JPH0797337A - Manifestation inhibitor containing anti-sense oligonucleotide derivative against human interleukin-6 receptor - Google Patents

Abstract

PURPOSE:To obtain the subject inhibitor useful as a human interleukin-6 activity inhibitor, containing an anti-sense oligonucleotide derivative against human interleukin-6 receptor (human IL-6R) as an active ingredient. CONSTITUTION:This manifestation inhibitor contains, as active ingredient, an anti-sense oligonucleotide derivative hydrodized with the region of a consecutive 9 to 30 base sequence containing a translation-initiating codon for mRNA coding human IL-6R.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to an antisense oligonucleotide derivative useful as a drug for inhibiting the expression of human interleukin-6 receptor (human IL-6R).

[0002]

2. Description of the Related Art Human interleukin-6 (human IL-
6) is a cytokine cloned as a factor that induces final-stage differentiation of B cells into antibody-producing cells (Kishimoto T et al., Blood 74, 1-).
10, 1989), and is now known to have various actions such as induction of acute phase proteins in the liver (K.
Ishimoto T et al., Blood 74, 1-1.
0,1989).

Human IL-6 is not limited to only lymphoid cells, but fibroblasts, vascular endothelial cells, and bladder cancer cell line T2.
4 and glioblastoma have been reported (Kohase M. et al., J. Cell.
Physiol. 132, 271-278, 197
8; Meir EV et al., Cancer Res. Fifty,
6683-6688, 1990) and its target cells are also diverse (Kishimoto T et al.,
Blood 74, 1-10, 1989).

In recent years, human IL- has been reported by Kawano M et al.
6 is autocrine growth in myeloma cells
It has been reported to function as a factor (K
awano M et al., Nature, 332, 83-8.
5, 1988), and also in renal cell carcinoma (Miki S et al., FEBS Lette).
r 250, 607-610, 1989).

On the other hand, signals for cell proliferation or differentiation by human IL-6 are present on the cell surface.
It is known to be transmitted to cells via R and glycoprotein gp130. (Taga T. et al., Cell 5
8, 573-581, 1989; Hibi M et al., Ce.
ll 68, 1149-1157, 1990). recent years,
As a method of suppressing the action of the gene causing the pathological condition, it has been proposed to suppress the expression of the protein by using an oligonucleotide (antisense oligonucleotide) complementary to mRNA transcribed from DNA. (Murakami, Kagaku, 46, 681-684, 199)
1).

[0006] Furthermore, as a method for solving problems such as lifespan, stability, and cell uptake efficiency of antisense oligonucleotides, a methylphosphonate derivative or sulfur in which the oxygen of the phosphate group of the nucleotide is replaced with a methyl group is used. Modified antisense oligonucleotides such as substituted phosphorothioate derivatives are known (Murakami,
In fact, it has been recognized that these antisense nucleotides inhibit viral protein synthesis (A).
gris, C.I. H. Et al., Biochemistry, 2
5,6268-6275,1986).

[0007] Based on this idea, Levy Y et al. Reported that human IL-6 was inhibited by inhibiting the translation of human IL-6 mRNA by an antisense oligonucleotide.
It was confirmed that the growth of a myeloma cell line using -6 as a growth factor was suppressed (LovyY et al., J. Clin. I.
nvest. , 88, 696-699, 1991). However, an antisense oligonucleotide derivative that significantly suppresses IL-6R expression in various cells expressing human IL-6R is not known.

[0008]

Accordingly, the present invention is intended to provide an antisense oligonucleotide derivative that inhibits the expression of human IL-6R.

[0009]

More specifically, the present invention relates to a human comprising an antisense oligonucleotide derivative for at least 9 consecutive nucleotide sequences including the translation initiation codon of mRNA encoding human IL-6R. An expression inhibitor of IL-6R is provided.

The present inventor has reported that m encoding human IL-6R
The present inventors have completed the present invention by finding that when an antisense oligonucleotide derivative against at least 9 consecutive nucleotide sequences including the translation initiation codon of RNA was synthesized and cultured with human renal cell carcinoma, the proliferation of cancer was suppressed. In a preferred embodiment of the present invention, an antisense oligonucleotide derivative for a continuous nucleotide sequence of 9 to 30, more preferably 12 to 25, including the translation initiation codon of mRNA encoding human IL-6R is used.

The term "antisense oligonucleotide" as used herein means not only those in which nucleotides corresponding to nucleotides constituting a predetermined region of DNA or mRNA are all complementary, but also DNA or mRNA and oligonucleotide are stable. Some mismatch may be present as long as it can hybridize to The translation initiation codon of human IL-6R and the base sequence in the vicinity thereof are as follows (see, for example, JP-A-2-288,898) (SEQ ID NO: 1).

1 -1 5'CTGTCCGCCTCTGCGGGACCATGGAGTGGTAGCCGAGGAGGAAGC ATG CTG GCC GTC GGC TGC GCG CTG CTG GCT GCC CTG CTG GCC GCG 3'Met Leu Ala Val Gly Cys Ala Leu Leu Ala Ala Leu Leu Ala Ala

Therefore, the base sequence of the antisense oligonucleotide derivative of the present invention can be appropriately selected from the 5'side and 3'side consecutive base sequences including the ATG of the codon of the first amino acid Met. According to one aspect of the present invention, the expression-inhibiting oligonucleotide is an antisense oligonucleotide for the nucleotide sequence consisting of the start codon ATG in SEQ ID NO: 1 and the sequence downstream thereof, for example, from Met at position 1. 5th Gl
a nucleotide sequence complementary to the base sequence of the codon encoding up to y, that is, 5'GCCGACGGCCAG
It has CAT-3 '(SEQ ID NO: 2).

According to a preferred embodiment of the present invention, the expression-inhibiting oligonucleotide is an antisense oligonucleotide for the nucleotide sequence consisting of the start codon in SEQ ID NO: 1 and the sequence upstream thereof. As an example of such an oligonucleotide, a base sequence complementary to the start codon ATG and 17 bases upstream thereof, that is, 5'-CATGCTTCCTTCCTGCGCTAC-
Those having 3 '(SEQ ID NO: 3) are included. As another example, a base sequence complementary to the start codon and 12 bases upstream thereof, that is, 5'-CA
Those having TGCTTCCTCCCTCG-3 ′ (SEQ ID NO: 4) can be mentioned.

According to another preferred embodiment of the present invention, the expression-inhibiting oligonucleotide is an antisense oligonucleotide for the base sequence consisting of the start codon in SEQ ID NO: 1 and its upstream and downstream sequences. As an example of such an oligonucleotide, a base sequence complementary to the start codon and a base sequence consisting of 11 bases upstream and 6 bases downstream, that is, 5'-
Those having GGCCAGCATGCTTCCTCCCTC-3 '(SEQ ID NO: 5) can be mentioned.

When the oligonucleotide derivative used in the present invention is a deoxyribonucleotide, each structure is as shown in Chemical formula 1, wherein X is independently oxygen (O), sulfur (S), lower alkyl group. Alternatively, it may be either a primary amine or a secondary amine. Y may independently be either oxygen (O) or sulfur (S). B is selected from adenine, guanine, thymine, or cytosine, and is a complementary oligonucleotide of DNA or mRNA mainly encoding human IL-6 receptor. R is independently hydrogen or a dimethoxytrityl group or a lower alkyl group. n is 7-2
8

Preferred oligonucleotide derivatives are not only unmodified oligonucleotides but also modified oligonucleotides. Examples of such modified products include lower alkyl phosphonate modified products such as the above-mentioned methyl phosphonate type or ethyl phosphonate type, and other phosphorothioate modified products or phosphoroamidate modified products (see Chemical Formula 2).

[0018]

[Chemical 1]

[0019]

[Chemical 2]

These oligonucleotide derivatives can be obtained by a conventional method as follows. X and Y in formula 1
The oligonucleotide in which is 0 is easily synthesized by a commercially available DNA synthesizer (for example, manufactured by Applied Biosystems). The synthesis method can be obtained by a solid phase synthesis method using phosphoramidite, a solid phase synthesis method using hydrogen phosphonate, and the like.

For example, T.W. Atkinson, M .; Sm
ith, in Oligonucleotide Sy
nthesis: A Practical Appro
ach, ed. M. J. Gait, IRL Pres
s, 35-81 (1984); H. Caruthe
rs, Science, 230, 281 (1985);
A. Kume, M .; Fujii, M .; Sekine,
M. Hata, J .; Org. Chem. , 49,213
9 (1984); C. Froehler, M .; Ma
tteucci, Teterahedron Let
t. 27, 469 (1986); J. Gareg
g, I. Lindh, T .; Regberg, J .; Sta
winski, R .; Stroberg, C.I. Henr
ichson, ibid. , 27, 4051 (198
6);

B. S. Sproat, M .; J. Gai
t, in Oligonucleotide Synt
hesis: A Practical Approac
h, ed. M. J. Gait. IRL Press, 8
3-115 (1984); L. Beaucage
and M.D. H. Caruthers, Tetrahhe
dron Lett. , 22, 1859-1862 (1
981); D. Matteucci and M.M.
H. Caruthers, Tetrahedron L
ett. 21, 719-722 (1980);
D. Matteucci and M.M. H. Carut
hers, J.M. Am. Chem. Soc. , 103, 3
185-3191 (1981).

The modified phosphate triester in which X is a lower alkoxy group can be obtained by a conventional method, for example, by treating the oligonucleotide obtained by chemical synthesis with a solution of tosyl chloride in DMF / methanol / 2,6-lutidine. (Moody HM, et al., Nuc
leic Acids Res. , 17,4769-4
782 (1989)).

A modified alkylphosphonate in which X is an alkyl group can be obtained by a conventional method, for example, using a phosphoamidite (MA Dorman, et.a.
l. , Tetrahedron, 40, 95-102.
(1984); L. Agarwal and F.A.
Riftina, Nucleic Acids Re
s. , 6,3009-3024 (1979)).

The phosphorothioate modified product in which X is S is a conventional method, for example, a solid phase synthesis method using sulfur (CA.
Stein, et. al. , Nucleic Acid
s Res. , 16, 3209-3221 (198
8)) or tetraethylthiuram disulfide, and can be obtained by a solid phase synthesis method (H. Vu
and B. L. Hirschbein, Tetra
hedron Letters, 32, 3005-30
08 (1991)).

The phosphorodithioate modified product in which both X and Y are S can be obtained by a solid phase synthesis method, for example, by converting bisamidite to thioamidite and reacting with sulfur (WK-D). Brill, e
t. al. J. Am. Chem. Soc. , 111,
2321-2322 (1989)).

The phosphoramidate modified product in which X is a primary amine or a secondary amine can be obtained by a solid phase synthesis method, for example, by treating hydrogen phosphonate with a primary or secondary amine (B. Froehl).
er, et. al. Nucleic Acids Re
s. , 16, 4831-4839 (1988)). Alternatively, it can also be obtained by oxidizing amidite with tert-butyl hydroperoxide (H. Ozak
i, et. al. , Tetrahedron Let
t. , 30, 5899-5902 (1989)).

Purification and confirmation of purity can be carried out by high performance liquid chromatography or polyacrylamide gel electrophoresis. The molecular weight can be confirmed by Electrospras
yIonization Mass Spectrom
entry or Fast Atom Bonbardme
It can be performed by nt-Mass Spectrometry. The antisense oligonucleotide derivative of the present invention is a DNA or mRN encoding human IL-6R.
Any synthetic method or origin may be used as long as it has a sequence that hybridizes to the base sequence of A.

The antisense oligonucleotide derivative of the present invention acts on human IL-6R-producing cells and binds to human IL-6R-encoding DNA or mRNA to inhibit its transcription or translation, IL-6
Suppressing the expression of R results in human IL-6
Has the effect of suppressing the action of. Human IL-suppressed by the antisense oligonucleotide derivative of the present invention
Examples of the action of 6 include a platelet increasing action, an antibody production enhancing action, an acute phase protein inducing action, a tumor cell proliferation action, a nerve cell differentiation action and the like.

Therefore, diseases caused by these actions, for example, renal cancer, myeloma, Rennert T lymphoma, cancer such as Kaposi's sarcoma, autoimmune diseases such as rheumatoid arthritis, mesangial proliferative nephritis, psoriasis, cancer cachexia, The antisense oligonucleotide derivative of the present invention is considered to be effective in treating endotoxin shock in infectious diseases.

The antisense oligonucleotide derivative of the present invention can be mixed with a suitable base material which is inactive against them to be used as an external preparation such as a coating agent and a poultice.
In addition, if necessary, an excipient, a tonicity agent, a solubilizing agent,
Tablets, powders, granules, capsules, liposome capsules, injections, solutions, nasal drops and the like can be further prepared by adding stabilizers, preservatives, soothing agents and the like to freeze-dried preparations. These can be prepared according to a conventional method.

The antisense oligonucleotide derivative of the present invention is applied to the affected area of the patient directly, or is intravascularly administered or the like, and is adapted to the patient so that it can reach the affected area. Furthermore, an antisense encapsulating material that enhances durability and membrane permeability can also be used. For example, liposome, poly-L-lysine, lipid, cholesterol,
Lipofectyl or derivatives thereof may be mentioned. The dose of the antisense oligonucleotide derivative of the present invention can be adjusted appropriately according to the patient's condition and used in a preferable amount. For example, it can be administered in the range of 0.1 to 100 mg / kg, preferably 0.1 to 50 mg / kg.
Hereinafter, the present invention will be described in detail with reference to Examples.

[0033]

EXAMPLES Synthesis Example 1 Synthesis of 5'-GCCGACGGCCAGCAT-3 '(SEQ ID NO: 2) 5 as a human IL-6R antisense oligonucleotide from the start codon of human IL-6 receptor mRNA
15 nucleotides complementary to the codon (GCCGACGG
CCAGCAT) (SEQ ID NO: 2) using a DNA synthesizer (Gene Assembler Plus, Phar).
(manufactured by Macia).

Synthesis Example 2 Synthesis of 5'-GCCGACGGCCAGCAT-3 '(SEQ ID NO: 2) (Phosphorothioate modified product) 5'-Dimethoxytritylthymidine (1 µmol) having a 3'-hydroxyl group bound to a support was used to convert the dimethoxytrityl group. After deprotection with trichloroacetic acid, the 5'-hydroxyl group was condensed with a 5'-dimethoxytrityldeoxyadenosine β-cyanoethylphosphoamidite derivative with tetrazole, and phosphorus was sulfurized with tetraethylthiuram disulfide. Is acetylated with acetic anhydride and dimethylaminopyridine.

Similarly, deprotection, condensation, sulfurization and acetylation are repeated. The final 5'-dimethoxytrityldeoxyguanosine β-cyanoethylphosphoamidite derivative was condensed and sulfurized to obtain a 15-mer phosphorothioate modified product (the above steps were applied.
d Biosystems 381A type DNA synthesizer. ) Is cleaved from the support with 2 ml of concentrated aqueous ammonia, the cyanoethyl group is removed from phosphorus, and the protective groups attached to adenine, guanine and cytosine are removed.

The 5'-dimethoxytrityloligonucleotide phosphorothioate obtained is crude or after purification by high performance liquid chromatography, the 5'-dimethoxy protecting group is removed with 5 ml of trifluoroacetic acid. If necessary, the obtained oligonucleotide phosphorothioate is purified by high performance liquid chromatography,
5'-GCCGACGGGCCAGCAT-3 'of the purpose
(SEQ ID NO: 2) (phosphorothioate modified product) About 2.
09 mg are obtained.

Synthesis Example 3 5'-GCGCAGCCGACGGGCCACAT-
Synthesis of 3 '(SEQ ID NO: 6) (phosphorothioate modified product) In the same manner as in Synthesis Example 1, the desired 5'-GCGCAGCC was synthesized.
About 1.81 mg of GACGGCCAGCAT-3 '(SEQ ID NO: 6) (phosphorothioate modification) is obtained.

Synthesis Example 4 5'-CATGCTTCCCTCCTCGGCTAC-
Synthesis of 3 '(SEQ ID NO: 3) (modified phosphorothioate) In the same manner as in Synthesis Example 2, the desired 5'-CATGCTTC was synthesized.
About 1.96 mg of CTCCTCGGCTAC-3 '(SEQ ID NO: 3) (phosphorothioate modification) is obtained.

Synthesis Example 5 Synthesis of 5'-CATGCTTCCCTCCTCG-3 '(SEQ ID NO: 4) (phosphorothioate modified product) In the same manner as in Synthesis Example 2, the desired 5'-CATGCTTC was synthesized.
About 1.91 mg of CTCCTCCG-3 '(SEQ ID NO: 4) (phosphorothioate modification) is obtained.

Synthesis Example 6 5'-GGCCAGCATGCTTTCCTCCTC-
Synthesis of 3 '(SEQ ID NO: 5) (modified phosphorothioate) In the same manner as in Synthesis Example 2, the desired 5'-GGCCAGCA was synthesized.
About 1.08 mg of TGCTTCCTCCTC-3 '(SEQ ID NO: 5) (phosphorothioate modification) is obtained.

Experimental Example 1 Human Renal Cell Carcinoma Growth Inhibitory Effect The human IL-6 autocrine cancer cell line was used to examine the cancer growth inhibitory effect of the human IL-6R antisense oligonucleotide derivative of the present invention. The human renal cell carcinoma line NC65 established by Schroeder et al. Was used (Hoe
ehn W et al., Invest, Urol. 16,106
-112,1978). RPMI1640 (manufactured by Nissui) supplemented with 2% fetal calf serum (FCS) as a culture solution
Was used.

A 35 mm culture dish containing 1 ml of the culture solution was stored overnight at 37 ° C. in a 5% CO ₂ incubator, and 1 × 10 5 NC65 cells, which were made into single cells by 0.25% trypsin treatment and pipetting. ^I added two each. Human IL-6R antisense oligonucleotides obtained in Synthesis Example 1 after 24 hours (0, 2, 5 and 10 μg
/ Ml) was replaced with 1 ml of the culture solution, and the cells were further cultured for 4 days. A cell mass of 30 or more was defined as a colony, and each number was counted under an inverted microscope. Human IL-6R antisense oligonucleotides showed a suppressive effect on colony formation (Fig. 1).

Experimental Example 2 Human soluble IL-6R (sIL
-6R) expression inhibitory effect Human IL-6R gene (JP-A-2-288898, No. 2
(See FIG. 3 and FIG. 3), an NcoI fragment was prepared and a TAG linker (CATG TAGAGAT) was prepared.
CT) was added to the CHO expression vector pdR (Reference name:
H. Hasegawa, Eur. J. Bioche
m. , 210, 9-12 (1992)) to construct a soluble IL-6R expression vector (pRNDR1).

[0044] The pRNDR1 dhfr ^- in · CHO cells were introduced by the calcium phosphate method, was amplified by MTX. Finally, 1 μM MTX resistant soluble IL-6R producing CHO cells (CHO.RN1) were obtained. This pRNDR
1 is located upstream of the translation initiation codon ATG of SEQ ID NO: 1 (5 '
Side) The soluble IL-6R gene starting from the -26th position is included. The cells were cultured in IMDM medium (manufactured by GIBCO) containing 1% FCS (manufactured by Boehringer Mannheim) and 1 μM MTX.

CHO.RN1 on 96-well culture plate
10 μM of human IL-6R antisense oligonucleotide derivative 7 in 75 μl of culture solution (6.6 × 10 ⁴ cells / ml)
5 μl was added, and the cells were cultured at 37 ° C. in _a 5% CO ₂ incubator. After culturing for 24 hours, the soluble I of the culture supernatant
The amount of L-6R was measured by a sandwich ELISA method using a mouse anti-IL-6R monoclonal antibody (MT-18) (see JP-A-2-288898) and a rabbit anti-IL-6R polyclonal antibody. As a control, only the above culture solution was used for measurement. An antisense oligonucleotide derivative of human IL-6R showed an inhibitory effect on the expression of soluble IL-6R (Fig. 2).

[0046]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 90 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Sequence CTGTCCGCCT CTGCGGGACC ATGGAGTGGT AGCCGAGGAG GAAGC ATG CTG GCC GTC Met Leu Ala Val 1 GGC TGC GCG CTG CTG GCT GCC CTG CTG GCC GCG Gly Cys Ala Leu Leu Ala Ala Leu Leu Ala Ala 5 10 15

SEQ ID NO: 2 Sequence length: 15 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Synthetic DNA Sequence GCCGACGGCC AGCAT 15

SEQ ID NO: 3 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Sequence CATGCTTCCT CCTCGGCTAC 20

SEQ ID NO: 4 Sequence length: 15 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Synthetic DNA Sequence CATGCTTCCT CCTCG 15

SEQ ID NO: 5 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Sequence GGCCAGCATG CTTCCTCCTC 20

SEQ ID NO: 6 Sequence length: 20 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Synthetic DNA Sequence GCGCAGCCGA CGGCCAGCAT 20

[Brief description of drawings]

FIG. 1 is a graph showing that the antisense oligonucleotide of the present invention in Experimental Example 1 suppresses the growth of human renal cell carcinoma line NC65.

FIG. 2 is a graph showing that the antisense oligonucleotide derivative of the present invention in Experimental Example 2 suppresses the expression of soluble IL-6R.

Claims (8)

[Claims] 1. A human IL-6R containing as an active ingredient an antisense oligonucleotide derivative for at least 9 consecutive nucleotide sequences including the translation initiation codon of mRNA encoding human interleukin-6 receptor (human IL-6R). Expression inhibitor. 2. The expression inhibitor according to claim 1, which comprises an antisense oligonucleotide derivative for the translation initiation codon in SEQ ID NO: 1 and the nucleotide sequence downstream thereof. 3. The base sequence is GCCGACGCGCCAGC
The expression inhibitor according to claim 2, which comprises an antisense oligonucleotide derivative which is AT (SEQ ID NO: 2). 4. The expression inhibitor according to claim 1, which comprises an antisense oligonucleotide derivative against the translation initiation codon in SEQ ID NO: 1 and the nucleotide sequence upstream thereof. 5. The base sequence is CATGCTTCCCTCCT.
The expression inhibitor according to claim 4, which is CGGCTAC (SEQ ID NO: 3). 6. The base sequence is CATGCTTCCCTCCT.
The expression inhibitor according to claim 4, which is CG (SEQ ID NO: 4). 7. The expression inhibitor according to claim 1, which comprises an antisense oligonucleotide derivative for the translation initiation codon in SEQ ID NO: 1 and sequences upstream and downstream thereof. 8. The base sequence is GGCCAGCATGCTT
The expression inhibitor according to claim 7, which is CCTCTCC (SEQ ID NO: 5).