JPH08131175A - Dna coding mouse neuropeptide y-y1 receptor subtype and its fragment - Google Patents

Abstract

PURPOSE: To obtain the subject new DNA having a specific amino acid sequence or such a sequence that a part thereof is added to, deleted from or substituted for the amino acid sequence, capable of giving cells for searching medicines through transformation. CONSTITUTION: This new DNA (fragment thereof), having an amino acid sequence containing an amino acid sequence of the formula or such a sequence that a part thereof is added to, deleted from or substituted for this sequence, codes a receptor subtype capable of receiving mouse neuropeptide Y.Y1, thus is useful as a probe or primer for identifying adult mouse myelocytes or the cells in the initial stage of developing the fetus, and also useful for making transformed cells such as agonists or antagonists applicable to screening medicines. This DNA is obtained by the following process: mRNAs are extracted from mouse myelocytes and a cDNA library made by using them is subjected to a probe, and the aimed DNA is recovered from a strain containing the genes sorted for the peptide receptor.

Description

Detailed Description of the Invention

[0001]

The present invention relates to mouse neuropeptide Y.
It relates to the gene encoding the Y1 receptor subtype.

[0002]

BACKGROUND OF THE INVENTION Neuropeptide Y (neuropeptide Y,
Hereinafter, abbreviated as NPY) is a physiologically active peptide consisting of 36 amino acids, which was isolated and identified from porcine brain in 1982 (Nature 296, page 659 (198).
2)), and it is currently believed that it is most localized in the brain (Trend in Pharmacologic Science 12: 389 (1991)). It is also known that NPY is widely distributed not only in the central nervous system but also in the peripheral nervous system and has, for example, a strong vasoconstrictor action and blood pressure lowering action. It is considered that both actions are caused by the presence of a receptor that specifically recognizes NPY in cells or tissues, and the binding of NPY thereto. Pharmacological studies have suggested that at least three subtypes of Y1, Y2 and Y3 exist in the NPY receptor. Recently, only one of them, Y1 type, is a human brain cDNA library (Proceeding of the National Academy of Science, Vol. 89, page 5794 (1).
992) and Journal of Biological Chemistry 267, 10, 935 (199).
2)) and rat brain cDNA library (FEBS
Letter 271, page 81 (1990)), and its structure was revealed to be 7-transmembrane type and GTP-binding protein-coupled type.

Up to now, dozens of seven-transmembrane GTP-binding protein-coupled type receptors have been cloned. Recently, C-proteins have been cloned into this receptor family by modification of mRNA maturation process called alternative splicing. It was discovered that there are subtypes in which a part of the terminal side recombines. For example, prostaglandin E2 receptor (Nature 365: 166 (19
93)) and somatostatin receptor (FEBS Letter 3
Vol. 31, page 260 (1993)) clarifies the existence of such subtypes. However, the existence of such a subtype has not been reported for the NPY • Y1 receptor. Note that there is no analysis information at the gene level regarding the Y2 and Y3 type receptors.

Kogner et al. Reported that among pediatric patients with acute lymphoblastic leukemia, a common high level of NPY was detected in the blood of patients with abnormal B cell maturation (Brad. Volume 80 Pages 1324 (199
2)). It is currently unknown whether high levels of NPY are responsible for this type of leukemia, but if there is any involvement, the structure of the NPY receptor expressed in hematopoietic cell lines should be clarified. Doing may be a clue for treating leukemia. Also, NPY in blood
Regarding the production of NPY by mouse megakaryocytes (Proceeding of the National Academy of
Science 84, 5585 (1987), and stimulation-induced production of NPY by human mononuclear cells (Journal
Off Neuroimology 51, 53, (199
4)) and the like, and it can be expected that the NPY receptor exists not only in the brain, which has been vigorously studied, but also in the hematopoietic system.

The NPY receptor is a human leukemia cultured cell (HE
There is also a report that it is highly expressed on the L cell) membrane (British Journal of Pharmacology 1
05, p. 71 (1992)), which has been proved to be a Y1 type receptor by pharmacological analysis. However, it is unclear whether it is the same type as cloned from the brain or an unidentified subtype produced by, for example, the alternative splicing described above.

As described above, it can be expected that NPY plays an important role not only in the brain but also in the hematopoietic cell line in the bone marrow. Cloning the NPY receptor subtype on the hematopoietic cell membrane and clarifying its structure are very important for elucidating the hematopoietic mechanism, for example, for studying differentiation and proliferation of hematopoietic cells. As described above, at present, expression of at least the Y1 type receptor on the hematopoietic cell membrane can be predicted, and the immediate problem is to clarify whether this is the same type as that expressed in the brain or a subtype. I can say.

[0007]

As described above, the NPY
Is expected to play an important role in hematopoietic cell lines as well, but little has been done on its receptor. Although it has been pharmacologically proved that Y1 type receptors are present in hematopoietic cells, there is no analysis data at the gene level, and therefore the existence of subtypes produced by alternative splicing cannot be ruled out. A useful agonist capable of clarifying the function of NPY in the hematopoietic system and controlling the signal transduction through the receptor,
To develop an antagonist, it is first necessary to clone the NPY • Y1 receptor subtype expressed on the hematopoietic cell membrane, determine the structure, and prepare a transformed cell that highly expresses this receptor. It is essential. Moreover, if the obtained receptor gene shows a tissue- or organ-specific expression pattern, the gene fragment can also be an effective gene marker for recognizing a tissue or a cell.

[0008] An object of the present invention is to provide a gene encoding a mouse NPY • Y1 receptor subtype which is specifically expressed in hematopoietic cells and early embryogenesis. It is also an object of the present invention to provide a DNA fragment useful as a probe or primer for identifying adult mouse bone marrow cells or cells in early fetal development.

[0009]

Means for Solving the Problems The present inventors have conducted extensive studies in view of the above circumstances, and as a result, have found that mouse NPY receptor Y
The amino acid sequence of one subtype (hereinafter sometimes abbreviated as NPY.Y1β receptor) was determined for the first time, and a gene encoding this was prepared. As a result, mouse NPY ・ Y
The 1β receptor was found to have the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing below.

That is, the present invention provides SEQ ID NO: 1 in the sequence listing.
The amino acid sequence shown by or 1 in the amino acid sequence
Alternatively, a DNA having a plurality of amino acids added, deleted or substituted and encoding a receptor subtype capable of accepting the mouse neuropeptide Y • Y1 is provided.

Further, the present inventors have found that cell-specific DNA in adult mice or cell-specific DNA in early fetal development.
And a DNA fragment useful as a probe or primer for identifying bone marrow cells of adult mouse or cells in early fetal development.

That is, the present invention provides SEQ ID NO: 5 in the sequence listing.
There is provided a DNA fragment consisting of at least 15 consecutive bases of the base sequence shown in or its complementary strand.

The present invention will be described in detail below.

As described in the Examples below, the present inventors have succeeded in determining the nucleotide sequence of the gene encoding the NPY.Y1β receptor. This base sequence is shown in SEQ ID NO: 2 in the sequence listing together with the deduced amino acid sequence encoded by it. As is clear from this sequence, this c
DNA has a total of 924 from base number 1 to base number 924.
It consists of base pairs. Base numbers 1 to 3 correspond to the translation start genetic code, and base numbers 922 to 924 correspond to the translation stop genetic code. In the base sequence represented by SEQ ID NO: 2, base numbers 922 to 924 are TGs.
It may be A, TAA or TAG. Further, since there are a plurality of codons encoding one amino acid, DNA having any base sequence is included in the scope of the present invention as long as the encoded amino acid sequences are the same. Sequence number 2
The amino acid sequence shown in SEQ ID NO: 1 is obtained by extracting the deduced amino acid sequence shown in. Therefore, the present invention includes any DNA encoding the amino acid sequence shown by SEQ ID NO: 1.

[0015] Generally, when the amino acid sequence of a peptide having physiological activity is slightly changed, that is, one or more amino acids in the amino acid sequence are replaced or deleted or one or more amino acids are added. It is a well-known fact that the physiological activity of the peptide may be maintained even if it is carried out. The present invention also includes a DNA which has such a modification and which encodes a protein capable of accepting the mouse neuropeptide Y • Y1. That is, a DNA encoding an amino acid sequence in which one or more amino acids are added, deleted or substituted in the amino acid sequence represented by SEQ ID NO: 1 and which can accept the mouse neuropeptide Y • Y1 is also within the scope of the present invention. included.
Similarly, in the base sequence shown in SEQ ID NO: 2, one or more nucleotides are added, deleted or substituted, and the expression of a DNA encoding an amino acid sequence capable of accepting mouse neuropeptide Y • Y1 is controlled. Included DNA is also included in the scope of the present invention.

DNAs that give rise to amino acid additions, deletions or substitutions can be prepared, for example, by site-directed mutagenesis, which is a well-known technique (eg Nucleic Acid Research, Vol. 10, No. 20, p6).
487-6500, 1982), and the term “one or more amino acids” as used herein means a sufficient number of amino acids that can be added, deleted or substituted by site-directed mutagenesis.

Site-directed mutagenesis can be carried out as follows, for example, using a synthetic oligonucleotide primer complementary to the single-stranded phage DNA to be mutated except for the specific mismatch which is the desired mutation. it can. That is,
A double-stranded DNA obtained by synthesizing a strand complementary to a phage using the above-mentioned synthetic oligonucleotide as a primer
A is transformed into a phage-carrying host bacterium. A culture of transformed bacteria is plated on agar and plaques are formed from single cells containing phage. Then, theoretically, 50% of the new colonies contain the phage with the mutation as a single chain, and the remaining 50% have the original sequence. The resulting plaque hybridizes with those that perfectly match the DNA with the desired mutation, but does not hybridize with those that have the original strand and does not hybridize to the kinased synthetic probe. Let the hybrid form. Next, plaques that hybridize with the probe are picked up, cultured, and DNA is recovered.

As a method for substituting, deleting or inserting one or more amino acids in the amino acid sequence of the enzyme that does not cause loss of the enzyme activity, in addition to the above site-directed mutagenesis, the gene may be a mutagen. And selectively cleaving the gene, then removing, adding the selected nucleotides,
Alternatively, there is also a method of substituting and then ligating.

Both ends of the above-mentioned DNA of the present invention, that is, the translation initiation code and the translation termination code can be bound to arbitrary DNA fragments. This DNA
The nucleotide sequence and size of the fragment are not important, and any DNA fragment suitable for ligation with an extranuclear gene such as bacteria can be used. For example, in the following Examples, the translation initiation code is linked to the DNA fragment having the nucleotide sequence represented by SEQ ID NO: 3, and the translation termination code is linked to the DNA fragment having the nucleotide sequence represented by SEQ ID NO: 4. .

The cDNA of this invention is a mouse bone marrow cell m
It can be obtained from an RNA-derived cDNA library by using, for example, the plaque hybridization method. According to this method, a DNA having a base sequence complementary to the probe can be obtained from a cDNA library by using a human NPY • Y1 receptor gene whose base sequence is already known as a probe.

Alternatively, since the nucleotide sequence of the DNA of the present invention has been determined by the present invention, PCR using a cDNA library derived from mouse bone marrow cell mRNA as a template, or R using mouse bone marrow cell mRNA as a starting material
It can also be easily prepared by the T-PCR method.

The cDNA thus obtained can be inserted into an appropriate vector (plasmid, phage, etc.) by a well-known method, and can be produced in large quantities in a bacterium serving as a host.

C for obtaining the cDNA of the present invention
The DNA library is from the early stage of mouse embryo development (from day 7
The cDNA library on the 11th day) can also be used.

In this way, the cDNA of the present invention having all the genetic information necessary for forming the mouse NPY • Y1β receptor is obtained.

Mouse NPY / Y1β receptor and human type NP
Mouse type homologue of Y / Y1 receptor (FEBS letter,
314, 285 (1992)) (Mouse NPY, Y
When it is compared with 1α receptor), there is a perfect match up to base number 908 of SEQ ID NO: 2 and no homology after that. That is, the mouse NPY • Y1β receptor is the base number 909 of SEQ ID NO: 2 of the mouse NPY • Y1α receptor.
It can be said that it is a novel mouse NPY • Y1 receptor subtype in which a completely novel DNA sequence is inserted by alternative splicing after the site corresponding to.

Using the DNA base sequences of different gene regions of mouse NPY • Y1 α and β receptor genes,
It is possible to compare the difference in expression pattern between the two organs, cells or fetal development. For example, from the results of Northern analysis or PCR analysis, the present inventors have found that the mouse NPY / Y1α receptor is the heart, brain, spleen,
Although it is expressed in a relatively wide range such as lung, skeletal muscle, and kidney, mouse NPY / Y1β receptor is not expressed in these organs at all, and bone marrow cells and early fetal development (7, 11 days). The result is that it is highly expressed in the eye).

As described above, in the base sequence shown in SEQ ID NO: 2, the region after the base number 909 corresponds to the novel mouse NPY.Y1 which was first identified in the following examples.
It is a region unique to the receptor subtype. Furthermore, the sequence shown in SEQ ID NO: 4 is one that is linked to the downstream of the stop codon in the sequence shown in SEQ ID NO: 2, and the above-mentioned c
Although it is a part of the insert fragment in the DNA library, this region is also a newly discovered DNA region according to the present invention, which is bone marrow cell-specific in adult mice or cell-specific in early fetal development. That is, c obtained in the following examples
In the insert in the DNA library, the nucleotide sequence represented by SEQ ID NO: 5 is a bone marrow cell-specific DNA region in adult mouse or a cell-specific DNA region in early embryogenesis.

Therefore, by labeling a DNA fragment which specifically hybridizes to this region with an appropriate label,
The nucleotide sequence can be used as a probe for identifying bone marrow cells or cells in early fetal development in adult mice.
The length of the probe is preferably at least 15 consecutive bases or more. The probe may be single-stranded or double-stranded, but will be single-stranded at least when used. The size of the probe may be any length up to the full length as long as it is 15 base pairs or more.

The DNA fragment which hybridizes with the base sequence shown in SEQ ID NO: 5 or a part of its complementary strand is P
It can also be used as a primer for CR. PCR is performed using such a pair of DNA fragments as primers to examine whether or not the DNA is amplified,
The presence of bone marrow cells or cells in early fetal development in adult mice can be examined. When used as a primer for PCR, the size of the DNA fragment is preferably about 15 to 30 bases. The primer may be single-stranded or double-stranded, but will be single-stranded when used.

[0030]

EXAMPLES The present invention will be described below with reference to examples. In the following examples, in the base sequence represented by SEQ ID NO: 2 in the sequence listing described below, the base pair having the sequence represented by SEQ ID NO: 3 in the base of base number 1 and the base of base number 924 are represented in the base sequence. The method for producing a DNA having a base sequence in which the base pairs having the sequence represented by SEQ ID NO: 4 are bound together, and the production of a transformant using this DNA will be described. In addition, an expression analysis method using a DNA base sequence specific to each receptor will be described. However, it is obvious that the present invention is not limited to the following examples. In addition, in the following Examples, each operation was carried out by Maniatis et al. [Molecular Cloning Laboratory Manual 2nd Edition (198) unless otherwise specified.
9), Cold Spring Harbor]. In addition, as the restriction enzyme, a commercially available one was used, and its specific usage was in accordance with the instructions for the commercially available product.

(1) Preparation of Mouse Bone Marrow Cell mRNA Mouse bone marrow cells previously cryopreserved at −80 ° C.
Quick homogenization was carried out while adding 30 ml of GTC buffer (6 M guanidine thiocyanate, 5 mM sodium citrate, 17 mM sodium sarcosyl sodium, 0.7% b-mercaptoethanol). The homogenate obtained is centrifuged at 3,000 xg for 5 minutes at room temperature,
The supernatant was transferred to another new tube. 25 ml of the supernatant of this homogenate was added to 5.7 M containing 0.1 M EDTA.
Layer on a cesium chloride cushion (8 ml) and use a Hitachi SRP28 rotor at 26 ° C at 26 ° C.
It was centrifuged at 000 × g for 45 hours. After centrifugation, the brown and brown protein layers and the DNA layer were removed with an aspirator. RNA precipitated at the bottom of the tube was added to TES buffer (100 mM Tris-HCl, 5 mM EDT).
A, 1% SDS, pH 7.5) was dissolved in 1 ml and deproteinized with phenol / chloroform (1: 1).

To the aqueous layer containing RNA, 0.1 ml of 3M sodium acetate and 2 ml of chilled ethanol were added, and RNA was added.
Was allowed to settle. RNA recovered by centrifugation is 80
After washing with% ethanol, it was vacuum dried and dissolved in sterile distilled water. Next, the obtained RNA aqueous solution was passed through an oligo (dt) cellulose column by the following procedure to separate mRNA having poly (A). That is, RNA dissolved in sterilized distilled water was added with 2 volumes of equilibration buffer (0.5M N
aCl, 20 mM Tris-HCl, 1 mM EDT
A, 0.1% SDS, pH 7.6) was added, and heat treatment was performed at 65 ° C. for 5 minutes, and then the mixture was applied to an oligo (dt) cellulose column that had been equilibrated with the equilibration buffer in advance, and 10 times the equilibration buffer It was washed with liquid. After washing, elution buffer (20 m
M Tris-HCl, 1 mM EDTA, pH 7.
MRNA was eluted using 6) and recovered by ethanol precipitation. The recovered mRNA was washed with 80% ethanol, vacuum dried, and dissolved in sterile distilled water. This mR
The following cDNA synthesis was performed using 3 μg of NA.

(2) Preparation of cDNA library cDNA synthesis from the prepared mRNA was carried out using a cDNA synthesis system commercially available from Pharmacia Co., Ltd. according to the protocol attached to the product. After synthesizing cDNA complementary to mRNA with reverse transcriptase, nicking and gapping the RNA chain with ribonuclease H, and repair-synthesizing this with T4 DNA polymerase to replace the RNA chain with the cDNA chain. . Finally, both ends of the cDNA strand were blunted with the Klenow fragment of E. coli DNA polymerase I. Next, λZAPII, which is commercially available from Stratagene.
A cDNA library was created using the library system. All the methods were performed according to the protocol attached to the product. That is, first, the synthetic cd
An EcoRI adapter was added to both ends of NA, and this was ligated to a λZAPII arm that had been previously cleaved with EcoRI. Then, in vitro packaging was performed, and the Escherichia coli XLI-Blue strain (supplied with the product) was infected to prepare a cDNA library.

(3) Selection of cDNA clone encoding mouse NPY • Y1β receptor About 300,000 phage groups were selected from Escherichia coli XLI-Blue in the cDNA library prepared in (2) above.
The strain was absorbed, spread on an agar plate, and cultured at 37 ° C. for 12 hours. Place the nitrocellulose filter on the agar and let it stand for 1 minute to allow the phage to adsorb to the filter, then remove the filter from the agar and denature solution (0.2M
A denaturing treatment was carried out for 5 minutes in NaOH, 1.5M NaCl). After thoroughly removing the denaturing solution on a paper towel,
Neutralization solution (1.5M Tris-HCl, 1.5M Na
Cl, pH 7.5) for 5 minutes, followed by 2
xSSC (1x contains 0.15M sodium chloride 15
Washing was carried out for 5 minutes in mM sodium citrate-hydrochloric acid buffer, pH 7.0). After drying this filter at 80 ° C for 2
Heated for hours. After returning to room temperature, 5x Denhardt's solution (1
x is 0.02% Ficoll, 0.02% polyvinylpyrrolidone, 0.02% bovine serum albumin), NET
Liquid (5M NaCl, 2M Tris-HCl, 0.5
(M EDTA, pH 8.0), 0.1% sodium dodecyl sulfate, and 100 μg of denatured salmon sperm DNA per ml were reacted at 55 ° C. for 16 hours.

The ³² P-labeling of the probe was carried out using a full-length fragment (about 1.1 kbp) of the human NPY receptor gene as a template and a multi-primer kit (Amersham). This ³² P-labeled probe was added to the above reaction solution, and a hybridization reaction was further performed for 24 hours.
Then, the filter was washed with 300 ml of 2xSSC containing 0.1% sodium dodecyl sulfate twice at room temperature for 5 minutes each time, and further with 300 ml of 2xSSC containing 0.1% sodium dodecyl sulfate at 55 ° C twice, 20 times.
Washed each minute. Then dry the filter,
Autoradiography was performed for 2 days at 0 ° C. using an intensifying screen.

A DNA probe labeled with ³² P is joined to the phage DNA in which the cDNA encoding the mouse NPY • Y1β receptor is inserted. Therefore, the portion corresponding to the plaque of the phage DNA adsorbed on the nitrocellulose filter produces black dots on the X-ray film. The plaque phage that produced this black spot was isolated from an agar plate to obtain a clone in which a cDNA having a length of about 2 kbp was inserted.

A plasmid (pNPY.Y1β) containing an insert was recovered from the obtained phage clone by the plasmid rescue method using f1 helper phage R408 (manufactured by Stratagene). The detailed method in this case followed the protocol of Stratagene.

(4) Determination of total nucleotide sequence of cDNA insert The entire nucleotide sequence of the cDNA insert was prepared by using a dilation kit for kilosequencing (purchased from Takara Shuzo Co., Ltd.) and a sequence DNA sequence kit (purchased from Toyobo Co., Ltd.). Used to determine. The determined entire base sequences are shown as SEQ ID NOS: 2, 3 and 4 in the sequence listing below.
The sequence represented by SEQ ID NO: 3 is bonded to the base represented by base number 1 of the sequence represented by SEQ ID NO: 2, and the sequence represented by SEQ ID NO: 4
The sequence represented by is bound to the base at base number 924 of the sequence represented by SEQ ID NO: 2. Clone pNPY / Y1
β contains 2065 base pairs as an insert DNA, and contains 9 from the translation initiation genetic code ATG to the translation termination genetic code TAA.
It had 24 base pairs as the largest continuous open reading frame. DN represented by SEQ ID NO: 2
The amino acid sequence derived from the A base sequence is shown in the sequence listing as SEQ ID NO: 1.

D inserted into clone pNPY.Y1β
Of the base sequence of NA, the bases up to the base number 908 of SEQ ID NO: 3 and SEQ ID NO: 2 were completely matched with the mouse homolog of the human NPY • Y1 receptor (mouse NPY • Y1α receptor). There was no homology from base number 909 of 2 (including SEQ ID NO: 4). From this, the mouse NPY / Y1β receptor is a novel NPY produced by alternative splicing as in the case of the prostaglandin E2 receptor and somatostatin receptor.
It can be said to be a receptor subtype.

(5) Construction of expression plasmid pcDNA.NPY for the purpose of expressing the mouse NPY.Y1.beta. Receptor gene in CHO cells. The cloned mouse NPY.Y1.beta. Receptor gene was introduced into cultured cells CHO to determine whether or not there was expression. The expression plasmid shown in FIG. 1 was constructed as follows by the method shown in FIG.

Cultured cell expression vector pcDNAI / ne
o (manufactured by Invitrogen) was purchased from Funakoshi Co., Ltd. This vector has a CMV promoter for initiation of transcription of a transgene, a polyadenylation signal, and a multicloning site between them. It also carries the gene required for neomycin resistance.

First, pNPY · Y1β is converted into N of 5 units.
After digestion with otI and XhoI, the obtained reaction product was separated by 1% agarose gel electrophoresis. Then, a DNA fragment of about 2 kbp containing the mouse NPY • Y1β receptor gene in this agarose gel was treated with Gene Cle.
An (manufactured by Biotech) was used for recovery in accordance with the attached protocol, followed by ethanol precipitation and dissolution in sterile distilled water.

Next, 5 μg of the expression vector pcDNA
I / neo was also digested with 5 units of NotI and XhoI, and then a DNA fragment of about 7 kbp was recovered by the same method and dissolved in sterile distilled water.

The above-mentioned two kinds of recovered DNA fragments, that is, the DNA fragment containing about 200 ng of the mouse NPY.Y1β receptor gene and about 50 ng of the vector DNA fragment were mixed and then the ligation reaction was carried out. This reaction was carried out using a Takara Ligation Kit (Takara Shuzo Co., Ltd.) according to the attached protocol. Escherichia coli MC1061 / P3 (attached to vector DNA) was transformed with this reaction solution by a conventional method to obtain ampicillin resistance (Amp ^R ).
A tetracycline-resistant (Tet ^R ) colony was obtained, and plasmid DNA was recovered from this colony. It was confirmed by agarose gel electrophoresis after the digestion reaction with NotI and XhoI that the recovered plasmid was the desired one. In this way, the plasmid for expression in CHO cells pcDNA.NPY could be constructed.

(6) Expression of Mouse NPY / Y1β Receptor Gene in CHO Cells The CHO intracellular expression plasmid pcDNA / NPY constructed in the above Example (5) is a kind of CHO cells.
-Introduced into K1 cells, the presence or absence of the expression of mouse NPY • Y1β receptor was examined. The experiment proceeded in the following three steps.

(A) C of plasmid pcDNA / NPY
Introduction into HO-K1 cells CHO-K1 cells are 10% fetal bovine serum (Boehringer Mannheim), 1.5 g / l sodium bicarbonate, 100 units / ml penicillin, 50 μg /
In Ham'F12 medium (manufactured by Nissui Pharmaceutical Co., Ltd.) supplemented with ml streptomycin, at 37 ° C. and 5% CO
_It was cultured under the condition of ₂ . After culturing, the number of attached cells was determined by the trypsin / EDTA solution (0.05% trypsin, 0.
53mM EDTA, manufactured by Gibco) and peeled off.
After collecting by centrifugation at 00xg for 5 minutes, 1x10 ⁶ cells / ml
Transformation buffer (227 mM sucrose,
7 mM potassium phosphate, 1 mM MgCl ₂ , pH
7.4). The electroporation method was used for introducing the plasmid into the CHO-K1 cells. The cell suspension (0.8 ml) suspended in the transformation buffer was placed in an electroporation cuvette and 10 μg of pcDNA was added.
-Add NPY, leave on ice for 10 minutes, then use Gene P
0.45k using ulser (manufactured by BIO-RAD)
Electroporation was performed under a stimulation condition of V, 25 μF. Then 10
The cells were allowed to stand on ice for a minute, and the cells were transferred to the above culture solution. 37
After culturing for 2 days at 5 ° C. and 5% CO ₂ , the culture solution was converted to the above-mentioned culture solution containing geneticin (0.2 g / l, manufactured by Sigma). By this operation, only cells that became resistant to geneticin (neomycin) by introduction of the plasmid began to grow. Mouse NPY / Y1β receptor-expressing cells were selected from among colonies of geneticin-resistant cells [ ¹²⁵ I] NP.
Selection was performed based on the presence or absence of Y-binding ability.

(B) Preparation of Transformed Cells for NPY Binding Experiment Transformed cells were cultured in the above-mentioned culture medium containing geneticin. After culturing, the transformed cells attached to the bottom of the culture vessel were peeled off using a rubber policeman, and the cells were incubated at 4 ° C for 80
Harvested by centrifugation at 0xg for 10 minutes. The collected cells were Tris buffer (50 mM Tris-H).
Cl, 2 mM CaCl ₂ , 5 mM KCl, 120 m
M NaCl, 1 mM MgCl ₂ , 0.1% BS
A, pH 7.4), and this was used for the NPY receptor binding experiment.

(C) Confirmation of mouse NPY.Y1.beta. Receptor expressed in CHO-K1 cells The expression of mouse NPY.Y1.beta. Receptor in transformed cells means that NPY receptor bound to the prepared transformed cell membrane. Confirmed by the presence of activity. This experiment is [ ¹²⁵
I] It carried out using the labeled NPY (made by NEN). First, 100 μl of reaction buffer (50 mM Tri
s-HCl, 2 mM CaCl ₂ , 5 mM KCl, 1
20 mM NaCl, 1 mM MgCl ₂ , 0.1%
BSA, pH 7.4) 2, 1, 0.5, 0.25
0.125 or 0.0625 nM [ ¹²⁵ I] NPY
Then, 100 μl of the transformed cell suspension (5 × 10 ⁵ cells) prepared in (b) above was added thereto, and the mixture was added at 25 ° C. for 9 hours.
The reaction was allowed for 0 minutes. After the reaction, the reaction solution was 3,000 xg,
The supernatant was removed by centrifugation for 5 minutes, and the radioactivity adsorbed on the precipitate was measured with a gamma counter. In addition, [ ¹²⁵ I] NP
In order to know the nonspecific adsorption of Y on the cell surface, the binding count in the presence of 5 μM NPY in the reaction system was also measured at each point. FIG. 2 is a Scatchard plot calculated from the specific binding activity at each point. This confirmed that the NPY receptor was expressed on the transformed cell membrane.

(7) Mouse NP in mouse bone marrow cells
Confirmation of Y · Y1β Receptor Expression Using 5 μg of mouse mRNA prepared in Example (1) as a template, cDNA was synthesized using a First-strand cDNA synthesis kit (Pharmacia).
The method was performed according to the attached protocol. Next, PCR was performed using 0.5 μg of the synthesized cDNA as a template. In carrying out the PCR reaction, the sense side primer is mouse NPY / Y1α as a primer selection condition.
And the β-receptor gene were selected from the common DNA base sequences, and the antisense primer was selected from the DNA base sequences specific to both receptors. 5 μl of 10 × PCR buffer (100 mM Tris-HCl, 500 mM KCl, 20 mM MgCl ₂ ,
0.1% gelatin, pH 8.4)) 5 μl dNT
P mixture (dATP, dGTP, dTTP and dCT
P 2 mM each), sense-side and antisense-side primers (100 pM each) and sterile distilled water were added to make 49 μl. 1 μl (5 units) Taq
DNA polymerase was added to start the PCR reaction. The PCR reaction consists of 3 steps. Step 1 is 9
4 ℃, 5 minutes treatment → 55 ℃, 2 minutes annealing → 72
One cycle of the elongation reaction was performed at 1 ° C for 1 minute. In step 2, 94 ° C., 1 minute treatment → 55 ° C., 2 minutes annealing → 72 ° C., 2 minutes, 30 minutes of elongation reaction. In step 3, 94 ° C., 1 minute treatment → 55 ° C., 2 minutes annealing → 72 ° C., 5 minutes after the elongation reaction, the reaction solution was stored at 4 ° C. The reaction product was separated by 1% agarose gel electrophoresis, and the presence or absence and the length of the amplified DNA fragment were analyzed. The results are shown in Figure 3. From this result, it was confirmed that the mouse NPY / Y1β receptor was certainly expressed in bone marrow cells. It was confirmed that the mouse NPY / Y1α receptor was also expressed in mouse bone marrow cells. The base sequences of the primers used in the above PCR are as follows. (Sense side) SP1: 5'-CCCATCTGACTCTCACAGGCTGTCT-3 '(corresponding to base numbers 603 to 627 of SEQ ID NO: 2) SP2: 5'-AGATATACATTCGCTTGAAAAGGAG-3' (corresponding to base numbers 695 to 719 of SEQ ID NO: 2) (anti Sense side) aAP1: 5'-TAAAAGATGGGGTTGACGCAGGTGG-3 '(sequence specific to mouse NPY / Y1α receptor; base sequence not described in the present invention) aAP2: 5'-CATGGTAGACATGGCTATGGTCTCG-3' (mouse NPY / Y1α receptor) Body-specific sequence (base sequence not described in the present invention) bAP1: 5'-AGTCAACGCAAACATGAGTACCCCC-3 '(corresponding to base numbers 23 to 47 of SEQ ID NO: 4) bAP2: 5'-ATGGAAATACATCAGGCTCAGAGGC-3' (sequence Corresponding to base numbers 54 to 78 of No. 4) In addition, in FIG. 3, each lane indicates the following. Lane 1: SP2 / aAP2, Lane 2: SP1 / aA
P1, Lane 3: SP2 / bAP2, Lane 4: SP2
/ bAP1, Lane 5: SP1 / bAP1. The left lane shows molecular weight markers.

(8) Confirmation of Expression of Mouse NPY • Y1α and β Receptor Genes in Each Mouse Organ and Developmental Stage Expression of mouse NPY • Y1α and β receptor genes in each organ and developmental stage using Northern analysis Was analyzed.

2 μg each of mRNAs derived from mouse heart, brain, spleen, lung, liver, skeletal muscle, kidney and testis were electrophoresed on an agarose gel and then transferred with a nylon membrane (manufactured by Clontech) and mice 7, 11, 1
2 μg of each mRNA from fetuses on the 5th and 17th days was electrophoresed on an agarose gel, and transferred nylon membranes (manufactured by Clontech) were purchased and used for analysis. These nylon membranes were put into a hybrid pack, 50 ml of rapid hybrid buffer solution (manufactured by Amersham) was added, and the mixture was reacted at 65 ° C. for 1 hour.
Mouse NPY • Y1β receptor gene-specific DNA nucleotide sequence having base number 909 or later and mouse NPY • Y
The DNA base sequence specific to the 1α receptor was labeled with ³² P by the method shown in Example (3), put into a hybrid pack, and
A hybridization reaction was carried out at 3 ° C for 3 hours. Then, the nylon membrane was washed with 200 ml of 2xSSC containing 0.1% sodium dodecyl sulfate (composition described in Example (3)) twice at room temperature for 5 minutes each, and further containing 0.1% sodium dodecyl sulfate. 200m
Washed twice with 1 x 0.2xSSC at 65 ° C for 10 minutes each. Then, the nylon membrane was dried and autoradiography was performed at -70 ° C for 2 days using an intensify screen. The results are shown in Figure 4.

In FIG. 4, each lane shows the following. Lane 1: heart, lane 2: brain, lane 3: spleen, lane 4: lung, lane 5: liver, lane 6: skeletal muscle, lane 7: kidney, lane 8: testis, lane 9: fetus (day 7). , Lane 10: fetus (day 11), lane 11: fetus (day 15), lane 12: fetus (day 17), the upper row, the interruption and the lower row in FIG. Upper row: Expression pattern of mouse NPY / Y1α receptor Middle row: Expression pattern of mouse NPY / Y1β receptor Lower row: Expression pattern of β-actin gene (control)

Mouse NPY / Y1β receptors are
It is not expressed in spleen, lung, liver, skeletal muscle, kidney, and testis, and it can be seen that the expression pattern is clearly different from that of α type. When evaluated in combination with Example (7), mouse NPY
-The expression of the Y1β receptor can be confirmed only in bone marrow cells in adult mice. High expression was confirmed in early fetal growth (7th and 11th days), and the mouse NPY / Y1β receptor-specific DNA nucleotide sequence represented by SEQ ID NO: 4 is a gene of bone marrow cells in early fetal development and in adult mice. It can be used as a marker.

[0054]

As described above, according to the present invention,
A gene encoding a mouse NPY • Y1β receptor was provided. Transformed cells produced using this gene can be applied to the screening of agonists and antagonists, which will be increasingly useful in the future. In addition, a part of this gene can be used as a bone marrow cell-specific gene marker in adult mice or a gene marker in early fetal development. That is, the present invention provides a DNA fragment that can be used as a probe or a primer for identifying bone marrow cells or cells in early fetal development in adult mice.

[0055]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 307 Sequence type: Amino acid Topology: Linear Sequence type: Protein Origin organism name: Mouse Tissue type: Bone marrow cells Direct origin Library name: Mouse bone marrow cell cDNA library Sequence Met Asn Ser Thr Leu Phe Ser Lys Val Glu Asn His Ser Ile His Tyr 1 5 10 15 Asn Ala Ser Glu Asn Ser Pro Leu Leu Ala Phe Glu Asn Asp Asp Cys 20 25 30 His Leu Pro Leu Ala Val Ile Phe Thr Leu Ala Leu Ala Tyr Gly Ala 35 40 45 Val Ile Ile Leu Gly Val Ser Gly Asn Leu Ala Leu Ile Ile Ile Ile 50 55 60 Leu Lys Gln Lys Glu Met Arg Asn Val Thr Asn Ile Leu Ile Val Asn 65 70 75 80 Leu Ser Phe Ser Asp Leu Leu Val Ala Val Met Cys Leu Pro Phe Thr 85 90 95 Phe Val Tyr Thr Leu Met Asp His Trp Val Phe Gly Glu Thr Met Cys 100 105 110 Lys Leu Asn Pro Phe Val Gln Cys Val Ser Ile Thr Val Ser Ile Phe 115 120 125 Ser Leu Val Leu Ile Ala Val Glu Arg His Gln Leu Ile Ile Asn Pro 130 135 140 Arg Gly Trp Arg Pro Asn Asn Arg H is Ala Tyr Ile Gly Ile Thr Val 145 150 155 160 Ile Trp Val Leu Ala Val Ala Ser Ser Leu Pro Phe Val Ile Tyr Gln 165 170 175 Ile Leu Thr Asp Glu Pro Phe Gln Asn Val Ser Leu Ala Ala Phe Lys 180 185 190 Asp Lys Tyr Val Cys Phe Asp Lys Phe Pro Ser Asp Ser His Arg Leu 195 200 205 Ser Tyr Thr Thr Leu Leu Leu Val Leu Gln Tyr Phe Gly Pro Leu Cys 210 215 220 Phe Ile Phe Ile Cys Tyr Phe Lys Ile Tyr Ile Arg Leu Lys Arg Arg 225 230 235 240 Asn Asn Met Met Asp Lys Ile Arg Asp Ser Lys Tyr Arg Ser Ser Glu 245 250 255 Thr Lys Arg Ile Asn Ile Met Leu Leu Ser Ile Val Val Ala Phe Ala 260 265 270 Val Cys Trp Leu Pro Leu Thr Ile Phe Asn Thr Val Phe Asp Trp Asn 275 280 285 His Gln Ile Ile Ala Thr Cys Asn His Asn Leu Leu Phe Leu Leu Leu 290 295 300 Asn Met Asn 305

SEQ ID NO: 2 Sequence length: 924 Sequence type: Nucleic acid Number of strands: Double stranded Sequence type: cDNA to mRNA Origin Organism name: Mouse Tissue type: Bone marrow cells Direct origin Library name: Mouse bone marrow cell cDNA library sequence ATG AAC TCA ACT CTG TTC TCC AAG GTT GAA AAT CAC TCA ATT CAC TAT 48 Met Asn Ser Thr Leu Phe Ser Lys Val Glu Asn His Ser Ile His Tyr 1 5 10 15 AAT GCC TCA GAG AAT TCT CCA CTT CTG GCT TTT GAA AAT GAT GAC TGC 96 Asn Ala Ser Glu Asn Ser Pro Leu Leu Ala Phe Glu Asn Asp Asp Cys 20 25 30 CAC CTG CCC TTG GCT GTG ATA TTC ACC TTG GCT CTC GCT TAT GGG GCG 144 His Leu Pro Leu Ala Val Ile Phe Thr Leu Ala Leu Ala Tyr Gly Ala 35 40 45 GTG ATT ATT CTT GGC GTC TCT GGA AAC CTG GCA TTG ATC ATA ATC ATT 192 Val Ile Ile Leu Gly Val Ser Gly Asn Leu Ala Leu Ile Ile Ile Ile 50 55 60 CTG AAA CAG AAG GAG ATG AGA AAT GTC ACC AAC ATT CTG ATC GTG AAC 240 Leu Lys Gln Lys Glu Met Arg Asn Val Thr Asn Ile Leu Ile Val Asn 65 70 75 80 CTC TCC TTC TCA GAC TTG CTC GTT GCG GTC ATG TGT CTC CCG TTC ACT 288 Leu Ser Phe Ser Asp Leu Leu Val Ala Val Met Cys Leu Pro Phe Thr 85 90 95 TTT GTA TAT ACA CTG ATG GAC CAC TGG GTC TTC GGG GAG ACC ATG TGC 336 Phe Val Tyr Thr Leu Met Asp His Trp Val Phe Gly Glu Thr Met Cys 100 105 110 AAA CTG AAT CCC TTT GTA CAG TGT GTC TCC ATC ACA GTA TCC ATT TTC 384 Lys Leu Asn Pro Phe Val Gln Cys Val Ser Ile Thr Val Ser Ile Phe 115 120 125 TCG CTG GTT CTC ATC GCT GTG GAA CGG CAT CAG CTA ATC ATC AAC CCA 432 Ser Leu Val Leu Ile Ala Val Glu Arg His Gln Leu Ile Ile Asn Pro 130 135 140 AGA GGG TGG AGA CCA AAC AAT AGA CAT GCT TAC ATA GGC ATT ACT GTC 480 Arg Gly Trp Arg Pro Asn Asn Arg His Ala Tyr Ile Gly Ile Thr Val 145 150 155 160 ATT TGG GTC CTT GCA GTG GCT TCT TCT CTG CCC TTT GTG ATC TAT CAA 528 Ile Trp Val Leu Ala Val Ala Ser Ser Leu Pro Phe Val Ile Tyr Gln 165 170 175 ATT CTG ACC GAC GAG CCC TTC CAA AAT GTG TCA CTT GCG GCG TTC AAG 576 Ile Leu Thr Asp Glu Pro Phe Gln Asn Val Ser Leu Ala Ala Phe Lys 180 185 190 GAC AAG TAT GTG TGC TTT GAC AAA TTC CCA TCT GAC TCT CAC AGG CTG 624 Asp Lys Tyr Val Cys Phe Asp Lys Phe Pro Ser Asp Ser His Arg Leu 195 200 205 TCT TAC ACG ACT CTC CTC CTG GTG CTG CAG TAT TTC GGC CCA CTC TGC 672 Ser Tyr Thr Thr Leu Leu Leu Val Leu Gln Tyr Phe Gly Pro Leu Cys 210 215 220 TTT ATA TTC ATA TGC TAC TTC AAG ATA TAC ATT CGC TTG AAA AGG AGA 720 Phe Ile Phe Ile Cys Tyr Phe Lys Ile Tyr Ile Arg Leu Lys Arg Arg 225 230 235 240 AAC AAC ATG ATG GAC AAG ATC CGG GAC AGT AAG TAC AGG TCC AGT GAG 768 Asn Asn Met Met Asp Lys Ile Arg Asp Ser Lys Tyr Arg Ser Ser Glu 245 250 255 ACC AAG CGA ATC AAC ATC ATG CTG CTC TCC ATT GTG GTC GCC TTC GCC 816 Thr Lys Arg Ile Asn Ile Met Leu Leu Ser Ile Val Val Ala Phe Ala 260 265 270 GTC TGC TGG CTG CCC CTT ACC ATC TTC AAC ACT GTG TTC GAC TGG AAC 864 Val Cys Trp Leu Pro Leu Thr Ile Phe Asn Thr Val Phe Asp Trp Asn 275 280 285 CAC CAG ATC ATT GCC ACC TGC AAC CAC AAT CTG CTG TTT CTG CTT TTG 912 His Gln Ile Ile Ala Thr Cys Asn His Asn Leu LeuPhe Leu Leu Leu 290 295 300 AAT ATG AAT TAG 924 Asn Met Asn 305

SEQ ID NO: 3 Sequence length: 205 Sequence type: Nucleic acid Number of strands: Double stranded Sequence type: cDNA to mRNA Origin Organism name: Mouse Tissue type: Bone marrow cells Direct origin Library name: Mouse bone marrow cell cDNA library sequence GGCACGAGGT GACACTCGTC CCGCTTCAAC AGAGGTGAAC AGACGCATTC TTTAAAAGAG 60 TATTCAGTTC AAGGGAATGA AGAACTGAGA ATTATCTTGG TGAATGGATT CAAATATATG 120 GAATAAGAGT ATGCTGAAGA TTTGATCCGC AAAGTATCACATATAACTA

SEQ ID NO: 4 Sequence length: 936 Sequence type: Nucleic acid Number of strands: Double stranded Sequence type: cDNA to mRNA Origin Organism name: Mouse Tissue type: Bone marrow cell Direct origin Library name: mouse bone marrow cell cDNA library sequences GTTTGGCTTA CACATTAACC CCGGGGGTAC TCATGTTTGC GTTGACTCTT GTTGCCTCTG 60 AGCCTGATGT ATTTCCATTA TTAAGGACCT TGAAGCTTTC AGCTGAATTA TATGTGCGCA 120 TATATACATA ATATTTCACA TGTCTTGCAT TTTACATATA TTTATTCATA GGCACTTGAT 180 CATTTCTTGC TATTGCTGAT GGAATTCCAT TTAAAAAATA CATCGCCAAA ATGGCTATAC 240 TAACATGTCA GGATATATTG GTCTTCTTTC CAGAATCCTG GTCAGACTCT TACAGTTGTG 300 TGTCATTTCT CATGGGTTCT CTGTGTGGGC GTCATCAGCA GATAATGCCA CTTTTCCTTC 360 CCTCCTTGTC CTGCTTTGTC TTTCTACTTT TCTCTGTTGA GTTGCACTTG TGACATATCT 420 CACATGGTGA CAGTAGGTGT GCGTGTGCAT GTTTGTCTAG TTGCTGGCTT TAGAGTGATCGAC 480 GTAGCTTCTT AGTGGAGGAC TTCCTGGGCC CACTGCTGCACCCCATCATCCTCCC540CCTCATCCATCCACCTCATCATCCACATCCTCATCCATCCT540A CTTTTGGA TTTTACTCTC ATTTTTGTAA CAGAATCCTA TCAAACCTGG ATCCACGAGA 660 GACAATTTCA CAGTGGGGAT GCTTGAAAGG TCATTCTTCT TTTCTTGCCT CCTGCAATAG 720 CTTCTCTGTC TTGTACAAGA GAACGTAGGT CATAAACCCA CTGTTCTTCT AAGGTTTGCA 780 GCATGGCGCT CATGACGTCA TAGGTAATGG TAGCTGATAG AAGGAGAATC CATCCTGATT 840 CTACATGCCC TGACTTGACT GCTTTACTTA GCTGCACAGG CCTTGCGCTT CCCTGGGGTT 900 TCTAGGTCAC TTTTTACATG TGCTGCTCTG TCAGTG 936

SEQ ID NO: 5 Sequence length: 952 Sequence type: Nucleic acid Number of strands: Double stranded Sequence type: cDNA to mRNA Origin Organism name: Mouse Tissue type: Bone marrow cells Direct origin Library name: mouse bone marrow cell cDNA library sequences T TTG AAT ATG AAT TAGGTTTGGC TTACACATTA ACCCCGGGGG TACTCATGTT 53 Leu Asn Met Asn 1 TGCGTTGACT CTTGTTGCCT CTGAGCCTGA TGTATTTCCA TTATTAAGGA CCTTGAAGCT 113 TTCAGCTGAA TTATATGTGC GCATATATAC ATAATATTTC ACATGTCTTG CATTTTACAT 173 ATATTTATTC ATAGGCACTT GATCATTTCT TGCTATTGCT GATGGAATTC CATTTAAAAA 233 ATACATCGCC AAAATGGCTA TACTAACATG TCAGGATATA TTGGTCTTCT TTCCAGAATC 293 CTGGTCAGAC TCTTACAGTT GTGTGTCATT TCTCATGGGT TCTCTGTGTG GGCGTCATCA 353 GCAGATAATG CCACTTTTCC TTCCCTCCTT GTCCTGCTTT GTCTTTCTAC TTTTCTCTGT 413 TGAGTTGCAC TTGTGACATA TCTCACATGG TGACAGTAGG TGTGCGTGTG CATGTTTGTC 473 TAGTTGCTGG CTTTAGAGTG ATCGTAGCTT CTTAGTGGAG GACTTCCTGG GCCCACTGCT 533 GTCTGTGCCT TGGTCCTGGT GCCTCTGGCA TCCCACCGTC TACAGGCATC CCA CTACTTT 593 AATCTTGCAT TTGATCCATA CAGCTCTTTT GGATTTTACT CTCATTTTTG TAACAGAATC 653 CTATCAAACC TGGATCCACG AGAGACAATT TCACAGTGGG GATGCTTGAA AGGTCATTCT 713 TCTTTTCTTG CCTCCTGCAA TAGCTTCTCT GTCTTGTACA AGAGAACGTA GGTCATAAAC 773 CCACTGTTCT TCTAAGGTTT GCAGCATGGC GCTCATGACG TCATAGGTAA TGGTAGCTGA 833 TAGAAGGAGA ATCCATCCTG ATTCTACATG CCCTGACTTG ACTGCTTTAC TTAGCTGCAC 893 AGGCCTTGCG CTTCCCTGGG GTTTCTAGGT CACTTTTTAC ATGTGCTGCT CTGTCAGTG 952

[Brief description of drawings]

FIG. 1 is a diagram showing the construction of a plasmid pcDNA.NPY for expression of mouse NPY.Y1.beta. Receptor in CHO cells.

FIG. 2 is a Scatchard analysis diagram showing [ ¹²⁵ I] NPY binding activity in CHO cells in which mouse NPY · Y1β receptor is stably expressed.

FIG. 3: Mouse NP in bone marrow cells by PCR method
It is a figure which shows the expression of Y * Y1 (alpha) and (beta) receptor. The above figure shows the location in the receptor gene to be amplified and its length when PCR reaction was performed with various primers. The figure below shows a schematic diagram of the electrophoretic pattern of DNA fragments amplified by the PCR reaction.

FIG. 4 is a schematic diagram of autoradiography showing a distribution of mouse NPY / Y1β receptor expression by Northern analysis.

Claims (6)

[Claims] 1. An amino acid sequence represented by SEQ ID NO: 1 in the sequence listing, or a receptor subtype having one or more amino acids added, deleted or substituted in the amino acid sequence and capable of accepting mouse neuropeptide Y • Y1. DNA that encodes. 2. A DNA encoding the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing. 3. A base sequence represented by SEQ ID NO: 2 in the Sequence Listing or a receptor subtype having one or more nucleotides added, deleted or substituted in the base sequence and capable of receiving mouse neuropeptide Y • Y1. The DNA according to claim 1, which has a nucleotide sequence encoding 4. The DNA according to claim 3, which has the nucleotide sequence represented by SEQ ID NO: 2 in the sequence listing. 5. A recombinant DNA comprising the DNA according to any one of claims 1 to 4, capable of self-propagating in a host cell, and capable of expressing the DNA in the host cell. 6. A DNA fragment comprising at least 15 contiguous bases of the base sequence represented by SEQ ID NO: 5 in the Sequence Listing or its complementary strand.