JPH08116997A - Specific detection of target rna and kit for rna detection - Google Patents

Abstract

PURPOSE: To specifically detect a target RNA in a high sensitivity by reacting a labeled probe reacting with a non-homologous site of the target RNA with a specimen in the presence of a competitive probe complementary to the non- homologous site of RNA having high homology. CONSTITUTION: When a target RNA is specifically detected in a specimen containing the target RNA and a RNA having high homology with the target RNA, a reverse complementary chain nucleic acid of a base sequence containing a non-homology site on the terget RNA such as the ribosomeal RNA of Salmonella is used as a labeled probe and a reverse complementary chain nucleic acid of a base sequence containing non-homology site on the RNA having high homology with the target probe such as the ribosomeal RNA of relative bacteria, etc., of Salmonella is used as a competitive probe, and hybridization of these probes with the specimen containing the target RNA and a RNA having high homology to the target RNA is carried out and labeled substance of the labeled probe bonded to the target RNA is detected. Thereby, the target RNA is specifically detected in high sensitivity in the specimen containing the RNA having high homology.

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method for specifically detecting target RNA by a hybridization method and an RNA detection kit used therefor. More specifically, it relates to a method for detecting ribosomal RNA, a method for detecting bacteria using the method, and a detection kit used therefor.

[0002]

2. Description of the Related Art As is well known, double-stranded DNA consists of two complementary polynucleotide chains, which are easily denatured by heat treatment or alkali treatment and dissociated into single strands. This reaction is reversible and, if placed under suitable conditions,
Hydrogen-bonding of two sets of bases of guanine and cytosine, and adenine and thymine (uridine) re-bonds to form a stable double-stranded DNA complex (hybridization). This reaction is fairly specific and occurs when the two strands are complementary to each other. Also,
The same applies not only to DNA but also to RNA. In order for a nucleic acid to form a hybrid, it is not necessary that the two nucleic acids are completely complementary, and even if there are some non-complementary portions, a hybrid is generated. However, such hybrids are unstable with respect to changes in temperature and ionic strength. By utilizing this property, it is possible to identify a nucleic acid having a similar base sequence, that is, having a very small difference by introducing an exogenous polynucleotide chain (probe) labeled in some form. As described above, in principle, it is possible to identify and detect similar nucleic acids that differ by only one or two bases by the hybridization method by strictly defining the binding conditions. In this case, a short probe having a base sequence that hybridizes with about 10 to 50 bases is usually used. However, in order to do this, great care and skill are required, and there is a problem in versatility.

In order to solve this problem, Andar Gunneberg et al. Devised an easy detection method for single nucleotide substitution using a competitive hybridization method for α1-antitrypsin deficiency (Clinical Chemistry, Vol. 39, No. . Ten,
1993, p2157-2162). In α1-antitrypsin deficiency, one base in the gene is replaced with another base (Glu-342 GAG → Lys
AAG) is a genetic disease caused by They detect this single nucleotide mutation using a DNA fragment amplified by the polymerase chain reaction method (PCR method). For example, a 21-base DNA with a mutated gene sequence
When is used as a labeled probe, only the mutated gene is detected when very strict hybridization conditions are set. Here, it is described that when a DNA having a normal sequence is added as a competitor before the hybridization reaction, only the mutated gene can be detected even under milder conditions. However, what they are targeting is a pure DNA fragment amplified by the PCR method. RNA has a strong hydrogen bonding force and its melting temperature (Tm) is considerably higher than that of DNA. Therefore, if the test subject is RNA, their method cannot be used as it is. In addition, although they say that a more excellent effect was obtained by adding a competitor before hybridization, in the case of DNA / RNA hybridization, the sensitivity of target nucleic acid detection can be improved by using a similar method. There is a tendency to decrease (this will be described in the example below). Furthermore, the RNA to be detected is not always pure, and generally contains a large amount of impurities, and PCR amplification D
It is likely that the result will be different from that of a pure system such as NA fragment.

The present inventor has previously developed an RNA detection method using two adjacent nucleic acid probes (adjacent hybridization method, Japanese Patent Application No. 6-061467). This method is a method in which one of two types of nucleic acid probes is immobilized on a carrier, the other is labeled by some method, and the labeled nucleic acid that specifically binds to the sample RNA is detected. It is also easy to operate and highly practical. Just R
Depending on the NA, further improvement may be required. For example, but not limited to, when there are many closely related bacteria such as Salmonella, if the above-mentioned adjacent hybridization method is carried out with one probe set as it is, a system for detecting only Salmonella will not be constructed. Expected to be quite difficult. Possible solutions include: 1. more stringently setting the hybridization conditions; 2. determining by combining the results using multiple probe sets. For 1., while it requires a considerably high degree of skill, the method of 2.
There is a problem that labor and cost increase.

[0005]

The object of the present invention is to specifically and simply specify a specific RNA in a sample in which RNA having a highly homologous sequence, that is, RNA having a very small number of different bases coexists. It is to provide a method for distinguishing from and detecting other RNA.

[0006]

Means for Solving the Problems In the method for detecting RNA by the hybridization method, the present inventors have added the target RNA in addition to the labeled probe for the target RNA.
Nucleic acid probe that binds to RNA highly homologous to
It is possible to prevent the labeled probe from binding to the above-mentioned highly homologous RNA by adding (competitive probe) which is added at the time of hybridization. Therefore, the target RNA is highly sensitive to the highly homologous RNA. The present invention has been completed and the present invention has been completed. Therefore, the present invention is a method for specifically detecting a target RNA in a sample containing the target RNA and an RNA highly homologous to the target RNA, which is a reverse complementary strand nucleic acid having a base sequence containing a heterologous site on the target RNA. Labeled probe, RN with high homology
The presence of the target RNA is detected by performing hybridization using the nucleic acid of the reverse complementary strand of the base sequence containing the heterologous site on A as a competitive probe and detecting the labeling substance of the labeled probe bound to the target RNA. And on how to. The nucleic acid used as the labeled probe and the competitive probe may be DNA or RNA, and 10 or more bases, preferably 15 to 50 bases are suitable. In general, there is a difference of about 1 base or 2 bases in both sequences.

In the method of the present invention, hybridization can be carried out according to a conventional method. In carrying out hybridization, it is preferable to add the labeled probe and the competitive probe at the same time. In addition, the present inventors have previously developed the adjacent hybridization method, that is, RNA using two kinds of nucleic acid probes for target RNA.
Can be carried out in combination with the method of the present invention. The adjacent hybridization method is specifically a reverse complementary strand DNA or RNA of a partial sequence (A) of 10 or more specific bases in the base sequence of the target RNA.
And existing near the partial sequence (A) on the target RNA 1
Reverse complementary strand DNA or RN of partial sequence (B) of 0 or more bases
A is prepared, and one of them is fixed as a capture probe on a carrier,
The other is labeled with a labeling substance to give a labeled probe, and the target RN
The sample containing A and the labeled probe are brought into contact with the capture probe immobilized on the carrier to hybridize the capture probe and the labeled probe to the target RNA, and the labeled substance of the labeled probe bound to the target RNA is detected to obtain the target R
It detects the presence of NA.

In the above-mentioned adjacent hybridization method, the partial sequence (B) needs to exist near the partial sequence (A), and it exists on either the 5'side or the 3'side of the partial sequence (A). You may. It is preferable that the 3'end of the sequence (B) and the 5'end of the sequence (A) or the 5'end of the sequence (B) and the 3'end of the sequence (A) are completely adjacent to each other. 3'terminal sequence of sequence (B) and 5'of sequence (A)
The terminal sequence, or the 5'terminal sequence of the sequence (B) and the 3'terminal sequence of the sequence (A) may overlap, in which case, when the reverse complementary strand nucleic acid probe thereof is hybridized, There is an increased probability that competition will occur with the target RNA at the overlapping portion and the sensitivity will decrease. Therefore, such overlapping portions are preferably as short as possible, preferably less than 5 bases, and more preferably completely non-overlapping, that is, completely adjacent to each other. On the other hand, the sequence (A) and the sequence (B) may not overlap with each other or be adjacent to each other, that is, may be separated from each other. However, as a result of hybridization of the reverse complementary strand nucleic acid probe thereof, the sequence (A) and the sequence ( A single-stranded portion is generated during B), and this portion is likely to be cleaved, increasing the probability that the sensitivity is lowered. Therefore, when the sequence (A) and the sequence (B) are present apart from each other, the 3'end of the sequence (B) and the sequence (A)
5'end, or the distance between the 5'end of sequence (B) and the 3'end of sequence (A) should be as short as possible,
It is preferably within 5 bases, and most preferably not separated from each other, that is, completely adjacent to each other. The nucleic acid probe used is suitably 10 or more bases, preferably 15 to 50 bases.

Examples of the target RNA in the method of the present invention include ribosomal RNA (rRNA). The method of the present invention can be used for the biological species identification test using rRNA as a target, and examples of the rRNA include those derived from bacteria. The method of the present invention is particularly advantageous when the target RNA is rRNA derived from Salmonella, and can distinguish Salmonella from related bacteria and specifically detect it. A typical example of a closely related bacterium of Salmonella is Citrobacter. In a method for specifically detecting a Salmonella bacterium by distinguishing it from a closely related bacterium, Citrobacter, the following DNAs of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 are respectively
It can be used as a capture probe, a labeled probe and a competitive probe. SEQ ID NO: 1 CTTCAGCTCC ATGAGTAAAT CA SEQ ID NO: 2 CTTCACCTAC GTGTCAGC SEQ ID NO: 3 CTTCACCTAC ATATCAGC In this method of the invention it is generally preferred to use 2 to 4 times the amount of the competing probe as the labeled probe. The present invention also provides a kit for detecting RNA, which comprises the following components for use in the method of distinguishing Salmonella from related bacteria and specifically detecting it. (A) A carrier on which the DNA of SEQ ID NO: 1 is immobilized; (b) the DNA of SEQ ID NO: 2 labeled with a labeling substance; (c) the DNA of SEQ ID NO: 3; (d) for detecting the labeling substance Reagent; and (e) Hybridization solution

The method for preparing the labeled probe is not specified, and examples of the labeling substance include digoxigenin, biotin, deoxyuridine bromide, fluoroescein and the like. The capture probe may be immobilized on a suitable carrier, and as the carrier, for example, a microtiter plate made of an organic polymer having a high binding property to a nucleic acid can be used. The method of immobilizing the capture probe is not particularly limited. For example, a method of placing the capture probe DNA or RNA solution in the above plate, drying it, and then immobilizing it by ultraviolet irradiation, or a covalent bond method such as the glutaraldehyde method. May be used. Then the target RN
A sample containing A, a labeled probe, and a competitive probe are brought into contact with a capture probe immobilized on the carrier to carry out hybridization. Then, the target RNA is detected by detecting the labeling substance of the labeled probe bound to the target RNA.

The method for preparing the sample containing the target RNA is not specified, but in order to perform it safely and simply, for example, after lysing the cells with an aqueous solution of sodium hydroxide or the like, neutralizing with hydrochloric acid or the like. Good. The prepared RNA solution is added to a carrier on which a capture probe is fixed together with a labeled probe and a competitive probe, and hybridization is generally performed at 15 to 60 ° C. for about 3 minutes to 18 hours. After washing with an appropriate solution (washing solution 1), a substance that binds to the labeling compound and an enzyme bound thereto are added and reacted for a certain time. The substance that binds to the labeling compound is not specified,
For example, if the labeled probe is labeled with biotin, use a mixture of biotin-conjugated horseradish peroxidase and avidin, or if it is labeled with digoxigenin (Dig), use a conjugate of anti-Dig immunoglobulin and horseradish peroxidase. be able to. After washing with an appropriate solution (washing solution 2), an appropriate enzyme substrate is added. The enzyme substrate is not specified. For example, when horseradish peroxidase is used, a blue reaction product can be obtained by using tetramethylbenzidine and hydrogen peroxide as substrates. Of course, a fluorescent substrate, a luminescent substrate, etc. can also be used. The washing solutions 1 and 2 are not specified, but physiological saline containing about 0.05% of a surfactant can be used.

The principle of the method of the present invention is generally as follows. For example, two types of RNA, A and B, are present in a sample, and their base sequences differ by only 1 or 2 bases. If the adjacent hybridization method is performed under normal conditions using a reverse complementary strand of A as a labeled probe to identify them, B may be detected (although the value is low) in some cases. This is the temperature,
This can be avoided by strictly setting the salt concentration or the concentration of the denaturing agent such as formamide, but it is difficult to control and B is detected by some practitioners. Here, when a nucleic acid of a reverse complementary strand of B (that is, different from the labeled probe by 1 or 2 bases) is added as a competitive probe and hybridized, the binding force between B and the competitive probe is higher than that of B and the labeled probe. Stronger, the binding property between B and the labeled probe is lost even under relatively mild conditions,
Alternatively, it is expected that it will become very weak and consequently B will not be detected. Hereinafter, the method of the present invention is also referred to as competitive hybridization.

[0013]

INDUSTRIAL APPLICABILITY By using the method of the present invention, it is possible to identify a nucleic acid having a very small number of different bases. Although its application range is wide-ranging, it is particularly effective in the field of diagnosis. Although not limited, if the present method is used for an identification test of an organism species targeting rRNA, it is possible to easily identify even a closely related bacterial species that was difficult to identify by the conventional method. It is also possible to detect mutations such as single base substitution / deletion and genetic diseases. Hereinafter, the present invention will be described in detail with reference to Reference Examples, Comparative Examples and Examples. In addition,
Although the examples show the distinction between Salmonella and closely related bacteria, the present invention is not limited thereto.

Reference Example [Determination of Salmonella and Citrobacter 23S rRNA gene nucleotide sequence] Salmonella typhimurium LT-2
(S. Typhimurium LT-2) and Citrobacter freundii IMAI (C. freundii IMAI) culture medium was extracted with DNA, and the polymerase chain reaction reaction was performed using the DNAs shown in SEQ ID NO: 1 and SEQ ID NO: 2 below. (P
CR), and the resulting DNA fragment of about 2800 bases was cloned into E. coli plasmid pUC118 according to a standard method. Using this, the nucleotide sequence of 23S rRNA of each bacterial species was partially determined, and several different regions of Salmonella and Citrobacter were found. In this reference example, the results of examining two locations are shown. Regarding the different regions, the 23S rRNA partial nucleotide sequences of Salmonella typhimurium and Citrobacter freundii (E. coli
(Equivalent to 1681st to 1770th in 23S rRNA gene)
The data which compared are shown. Salmonella 5'-TGGTGCCGTAACTTCGGGAGAAGGCACGCTGACACGTAGGTGAAGTGATTTACTCATGGAGCTGAAG TCAGTCGAAGATACCAGCTGGCT Citrobacter 5 '-................................ TT ...... .................................. A .............. (below (The bases represented by dots are the same for both.)

SEQ ID NO: 1 CTTCAGCTCC ATGAGTAAAT CA (reverse complementary strand DNA of 23S rRNA partial base sequence of Salmonella typhimurium corresponding to 1726th to 1747th of Escherichia coli 23S rRNA gene) SEQ ID NO: 2 CTTCACCTAC GTGTCAGC (Escherichia coli 23S The reverse complementary strand DNA of the 23S rRNA partial nucleotide sequence of Salmonella typhimurium corresponding to the 1708th to 1725th rRNA gene) SEQ ID NO: 3 CTTCACCTAC ATATCAGC (corresponding to 1708th to 1725th Escherichia coli 23S rRNA gene) Reverse complementary strand DNA of the partial base sequence of Citrobacter Freundy 23S rRNA

Comparative Example [Detection of Salmonella by Phosphorus Hybridization Method] In the partial region shown above, Salmonella typhimurium differs from Citrobacter freundii by 3 bases. However, there is a bias in the difference, and the two are close (TGACACGTA → TGATATGTA), and the other one on the 3'side
The three different bases are more than 30 bases apart. In such a case, it is considered that the difference on the 3'side cannot usually be used for the purpose of identification, and therefore, some probe candidates were selected from the peripheral region at a position different by two bases, and the adjacent hybridization method was performed. Hereinafter, representative test examples using the DNA of SEQ ID NO: 1 as a capture probe and the DNA of SEQ ID NO: 2 as a labeling probe will be shown. All synthetic DNAs used in the test, including both DNAs, were synthesized using a DNA synthesizer (PCR-MATE model 391, manufactured by ABI, the same applies hereinafter). DNA of SEQ ID NO: 1 (capture probe)
To 0.02 μg / μl in 50 mM sodium phosphate buffer, pH 8.0, and add 50 to each well of a microtiter plate (Sumitomo Bakelite, MS-3608FA).
Add μl and dry at 80 ° C. After irradiating with 120 mJ / cm ^{2 of} ultraviolet rays, it was washed 3 and 4 times with 200 μl of 30 mM sodium citrate / 300 mM sodium chloride (2 × SSC) and dried. The labeled probe used was the DNA of SEQ ID NO: 2 labeled with digoxigenin (Dig) with the reaction solution having the composition shown in Table 1 below.

[0017]

[Table 1] ────────────────────────────────── Potassium cacodylate buffer, pH 7.2 0.1M Chloride Cobalt 2mM Dithiothreitol 0.2mM Deoxyadenosine triphosphate 1mM Digoxigenated deoxyuridine triphosphate 0.2mM Probe DNA 3μg Terminal deoxynucleotidyl transferase 50-100 U Reaction volume 20 μl ────────── ─────────────────────────

After labeling, 1/10 volume of 0.2M EDTA, 1/10 volume of 4M
LiCl, 3 μg of glycogen and 2.5 volumes of ethanol were added, and the mixture was left at -80 ° C overnight. The precipitate was collected by centrifugation, washed with 70% ethanol and dried, then 100 μl
10 mM Tris hydrochloric acid, pH 8/1 mM ethylenediaminetetraacetic acid tetrasodium salt (TE). A fixed amount of the obtained labeled probe was mixed with the hybridization buffer shown in Table 2 below (labeled probe solution).

[0019]

[Table 2] Hybridization buffer ─────────────────────────────────── SSC (*) 2x Formamide 30% Blocking reagent (Boehringer Mannheim) 1% Sodium dodecyl sulfate 0.2% Yeast transfer RNA 100 μg / ml Salmon sperm DNA (**) 100 μg / ml Labeled probe 37.5ng / 50 μl Add ─────────── ────────────────────────── (*) 0.15M sodium chloride / 0.015M sodium citrate (**) 100 ° C, 10 minutes in advance Perform denaturing treatment.

Test rRNAs from Salmonella and Citrobacter were prepared as follows. Salmonella (S. Typhimurium LT-2 and S. Enteritidis on plate medium
L-58) and Citrobacter (C. freundii ATCC 8090) colonies are cultured in 10 ml of LB medium (Table 3 below) at 37 ° C overnight. Take 0.1 ml of the culture solution, inoculate it into LB, and incubate at 37 ° C for 4 hours. Take 0.9 ml of the culture solution, add 0.1 ml of 1.8 M sodium hydroxide, and mix. Leave at room temperature for 10 minutes, 0.1 ml of 1.8M
Add hydrochloric acid-0.2 M sodium phosphate buffer, pH 7 to neutralize.

[0021]

[Table 3] LB medium (in 1 liter) ───────────────── Peptone 10g Powdered yeast extract 5g Sodium chloride 5g Prepared to pH 7.4 ──────── ─────────

Hybridization and detection were performed as follows. Lysis solution 50 μl and labeled probe solution 50 μl
1 was placed in a microtiter plate on which a capture probe was fixed, and the mixture was allowed to stand at 37 ° C. for 2 hours. After washing 3 times with physiological saline (washing solution) containing 0.05% Tween20, blocking solution (1% blocking reagent, 20 mM Tris-HCl, pH 7.5)
/0.15M NaCl) 10,000-fold diluted anti-Dig sheep antibody-horseradish peroxidase (HRP, Boehringer Mannheim) was added and left for 30 minutes, then washed 3 times with a washing solution,
Chromogenic substrate solution (A solution: 0.12% 3,3 ', 5,5',-tetramethylbenzidine / 0.1M sodium acetate, pH 5/30% dimethylformamide, solution B: 0.03% hydrogen peroxide / 0.2% phosphoric acid, At the time of use, the solution A and the solution B were mixed at a ratio of 1: 1), 100 μl was added, and the mixture was left for 5 to 15 minutes. The absorbance of the obtained blue liquid was measured at a wavelength of 660 nm. The results are shown in Table 4 below.

[0023]

[Table 4] ─────────────────────── Bacterial species OD660 ───────────────────── ─── S. Typhimurium LT-2 0.397 ± 0.050 S. Enteritidis L-58 0.621 ± 0.007 C. freundii ATCC8090 0.278 ± 0.057 ─────────────────────── -As shown in Table 4, Citrobacter was clearly detected under the hybridization conditions of this comparative example.

Example 1 [Discrimination between Salmonella and Citrobacter by Competitive Hybridization Method] Adjacent hybridization method was adopted here, and the capture probe and labeled probe used were the same as those in Comparative Example. As the competitive probe, the DNA shown in SEQ ID NO: 3 below was used. Sequence No. 3 CTTCACCTAC ATATCAGC Hybridization was performed as follows.
50 μl of lysate prepared according to the method of Comparative Example and 50 μl of hybridization buffer containing no labeled probe
Dispense l to the plate on which the capture probe is fixed. Here, 30 minutes of prehybridization and 90 minutes of hybridization were performed at 37 ° C. The experimental conditions are shown below. The labeled probe and the competitive probe are
Dissolve in TE at 30ng / ml and 120ng / ml, 1 of which
μl was added to each reaction.

Condition 1 A labeled probe is added during prehybridization. Condition 2 A labeled probe and a competitive probe are added during prehybridization. Condition 3 Add no label during pre-hybridization, and add labeled probe during hybridization. Condition 4 No addition is made during prehybridization, and a labeled probe and a competitive probe are added during hybridization. Condition 5 A competitive probe is added at the time of prehybridization, and a labeled probe is added at the time of hybridization.

After the hybridization, detection (OD 660 nm) was performed according to the method described in Comparative Example. The results obtained are shown in Table 5 below.

[0027]

[Table 5] Test results of competitive hybridization method ─────────────────────────────────── Species condition 1 Condition 2 Condition 3 Condition 4 Condition 5 ─────────────────────────────────── S. Typhimurium LT-2 0.397 0.391 0.386 0.377 0.197 S. Enteritidis L-58 0.621 0.599 0.608 0.601 0.348 C. freundii ATCC8090 0.278 0.053 0.280 0.058 0.035 ────────────────────────── ─────────

In Table 5, a clear decrease in the sensitivity of Salmonella is observed when only the competing probe is present during prehybridization (condition 5). On the other hand, there is no change in Citrobacter. Considering this result, it is considered that when the competitive probe is added before the hybridization, a part of the probe binds to the target RNA, here, the Salmonella rRNA, so that the sensitivity is lowered. Further, since there is no difference between Condition 1 and Condition 3, it is presumed that the system (adjacent hybridization method) used in this Example does not require prehybridization. In the method of the present invention, it is also considered preferable to add the labeled probe and the competitive probe at the same time. PCR by Andar Gunneberg et al.
It has been reported that, in the competitive hybridization targeting the DNA fragment amplified by the method, a more excellent effect was obtained by adding the competitive probe before the hybridization, but in this Example, as described above, The presence of only competing probes during prehybridization eventually reduced the sensitivity of Salmonella, and therefore DNA amplified by Andar Gunneberg by PCR
It is considered that the labeled probe and the competitive probe hybridize to the RNA in the sample by a slightly different principle from the competitive hybridization targeting the fragment.

Example 2 In order to examine the relationship between the detection amount and the ratio of the labeled probe to the competitive probe used in the method of the present invention, the amount of the competitive probe added during hybridization was used under the condition 4 of Example 1 above. Was changed, and hybridization and detection (OD 660 nm) were performed in the same manner as in Example 1. The amount of labeled probe was the same as in Example 1 and was constant.
The results are shown in Table 6 below.

[0030]

[Table 6] ─────────────────────────────────── Labeled probe: Competitive probe 1: 0 1: 1 1: 2 1: 4 1:10 ─────────────────────────────────── S. Typhimurium LT-2 0.597 0.623 0.599 0.601 0.512 C. freundii ATCC8090 0.278 0.117 0.073 0.058 0.048 ────────────────────────────────────

From the results shown in Table 6, the greater the amount of competing probe added during hybridization, the lower the detection value of Citrobacter, while the sensitivity of Salmonella is 1: 4.
It turns out that there is almost no change until. However, since it is shown that the sensitivity of Salmonella decreases obviously when the competitive probe becomes 10 times as much as the labeled probe, the amount of the competitive probe used seems to be about 2 to 4 times that of the labeled probe.

Example 3 A kit for 500 samples containing the following components was prepared. ─────────────────────────────────── Denaturing solution 1M sodium hydroxide aqueous solution 5ml Neutralizing solution 1M hydrochloric acid / 0 2M Phosphate buffer 5 ml Detection plate Plate on which capture probe DNA (1 μg / well) is immobilized Hybridization buffer As shown in Table 2 10 ml Enzyme antibody Anti-Dig antibody-peroxidase (Boehringer Mannheim) 0.5 ml Enzyme-antibody dilution solution as described in comparative example 50 ml Enzyme dilution solution A solution as described in comparative example 25 ml Enzyme dilution solution B solution as described in comparative example 25 ml Wash solution as described in comparative example 1000 ml Digoxigenin labeled probe DNA 10 μg Competitive probe DNA 30 μg ---------------------------------------------------------------------------------------------

[0033]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 22 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence CTTCAGCTCC ATGAGTAAAT CA 22

SEQ ID NO: 2 Sequence length: 18 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CTTCACCTAC GTGTCAGC 18

SEQ ID NO: 3 Sequence Length: 18 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence CTTCACCTAC ATATCAGC 18

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical display location // (C12N 15/09 ZNA C12R 1:42) (C12Q 1/04 C12R 1:42) C12R 1 : 42) (72) Inventor Takashi Taneda 968 Shiizaki, Sanmu-cho, Sanmu-gun, Chiba Prefecture (18) (72) Takanori Namimatsu 2-11-11 Wakamiya, Ichikawa-shi, Chiba Zenroku Nakayama Dormitory

Claims (9)

[Claims] 1. A method for specifically detecting a target RNA in a sample containing the target RNA and an RNA having a high homology with the target RNA, which is a reverse complementary strand nucleic acid having a base sequence containing a heterologous site on the target RNA. Is a labeled probe, and a nucleic acid having a reverse sequence of a base sequence containing the non-homologous site on highly homologous RNA is used as a competitive probe to perform hybridization, and the target substance is detected by detecting the labeling substance of the labeled probe bound to the target RNA. A method for detecting the presence of. 2. The method according to claim 1, wherein two kinds of nucleic acid probes are used for the target RNA. 3. The method according to claim 1 or 2, wherein the target RNA is ribosomal RNA. 4. The method according to claim 3, wherein the ribosomal RNA is derived from bacteria. 5. The method according to claim 4, wherein the bacterium is Salmonella. 6. The method according to claim 5, which is used for distinguishing and detecting Salmonella from closely related bacteria. 7. The method according to claim 6, wherein the DNAs of the following SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 are used. Sequence number 1 CTTCAGCTCC ATGAGTAAAT CA Sequence number 2 CTTCACCTAC GTGTCAGC Sequence number 3 CTTCACCTAC ATATCAGC 8. The method according to claim 7, wherein the competitive probe is used in an amount of 2 to 4 times the labeled probe. 9. A kit for detecting RNA for use in the method according to claim 7, which comprises the following components. (A) Carrier on which DNA of the following SEQ ID NO: 1 is immobilized; (b) DNA of the following SEQ ID NO: 2 labeled with a labeling substance; (c) DNA of the following SEQ ID NO: 3; (d) To detect the labeling substance And (e) Hybridization solution SEQ ID NO: 1 CTTCAGCTCC ATGAGTAAAT CA SEQ ID NO: 2 CTTCACCTAC GTGTCAGC SEQ ID NO: 3 CTTCACCTAC ATATCAGC