JPH0753382A - Gene manifestation inducer - Google Patents

Abstract

PURPOSE:To provide a monocyte swarmer factor gene manifestation inducer useful for preventing and treating e.g., atheromatous arteriosclerosis where accumulation of blood monocytes on foci is recognized, containing, as the active ingredient, specific prostaglandin E1 etc. CONSTITUTION:The objective monocyte swarmer factor gene manifestation inducer containing, as the active ingredient, a prostaglandin E1 of the formula (R<1> is H, a 1-10C alkyl or one equivalent of cation; R<2> is H or methyl; R<3> is a 1-10C alkyl or 3-8C cycloalkyl; n is 0 or 1; X and Y are each CH2 or S, however, not being S at the same time) such as 7-thiaprostaglandin E1 and/or an enantiomorph thereof.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a gene expression inducer.
To do. More specifically, Prostaglandin E ₁Activates
Induction of monosite migration factor gene expression contained as a component
Regarding agents.

[0002]

BACKGROUND OF THE INVENTION Prostaglandins are inhibitors of platelet aggregation, vasodilatory hypotensive action, gastric acid secretion inhibitory action,
It has various physiological effects such as smooth muscle contraction, cytoprotection, and diuresis, and is useful for treatment or prevention of myocardial infarction, angina, arteriosclerosis, hypertension, duodenal ulcer, labor induction, abortion, etc. It is a compound. Among them, prostaglandin E ₁ has a strong platelet aggregation inhibitory action and vasodilatory action, and has already been used clinically.

Among the compounds disclosed in the present specification, 7-thiaprostaglandin E ₁ is a compound already disclosed by the present applicant, and has antithrombotic and antithrombotic effects due to platelet aggregation inhibitory action, antihypertensive action and vasodilatory action. It has been disclosed that it exhibits angina, anti-myocardial infarction, anti-arteriosclerosis, and malignant tumor metastasis-preventing action (JP-A-58-110562). On the other hand, this 7
-Thiaprostaglandins E ₁ are known to be useful for neurosis in diabetes (JP-A-64-5)
No. 2721).

Further, among the compounds disclosed in the present specification, the 5-thiaprostaglandin E ₁ derivative is also a known compound already disclosed by the applicant of the present invention, and is a compound having excellent antitumor activity (Japanese Patent Application Laid-Open Publication No. 2000-242242). (Sho 61-233664).

On the other hand, monosite migration factors such as MCP
-1 / MCAF is a cell-specific chemotactic factor that is produced by T lymphocytes, macrophages, smooth muscle cells, fibroblasts, vascular endothelial cells, etc., and is known as arteriosclerotic lesions, rheumatoid joint lesions, and bones. Progression of inflammation / immune response in lesions by causing accumulation of blood monosites in malignant tumors such as formation site or melanoma
It is known as a factor that is deeply involved in regulation (eg Loenard, EJ and Yoshimura, T. (1990) Immuno.
logy Today Volume 11, pages 97-101, Nelken, NA
Et al., The Journal of Clinical Investigation (199
1) Volume 88, pages 1121-1127, Koch, AE et al.
The Journal of Clinical Investigation (1992)
90, 772-779, Hanazawa, S. et al., The Jo
urnal of Biological Chemistry (1993) No. 268
Vol., 9526-9532, Graves, DT et al., American
Journal of Pathology (1992) Volume 140, 9-
(See page 14, etc.).

Therefore, the expression inducer of the gene is expected to be useful as a therapeutic and / or preventive agent for arteriosclerosis, rheumatoid arthritis, osteoarthritis, etc.
There are no reports of low molecular weight compounds having such gene expression inducing activity.

[0007] Although prostaglandin E compounds are known to affect the expression of various genes (for example, Phipps, RP et al., Immunology Today (199).
1) Volume 12, pages 349-352, Martin, CA et al., Ce
llular Immunology (1991) 135, 245-
258, etc.), monosite migration factor such as MC
There is no report that it has the activity of inducing the gene expression of P-1 / MCAF.

[0008]

The problem to be solved by the present invention is to find a drug that induces the expression of a monosite chemotactic factor gene such as MCP-1 / MCAF.

[0009]

As a result of intensive studies, the present inventors have found that a prostaglandin E ₁ or a pharmacologically acceptable salt thereof is a monosite migration factor such as M.
Having a CP-1 / MCAF gene expression-inducing activity, various diseases in which monosite accumulation in the lesion may be observed, such as atherosclerosis, rheumatoid arthritis, osteoarthritis, bronchial asthma, The inventors have found that they are useful pharmaceutical compounds as therapeutic agents and / or preventive agents for malignant tumors such as melanoma, and completed the present invention.

That is, the present invention provides the following formula [I]:

[0011]

[Chemical 2]

[Wherein R¹Is a hydrogen atom, C₁~ C_TenDirectly
Chain or branched alkyl group or 1 equivalent of cation
Represents the Where R¹Represents 1 equivalent of cation
In the formula, the —COO moiety has a negative charge of 1.
R²Represents a hydrogen atom or a methyl group, R³Is C₁~ C
_TenA linear or branched alkyl group or C₃~ C
₈Represents a cycloalkyl group, and n represents 0 or 1.
X and Y are -CH₂Represents-or a sulfur atom,
XY is not a sulfur atom at the same time. ]
Rostaglandin E₁Active class and / or its enantiomer
Induction of monosite migration factor gene expression contained as a component
It is an agent.

In the above formula [I], R ₁ is a hydrogen atom,
It represents a C _{1 to} C ₁₀ linear or branched alkyl group or 1 equivalent of a cation. Examples of the C ₁ -C ₁₀ alkyl group include methyl, ethyl, n-propyl, iso-
Propyl, n-butyl, sec-butyl, tert-butyl, n-pentyl, n-hexyl, n-heptyl, n
-Octyl, n-nonyl, n-decyl group and the like can be mentioned. Among these, hydrogen atom or C ₁ ~
A C ₄ alkyl group is preferable, and a hydrogen atom and a methyl group are particularly preferable.

As one equivalent of cation, for example, N
Alkali metal cations such as a ⁺ and K ⁺ ; 1 / 2C
Examples thereof include divalent or trivalent metal cations such as a ²⁺ , 1 / 2Mg ²⁺ and 1 / 3Al ³⁺ ; ammonium cations such as ammonium ion and tetramethylammonium ion.

In the above formula [I], R ² represents a hydrogen atom or a methyl group. When R ² is a hydrogen atom, n is preferably 0, and when R ² is a methyl group, n is preferably 1.

In the above formula [I], R ³ is C _{1 to} C _10.
Examples of the linear or branched alkyl group include, for example, methyl, ethyl, n-propyl, iso-propyl, n-butyl, sec-butyl, tert-butyl, n-pentyl, n-hexyl, n -Heptyl, n-
Octyl, n-nonyl, n-decyl, 1-methylpentyl, 1-methylhexyl, 1,1-dimethylpentyl,
Examples thereof include 2-methylpentyl, 2-methylhexyl, 5-methylhexyl, and 2,5-dimethylhexyl groups. Among these, C ₃ -C ₈ alkyl groups are preferable, and particularly n-butyl, n-pentyl, n-hexyl, (2R) -2-methylhexyl, (2S) -2-
A methylhexyl or 2-methylhexyl group is preferred.

When R ³ represents a C ₃ -C ₈ cycloalkyl group, it includes cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl groups, and among them, cyclopentyl and cyclohexyl groups are preferred. To be

In the above formula [I], when n is 0 and the carbon at the 15-position is an asymmetric carbon, the steric configuration is preferably the S configuration, and when n is 1 and the carbon at the 16-position is asymmetric. In the case of carbon, the configuration may be either S configuration or R configuration, but more preferably S configuration.

The configuration of the double bond between the 13th carbon and the 14th carbon in the above formula [I] is E
Arrangement.

The configurations of the 8-, 11- and 12-positions of the prostaglandin E ₁ 's represented by the above formula [I] are the same as the natural prostaglandin E ₁ . Prostaglandins E _{1 according} to the present invention have such a configuration,
Or its enantiomer, or a mixture thereof in any proportion. However, a mixture of prostaglandin E ₁ such that the relationship of prostaglandin E ₁ compound and diastereomers having such configuration and the proportion any of them are also monocyte chemoattractant protein, for example MCP-1 / MC
It has an activity of inducing gene expression of AF.

Specific preferred examples of the prostaglandin E ₁ used in the present invention are as follows. (1) Prostaglandin E ₁ (2) 7-thiaprostaglandin E ₁ (3) 16-methyl-7-thiaprostaglandin E
₁ (4) 17,20-Dimethyl-7-thiaprostaglandin E ₁ (5) Compound (4) (17R) form (6) Compound (4) (17S) form (7) 20-Methyl-7 ―Ciaprostaglandin E
₁ (8) 15-Methyl-7-thiaprostaglandin E
₁ (9) 16,16-Dimethyl-7-thiaprostaglandin E ₁ (10) 16,17,18,19,20-Pentanor-15-cyclopentyl-7-thiaprostaglandin E ₁ (11) 16, 17,18,19,20-Pentanol-15-cyclohexyl-7-thiaprostaglandin E ₁ (12) 15-deoxy-16-hydroxy-16-
Methyl-7-thiaprostaglandin E ₁ (13) Compound (12) (16R) body (14) Compound (12) (16S) body (15) 5-Thiaprostaglandin E ₁ (16) 16- Methyl-5-thiaprostaglandin E ₁ (17) 17,20-Dimethyl-5-thiaprostaglandin E ₁ (18) Compound (17) (17R) form (19) Compound (17) (17S) Body (20) 20-Methyl-5-thiaprostaglandin E ₁ (21) 15-Methyl-5-thiaprostaglandin E ₁ (22) 16,16-Dimethyl-5-thiaprostaglandin E ₁ (23 ) 16,17,18,19,20-Pentanor-15-cyclopentyl-5-thiaprostaglandin E ₁ (24) 16,17,18,19,20-Pentanor-15-si Chlohexyl-5-thiaprostaglandin E ₁ (25) 15-deoxy-16-hydroxy-16-
Methyl-5-thiaprostaglandin E ₁ (26) (16R) form of compound (25) (27) (16S) form of compound (25) (28) Methyl ester form of compounds (1) to (27) ( 29) Ethyl ester form of compounds (1) to (27) (30) Tert-butyl ester form of compounds (1) to (27) (31) Sodium salt of compounds (1) to (27) (32) Compound ( 1)-(27) potassium salt (33) compound (1)-(27) magnesium salt (34) compound (1)-(27) ammonium salt

Of the prostaglandins E ₁ of the present invention, prostaglandins E ₁ are already known compounds. The 7-thiaprostaglandin E _1's are produced by the method separately invented by the applicant. For example, JP-A-57
-108065, JP-A-58-110562 and the like. The 5-thiaprostaglandins E ₁ are produced by the method separately invented by the applicant. For example, JP-A-58-198466, JP-A-59-122462, and JP-A-61-2336.
This is described in detail in Japanese Patent Laid-Open No. 64 and the like.

The prostaglandins E _{1 according} to the present invention are, as shown in Examples, monosite chemotactic factors,
For example, it was found to have an activity of inducing the gene expression of MCP-1 / MCAF. Therefore, if administered prostaglandin E ₁ compound having such activity to a living body, T
Lymphocytes, macrophages, smooth muscle cells, fibroblasts,
It can act on various cells including vascular endothelial cells and induce the production of monocytic chemotactic factor in the cells.
As a result, the cells have the effect of migrating / activating blood monosites, and thus the accumulation of blood monosites locally,
Alternatively, it may be possible to control the local inflammatory / immune response. In addition, MCP-1 / MC of blood monosite itself
By inducing the production of a monosite chemotactic factor such as AF, the degree of activation of the blood monosite and the migratory ability can be changed.

From the above, the monosite migration factor gene expression inducer of the present invention can be used as a therapeutic and / or prophylactic agent for various diseases in which accumulation of blood monosites in the lesion may be observed. .

[0025]

EXAMPLES Hereinafter, according to examples, prostaglandin E
Class ₁ is a monosite chemotactic factor such as MCP-1 / MC
It is shown to be a gene expression inducer of AF. However,
The present invention is not limited to these examples.

[0026]

Example 1 Peripheral blood-derived cell line T of an acute monocytic leukemia patient
10 HP-1 cells (ATCC registration number TIB203)
% 1 in RPMI 1640 medium supplemented with% fetal bovine serum
0 were suspended at ⁶ / ml. Next, this cell suspension was added to a 96-well plate at 200 μm per well.
Dispense 1 liter each, and then add prostaglandin E to each well.
₁ solution was added in 2μl to a final concentration of ^{10 -5 M, 10 -6 M,} 10 -7 M and 10 ^-8 M to, 37 ° C. in 5% CO ₂ incubator and incubated for 30 minutes. Then, lipopolysaccharide (LPS, E. coli 011
1: B4, purchased from CALBIOCHEM) 2 μl of aqueous solution was added so that the final concentration was 1 μg / ml,
Further, the cells were cultured in a 5% CO ₂ incubator at 37 ° C for 24 hours.

Then, the cultured cells were recovered by pipetting and pelletized by centrifugation at 12,000 rpm for 30 seconds, and then RNA extraction reagent, RNAzo.
1B [registered trademark, Cosmo Bio Inc.]
homczynsk et al. (Analytical Biochem., No. 162)
RNA was extracted according to Vol. 156-159, 1987).

Next, the method of Thomas Lion et al. (Analytical B
iochemistry Volume 188, 335-337, 1990
Year)), using a substrate to which DIG-dUTP [digoxigenin deoxyuridine triphosphate, Boehringa Mannheim Yamanouchi Co., Ltd.] was added, cDNA was synthesized, and then human MCP-1 mRNA-derived cD was prepared by PCR.
NA was amplified. The DNA primer used was a known human MCP-1 cDNA sequence (T. Yoshimura et al.,
FEBS LETTERS Volume 244, 487-49
5'-AAA, based on page 3, 1989).
GTCTCTGCCGCCCCTCTG and 5'-T
TGGGTTTGCTTGTCCAGGGTG, 2
It is capable of amplifying a 82 bp length.

The amplified sample was subjected to agarose gel electrophoresis, blotted on a nylon membrane, and the obtained nylon membrane was reacted with an alkaline phosphatase-labeled anti-DIG antibody [manufactured by Boehringa Mannheim Yamanouchi Co., Ltd.], followed by chemiluminescence. The substrate Lumi-PPD530 [manufactured by Boehringa Mannheim Yamanouchi Co., Ltd.] was added, and after 30 minutes, the film was exposed to an X-ray film for 20 minutes. The peak area obtained by subjecting it to a densitometer and measuring OD650 nm is shown in Table 1 as the MCP-1 gene expression level.

[0030]

[Table 1]

As shown in Table 1, prostaglandin E
₁ is MCP-at a final concentration of 10 ⁻⁵ M to 10 ⁻⁸ M.
It has the activity of inducing the expression of one gene 4 to 5 times.

[0032]

EXAMPLE 2 Test compound in place of prostaglandin E ₁ 1 (15-deoxy-16-hydroxy-16-methyl-7-thia-prostaglandin E ₁ methyl ester) was exactly the same as in Example 1 by using The results of the tests are shown in Table 2.

[0033]

[Table 2]

[0034]

Example 3 Instead of prostaglandin E ₁ , test compound 2 ((17R) -17,20-dimethyl-7-thiaprostaglandin E ₁ methyl ester), test compound 3 ((16S) -15- Deoxy-16-hydroxy-16-methyl-5-thiaprostaglandin E ₁ methyl ester) was used to perform the same test as in Example 1 and the results are shown in Table 3.

[0035]

[Table 3]

[0036]

[Example 4] Under the conditions described in Example 1, L
Table 4 shows the results obtained by performing the different operations except that PS was not added. It can be seen that prostaglandin E ₁ has an activity of inducing MCP-1 gene expression even when LPS is not added.

[0037]

[Table 4]

[0038]

INDUSTRIAL APPLICABILITY The gene expression inducer of the present invention shows that accumulation of blood monosites in the lesions of malignant tumors such as atherosclerosis, rheumatoid arthritis, osteoarthritis and melanoma is recognized. It can be used as a preventive or therapeutic agent for a certain disease.

Claims (8)

[Claims] 1. The following formula [I]: [In the formula, R ¹ represents a hydrogen atom, a C _{1 to} C ₁₀ linear or branched alkyl group, or 1 equivalent of a cation. R
² represents a hydrogen atom or a methyl group, and R ³ is C _{1 to} C ₁₀
A straight-chain or branched alkyl group or C ₃ -C ₈
Represents a cycloalkyl group, and n represents 0 or 1.
X and Y represent —CH ₂ — or a sulfur atom,
XY is not a sulfur atom at the same time. ] A monosite chemotactic factor gene expression inducer containing the prostaglandin E ₁ and / or its enantiomer represented by the following as an active ingredient. 2. The monosite migration factor is MCP-1 / MC.
The monosite migration factor gene expression inducer according to claim 1, which is AF. 3. The monosite migration factor gene expression inducer according to claim 1, wherein R ¹ in the above formula [I] is a hydrogen atom or a methyl group. 4. The monosite chemotactic factor gene expression inducer according to claim 1, wherein R ² in the above formula [I] is a hydrogen atom. 5. In the above formula [I], n is 0 and R is
5. The monosite chemotactic factor gene expression inducer according to claim 1, wherein ³ is a pentyl group or a 2-methylhexyl group. 6. The monosite chemotactic factor according to any one of claims 1 to 5, wherein the carbon to which R ² is bound in the above formula [I] is an asymmetric carbon and the absolute configuration is the S configuration. Gene expression inducer. 7. The monosite migration factor gene expression inducer according to claim 1, wherein R ² in the above formula [I] is a methyl group. 8. In the above formula [I], n is 1 and R ³
Is a butyl group, The monosite migration factor gene expression inducer according to any one of claims 1 to 4 or 7.