ′, or Fa of the antibody molecule
Fraction b may be used. The measurement method using the antibody of the present invention is not particularly limited, and the amount of antigen in the liquid to be measured (eg, human neurotensin receptor amount)
If the measurement method is to detect the amount of the antibody, antigen or antibody-antigen complex corresponding to the above by chemical or physical means and calculate this from a standard curve prepared using a standard solution containing a known amount of antigen, Any of the measurement methods may be used. For example, nephrometry, competitive method, immunometric method and sandwich method are preferably used, but from the viewpoint of sensitivity and specificity, the sandwich method described later is particularly preferably used. Examples of the labeling agent used in the measurement method using a labeling substance include radioisotopes, enzymes, fluorescent substances, luminescent substances and the like. Examples of radioactive isotopes include [
¹²⁵ I], [ ¹³¹ I], [ ³ H], [ ¹⁴ C] and the like are preferable as the above-mentioned enzyme, which is stable and has a large specific activity.
For example, β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like, as the fluorescent substance, fluorescamine, fluorescein isothiocyanate and the like, and as the luminescent substance, luminol, luminol derivative, luciferin. , Lucigenin and the like. further,
The biotin-avidin system can also be used for binding the antibody or antigen to the labeling agent.

For the insolubilization of an antigen or an antibody, physical adsorption may be used, or a method using a chemical bond which is usually used for insolubilizing or immobilizing proteins or enzymes. Examples of the carrier include insoluble polysaccharides such as agarose, dextran and cellulose, synthetic resins such as polystyrene, polyacrylamide and silicon, and glass. In the sandwich method, the insolubilized anti-human neurotensin receptor antibody is reacted with the test solution (first reaction), and further the labeled anti-human neurotensin receptor antibody is reacted (second reaction), and then on the insolubilized carrier. The amount of human neurotensin receptor in the test solution can be quantified by measuring the activity of the labeling agent. The primary reaction and the secondary reaction may be carried out in the reverse order, may be carried out simultaneously, or may be carried out at different times. The labeling agent and the method of insolubilization can be the same as those described above. Further, in the immunoassay method by the sandwich method, the antibody used for the solid phase antibody or the labeling antibody does not necessarily have to be one type, and a mixture of two or more types of antibodies may be used for the purpose of improving the measurement sensitivity. May be. In the method for measuring human neurotensin receptor by the sandwich method of the present invention, the anti-human neurotensin receptor antibodies used in the primary reaction and the secondary reaction are preferably antibodies having different binding sites for human neurotensin receptors. Used. That is, the antibody used in the primary reaction and the secondary reaction is preferably, for example, when the antibody used in the secondary reaction recognizes the C-terminal portion of the human neurotensin receptor, the antibody used in the primary reaction is preferably An antibody that recognizes an N-terminal other than the C-terminal is used.

The human neurotensin receptor antibody of the present invention may be assayed by a measuring system other than the sandwich method, for example,
It can be used for competitive methods, immunometric methods, nephrometry, and the like. In the competitive method, after the antigen in the test liquid and the labeled antigen are reacted competitively with the antibody,
The unreacted labeled antigen, (F) and the labeled antigen (B) bound to the antibody are separated (B / F separation), the labeled amount of either B or F is measured, and the amount of antigen in the test solution is determined. Quantify. In this reaction method, a soluble antibody is used as an antibody, B / F separation is performed by a liquid phase method using polyethylene glycol, a second antibody against the antibody, or the like, and a solid-phased antibody is used as the first antibody, or The first antibody should be soluble and the second
A solid phase immobilization method using a solid phase immobilization antibody as an antibody is used. In the immunometric method, the antigen in the test liquid and the solid-phased antigen are competitively reacted with a fixed amount of the labeled antibody and then the solid phase and the liquid phase are separated, or the antigen in the test liquid is separated. After reacting with an excess amount of the labeled antibody and then adding the immobilized antigen to bind the unreacted labeled antibody to the solid phase, the solid phase and the liquid phase are separated. Next, the labeled amount of either phase is measured to quantify the amount of antigen in the test liquid. In nephrometry, the amount of insoluble precipitate produced as a result of the antigen-antibody reaction in the gel or in the solution is measured. Even when the amount of antigen in the test liquid is small and only a small amount of precipitate is obtained, laser nephrometry utilizing laser scattering is preferably used.

In applying these individual immunological assay methods to the assay method of the present invention, it is not necessary to set special conditions, operations and the like. The measurement system for the human neurotensin receptor may be constructed by adding ordinary technical consideration to those skilled in the art to ordinary conditions and operating methods in each method. For details of these general technical means, reference can be made to reviews, books, etc. [eg Irie
Hiroshi "Radioimmunoassay" (Kodansha, published in 1974), Hiroshi Irie "Radioimmunoassay" (Kodansha, published in 1979), Eiji Ishikawa et al., "Enzyme Immunoassay" (Medical Shoin, published in 1978) ), Eiji Ishikawa et al. “Enzyme Immunoassay” (second edition) (Medical Shoin, 1982 issue), Eiji Ishikawa et al. “Enzyme Immunoassay” (3rd edition) (Medicine Shoin, 1987 issue) ), "Methods in ENZYMOLOGY"
Vol. 70 (Immunochemical Techniques (Part A)), ibid
Vol. 73 (Immunochemical Techniques (Part B)), ibid.
Vol. 74 (Immunochemical Techniques (Part C)), ibid.
Vol. 84 (Immunochemical Techniques (Part D: Selected
Immunoassays)), Vol. 92 (Immunochemical Tech)
niques (Part E: Monoclonal Antibodies and General Im
munoassay Methods)), ibid Vol. 121 (Immunochemical
Techniques (Part I: Hybridoma Technology and Monoclo
nal Antibodies)) (above, issued by Academic Press) etc.). As described above, by using the human neurotensin receptor antibody of the present invention, the human neurotensin receptor can be quantified with high sensitivity.

In the present specification and drawings, when an abbreviation is used for a base or amino acid, IUPAC-IUB is used.
It is based on the abbreviations by the Commission on Biochemical Nomenclature or the abbreviations commonly used in this field, and examples are given below. When amino acids may have optical isomers, the L form is shown unless otherwise specified. DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine RNA: ribonucleic acid mRNA: messenger ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: deoxyguanosine Phosphoric acid dCTP: Deoxycytidine triphosphate

ATP: adenosine triphosphate EDTA: ethylenediaminetetraacetic acid SDS: sodium dodecyl sulfate EIA: enzyme immunoassay Gly: glycine Ala: alanine Val: valine Leu: leucine Ile: isoleucine Ser: serine thynin: threon: threon: threon: threon: threon: threon: threon: threon: threon Glu: Glutamic acid Asp: Aspartic acid

Lys: lysine Arg: arginine His: histidine Phe: phenylalanine Tyr: tyrosine Trp: tryptophan Pro: proline Asn: asparagine Gln: glutamine pGlu: pyroglutamic acid Me: phenyl group: P: ethyl group: phenyl group Et: phenyl group Et: TC: thiazolidine-4 (R) -carboxamide group

The sequence numbers in the sequence listing in this specification show the following sequences. [SEQ ID NO: 1] This shows the amino acid sequence of the human neurotensin receptor protein of the present invention. [SEQ ID NO: 2] This shows the base sequence of DNA encoding the human neurotensin receptor protein of the present invention. [SEQ ID NO: 3] Synthetic DNA used for screening cDNA encoding human neurotensin receptor protein of the present invention [SEQ ID NO: 4] Used for screening cDNA encoding human neurotensin receptor protein of the present invention Synthetic DNA

Plasmid pT obtained in Example 2 described below
The transformant Escherichia coli carrying S861 (Es
cherichia coli) DH10B / pTS861 is
Deposit number FERM BP- from the Ministry of International Trade and Industry, National Institute of Advanced Industrial Science and Technology (NIBH)
Deposited as 4898. In addition, Example 3 described later
The transformant CHO / pTS861-1-2E6 carrying the plasmid pTS861 obtained in (1) was deposited with the deposit number FERM BP- at the Institute of Biotechnology, National Institute of Advanced Industrial Science and Technology (NIBH) from November 24, 1994. 4899
Has been deposited as.

[0070]

EXAMPLES The present invention will be described in more detail below with reference to examples, but the present invention is not limited thereto. The gene manipulation method using E. coli is described in
niatis et al., Molecular cloning [Molecular Cl
oning], Cold Spring Harbor Laboratory, 1989).

[0071]

Example 1 Cloning of human neurotensin receptor protein cDNA Human colon adenocarcinoma H
T-29 cells were cultured in a high glucose DMEM medium containing 10% fetal bovine serum at 37 ° C and 95% air / 5% CO _2.
After culturing under the conditions and becoming almost confluent, the total RN was analyzed by the guanidine-isothiocyanate method.
A was prepared. From the total RNA obtained here, oligo (d
T) Poly A ⁺ RNA fraction was prepared by cellulose column. 10 μg of this poly A ⁺ RNA was used to synthesize first strand DNA using random hexamer and reverse transcriptase, and then E. coli DNA polymerase I, RNase
Second strand DNA was synthesized using H and poly A ⁺ R
Double-stranded cDNA was obtained from NA. This double-stranded DNA is
4 After treatment with DNA polymerase to blunt the ends,
An EcoRI adapter was added. Eco at both ends
The double-stranded DNA to which the RI adapter was added was removed by gel filtration to remove cDNA of about 400 bp or less, and then T
A phosphate group was introduced into the EcoRI adapter using 4 polynucleotide kinase. Next, this cDNA is λg
After assembling into t11 EcoRI arm, in vitro packaging was performed, and the total H of about 3 × 10 ⁶ pfu was obtained.
A cDNA library of T-29 cells was prepared. The λ phage of this cDNA library was transformed into E. coli Y1090.
After infection with the strain, approximately 1 × 10 ⁴ plaques were plated on soft agar plates and incubated at 42 ° C. overnight to form plaques. After transferring the plaques onto a nitrocellulose filter, denaturing solution [0.5N sodium hydroxide, 1.5M sodium chloride], neutralizing solution [0.5M Tris-hydrochloric acid (pH 7.0), 1.5M sodium chloride] ],
3 × SSC [20 × SSC = 3M sodium chloride, 0.
3M sodium citrate] and dried in air for 80
The phage DNA was fixed on a nitrocellulose filter by baking at 3 ° C for 3 hours.

On the other hand, a known human neurotensin receptor protein cDNA [Vi [Vi
ta, N. et al. FEBS Lett. 317,
139-142 (1993)] based on the nucleotide sequence of synthetic oligonucleotides and. Is 5'-CGGACA
GAGCCGCGGGGACTCCAGCGCCCACC
ATGCGCCTCA-3 ′ (SEQ ID NO: 3),
-30 to +10 (translation initiation site is +1) A synthetic oligonucleotide containing a sense sequence. Is 5'-
TCCTCCTGGACACGTTCCGGGGCGC
ACAGC-3 '(SEQ ID NO: 4) and + 1258-
Synthetic oligonucleotide containing +1287 antisense sequence. These and the synthetic oligonucleotides of these were prepared using [γ- ³² P] ATP and T4 polynucleotide kin.
Labeled by using ase. The filter on which the phage DNA was immobilized was used as a hybridization buffer containing both synthetic oligonucleotide-labeled probes [2 x SSC, 10 x Denhardt's solution, 150 µg / m
l Heat-denatured salmon sperm DNA, 670 μg / ml yeast RN
Hybridization was carried out in A] at 58 ° C. The filter was finally 5x in 2xSSC, 0.1% SDS solution.
After washing at 5 ° C., an autoradiogram was taken to search for plaques that hybridize with the probe.

Phage DNA was extracted from the phage clone λhNTR84 obtained by this method and then digested with a restriction enzyme EcoRI to cut out a cDNA fragment.
Ph at the EcoRI site of the UC118 plasmid
NTR84-14 was obtained. The nucleotide sequence of the inserted cDNA fragment was determined by an ordinary method using [α- ³² P] dCTP, and it was found that this cDNA fragment consisted of 2141 bp having the nucleotide sequence represented by SEQ ID NO: 2. . Reported nucleotide sequence of human neurotensin receptor protein cDNA [Vita, N. et al.
FEBS Lett. 317, 139-142 (199
3)], three base substitutions were found. The first position is the base T → A at the 360th position in [Fig. 2], the second position is the A → G position at 920th in [Fig. 2], and the third position is [Fig. 2].
Was the 1329th base A → G. Of these, 2
The base substitutions at position 3 and 3 are in the translation region, and
Substitution at position 6 is silent mutation ⁶³ Lys (AAA) →
^{It was 63} Lys (AAG), but the third mutation was accompanied by amino acid substitution ²⁰⁰ Thr (ACG) → ²⁰⁰ Ala
(GCG) [SEQ ID NO: 1 and FIG. 1]. As described above, the plasmid phNTR84-14 containing the human neurotensin receptor protein cDNA fragment
I got

[0074]

Example 2 Construction of Expression Plasmid for Human Neurotensin Receptor Protein cDNA cDNA The plasmid phNTR84-14 containing the human neurotensin receptor protein cDNA fragment obtained in Example 1
From the above, a human neurotensin receptor protein cDNA expression plasmid was prepared as shown in FIG. First, phNTR84-14 was digested with a restriction enzyme SacII, and the obtained DNA fragment of about 440 bp was digested with T4 DNA.
After blunting with polymerase, EcoR
I linker was added. Next, this DNA fragment is Eco
After digestion with RI, EcoR of pUC119 plasmid
It was introduced into the I site, and the N-terminal portion of the translation region of human neurotensin receptor protein cDNA was subcloned. Next, a DNA methylase-deficient strain of Escherichia coli SCS
The plasmid phNTR84-14 containing the human neurotensin receptor protein cDNA fragment obtained from 110 (dam ⁻ , dcm ⁻ ) was digested with the restriction enzyme StuI, XbaI linker was added, and then XbaI and M were added.
Double digestion of luI was carried out to obtain an about 1.4 kbp DNA fragment containing the C-terminal portion of the translation region of human neurotensin receptor protein cDNA.

Approximately 1.4 k containing the C-terminal portion of the translation region of this human neurotensin receptor protein cDNA
bp XbaI, MluI fragment was subcloned into the N-terminal portion of the translation region of the human neurotensin receptor protein cDNA obtained above to obtain a plasmid Xba
A plasmid pTS858 was obtained by subcloning almost the translation region of the human neurotensin receptor protein cDNA by introducing into the I and MluI sites. further,
In order to introduce a SalI site into the N-terminal portion of the translation region, pTS858 was EcoRI, HindIII double digested DNA fragment was pGEM9Zf (-) EcoRI,
A plasmid pTS859 introduced into the HindIII site was obtained.

As an expression vector, pAKKO 1.11
(Indicated as pA1-11 in FIG. 3) was used.
pAKKO 1.11 was constructed as follows. From pTB1417 described in JP-A-5-076385 to Hi
1.4 kb D containing SRα promoter and polyA addition signal by ndIII and ClaI treatment
An NA fragment was obtained. In addition, pTB348 (Naruo, K. et a
l. Biochemical and Biophysical Research Communications (Biochem. Biophys. Res.
Commun.) 128, 256-264 (1985)) to ClaI and S
By treatment with alI, a 4.5 kb DNA fragment containing the dihydrofolate reductase (dhfr) gene was obtained. These D
The NA fragment was treated with T4 polymerase to make the ends blunt, and then ligated with T4 ligase to prepare pAKKO.
The 1.11 plasmid was constructed. Plasmid pTS85
Human of about 1.4 kbp obtained by digesting 9 with SalI
A SalI DNA fragment containing the translation region of the neurotensin receptor protein cDNA was added to pAKKO 1.11 S.
Human neurotensin receptor protein cDNA expression plasmid pTS861 introduced in the forward direction into the aI1 site
I got Escherichia coli was transformed with this expression plasmid pTS861 and transformed into Escherichia coli (Escherichia coli).
ia coli) DH10B / pTS861 was obtained.

[0077]

Example 3 Expression of Human Neurotensin Receptor Protein cDNA in CHO (dhfr ⁻ ) Cells CHO (dhfr ⁻ ) cells 5 × 10 ⁴ to 1 × 10 ⁶ cells having a diameter of 10 cm were gradually changed. Four pieces were spread on a petri dish and cultured in Ham's F12 medium containing 10% fetal bovine serum for 24 hours. Into these cells, the human neurotensin receptor protein cDNA expression plasmid p obtained in Example 1 was added.
1.5 μg of TS861 was transfected using the calcium phosphate method. DMEM containing 10% dialyzed fetal bovine serum 24 hours after transfection
The medium was exchanged with a medium and cells in which the plasmid was integrated into the chromosome were selected. A cell line CHO / pTS861 that stably expresses a human neurotensin receptor protein after cloning selected colonies of cells and then cloning from a single cell by limiting dilution method.
Two clones of -1-2E6 and CHO / pTS861-24-2C5 were obtained.

[0078]

[Example 4] Measurement of human neurotensin receptor protein activity One cell expressing human neurotensin receptor protein was used.
Spread on a 2-well plate, D containing 10% dialyzed fetal bovine serum
The cells were cultured in MEM medium at 37 ° C. under 95% air / 5% CO ₂ conditions until confluent, and the medium was exchanged the day before the binding experiment. The binding experiment for [ ¹²⁵ I] neurotensin was performed as follows. First, the binding assay buffer (0.1%
BSA, 1 mM orthophenanthroline, 20 mM H
DMEM medium containing EPES adjusted to pH 7.4 with sodium hydroxide) washed once with 1 ml,
Add 1 ml of binding assay buffer cooled to 4 ° C and add 1 ml at 4 ° C.
It was kept warm for 0 minutes. After sucking out this binding measurement buffer,
0.5 ml of a binding assay buffer containing 500 pM [ ¹²⁵ I] neurotensin cooled to 4 ° C. was added, and the binding reaction was carried out at 4 ° C. for 3 hours. After the reaction was completed, the binding measurement buffer was removed and the plate was washed 3 times with 1 ml of PBS buffer cooled to 4 ° C. The amount of [ ¹²⁵ I] neurotensin bound to the cells was determined by γ after the cells were detached with 0.2N sodium hydroxide.
-Measured with a counter and used as the total binding amount. Also,
At the time of the binding reaction, 1 μM of unlabeled neurotensin was added and the same operation was performed, and the amount of [ ¹²⁵ I] neurotensin bound to the cells was defined as the nonspecific binding amount. The results are shown in [Table 1].

[0079]

[Table 1] From [Table 1], the cell line CHO / pTS8 that stably and highly expresses the human neurotensin receptor protein of the present invention.
61-1-2E6 and CHO / pTS861-24-2C
It was confirmed that 5 can specifically bind to the ligand neurotensin.

[0080]

The human neurotensin receptor protein of the present invention is a novel protein having an amino acid sequence different from the amino acid sequence of the known human neurotensin receptor protein. In addition, the cells carrying the expression vector containing the human neurotensin receptor protein of the present invention (particularly, CHO cells) are much larger than the known COS-7 cells containing the human neurotensin receptor protein. Can express the human neurotensin receptor protein. The human neurotensin receptor protein of the present invention, a partial peptide thereof, or a cell containing the human neurotensin receptor protein or a cell membrane fraction thereof can be efficiently screened for a human neurotensin receptor agonist or antagonist. According to the screening method of the present invention, an agonist or an antagonist can be advantageously selected, and therefore, for example, a prophylactic / therapeutic agent for Parkinson's disease, depression, dementia, hyperactive childhood syndrome or consciousness disorder, an anorexic inducer , Anxiolytics, hypnotics, or retrograde esophagitis, enteritis, pancreatitis, ulcers,
It is possible to early develop a drug such as a prophylactic / therapeutic agent for gastric cancer, intestinal cancer, psychosis, Huntington's disease or mania.

[0081]

[Sequence list]

[SEQ ID NO: 1] Sequence length: 418 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Met Arg Leu Asn Ser Ser Ala Pro Gly Thr Pro Gly Thr Pro Ala Ala 1 5 10 15 Asp Pro Phe Gln Arg Ala Gln Ala Gly Leu Glu Glu Ala Leu Leu Ala 20 25 30 Pro Gly Phe Gly Asn Ala Ser Gly Asn Ala Ser Glu Arg Val Leu Ala 35 40 45 Ala Pro Ser Ser Glu Leu Asp Val Asn Thr Asp Ile Tyr Ser Lys Val 50 55 60 Leu Val Thr Ala Val Tyr Leu Ala Leu Phe Val Val Gly Thr Val Gly 65 70 75 80 Asn Thr Val Thr Ala Phe Thr Leu Ala Arg Lys Lys Ser Leu Gln Ser 85 90 95 Leu Gln Ser Thr Val His Tyr His Leu Gly Ser Leu Ala Leu Ser Asp 100 105 110 Leu Leu Thr Leu Leu Leu Ala Met Pro Val Glu Leu Tyr Asn Phe Ile 115 120 125 Trp Val His His Pro Trp Ala Phe Gly Asp Ala Gly Cys Arg Gly Tyr 130 135 140 Tyr Phe Leu Arg Asp Ala Cys Thr Tyr Ala Thr Ala Leu Asn Val Ala 145 150 155 160 Ser Leu Ser Val Glu Arg Tyr Leu Ala Ile Cys His Pro Phe Lys Ala 165 170 175 Lys Thr Leu Met Ser Arg Se r Arg Thr Lys Lys Phe Ile Ser Ala Ile 180 185 190 Trp Leu Ala Ser Ala Leu Leu Ala Val Pro Met Leu Phe Thr Met Gly 195 200 205 Glu Gln Asn Arg Ser Ala Asp Gly Gln His Ala Gly Gly Leu Val Cys 210 215 220 Thr Pro Thr Ile His Thr Ala Thr Val Lys Val Val Ile Gln Val Asn 225 230 235 240 Thr Phe Met Ser Phe Ile Phe Pro Met Val Val Ile Ser Val Leu Asn 245 250 255 Thr Ile Ile Ala Asn Lys Leu Thr Val Met Val Arg Gln Ala Ala Glu 260 265 270 Gln Gly Gln Val Cys Thr Val Gly Gly Glu His Ser Thr Phe Ser Met 275 280 285 Ala Ile Glu Pro Gly Arg Val Gln Ala Leu Arg His Gly Val Arg Val 290 295 300 Leu Arg Ala Val Val Ile Ala Phe Val Val Cys Trp Leu Pro Tyr His 305 310 315 320 Val Arg Arg Leu Met Phe Cys Tyr Ile Ser Asp Glu Gln Trp Thr Pro 325 330 335 Phe Leu Tyr Asp Phe Tyr His Tyr Phe Tyr Met Val Thr Asn Ala Leu 340 345 350 Phe Tyr Val Ser Ser Thr Ile Asn Pro Ile Leu Tyr Asn Leu Val Ser 355 360 365 Ala Asn Phe Arg His Ile Phe Leu Ala Thr Leu Ala Cys Leu Cys Pro 370 375 380 Val Trp Arg Arg Arg Arg Lys Ar g Pro Ala Phe Ser Arg Lys Ala Asp 385 390 395 400 Ser Val Ser Ser Asn His Thr Leu Ser Ser Asn Ala Thr Arg Glu Thr 405 410 415 Leu Tyr

[0082]

[SEQ ID NO: 2] Sequence length: 1254 Sequence type: Nucleic acid Number of strands: Double stranded Topology: Linear Sequence type: cDNA Characterization method: S sequence ATGCGCCTCA ACAGCTCCGC GCCGGGAACC CCGGGCACGC CGGCCGCCGA CCCCTTCCAG 60 CGGGCGCAGG CCGGACTGGA GGAGGCGCTG CTGGCCCCGG GCTTCGGCAA CGCTTCGGGC 120 AACGCGTCGG AGCGCGTCCT GGCGGCACCC AGCAGCGAGC TGGACGTGAA CACCGACATC 180 TACTCCAAGG TGCTGGTGAC CGCCGTGTAC CTGGCGCTCT TCGTGGTGGG CACGGTGGGC 240 AACACGGTGA CGGCGTTCAC GCTGGCGCGG AAGAAGTCGC TGCAGAGCCT GCAGAGCACG 300 GTGCATTACC ACCTGGGCAG CCTGGCGCTG TCCGACCTGC TCACCCTGCT GCTGGCCATG 360 CCCGTGGAGC TGTACAACTT CATCTGGGTG CACCACCCCT GGGCCTTCGG CGACGCCGGC 420 TGCCGCGGCT ACTACTTCCT GCGCGACGCC TGCACCTACG CCACGGCCCT CAACGTGGCC 480 AGCCTGAGTG TGGAGCGCTA CCTGGCCATC TGCCACCCCT TCAAGGCCAA GACCCTCATG 540 TCCCGAAGCC GCACCAAGAA GTTCATCAGC GCCATCTGGC TCGCCTCGGC CCTGCTGGCG 600 GTGCCTATGC TGTTCACCAT GGGCGAGCAG AACCGCAGCG CCGACGGCCA GCACGCCGGC 660 GGCCTGGTCATCCCCCCCCGCGCGC660 T GCCACCGTCA AGGTCGTCAT ACAGGTCAAC 720 ACCTTCATGT CCTTCATATT CCCCATGGTG GTCATCTCGG TCCTGAACAC CATCATCGCC 780 AACAAGCTGA CCGTCATGGT ACGCCAGGCG GCCGAGCAGG GCCAAGTGTG CACGGTCGGG 840 GGCGAGCACA GCACATTCAG CATGGCCATC GAGCCTGGCA GGGTCCAGGC CCTGCGGCAC 900 GGCGTGCGCG TCCTACGTGC AGTGGTCATC GCCTTTGTGG TCTGCTGGCT GCCCTACCAC 960 GTGCGGCGCC TCATGTTCTG CTACATCTCG GATGAGCAGT GGACTCCGTT CCTCTATGAC 1020 TTCTACCACT ACTTCTACAT GGTGACCAAC GCACTCTTCT ACGTCAGCTC CACCATCAAC 1080 CCCATCCTGT ACAACCTCGT CTCTGCCAAC TTCCGCCACA TCTTCCTGGC CACACTGGCC 1140 TGCCTCTGCC CGGTGTGGCG GCGCAGGAGG AAGAGGCCAG CCTTCTCGAG GAAGGCCGAC 1200 AGCGTGTCCA GCAACCACAC CCTCTCCAGC AATGCCACCC GCGAGACGCT GTAC 1254

[0083]

[SEQ ID NO: 3] Sequence length: 41 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA Sequence CGGACAGAGC CGCGGGACTC CAGCGCCCAC CATGCGCCTC A 41

[0084]

[SEQ ID NO: 4] Sequence length: 31 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA Sequence TCCTCCTGGA CACGTTCCG GGGCGCACAG C 31

[0085]

[Brief description of drawings]

FIG. 1 shows the amino acid sequence of the human neurotensin receptor protein of the present invention.

[0086]

FIG. 2 shows the nucleotide sequence of DNA encoding the human neurotensin receptor protein of the present invention. 7th in the figure
The nucleotide sequence from the 32nd position to the 1988th position is a portion encoding the human neurotensin receptor protein.

[0087]

FIG. 3: Human neurotensin receptor protein cd
The construction drawing of the expression plasmid pTS861 carrying NA is shown. The hatched portion of the expression plasmid pTS861 is human.
Shows the neurotensin receptor protein cDNA, D
HFR indicates the dhfr gene, and Amp ^r indicates the ampicillin resistance gene.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical indication location A61K 45/00 AAK AAM AAN ACJ ADU AED C07K 16/28 C12N 1/19 8828-4B 1/21 8828 -4B 5/10 15/09 C12P 21/02 C 9282-4B G01N 33/53 S 33/566 // A61K 39/395 D 9281-4B C12N 15/00 A

Claims (15)

[Claims] 1. A human neurotensin receptor protein or a salt thereof, which comprises the amino acid sequence represented by SEQ ID NO: 1. 2. A partial peptide of the human neurotensin receptor protein according to claim 1, or a salt thereof. 3. A DNA containing the DNA encoding the human neurotensin receptor protein according to claim 1. 4. The DNA according to claim 3, which has the nucleotide sequence represented by SEQ ID NO: 2. 5. A vector containing the DNA according to claim 3. 6. A transformant carrying the vector according to claim 5. 7. The transformant according to claim 6 is cultivated under conditions capable of expressing a DNA encoding a human neurotensin receptor protein.
A method for producing the described human neurotensin receptor protein. 8. A cell containing the human neurotensin receptor protein according to claim 1 or a cell membrane fraction thereof. 9. The human neurotensin receptor protein according to claim 1 or a salt thereof, the partial peptide according to claim 2 or a salt thereof, or the cell according to claim 8 or a cell membrane fraction thereof. A method for screening a human neurotensin receptor agonist or antagonist. 10. A human neurotensin receptor protein or a salt thereof according to claim 1, a partial peptide or a salt thereof according to claim 2, or a cell or a cell membrane fraction thereof according to claim 8. A kit for screening a human neurotensin receptor agonist or antagonist. 11. A human neurotensin receptor agonist obtained by using the screening method according to claim 9 or the screening kit according to claim 10. 12. A human neurotensin receptor antagonist obtained by using the screening method according to claim 9 or the screening kit according to claim 10. 13. A preventive / therapeutic agent or an anorexic inducer for Parkinson's disease, depression, dementia, hyperactive childhood syndrome or consciousness disorder, which comprises the human neurotensin receptor agonist according to claim 11. . 14. Prevention of retrograde esophagitis, enteritis, pancreatitis, ulcer, gastric cancer, intestinal cancer, psychosis, Huntington's disease or mania, which comprises the human neurotensin receptor antagonist according to claim 12. A therapeutic, anxiolytic or hypnotic sedative. 15. An antibody against the human neurotensin receptor protein according to claim 1 or a salt thereof or the partial peptide according to claim 2 or a salt thereof.