JPH07509136A - Enrichment and identification of fetal cells in maternal blood for in situ (IN SITU) hybridization - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Maternal blood for in situ (IN 5 ITU) hybridization Technological field for enrichment and identification of fetal cells in The present invention provides a method for enriching fetal cells in maternal blood and a method for identifying such fetal cells. (about how to do it). Furthermore, such cells may be used to develop nucleic acid autologs for medical reasons. For example, to identify the gender of the fetus, or detect any inherited abnormalities in fetal cells. In-situ technology for detecting sexual or viral infections The present invention relates to a method of using a test object in hybridization.

Background technology The sex of a human fetus, the number of abnormal chromosomes in certain fetuses, etc. Direct testing with cell genetic analysis or nucleic acid analysis can be used to detect specific DNA sequences in chromosomes. It was usually detected or confirmed by investigating the A test like this once is a live animal harvested during an outpatient surgical procedure that poses some risk to the mother or fetus. It was necessary to culture the cells.

Such cells, detached from the fetus, can be obtained by amniocentesis. Amniocentesis is This involves inserting a needle through the abdominal wall into the uterus and removing a small amount of amniotic fluid. one more The method involves passing a catheter into the neck or abdomen and collecting villous tissue from the surface of the placenta. This is a method to However, if spontaneous miscarriage or other serious events occur, the amniotic fluid may The risk of this occurring is 0.5% with the puncture method and 1% with the chorionic villus sampling method. amniocentesis or velvet Fetal cells collected through hair harvesting are usually grown in culture for several days and then tested for abnormalities. do.

Characterization of various types of fetal cells was performed. Fetal cells are fetal red blood cells, phosphorus including, but not limited to, trophoblasts and trophoblasts.

Trophoblast (trophoblast) is cytotrophoblast, syndithiotrophoblast (syncytial vegetative cells), cells taken from embryos cultured in test tubes (in vitro fertilization techniques) etc. The word erythrocyte (red blood cell) used here is especially Unless otherwise specified, includes not only red blood cells but also erythroblasts, normoblasts, and reticulocytes. There is.

It is known that small amounts of fetal cells circulate in the mother's blood. maternal circulation Approximately 1 in 4,000 to 7,000 fetal red blood cells is fetal nucleated in the blood. They are red blood cells. Methods for detecting certain fetal cells and/or transferring them to maternal blood A method of separating it from liquid has been reported. For example, S. C. Yeoh et al., Pren. atal Diagnosis 11: 117-123 (1991); U.W. Mueller et al. Lancet 336: 197200 (19 90); PCT Publication No, Wo.

91107660 Infant Medical Center Company, PCTPublication n No, Wo, 91/16452 Ce1lpro Co., Ltd.; US Patent No, 5,153, 117, etc.

For background on nucleic acid genetic testing methods, see, for example, P.G., McDonough, Se. g+, Perinatol, 9:250-256 (195B).

G, Butler et al., Fertility g 5terility 5 1: See 375-386, etc.

Nucleic acid hybridization technology is the process by which single-stranded DNA or RNA is linked to a complementary nucleus. It is based on the ability to pair, or hybridize, with acid chains. Ru. This hybridization reaction involves the production of specific probes or probe populations. This led to the development of specificity genes (DNA), or polynucleotides. Enables to identify sequences, or the transcription and expression of those genes (RNA) .

Using specific nucleic acid (RNA or DNA) probes to determine the sex of the fetus or genetic markers for other fetal genetic characteristics, or for infections or other pathological conditions. The corresponding marker can be detected. Certain genetic diseases are caused by genes that are not present in normal tissues. The presence of children is characteristic. Other pathological conditions are caused by RNA that is not expressed in normal cells. 5 or by the expression of RNA translation substances (i.e. peptinoids or proteins) Some things can be characterized. Some pathological conditions are caused by certain genes or parts of genes. characterized by the absence or altered expression of gene products or proteins.

Furthermore, the gender of animal fetuses, such as cow fetuses, can be characterized in the same way as humans. is often desired.

Before the hybridization reaction, it is necessary to disrupt the cells and separate the nucleic acids from the cells. Solution hybridization methods that require cell integrity, three-dimensional partitioning, and detection sacrificing the acuity of Relatively easy to isolate, such as fetal cells circulating in the mother's blood Solution hybridization methods are not possible when only small amounts of cells are available. be.

Nucleic acid amplification, such as by polymerase chain reaction, is a known technique, but It has certain known drawbacks that hinder performance and efficiency. For example, this kind of technology causes cell lysis and gives false positives due to the sensitivity of this technique, resulting in low copy number In order to detect the target, a high level of amplification is required and specific There is a danger that you will lose your sexuality. Further hybridization of the amplified target is required. When amplifying in any case, many time-consuming steps are required. Become.

In situ hybridization is performed at the single cell level. provides techniques for the identification and quantification of nucleic acids (DNA and RNA) in tissues. This way The hybridization technique identifies specific genes at the single cell level. It can also be used to detect the presence or absence of genes and the expression of gene products.

In 5iLu hybridization is covered by US Patent No.

No. 5.225,326 and pending U.S. Patent No. 1iJ No. 07/668.751. has been done.

Disclosures of each patent, applied patent, and published literature specified in this application specification can be found in the bibliography. I stopped it and showed it.

Despite the previously mentioned findings, prior art methods do not allow for invasive damage to the maternal uterus. A true test for determining the sex of a fetus or detecting fetal abnormalities on a normal basis without lacks a quick, incisive, efficient and practical way to Therefore, the present invention This fulfills a long-held desire in the field.

Disclosure of invention Among a series of embodiments of the invention, a method for identifying the sex of a fetus in a subject is provided. . In these specific examples, the cells may be derived from maternal peripheral blood, maternal blood, villus samples, etc. It can be collected from Cell samples can be used as is or as described elsewhere. Fetal cells may be expanded and enriched (ie, increased by 4 degrees) prior to analysis. Thin Cells may be fixed with conventional precipitating fixatives or cross-linking fixatives; You can use it for subsequent tests without doing anything. Operates like a microscope slide glass This can be done with cells placed on a solid solid support, or with cells suspended. Prior to use, wash the cells in suspension with chilled PBS to ensure a single-cell suspension. May be mixed thoroughly to form a liquid.

This method consists of two steps: obtaining a specimen containing fetal cells, and maternal cells coexisting in the sample. Detecting a marker that identifies fetal cells from the cells.

In accordance with the present invention, the most preferred method of identifying cells as fetal cells is The presence of RNA for fetal proteins such as moglobin (HbF) and α-feto1 white matter It is to detect. Such RNA is usually metsenger RNA (mRNA). ), but instead or in addition, heterologous cell nuclear RNA (hnRN A) and liposomal RNA (rRNA). This means that fetal protein This shows that white matter genes are transcribed and expressed. This detection is in 5 It is preferable to perform hybridization in a substantially intact cell membrane. It is also desirable to use synthetic NA probes directed toward fetal protein RNA. Yes.

In a preferred embodiment, a synthetic NA probe is used, and the probe is imbued with a dye fluorophore. are attached by covalent bonds. The intracellular fetal cell-specific RNA of this probe and The binding can be seen under a microscope as bright fluorescence or detected on a fluorometer. It can also be detected. Here, ``fluorescence'' refers to irradiation with a wavelength different from the emitted wavelength. This refers to the detectable radiation emitted when excited by The radiation caused by excitation is usually ultraviolet radiation. Visible light, but also infrared radiation or other electromagnetic radiation.

Another preferred embodiment is direct labeling or alkaline phosphatase-like This method uses a synthetic NA probe that is indirectly labeled with a specific enzyme. fetal RNA and This binding to the probe is caused by a reaction between a detectable substance (e.g. NBT and BCIP). , a blue or purple solid precipitates) is reacted with a substrate that can be seen under a microscope. Rukoto can.

The information obtained from such assays, as discussed more specifically below, Fetal hemoglobulin based on the number of fetal red blood cells detected as well as for example, the amount of fetal-maternal blood loss in the case of Rh incompatibility. throw The amount of specific gamma globulin containing anti-Rh(D) to be given is calculated from this measurement. suppresses the mother's immune response to fetal red blood cells entering the mother's blood circulation system. do.

Another embodiment of the invention provides for the presence of at least two different RNAs in a cell. It is to detect the presence of the object. Fetal cells usually contain no specific mRNA species. It has a unique mRNA5 or mRNA species produced. These RNA5 Detection can be performed as metsenger RNA5 or as heteronuclear RNA5 (hnRN cells or single cell fractions, regardless of whether they are detected as As). There are certain populations of RNA that help to identify them as developmentally fetal or embryonic. For example, hemoglobin in fetal red blood cell nuclei), Other fetal-specific or embryo-specific RNA5 is either one or fetal-specific. Even when considered as a population of RNA5, only small amounts are present. More RNA Seeds can be produced in certain maternal cells regardless of whether they are produced in certain fetal cells. is possible. However, if the maternal cells of the same source are Even when they do not have two RNA species, fetal cells can contain two or more specific species within the same cell. The situation is such that it expresses RNA5. Same - many mRNAs at the same time in a cell The ability to detect hnRNA species in non-fetal cells (e.g. maternal) to increase the ability to identify fetal cells and detect specific signals like no other. It provides a means of linking the signals produced when RNA5 is present and that will identify unique fetal cells.

Another way to identify fetal cells is to identify which fetal cells are present in the sample. The aim is to detect substances that are not present in maternal blood cells. Especially effective for such detection. One such substance is cytokeratin, which can be detected using antibodies against it. I can do it. Another such substance is the peptide fetal hemoglobin, which dye substances such as acidic hemadoxylin and eosin B (e.g. Sigma D iagnostics, P, 0. 14508, SL, I-ouis, M0 63178, cat, no.

285,) and antibodies against fetal hemoglobulin.

However, yet another method for identifying fetal cells is The purpose of this method is to detect a single RNA present in the host. This RNA is a nucleic acid hybrid Veptinodes can be detected by antibody binding or staining. I can put it out.

A further embodiment of the invention provides that the fetal cells in the subject are Includes cell ratio enrichment methods.

Such enrichment is preferably caused by selective removal of maternal cells. , for example, has a ligand that can be selectively removed from the sample. This occurs by bringing a sample into contact with surface components of cells. The ligand is maternal blood Preferably, the antibody is an antibody against an antigen normally present in fluid cells. liquid holding the sample The ligand is preferably bound to a solid matrix for separation from the body. . Preferably the matrix is a magnetic bead. The matrix is also a cell It may also be in the form of a column through which the membrane FAfi passes.

In a preferred embodiment, the antibody comprises a monoclonal antibody directed against CD45. . This antibody is a normal antibody of human white blood cells of the isotype expressed on all white blood cells. (LCA) selectively binds to epitopes expressed in all family members. fetal Preferably, red blood cells are enriched in this way.

Other antibodies that can be used with or in place of anti-CD-45 include anti-CD-45. -13, anti-CD-34, anti-CD-44 and anti-CD-31. Preferably, use The amount of antibody applied is approximately 2 to 20 μg per million white blood cells in the sample.

Alternatively, or in addition to the above method, fetal cells may be concentrated by density gradient centrifugation. can be enhanced (enriched). Fetal red blood cells, lymphocytes, and trophoblasts (trophoblast) is preferably enriched in this way. Subsequently, fetal cells are usually It is detected as described above.

Another embodiment of the invention provides a new method for identifying fetal cells in a subject. Ru. This method involves collecting a sample containing fetal cells and using an instrument to detect a fluorescent label. ! It includes a step of pre-labeling fetal cells with (label). Next, this fetal thin Concentrate (enrich) the cells by flow cytometry.

In another embodiment of the invention, the nucleic acid of a fetal cell having a substantially intact cell membrane is A new method for detecting sequences using in 5 ita hybridization method is provided. This method isolates the fetal cells from a precipitating agent and a cross-linking agent. Fix with mediram containing at least one drug selected from the group of The fixed sample is treated with denaturants, hybrid stabilizers, buffers, and selective pore formation agents. and a nucleotide at least substantially complementary to the target nucleotide sequence to be detected. A compound consisting of a single synthetic oligonucleotide block with a rheotide sequence. It consists of a step of contacting with an hybridization solution. This contact is at least In the presence of one detectable label, at temperatures of 15°C to 80°C, about 5 to 2 Hybridization is carried out for 40 minutes.

Hybridization is then detected with the aforementioned label.

Further embodiments of the invention provide nucleic acid sequences of fetal cells having substantially intact cell membranes. We propose a new method for detecting I'm offering it. This method involves treating the fetal cells with a denaturing agent, a hybrid stabilizing agent, a buffer, etc. , a membrane pore forming agent and at least one target nucleotide sequence to be detected. One synthetic oligonucleotide sequence with substantially complementary nucleotide sequences contacting the aforementioned fetal cells with a solution consisting of (both in the presence of one detection label), then hybridize using the above-mentioned label. The method consists of a step of detecting the formation of a pad. Hybridization medium is a fixative May include.

Yet another embodiment of the present invention provides a key 7) for identifying fetal cells in a subject. provide

In another embodiment of the invention, a kit is provided for enriching fetal cells in a blood sample. provide This involves creating a density gradient to isolate the fetal cells of interest. Ru.

Further, in another embodiment of the present invention, a specimen such as maternal peripheral blood is preferably used. developed a new kit to enrich fetal cells and detect nucleic acid sequences in these fetal cells. provide.

This kit 4L - contains cell surface antibodies present on many or all adult white blood cells. Contains stakes for the field. This antibody is then attached to a matrix that facilitates separation. Can be combined. This kit also includes denaturants, hybrid stabilizers, It contains a hybridization solution containing a buffer and a pore platoon forming agent. moreover This kit is capable of hybridizing with the target fetal RNA nucleotide sequence. Contains a supply of oligonucleotide probes. This kind of kit is also suitable for Another alternative detection probe that can hybridize to nucleic acid sequences of therapeutic interest. It is an advantage to have a

Various types of fetal cells are characterized by their cell morphology. In a preferred embodiment , the present invention relates to fetal nucleated red blood cells. Alternatively, the present invention provides fetal trophoblasts. It can contain a blast (trophoblast), and the term fetal trophoblast is Totrophoblast (cytotrophoblast) and syndithiotrophoblast (syncytiotrophoblast) Fetal cells, including cells), can be isolated from the mother by ligand binding to maternal cells or by density gradient centrifugation. It can be isolated from the body's peripheral blood. However, the process of the present invention requires maternal peripheral blood Percutaneous sampling of blood from the umbilical cord, amniotic fluid, etc. Any sample obtained by puncture, villus sampling or other methods may be used.

Following the enrichment of fetal cells as described above, cells can be used to recognize fetal cell antigens, For example, staining with labeled antibodies against cytokeratin or fetal hemoglobin. color, staining for fetal hemoglobin, or preferably For the sequence of Metsenger RNA (mRNA), which is present in the cells and absent in the maternal blood cells. In 5 in situ hybridization method using DNA probe, mother Can be recognized or separated from somatic cells.

Various antibodies are used to distinguish between fetal and maternal cells. fluorescent label attached The use of antibodies against cytokeratins according to the present invention tion method and is particularly desirable.

However, the preferred method according to the invention uses a probe to collect blood from the mother's peripheral blood. On cells obtained from the in 5 under conditions that select for the trigger RNA (mRNA) hair ring sequence. The iLu hybridization method is used.

According to the present invention, the mRNA for fetal hemoglobin (HbF) is In particular, this type of cell is highly sensitive to detection by hybridization method. It turned out to be a good marker.

Alternatively, the present invention can be applied to fetal cells cultured (fertilized) in vitro. It may also include products of conception, which do not need to be separated or identified from the maternal cells. can.

The advantage of hybridization techniques in preferred embodiments of the invention is that genetic under similar conditions (preferably the same) as when detecting child or virus DNA. , it is possible to perform hybridization to detect fetal mRNA sequences. . Furthermore, in the most preferred embodiment, a probe for mRNA and a probe for DNA General incubation in which the probe is present in the hybrid probe tail This means that only one process is required.

In the in 5 ita hybridization technology of the present invention, one of - cells Even individual genetic abnormalities can be detected. According to the invention, incubation is approximately The time is preferably 120 minutes or less, and the time is preferably between about 5 and 30 minutes. If the number of bases is 15 If you try to detect genetic abnormalities below 0.00, it will take a long time to obtain the required results. Incubation time increases and may even exceed 240 minutes.

Another aspect of the present invention is to treat genetic abnormalities such as additions, deletions, translocations, rearrangements, etc. They are characterized as nucleotide sequences of about 15 base pairs, but they are difficult to detect. That is.

From this point of view, the present invention is not limited to the detection of such genetic abnormalities in fetal cells. However, the invention also applies to nucleic acids obtained from virtually any other source. has a target nucleic acid molecule Cells refer to eukaryotic cells (e.g., blood, skin, bones, lungs, nervous system, liver, uterus, , human cells such as the prostate gland, mucous membranes, or any ectoderm, mesoderm, or endoderm in general. prokaryotic cells (e.g. bacteria), plant cells, and any other type of Cells from the pool may be used. They can be a single eukaryotic cell like yeast, or a human Furthermore, the present invention provides a method for eukaryotic cell complexes such as those obtained from cellular D. Like NA and RNA, it is used to identify strains of various viruses. In that case , the target strand of nucleic acid can be used for uncoated viruses or coated viruses (lipid-protein membranes). (with an uncoated membrane such as ).

Brief description of the drawing Figure 1 shows the numbers of chromosomes X, Y, and 18 in a normal male amniocyte (amniotic fluid cell). We demonstrate the use of in 5 in situ hybridization to do this.

Figure 2 shows a method for simultaneously detecting the X and Y chromosomes of amniocytes and white blood cells. shows the law.

Figure 3 shows a preferred technique for enriching fetal red blood cells from maternal blood according to the present invention. A schematic diagram is shown.

Figure 4 shows the enrichment of fetal trophoblasts from maternal blood according to the present invention. A systematic diagram of the technology used is preferably shown.

Figure 5 shows the mesosensor R of fetal hemoglobin used to identify fetal red blood cells. The use of probes for NA is shown.

Figure 6 shows the use of anti-cytokeratin antibodies to identify fetal cells in maternal blood. It shows.

Figure 7 shows detection of the Y chromosome in fetal trophoblasts. It is anti It was identified using a cytokeratin antibody and isolated from maternal blood.

Figure 8 shows placental trophoblasts identified using anti-cytokeratin antibodies. In order to measure the number of chromosomes X, Y and 18 in the layer), in5iLu hybrid Indicates the use of daization.

Figure 9 shows the use of fetal cell-specific mRNA to identify amniocytes and trophoblasts. In contrast, we demonstrate the use of an in 5 in situ hybridization method.

Figure 1O shows fetal cell-specific mRNA and chromosomes X and Y in fetal red blood cells. 5iLu - Indicates the use of hybridization method.

BEST MODE FOR CARRYING OUT THE INVENTION The methods of the invention can be used to identify fetal cells in a wide variety of subjects.

Typical examples of such samples include maternal peripheral blood, placental tissue, villi, amniotic fluid and fetal It is a sexual (embryonic) tissue. For the reasons mentioned earlier, maternal peripheral blood is the preferred sample. Yes, previously, maternal cells (which would interfere with the measurement of any fetal nucleic acids) and the fetus Obtaining reliable and consistent results is most difficult due to the high cell-to-cell ratio. It was.

The methods of the invention can be used to detect the number of fetal cells in a subject. This way Typical examples of fetal cells include trophoblasts and eukaryotic red blood cells. (erythrocyLes), fetal epithelial cells, fetal mesothelial cells, fetal lymphocytes Contains lymphocytes and embryonic germ cells.

The method of the invention involves determining the sequence of fetal cell-specific polynucleotides in fetal cells; is an oligonucleotide and can be used to detect. This does not limit the invention. The new method of the present invention can detect chromosomes in viruses or fetal cells.

Typical examples of viruses that can be detected by the present invention are human immunodeficiency virus, liver These are the flame virus and the herpes virus. Typical examples of chromosomes detected by this invention are , human X chromosome, Y chromosome and 1.13.16.18.21 chromosome.

The sensitivity of the in 5 ita hybridization technology of the present invention is Visual (naked eye) and photographic detection of a single copy of one gene sequence present in It is possible to do this.

By way of non-limiting example, each probe of approximately 25 bases in length may be tagged with one fluorophore. A gene sequence of approximately 6,000 bases was obtained using a standard fluorescence microscope. You can certainly detect it by looking closely. - Attaching four fluorophores to the probe results in At the incubation time specified here, the presence or absence of a gene sequence of about 1500 bases can be determined. Can be detected reliably. Furthermore, double-stranded nucleic acid ``sensitization J'' (se (nse) strand and “anti-sense J (anti-sense) strand” If you use a probe against the corresponding sequence of It is possible to detect the presence or absence of a short sequence of about 750 base pairs within the time it takes to scan. or Image analysis methods may also be able to detect substances as short as 15 to 20 base pairs.

Similarly, if a virus such as human immunodeficiency virus (HIV) When the cells become infected, the virus incolates with the nucleic acid sequences of the fetal cells. The sexual nucleic acid (RNA or DNA) is the in 5 in situ hybridization method of the present invention. can be detected using fusion technology.

The present invention uses a single cell sample and can test many targets simultaneously. this thing provides maximum information from a single sample and is ideal for large numbers of fetal cell samples. Minimizes the need for cell purity and fractionation, thus increasing safety for both mother and fetus. Minimize the necessity.

-■ from day 1 To identify fetal cells and detect genetic abnormalities within fetal cells, fetal cells can be extracted from maternal cells. need to be separated and identified. This requirement is due to This is especially necessary when taking cell samples from peripheral blood. Overall, the accuracy of fetal cells Any method that ensures accurate separation and identification can be used in the method of the present invention. come. A technically skilled person (person of ordinary skill in the art) can determine positive (positive) and negative (absent) antibodies. It will be appreciated that this separation method can be used for the identification and fractionation of fetal cells. The positive and negative separations using antibodies are those that specifically bind to fetal cell antigens. antibodies that do not bind to maternal cell antigens (positive separation), and antibodies that do not bind to maternal cell antigens (positive separation). Contains antibodies that specifically bind and do not specifically bind to fetal cell antigens (negative fraction #).

This antibody can be attached to a number of solid surfaces or support materials by physical or chemical bonding. Attach to substrates such as containers, columns, holes, beads and spheres (particles).

On the other hand, antibodies can bind to substances that facilitate selective separation steps. For example, antibodies can be labeled with a fluorescent marker and placed in a cell sorter using standard procedures. Can be separated.

Generally, such antibodies are administered in an amount of approximately 2-20 μg per million target cells. Effective when used. That is, the antibodies that recognize and bind to leukocytes are Add the above amount based on the number of white blood cells in the sample. On the other hand, it recognizes and nourishes Antibodies that bind to the blastema are selected based on the expected number of trophoblasts in the sample, as described above. Add quantity.

In a preferred embodiment of the invention, negative separation is used. A particularly preferred negative separation is This is done using an antibody against CD45.

After this, anti-CD45 selectively binds to leukocytes.

Anti-CD45 is conveniently attached to a solid support such as magnetic beads. and that Place in a test tube and shake together with the sample. Then, under the action of a magnetic field, one side of the test tube is magnetized. The beads are brought together and the liquid containing the unbound sample is removed between them.

Such beads are anti-CD45 immunomagnetic beads, Catalog No. 1178. ．． Awac, Inc., 1608B Larrabee Road, Webb r.

Available as ok, ME 04092.

On the other hand, Calibiochem, 10933 N, Torrey P ines Road, La Jolla, CA, uncoated catalo Product No. 400995, Catalog of products coated with streptavidin Immune magnetic beads are available as No. 400996.

It is desirable that such beads be removed from fetal cells (negative selection is used). (when positive selection is used) or desired to be enriched (when positive selection is used). Antibodies against cell surface antigens found on cell types such as fetal cells; user can coat. Another bead coated with antibody is an aqueous suspension of iron oxide particles coated to provide boxyl groups, and It can form covalent bonds with biochemically active molecules.

This bead and instruction manual are from BioMag Carboxyl Terminat. ed, catalog no. 8-4125. Advanced MagneL ics, Inc., Cambridge MA (617) 497-2070 It can be used as

If desired, white blood cells may be CD45. CD13. Binding with antibodies against CD34 It is much more effectively removed when Anti-CD44 also targets contaminated maternal red blood cells. included in the mixture to remove. Addition of anti-CD31 eliminates contaminated platelets. Can be specifically removed. Such antibodies are available from a variety of sources. Ama c, Inc. (see above), Becton Dickinson, Fran Klin Lakes, NJ 07417-1884. Zyi+ed Labo ratories II Inc., 458 Carlton Court, 5 out h　5anFrancisco, CA.

Reference Zy++ed's 1992 catalog p. 10-1 and p. 71-72. below See also, W. Knapp, 401 in 1 of 11 White, Worksheet. Yongbu and Conference, 0xford UniversityLy Press, 1989; D, F. Keren, Flow cytometry in mackerel, p. 41-87 ASCP Press, Chicago, 1989゜Fetal cells are from the mother Separated from body peripheral blood by density gradient centrifugation (separation) or flow cytometry. I can let go. For example, first, by using an antibody labeled specifically for the antigen of fetal cells, For example, synthetic oligonucleotides that can hybridize to fetal cell RNA. ・Using flow cytometry with nucleic acid specific probes such as probes, Can identify and classify fetal cells.

A day of blood...Blood' Figure 3 shows an example of separation of fetal nucleated red blood cells (erythrocytes), consisting of parts 3A and 3B. It was shown to. Each step is explained graphically in a numbered box, and more than one step Parts and containers that appear in the product are identified by the same reference number.

In step 10, 20d of maternal peripheral blood 18 is collected and, for example, a vacuum injection tube (Va Usually contains two lO-〇EDTA, such as cuttainer tube). , into anti-hemagglutinating collection tubes 12 and 14. Or umbilical cord blood 10 mg may be added. Blood is transferred to a 50d centrifuge tube 16.

In step 20, the blood samples were mixed in 15W1 cell buffer A and buffered. Sample 24 (see representative solution below). Mix well.

In step 30, about 1.083, for example old 5topaque 1083 A 15 d density-gradient separation solution 32 with a density of Then, carefully layer up to 20 volumes of Buffer 24 on top of the Density Separation Solution. density separation The reagent has a density of about 1.075 to about 1.095, preferably between 1.08 and 1.09. have a degree.

In step 40, the triangular tube 34 is moved into the chamber by the swinging packet rotor 36. Centrifuge at 700×g for 30 minutes under warm conditions. Arrow 38 indicates the tube as shown. 34 shows the direction of centrifugal force. If you have two blood sample containers Once prepared the first time, add a second density separation tube for the remaining 20d of diluted blood. Prepare the tube and repeat steps 3o and 40 for the second tube. If the sample is blood from the umbilical cord, only one such tube is required.

In step 50, the upper serum/IN buffer layer 54 is aspirated and removed. this Discard unnecessary items. The soft layer 56 is a boundary layer with the upper part of the density component M solution 52, and body and fetal white blood cells, including nucleated red blood cells and erythroblasts I'm here. Collect the soft layer 56 with a pipette 58 and add a new 50IIr1 triangular tube 6. Moving on to step 2, if multiple density method separation material tubes 34 are prepared for one patient. If so, put all the boundary layers 56 into one 50-triangular tube 62.

In step 60, the collected cell layer was added to Cell Huffer A with Cell Buffer A. 22, and the capacity is 50 d.

In step 70, cells in tube 62 are centrifuged at 1100 Orp for 10 minutes at room temperature. Separate and pellet.

In step 80, cells are resuspended, this time in 1M1 Cell Buffer B82. .

In step 90, using sterile technique as described below, 100 μl of anti-CD4 5 magnetic beads 94 are prepared in a 2 m microcentrifuge tube 92. (bead quasi Preparations are not shown in the figure. ) Attach the beads to one side of the tube using a magnet. Wash with Cell Buffer A for 1.4 d.

Let the tube stand for 5 minutes. Carefully remove the washing solution with a pipette. magnet also remove. The tube 6 according to step 70 as shown in the diagram of step 90 Place the resuspended cells of 4 into tube 92. 10 minutes at room temperature with gentle mixing Incubate.

At step 100, a magnetic support block, illustrated as magnet 102, A magnet holds beads 94 on opposite sides of tube 92.

At step 110, the solution is removed and collected with a pipette 112. pipette 112 The cell suspension 114 includes fetal cells. Cellular substance 1 remaining on beads 94 18 mainly contains maternal leukocytes.

Step 120 includes transferring the pipette solution from the pipette 112 onto the microscope slide 162. 114 is a diagram illustrating how the 114 is moved. Such transfers are usually performed with a pipette. . If hybridization is performed in suspension, use washed fetuses instead. Place the cell suspension into a new tube (not shown).

Alternatively, for example, use beads with anti-CD45 bound to them (directly negative option) Alternatively, the analyte is reacted with anti-CD45 in solution, and the anti-CD45 and anti- It is necessary to separate this type of antibody from leukocytes that have invaded the original antibody ligand (ligand). any means, in particular antibodies against epitopes (epiLopes) of the CD45 molecule; (indirect negative selection). An example of such a ligand-forming antibody is a sheep-anti-mouse IgG antibody bound to a substrate. , which are generally solid or antibody-coated magnetic beads or coated containers. An object, such as a vessel wall, from which the ligand complex can be easily transferred from solution.

Kuifu Retired Emperor's bottom Slides can be easily made using the usual cell spin method. Alright can be prepared as organosilanized slides.

To make cell spin slides, from step 110, prepare a 200 μm cell suspension 1 14 onto each slide and spin the cells at 500 rpm for 5 minutes. cell speed Soak the slides in cold 80% ethanol/water (V/V) for 5 minutes. air dry .

Alternatively, directly add 30 μm ethanol/methanol (3:1 v/v) to each step. It is also possible to directly fix slides with cells spun on a slide.

To make organosilanized slides, clean slides are placed in freshly prepared 3-A 2% (V/V) of an organic silane such as minopropyltriethoxysilane (APTO) ) Soak in acetone solution for 2 minutes, rinse slides twice with water and air dry.

Each of the 2 (ld maternal blood and 10 d umbilical cord blood) used as samples. for example, 80% ethanol/water or 50% of 3:l ethanol/methanol. Resuspend the cell pellet in u1 fixative. Slice 50tlI of this suspension. the sample onto a plate and air dry it.

flow cytometry The Coulter Profile ■ type site meter has a PMTI setting of 100. and Senting 900 (7) PMT3, used to detect nucleic acids in fetal cells. It will be done. The color compensation of PMTI-PMT3 is 15%. Epix Elite method is the mother It is used to sort out fetal cells from samples such as body blood.

When fluorescein (usually FITC) is the probe, the dye is first Excite with 8 nm light and then measure the emitted light. For measuring synchrotron radiation (LFLI) ), i.e. 540bp which only passes wavelengths between 520nm and 560nm (40) A filter is used. The filter for LFL3 has a wavelength of 635n. This is a 635 long wavelength pass filter that allows wavelengths of 635 or more to pass through.

Markers are used to identify cells as fetal cells, such as trophoblasts. be exposed. A variety of antigens are known to be found on the surface of trophoblasts, and Antibodies to the antigen bind these cells to maternal blood, other maternal cells, and placental tissue. It is used as a label to identify and separate different types of cells. In the present invention, cytokeratin Antibodies to 0, which are preferred fetal cell markers for trophoblasts, e.g. , (1) cytokeratin, (2) β-subunit of chorionic gonadotropin, ( 3) Fetal hemoglobin protein, (4) Chorionic mammary gland stimulating hormone protein [placental ctodiene (placenta-stimulating lactation hormone)], (5) pregnancy-specific β-glycoprotein, ( 6) α-fetoprotein, etc. Antibodies with various labels against cytokeratin body available. These are CAM5.2Becton Dickinson, Ka Tag No. 92-0005; and anti-cytokeratin 18-FITCSigm a　Chemical　Co+mpany, Catalog No.

F-4772 (antibody against cytokeratin 18); most favorable The preferred one is an antibody against cytokeratin labeled with fluorescence + aoieLy. It is.

More preferably, the fetal cell-specific RNA sequence is used as a marker for fetal cells. be exposed. Such sequences include, for example, the fetal hemoglobin gene, cytokeratin gene, chorionic gonadotropin β-subunit gene, chorionic mammary gland stimulating hormone gene (placenta-stimulating lactation hormone), pregnancy-specific β-glycoprotein gene, fetal These are transcriptions of the alveolar hemoglobin gene and α-Funizonal protein gene. these genes and other gene sequences can be found in Genetic 5 sequence Data Ba Available from GenBank, 69.0 version. The file containing these arrays The population of lobes and probes was prepared using Applied Biosystem+*s, Inc. ,,F.

5ter　C4ty, CA, supplied by NA commercially available, like model 380B as oligodeoxynucleotides using synthetic reagents and other reagents from the company. Synthesize. Probes are natural nucleotide-based or natural nucleotide-based. This includes known analogs of , including those modified to be conjugated to a labeled moiety.

A new method for identifying fetal cells in a specimen using density gradient centrifugation is Use a gradient solvent. Most preferably, the density gradient solvent is a colloidal polyvinyl resin. Lolidon-coated silica (e.g. Percoll), Nycodenz, non-ionic Polymer II (Ficoll) alone or diatrizoate soda (Ficoll) Reagents including I-Paque or former 5topaque) and mixtures thereof The density of the cells is selected to be one that conveniently separates the fetal cells of interest from other blood components. Bu.

The present invention can detect genetic abnormalities with a minimum number of fetal cells. Fetal cells are collected by amniocentesis can be obtained by barb, villus sampling, or other standard methods known in the art. I can do it. In one embodiment of the invention, however, the fetal cells invade the uterine cavity. The blood is collected from the mother's peripheral blood without causing any damage to the mother or fetus. already In one embodiment of the invention, umbilical cord blood is collected percutaneously. Sensitivity of this method is often lower than that required by conventional fetal cell isolation and detection techniques, e.g. Preferably 1-21, optionally 0.21, may be any small amount of umbilical cord blood.

Genetic decoction examination team Genetic abnormalities detected by the present invention include deletion, addition, amplification (expansion), translocation, or rearrangement. It is an array.

For example, deletions can be made by hybridizing silanable attachment of the probe to the target sequence. It is identified by detecting missing matches. To detect missing gene sequences, usually A population of probes that is complementary to a nucleic acid sequence present in fetal cells but not in abnormal fetal cells. Prepare. If the probe hyperrises to the sequence of the cell being tested, then The sequence is detected in this case and the cell is normal for that sequence. If the probe If it does not hybridize with the cell's nucleic acid, then the sequence will not be detected in that cell. , on the other hand, if a control (reference) sequence such as the X chromosome is detected in the cell. In some cases, the cells are recognized as abnormal.

Attachment involves the attachment of a labeled probe to a polynucleotide repeat on a chromosome. It is identified by the detection of Chromosomal insertion or chromosome 2 indicating Down syndrome Detects gene sequence additions such as cutting abnormalities such as trisomy 1 (trisomy) To do this, prepare a population of probes that are complementary to the gene sequence of interest. down syndrome For example, if a probe complementary to chromosome 21 is ＼＼Iburirai for the three occurrences (Lhree appearances) If we zoom in, the sequence of chromosome 21 will appear three times. nces) are detected, revealing the trisomal condition of Down syndrome. If example For example, if the detection means is a fluorescent dye, the three distinct fluorescent dots visible in the cell are the three dyes. It will indicate a somatic condition.

As explained in Example 14, there is amplification in a specific DNA fragment. , the signal intensity from the labeled probe corresponding to the sequence undergoing amplification increases.

There are many image analysis methods (io+age analysis 5ystea+) quantify the signal and compare it to a standard to determine if a specific amplifiable mutation is present. Decide whether

Translocations or rearrangements can be identified in several ways, e.g. the first labeled probe is , binds to marker regions of chromosomes that are not translocated. The second labeled probe is then a second region of the same chromosome (due to rearrangement) or a second chromosome (due to translocation) ). Following this, the binding of the first and second probes is detected. . Alternatively, a translocation may first involve a polynucleotide in the chromosome that undergoes the translocation or rearrangement. In the marker area of the do part, I! ! Identification is achieved by binding of the i-probe. So Following this, binding of the labeled probe is detected.

For example, to detect a translocation, identify a marker on the chromosome in question and then Prepare hybridizing population probes. They fluoresce at specific wavelengths It is marked with a detectable label, such as a dye. Unusual translocations and rearrangements to test for , and prepare a second population probe that identifies it. second The population probes are made of dyes that fluoresce at different wavelengths than the initial set of labeled probes. It is clearly marked with different signs. in 5itu hybrida Isolation was performed using both population probes, and the high The hybridization results are compared. If the first and second signs are If all cell samples match, no translocation has occurred.

If the first label does not match the second label in an important fraction of the sample, If you look closely, translocations and rearrangements are occurring. For example, F, 5pelIll an, C11nical Genetics 41(4)+169-174(1 991); J, W, Gray, Progress 1ncIinical g Bi.

1, Res, 372:399-411 (1991).

hybridization Ethanol, for example 80% ethanol/water (V/V), in 5it u ・Conveniently used as a fixative for cell processing during hybridization I can do it. Other suitable precipitants include acetic acid, methanol, acetic acid and their combinations, such as ethanol/methanol mixtures (3:1). There are also combinations. Other useful adhesion promoters will be apparent to those skilled in the art. fixed Regarding the hybridization of adhesives and fixed cells, U.S. Patent No. .

5.225,362. It is stated in The fixative has good cell shape preservation, anti- Body preservation and accessibility must provide high hybridization efficiency. do not have. Some salts, such as mercuric chloride, sodium chloride, sodium sulfate, dichromium potassium acid, potassium phosphate, ammonium bromide, calcium chloride, acetic acid Soda, lithium chloride, cesium acetate, calcium or magnesium acetate, Potassium nitrate, potassium dichromate, sodium chromate, potassium iodide, sodium iodate Thorium, sodium thiosulfate, and extreme temperatures like shaking a slide over a flame. also acts as a fixative.

Fixatives include, for example, paraformaldehyde, glutaraldehyde and formaldehyde. These substances, such as dehydes, cross-link (cross-link) together and anchor cellular components. It can contain compounds that Cross-linking agents preserve the ultrastructure (ultrastructure), but Create a network of nucleic acids and antigens to be collected, and bring them close to probes and antibodies. thus often reducing the efficiency of hybridization. Some cross-linking agents It binds covalently to the nucleic acid that has been used to prevent subsequent hybridization.

For hybridization Hybridization solutions typically include chaotropic denaturants, buffers, and pores. Contains a gap-forming agent and a hybridization stabilizer. As a chaotropic modifier, photo lumamide, urea, thionanate, guanidine, trichloroacetic acid, tetramethylene amines, perchlorates and sodium iodide. pH at least about 6. Buffers kept between 0 and about 8.5, preferably between 7.0 and 8.0, can be used. Wear.

Pore forming agents include, for example, Br1j35. Br1j58. Sodium dodecyl sulfate, Like CHAPS, Tween, 5arkas or TritonX-100 Well, it's a surfactant. Depending on the location of the target nucleic acid, the probe is Pore-forming agents are selected so that they can penetrate through plasma), nuclear membranes, and cell septum structures. . For example, 0.05% Br1j35 and 0.1% Triton X-100, Make sure that the probe passes through the plasma membrane but not the cell nuclear membrane. On the other hand, Deoki Sodium cicholate allows the probe to cross the cell nuclear membrane. In this way, Cell extraction pore formers to limit hyperprint formation on sporoplasmic nucleic acid targets Try to avoid it. Such selective cell location limits the target nucleic acid to the cell. hybridization of the probe to complementary nucleic acid sequences while in the plasma. exclude and contribute to the specificity and sensitivity of the measurement. Other than surfactants such as fixatives and salts Drugs can aid this reaction.

Hybrid stabilizers such as salts with monovalent or divalent cations contained in the hybridization solution to connect the complementary sequence of the probe to its target nucleic acid. promotes the formation of hydrogen bonds between Sodium chloride preferably at a concentration of 0.15M to IM Thorium is used. related to the target nucleic acid to prevent non-specific binding of the nucleic acid probe. If possible, add the nucleic acids that are not used in the hybridization solution to the hybridization solution.

Many types of solid supports are utilized to practice the present invention. be used Support materials include, but are not limited to, glass, scotch tape (3M), and Ron, GeneScreen Plus (Neiu England Nucl ear) and nitrocellulose. Most preferably, the microscope slide Lass is used. The use of these supports and the manner in which the subject is placed thereon is within the skill of those skilled in the art. This is obvious. The choice of support material depends on how the cells are observed and quantified. evening. Some filter materials have non-uniform thickness and therefore Contraction and expansion during hybridization are not uniform. Furthermore, if you add, spontaneous Some supports that fluoresce interfere with the quantification of low levels of fluorescence. microscope slide Glass is the most preferred because it has a high signal-to-noise ratio and retains tissue well. It is a desirable solid support material.

A specific example of this process is to immobilize target cells on a solid surface (particularly slate glass). . In another example, the target cells are suspended in a liquid and immobilized on a solid surface during the entire process. The use of conventional flow cytometry instruments particularly facilitates this invention. Ru.

The process consists of the following steps:

(1) In a solution containing a probe that binds to a target molecule in or on the cell, The cells are contacted. This contact makes the probe a cell-binding probe. , the probe is carried out by the method of binding to the target molecule, and the probe is a reporter group. have a loop.

(2) Contacting the cells with a solution containing a structural analog of the reporter group.

(3) Detect the reporter group on the probe bound to the cell, and - or further steps are not detected.

Therefore, before step (2), after step (2), or after step (2), During (2), step (1) is performed.

When the probe and analogue are present in the same solution, step (1) and step (2) ) are thought to occur at the same time.

Preferably, the probe and analogue are present in the same solution, and step (1) and step In a preferred embodiment in which step (2) is performed simultaneously, many The probes are simultaneously hybridized, e.g., preferably HbfmRNA. When a probe for human chromosome 21 is included in the contacting step, HbfmRNA The reporter group of the probe for human chromosome 21 is the reporter group of the probe for human chromosome 21. Detectably different from the reporter group.

In view of the sub-subject of the invention, the reporter group is a cyclic compound. this In view of a further sub-subject of the invention, the cyclic group includes unsaturated bonds, From Ming's narrower subgeneric point of view, the cyclic group consists of aromatic acid compounds (- or benzene ring).

Regarding the reporter group, on a molar basis, it is preferable that there is an excess of It is particularly desirable that the analogue is at least 10 times more abundant than the reporter group. .

The analog competes with the reporter group for non-specific binding points. together with nucleic acid probe In the case of aurintricarboxylic acid (ATA), an additional mechanism is Contains the binding of ATA to the active site of the protein that binds to the reporter group. There is. Analogs retain most or all structural features of the reporter group. As such, it is desirable to select analogues with structural features that are not present in the probe. It additionally has.

Preferably, the analog should penetrate cells and viruses. Olin derivatives (Ro) - dami derivative), the analogue has an aromatic group in addition to the ATA. has a polar reactive group such as -C○, -NH2, OH, or -3Oz group. Examples of preferable examples include cromoxatin cyanine R and chrome azurol. There are S etc.

A preferred subgroup of analogues include those in which NH,1 of lysine is blocked. Ru.

The fluorescent reporter group allows the reporter group to absorb energy and then detect the emitted energy by emitting some of the absorbed energy; Chemiluminescent reporter groups refer to enzymes that release energy in the form of light. It is detected by causing a similar reaction.

Other reporter groups, such as biotin, show that they are similar to streptavidin. It is detected by combining with a group such as Streptavidin is detectable such as alkaline phosphatase and horseradish peroxidase, which can catalyze the reaction. directly or indirectly binds to enzymes such as

Fluorescent groups that can be used in this process include phlorecene (or FITC), Law containing Marine, Rhodamine and Texas Red and Phycoerythrin It is a damin derivative.

The chemifluorescent group that can be used in this process is isoluminol (or 4-aminol). Nophthal hydrazisodo; Aldrich Chemical Co+apa ny or refer to the catalog of Molecular Probes, Inc. )including.

In one preferred embodiment of this process, when the reporter group is phlorecene, , step (4) is about 520n and wavelength between 5601 (especially about 520rv+) most preferably the absorption wavelength of the chip (3) is It is less than 520 nm.

A preferred specific example of the fluorescence measurement step further includes a washing step between steps (2) and (3). Contains. In the washing process, cells are removed from the suspended solution by centrifugation, and then washed. The cells are suspended in a washing solution and then centrifuged to remove the cells, the washing solution is usually probed. Does not include.

In a special embodiment of this process, the solution used in step (2) is The Porter group includes analogs of the Reporter group, free radical quenchers Contains scavenger and fixative.

A fluorescent probe that binds to a target molecule binds to that target with a high degree of specificity Preferably, the fluorescent probe is a nucleic acid molecule, an antibody, or a specific fluorescent probe. is a fluorescent dye that covalently attaches to other molecules that can bind to target molecules. .

When the analog is added to the mixture (caftail), the preferred concentration is 0.01% or and 0.5% w/v (particularly about 0.01 to 0.05%).

Another aspect of the invention is a kit for detecting nucleic acids in fetal cells in a subject. . Such a kit includes:

(1) Fixation/hybridization mixture and - or more labeling agents. solution containing For example, and without limitation, this solution may contain 50+*H Anidine isocyanate, 25-40% formamide, 31% PEG.

0, 4MDTT, 15 X Fico/Shi/PVP, 502+oM EDTA , lagZ■1 Salmon sperm DNA, 50mM) Lis acetate CpH1-8) , with approximately 5% Triton x-100 and approximately 20 pg/mI of reporter molecules. Contains directly labeled synthetic oligonucleotide probes. This solution and probe The properties of the target and its reactivity towards cells and target sequences should be determined in advance. (2) Means and apparatus for carrying out the hybridization reaction of the present invention.

Alternatively, the kit may also include (1) a probe or is the second detectable reporter group that reacts with the probe-target hybrid. System: (2) Concentrated stock that can be used as is but diluted sufficiently as a cleaning solution solution (3) a solid support (e.g. a microscope slide), for fixing cells on the above-mentioned support; equipment that can be used to incubate or even clean specimens. , mechanical members necessary or useful in carrying out the present invention; and, if desired, (4) Photographic film or emulsion that records the results of the assay performed in the present invention .

Another aspect of the present invention is that the fetus in the subject is treated without separating maternal blood cells. An object of the present invention is to provide a kit for detecting sexual hemoglobin.

A preferred embodiment of this kit includes means capable of detecting HbF mRNA in fetal cells. . What we have prepared is a mounting glass slide on which blood is applied using a capillary tube. , preferably slide mount A, slide mount B1 and slide mount This is a solution for cleaning.

Also prepared were concentrated washing solution A, concentrated washing solution B, and fetal hemoglobin assay. It is a solution for use. The concentrated liquids described here are used as typical examples of the concentrated liquids described below. Generally dilute it.

Another aspect of the invention is to provide a blood source, such as maternal blood or umbilical cord blood. An object of the present invention is to provide a kit for enriching and detecting fetal cells in a specimen. in this way The kit contains: (1) A reagent that creates a density gradient or more that increases the concentration of fetal cells; (2) Probes specific for fetal cells and/or fetal cell mRNA (preferably or a labeled antibody for detecting or separating fetal hemoglobin mRNA; and (3) The means and instructions or kit for enriching fetal cells are as follows: (1) desirably attached to a solid support, preferably an embryonic Contains anti-CD-45 for negative selection of red blood cells, preferably fetal cells in the subject binds to magnetic beads – or more – to concentrate positive or negative antibodies; and (2) Probes specific for fetal cell mRNA to detect fetal cells; do (3) It is proposed that density gradient centrifugation or flow cytometry is a means of enriching fetal cells. Statement: and, if desired, (4) create a density gradient to concentrate fetal cells; More reagents.

Conveniently, either of the two such kits just mentioned can also be - or more target nucleic acid sequences in fetal cells by including: Equipped with means of detection and can provide: (2) Probe or probe-second detectable that hybridizes with the target Reporter system (3) Use as is or dilute sufficiently and use as a cleaning solution. a condensed stock solution; and optionally (4) a solid support (e.g., a microscope a device for fixing cells on the support described above, or Any materials necessary or necessary in carrying out the invention, such as equipment to aid in maintenance and cleaning. is any useful mechanical member (5) to record the results of the assay performed in the present invention; Photographic film or emulsion.

Such a kit is an automated system for carrying out all the methods of the present invention. We provide reagents and materials for use as options.

Table 1 shows abbreviations and names of various compounds and dyes mentioned in the specification.

deep red People and Pan-S 85 and 85 or ± plan criticism Tempo 2,2,6,6-titramethylpiveridine-N-oxyl [CAS #2564-83-2 EDTA Ethylenediaminetetraacetic acid DMF Dimethylformamide DMSO dimethyl sulfoxide DTT dithiothreitol PvP Polyvinylpyrrolidone PE64000 polyethylene glycol (approximately 4000 mol, weight) PBS phosphate-buffered saline AT8-phosphoricarphonic acid [CAS #4431-00-9] CHAP S 3-[(3-cholamidopropyl)-dimethylammonio]-1-propane -Sulfonate [CAS #75621-03-3] Photobiotin N-(4-azido-2-nitrophenyl)-N'-(3-biotin Chiniruaminopropyl)-N'-methyl-1,3-propanediamine [CA S #96087-37-51] Ficoll Nonionic Polysucrose (Pharmacia) Histo paque 1083 Aseptically filtered solution containing Ficoll Non-ionic po Lysucrose (type 400) and sodium diadrizoate, density 1.08 3 Percoll Colloidal PVP coated silica Nycodenz 5-(N -2,3-dihydroxypropylacetamide)-2,4,6-) Ryodo N, N'-bis(2,3-dihydroxypropyl)isophthalamide [CAS] #6610B-95-01TIIIeen Polyoxyethylene sol of fatty acid Bitane salt 5arkasyl N-lauroylsarcosine sodium salt [CAS# 7631-98-3] Triton X-100 Octylphenoxypolyethylene glycol (polio xyethylene ether) [CAS #9002-93-1] Br1j 35 Polyoxyethylene 23 lauryl ether [CAS #90 02-92-0].

Br1j58 Polyoxyethylene 20 cetyl ether [CAS# 9004- 95-9] Tris) Lis(hydroxymethyl)aminomethane [CAS #77-86 -1 piece insoluminol 4-aminophthal hydrazide [CAS #36 82-14-2] APTO3-aminopropyltriethoxysilane [CAS# 919-30-2 ] DAPI 4',6-diaminono-2-phenylindole hydrochloride [CAS # 2B71B-90-3]BCIP 5-bromo-4-chloro-3-indolyl Phosphate [CAS #102185-33-1 Elephant fee ■ Supervisory profit East n1 plate 12 Naphthol Blue Black Naphthol B1, BIK.

13 Palatin First Blank Palatin F-WAN B WAN 20 Sulfnarhodamine 101 hydrate Sulfuro [CAS #6031 1-02-6] Damin 101 Texas Red Sulfnarhodamine 101 Hydrochloride [CAS #82354-19-6] Direct Blue 53 Engineering Vance Blue [CAS #314-13-6] Fluorescene Inchocyanate FITC-T Hoechst 33258 2’-[4-hydroxyphenyl]-5-[ 4-methyl-1- piperazinyl]-2,5'-bi -IH-hendiimidazole Trihydrochloride [CAS #23491-45-4] NLural Black 1 Hematoxylin [CAS #517-28-2] Ac1d Red 91 Eosin B [CAS # 548-24-3 CoSi gma 840-10 Nitro Blue Tetrazolium NBT Kyouwa Blood Melon The following solutions are used in the practice of this invention.

Cell Buffer A (diluted for use): 0.8% BSA in PBS, 0.1% DE Kistrose, 0.1% sodium azide.

Cell Buffer B (diluted for use): 2% BSA in P'BS.

0.1% dextrose, 0.1% sodium azide.

Fixation solution: 4 volumes ethanol, 5 volumes PBS, 1 volume glacial acetic acid.

Hybridization mixture: 5X5SC (0.75M NaCL, 0.075 M Sodium citrate); 30% formamide (v/v); 3 %TritonX-100 (V/V); 0.4M guanidine isothiocyane Salt; 0.16M Sodium Phosphate (pH 6); 15X Ficoll/PV P; IB/ml torn salmon or herring sperm DNA; 10mM EDTA; 25mM DTT; 31% PEG 4000° For hybridization mixtures used with nucleic acid probes, hybridization The ization reaction time ranges between about 20°C and about 90°C, preferably about 37°C. and about 85°C, most preferably about 40°C and about 46°C.

The hybridization reaction time is between 5 minutes and 16 hours, preferably Less than 4 hours. More preferably, the hybridization reaction time is 120 minutes or less, more preferably 60 minutes or less. Most preferably, the reaction The time is 30 minutes or less.

Wash a#l has the following composition: 0.4M guanidine isothiocyanate; 0.1% TriLon X-100 (V/V); and 0.1% TriLon X-100 (V/V); I 　X5SC.

Cleaning solution #2 has the following composition: 0.1% Triton X-100 (V/ v) ; and 0.0 in deionized water. IX5SC, (SSC has the following composition : 0.15M NaCl, 0.15M Sodium citrate, pH 7, 0゜2xS SC is made to become SSC when diluted 1:1 with water; SC is made to become SSC when diluted with water to 1:1O. )PBS The composition of is 0.136 M NaCl, 0.003 M KCI, 0.00 8 MNa,) IPO, 7HzO, 0,001M KH, PO,, if dye If a labeled antibody is used as a probe, or bovine serum albumin (B SA) and dissolve the probe in PBS, then preferably from 4°C to 34°C. React with target cells at a temperature range of °C. There is no need to fix cells (for example , when the antibody target is a cell surface antigen), or probe-target incubation. fix after the end of the probe-target incubation or before or during the probe-target incubation. It's okay.

The mounting solution was 50% PBS, 150% glycerol (V /V), 0.1% 1,4-phenylenediamine (as anti-streaking agent) and lμg/ al Hoechst 3325B or DAPI (dye).

probe Probes are DNA or RNA, or synthetic analogs of DNA or RNA.

The probe attaches to a complementary or mirror image target cell gene sequence, usually through hydrogen bond formation. and can be joined by one or more types of chemical bonds. Normal DNA or RNA probes include adenosine, uridine, thymidine, guanine, cytosine, and Rui are made based on their natural and synthetic chemical derivatives. The phosphate skeleton is ribo It is linked to deoxylipose, deoxylipose and their analogs or derivatives. nuclear Acid probes can be prepared in a variety of ways known to those skilled in the art. probe recommended A, B, 1. Using reagents, Apply Biosystem+*s (A, B, 1. ) is an oligonucleotide synthesized on DNA Synthesizer Model 380.

In the final step of synthesis, the aminohexyl phosphate linker is preferably attached to fetal cells. Attaches to the 5' end of the probe for the specificity marker. and preferably Both 5' and 3' probes for other sequences, such as chromosomal sequences to be detected. It is desirable to attach it to the end of the 5'-or 5',3'-aminohexy The oligonucleotides are then each coupled to a dye of choice. g) L/, purified by HPLC. As explained in the example below, Even if a fluorescent label is attached to the probe, the fluorescence can be detected visually under a microscope.

The purified single-stranded DNA probe was isolated from the -heavy chain phage M13 or this phage. plasmid derivatives or by reverse transcription of purified RNA templates.

Pincer ≦ Niritun A detectable label can be any molecule that can be detected.

Commonly used detectable labels include, but are not limited to, 32P, +25 1, a radioactive label containing coH and 'ibS. Nuku labeled with biotin Rheotit can be used to transform DNA by nick translation, enzymes or chemical means. Alternatively, it can be incorporated into RNA. The biotin-labeled probe After hybridization, avidin/streptavidin, fluorescent, enzyme or is detected using a colloidal gold conjugate. Nucleic acids can also be used with other fluorescent compounds, immunoassays, etc. It is labeled with fluorescent derivatives and biotin analogues. Nucleic acids can also be labeled with protein attachment be done. Radioactive or fluorescent histones, enzymes (alkaline phosphatase and Nucleic acids cross-linked with peroxidase) or heavy chain binding (ssB) proteins are also It can be used. Increased sensitivity for detection of colloidal gold and peroxidase products A number of enhancement or magnification methods using silver solutions are used to improve the image quality.

Indirect fluorescent immunocytochemical means are also available (Rudkin and 5t ollar (1977) Nature 265:472; Van Proo ijen, eL al (19B2) Exp, Ce11. Res, 141:3 97), polyclonal antibodies are produced by injecting poly(rA)-poly(dT) into animals. is enhanced for RNA-DNA hybrids. The DNA probe is fine. Hybridizes with cells and in5iLu, and the high print is an RNA-DNA hive. It can be detected by incubating with an antibody against the lid.

Probes are detectably labeled before being added to the hybridization solution. be converted into Alternatively, a detectable label that binds to the hybridization product Select knowledge.

In practicing the present invention, probes can be labeled with any detectable group. Ru. Such detectable groups include detectable physical or chemical Any substance with properties is possible. Such detectable labels can be used in immunoassays. Significant progress has been made in the field. and usually any label useful in this way is Can be applied to inventions.

Particularly useful are enzymatically active groups. For example, enzymes (CIin, Ch Em., 22:1243 (1976)) 1 enzyme substrate (British patent 5pec, 1, 548,741), coenzymes (U.S. Pat. 238,565); enzyme inhibitor (U.S. Pat. No. 238,565);

4, 134,792); Fluorescent agent (CIin, Chem, 25:353 ( 1979); chromophore; such as chemiluminescent and bioluminescent Luminosaur (see CIin, Chem, 25:512 (1979)); specific Binding ligand; i1 pair between bases; like t'H, "S," P, "'I" C It is a radioactive isotope.

Probe size and... The length of the probe affects its diffusion rate, hybridization rate and hybrid stability. Affects sexuality. According to the invention, small probes (15-200 bases, preferably (15-100 bases, most preferably 15-30 bases) are the most sensitive, quickest and most stable. The above-mentioned small protons span the entire length of the target nucleic acid to be detected, creating a It is desirable to prepare a mixture of the following. For example, if the target nucleic acid is 1000 At any base length, about 40 different probes of 25 bases can cover the entire target nucleic acid. Can be used in hybridization solution to completely cover the area.

A particularly advantageous configuration of the probe is such that the probe is The second step is to prepare a population of probes whose sequences range from 1 to 25 bases in number. hybridize to. The second probe has a sequence hybridizing from base number 31 to base number 55. Soybean. The third probe hybridizes to base numbers 61 to 85. . And as such, the starting point of each subsequent probe is the end of the preceding probe. 5 bases away from. Such a configuration, in which 5 bases are skipped for every 25 bases, is Optimal hybridization results when used for hybridization according to the invention was found to provide a signal.

The concentration of the probe is different from that of the in 5 ita hybridization reaction. influence the parameters of Enhances diffusion during hybridization reactions High concentrations are used to reduce time and saturate the available cell array. expensive 0.005-100 to obtain fast reaction speed while maintaining signal-to-noise ratio. A probe concentration of pg/ml is preferred.

Paun's The genetic abnormality that can be detected by the test of the present invention is Down syndrome [trisomy (trisomy)]. somatic21)), Tuner syndrome (xO chromosome), Klinefelter syndrome ( xxy trisomic), Nidoward syndrome (trisomic 1B) and Patau syndrome (trisomic 1B) It is chromosomal 13).

The following examples are provided for illustrative purposes only and do not limit the invention in any way. I have no intention of doing so.

Chisuse mottled soil Use of chromosome-specific probes to determine the numerical status of specific chromosomes in amniocytes Made by Toyokatsu■■ Dilute 2 ml of amniotic fluid to 10 ml with PBS and centrifuge at 1200 rpm for 10 minutes. . The resulting cell pellet was mixed with 1000 μl of ethanol and methanol (v/v, 3 : Suspend in 1). Place 200 μm of sample onto each slide using cell spin method. .

Made by Pu Sanji J Kusei Several 25 base synthetic oligonucleotide probes were used with the DNA sequences in Table 2. prepared from each of the columns.

deep red Probe Chromosome Gene Bank Name Detected positional salt α-centromeric repeat X HUMSATAX α-centromeric repeat Pete Y HUMSATBα-centromeric repeat 18 HUMRE g of PA84 probe Oligonucleotides are recommended A, B, 1. Synthesized using reagents (Ap plied Biosystems, Inc., DNA Synthesizer Model 3 80B), and in the final step an aminohexyl phosphate linker is attached to the 5' end. It was done. The 5'-aminohexyl oligodeoxynucleotide is then Binds to rhodamine dye from Ecular Probes, 1nc. stop purified by HPLC (water) using a Baseline 810 chromatography instrument. Ta.

High realization Cells were placed on slides for the hybridization step. 30% fo Lumamide, 5xSSC, 0.1M sodium phosphate buffer, ρ) 17.4.10 Denatured salmon or herring sperm DNA with a low molecular weight of 0 μg/ml, 10% ( v/v) Triton x-100, 10% DMS0.15 XFicoll/ PVP, 0.4M guanidine isothiocyanate, 10mM DTT, and 20 to 25 μl of hybridizer consisting of 0.025 M EDTA and probe The ization mixture was added to a concentration of 20 μg/III. Metamorphosis and Ha Hybridization was performed at the same time by placing the slides in a warmer at 85°C for 15 minutes. .

Three separate hybridization solutions were prepared.

The first solution contains the probe for the X chromosome; the second solution contains the probe for the Y chromosome. ; the third contains a probe for chromosome 18.

Washing the slides after the hybridization reaction is recommended to remove non-specific probes. It is also effective for quickly removing background from isomeric bonds. hybridization Afterwards, the slides were placed in a Coplin jar and 100 ml of wash solution #1 was added.

The solution was stirred and held in solution for 2 minutes. Remove this cleaning solution and use cleaning solution #2. added. This second wash was stirred for 5 seconds and poured off. By cleaning solution #2 The washing process was repeated 6 times. Then 0.1% 1.4-fluoride in 50% glycerol Enylene diamine (as an anti-fading agent) and 1 μg/ml Hoechst 33 15 μl of mounting solution containing 25B (counterstaining dye) was added.

1 light ■Japanese jujube Optical micrographs were taken using an Olympus BHIO microscope equipped with a fluorescence detector, and Exposure using Kutachrome EES-135 (PS 800/1600), ASA It was developed at 1,600 yen. Direct comparison of all optical micrographs taken Therefore, exposure times of 30 to 60 seconds were always used.

As shown in Figure IA, when using the Y probe, the fluorescence of one point (L dot) It can be seen in the nucleus of amniotic cells.

Figure IA: Top panel is a photograph (40x magnification) of two Hoechst-stained cell nuclei. and the bottom panel is a fluorescent photograph (100x) of these same two cells.

Figure IB shows a male amniotic cell with two dots visible in the cell nucleus when using the X probe. The upper panel is a photograph (40x magnification) of cell nuclei stained with HoechsL. The lower panel is a photograph (100x magnification) of this same cell viewed under fluorescence. chromosome 1 When using the probe for 8, there are two dots in the cell nucleus (Fig. IC).

Figure IC: The upper panel is a photograph of Hoechst-stained cell nuclei, and the lower panel is a photograph of a fluorescently stained cell nucleus. That's what I saw. These amniotic cells thus contain normal X, Y and 18 There are chromosomes.

Back side markings Simultaneous detection method for the number of X and Y chromosomes in amniotic cells and peripheral blood mononuclear cells Toyomi Ri kesenuki Dilute amniotic fluid from No. 21 to 10 ml with PBS and centrifuge at 120 rpm for 10 minutes. . The resulting cell pellet was mixed with 800 μm ethanol and methanol (v:v, 3:1). ). 200 μl of the sample was placed onto each slide using a cell spin method. I set it. In addition, approximately 5,000 peripheral blood mononuclear cells obtained from a normal male were collected using cell spindles. It was placed on the slide using the cylindrical method.

PuP: ぢU prisoner 1 tear Several 25-base synthetic oligonucleotide probes are listed in Table 3. It was prepared from each DNA sequence.

deep red Probe Chromosome Gene bank Fluorescent name Detected position name Label α-centron link repeat X HUMSATAX rhodamine α-cent Romeric repeat Y HUMSATB fluorescent oligodeoxynucleotide was synthesized as described above, and in the final step an aminohexyl phosphate linker was added to the 5′ end. I attached it to 5'-aminohexyl oligodeoxynucleotides for each of the above chromosomes. The cleotinodo probe was conjugated to various fluorescent dyes shown in Table 3 above. firefly The photodye was available from Molecufar Probes, Inc., and Purified by HPLC (water) using Baseline 81O chromatography equipment .

Hybridization and These steps were performed in Example 1.

quince In this experiment, the X chromosome probe was labeled with rhodamine, while the Y chromosome probe was labeled with rhodamine. probe was labeled with FITC, and both probes were hybridized together. It was added to the mixture and the above steps were carried out. In Figure 2A, the top panel is Hoechst This is a photograph of the stained nucleus of an amniotic cell, and the bottom panel shows one bright dot in the cell nucleus. This is a fluorescent photograph showing one bright dot (X chromosome) and one bright dot (Y chromosome). figure 2B is a photograph of three other amniotic cells similar to the photograph of FIG. 2A.

Figure 20 shows the same hybridization mixture and normal male peripheral blood. Triple hand (DAPI-FITC-Rhodamine) fill using mononuclear cells This shows the results obtained when taking pictures through Tarcent. This photo also , one bright dot and one bright dot for the χ and Y chromosomes, respectively, with Hoechst staining. Figure 2D shown in the background is an image analysis system (BioScan Opt imas”, E6monds, Washington). This is a photograph of a false color representation of a vacuole.

cliff pier lord Number of chromosomes in embryos prepared for test tube culture or fetal cells obtained from villi Use of chromosome-specific probes to determine 廠凰■Plate made Cells obtained from non-viable embryos prepared for in vitro culture, Cells from fertilization and cells from villi were obtained in the usual manner and sliced. I placed it on the glass.

1 Sannizu Imperial Palace Some 25-base synthetic oligonucleotide probes are listed below as Table 4. Prepared from each of the indicated DNA sequences.

dog”- Probe Chromosome Gene bank Fluorescence name Detected position name Label α-centromeline repeat X HUMSATAX rhodamine α-cent Romeric Repeat Y HUMSATB Fluorescent α-Centromeri 7 Cribby 18 HUMREPA84 Coumarin α-centromeric repeat 16 HUMASATD Rhodamine Amyloid 21 HUMAMMYB Rhodami Collagen Type IV 13 HUMCOLIA Fluorescent Satellite DN A1, HUMSAT31 Rhodamine Satellite D N A I H 11MSAT32 Rhodamine Satellite D N AI HUMSAT33 Rhodamine collagen and The oligonucleotide is synthesized and in the final step an aminohexyl phosphate linker is added. are attached to the 5' and 3' ends.

5',3'-aminohexyl oligodeoxynucleotides for each of the above chromosomes. The rheotide probe binds to various fluorescent dyes as shown in Table 4 above. . Fluorescent dyes can be obtained from Molecular Probes, and HPLC Wash with (water).

Hybridization, °　′, These steps are performed in the same manner as in Example 1.

To take pictures of the four fluorescent dyes used for labeling, four different labeled probes, suitable Four different filter cubes, with appropriate excitation and emission filters, are used in the microscope Used in mirrors. Pictures are taken successively while changing the filter cube.

Or Chroma Tech, Inc. of Brattleboro, VermonLH and Omega, Inc. of Bra-ttleboro , dual and triple available from Vermont. Filter set allows simultaneous shooting of two or three different colors (as shown in Example 4 above). Color TV camera also available as an option can.

As in the process of Example 1, one probe is detected from one cell. Example According to step 2, two probes are detected, observed, and photographed.

If we use reporter molecules that fluoresce at different detectable wavelengths, we can More than that can be detected. The available optical filter systems allow for many different Many different probes will be able to be distinguished as fluorophore dyes can be identified. cormorant.

In the previous example, if the fetal cells have a normal male karyotype and when using the One point of orange fluorescence (one dot) is present in the cell nucleus of the vacuole; When using one green dot; when using a probe for chromosome 18, 2 blue dots; when using a probe for chromosome 16, 2 red dots When using a probe for chromosome 21, two orange dots; When using a probe for chromosome 13, two green dots; When using the probe, there are two orange dots; these are normal staining. These are the results for male fetuses with body counts.

1 ship pier Detection of fetal cells using DNA probes A. Flow cytomery and fetal trophoblast selection of fetal trophoblasts circulating in maternal blood Enrichment using cell detection probe I White blood cells isolated from pregnant women were used in the following example. Nuclease (nuclease) Wash with PBS that does not contain enzyme (degrading enzyme) and use a concentration that allows the cells to be clearly separated. , and a cell suspension. Cells were pelleted by centrifugation and the supernatant was removed. cell was resuspended in 0.5% paraformaldehyde and left at 4°C for 12-16 hours. did. After fixation, cells were centrifuged to remove paraformaldehyde and then PB Washed once with S and resuspended in ZX5SC. Use cells immediately.

Made by Pusanij Shokudara A, Negative control probe contains 25-salt from the nitrogen reductase (NR) gene sequence. The radix sequence is used (Table 5); the positive control probe includes the 25-salt of the 28S gene. A radix array is used (Table 5).

The probe for gene sequence testing covers human chromosomes X, Y, 13.16.18 and 21 regions. It is an oligonucleotide with complementation in the region.

Details of probe selection, preparation, and labeling are provided in Table 6 below.

B, Fetal cell identification probe.

The probe for fetal cell identification (Table 6B) is Genetic 5equence D Available from ATA Bank, GenBank, version 69.0, and the following Prepared from gene sequence: (1) Fetal hemoglobin gene, (2) Cytokeratin gene, (3) β-subunit of chorionic gonadotropin, (4)! ! ! hair somato mammary gland spine Extreme hormone (human placental lactodiene (lactation hormone)) (5) α-fetoprotein gene, and (6) Pregnancy-specific glycoprotein gene.

The above sequence was cut into 25 base oligonucleotides, and the above sequence was cut with a DNA synthesis agent. In the final step, an aminohexyl phosphate linker was added to each oligonucleotide. It was added to the 5' end of Othit. 5'-aminohexyl oligonucleotide coupled to the fluorescent dye FITC and purified by column chromatography and) IPLC. make

deep red control probe Probe array name 2BS ATCGAGTAGTGGTATTTCACCGGCSEQ ID N O;1:NRTACGCTCGATCCAGCTATCAGCCGT 5EQI DNO:2: Probe for genetic testing Probe Chromosome GenBank Fluorescence name Detected position name Label α-centromeric repeat X HUMSATAX rhodamine α-cent Romeric Repeat Y) IUNSATB Rhodamine α-centromeric Repeat 18 HUMREPEA84 Rhodamine Collagen Type IV 2 3 HUMCOLIA rhodamine amyloid 21 HUMAMYB rhoda Minamyloid (Fragile)X　X　a+uL, Fluorescent FragileX The condition, ie amplification, is detected with probe SEQ 10:3:. And that This is further illustrated in Example 14 below.

lldan Fetal cell detection probe Probe GenBank Fluorescence Name Location name Sign Fetal hemoglobin HUMGLBN fluorescent human keratin MCYTOK Fluorescent HCG Between 14cG3B Fluorescent 1 (CG HUMCG6BA Fluorescence 11cG HUMCG7B2 Fluorescence 1 (CG　’　HUMCGB Fluorescence Large somatomammary gland stimulating hormone HUMC5I, 3 Fluorescent α-fetoprotein 1 (U MAFP Fluorescence Pregnancy-Specific α-Glycoprotein Fluorescence Transferrin receptor 〇〇 MTFRR rhodamine fetal hemoglobin ε chain CY5 Fetal hemoglobulin I CY3 High realization To perform hybridization using the fetal cell detection probe, use a 30% fu Formamide, 5xSSC, 0.16M sodium phosphate buffer, pH 7.4, lμ g/μl sheared DNA, 3% (V/V) Triton X-100, 5% PEG 4000.25mM DTT, 0.4M guanidine isothiocyanate, 15X Ficol 1/PVP and probe added at a concentration of 2.5μs/a+1 (a mixture of fetal cell identification probes) Add the solution to the cell pellet. Hybridization was performed under humid conditions at 42°C. Do this for 30 minutes.

Removal lock After hybridization, cells were placed in a 1511 tube containing 10n+1 wash solution #1. Place in a conical tube. Stir the solution until the cells are a single-cell suspension, then Centrifuge at 250×g for 5 minutes. Remove the supernatant and add 10ml of washing solution #2. Add to the pellet. Agitate the second wash until a single cell suspension is obtained. cells Centrifuge again at 250×g for 5 minutes. Remove the supernatant and collect the cell pellet at 0. Resuspend in 2 ml of PBS counterstain solution containing 0.025% Evans Blue. become cloudy

Flow cytometer and Cells were collected using an Epics Elite classification flow cytometer (CoulterIn struments). The equipment is a 488 argon laser, FLI 525 stop band pass filter for staining and 635 nm long pass filter for counterstaining. I'm using a filter. Contain a negative probe for each sample analyzed Analyze the sample first. and less than 0.05% cells fall in the upper quadrant. Set the quadrant image so that The sample hybridized with the positive probe is then Analyze the pull with the same parameters as the sample classified with the negative probe. upper part The cells that fell into the quadrants were collected and hybridized to determine the genetic characteristics of the fetal cells. Soybean.

■ In this experiment, NR was used as a negative control probe, whereas Therefore, the fetal cell identification probe is a positive probe. and circulates in the mother's blood Identify fetal cells that Fetal cells are sorted one after another as described above and then screened. Place it on the ride glass. The fetal cells were tested using a genetic testing program as described in Examples 1 and 2. Analyze using the web.

B. III Hemoglobin mRNA prepared for use in the present invention To further explain and illustrate the population probes we have developed, please refer to the detailed instructions below. Provided for 6B. SEQ rD NO: 4: ) IUMGLBN gene whereas three fragments of the 443-nucleotide sequence obtained from GenBank It is. Bases 1 to 91 of SEQ ID NO: 4 are 2 of HUMGLBN. 179 to 2269. Bases from 92 to 314 of SEQ ID NO: 4: are 2393 to 2615 of HUMGLBN. The bases from 315 to 443 are They are 3502 to 3630 of HUMGLBN. SE mouth ID NO: 4: From thin Population DNA probes complementary to the target mRNA transcribed in the Prepared according to.

More specifically, the population probe sequence is SEQ ID NO: 21: It is provided as ID NO:5:. Each of them targets mRNA An oligonucleotide of up to 25 bases of complementary DNA, and transcribed from position and more clearly exemplified as SEQ ID NO: 4: Ru. Each such probe was synthesized as described here and labeled 5' with FITC. do.

Figure 5 shows a sample prepared by the process of Figure 3 and hybridized to the population probe described above. Micrograph showing fetal nucleated red blood cells enriched for proliferation in a peripheral blood sample. Ru. Cells with gray nuclei and distinct morphology are fetal nucleated red blood cells. nuclear The cells are fetal red blood cells or still contain fetal hemoglobin mRNA. , fetal reticulocytes.

0.1 day Shino 6 Jsu, RNA5's imperial skin ■ As mentioned earlier, fetal cells express two or more specific RNAs in the same cell. On the other hand, maternal cells from the same specimen source contain both R in the same cell. Contains no NA species. Only when a unique combination of RNA5 exists Many mRNA and hnRNA species can be detected simultaneously in one cell. In other words, fetal A specific signal identifying the cell is detected.

Prior to use, wash the cells in suspension with chilled PBS to ensure a single cell suspension. Mix thoroughly.

In the current example, the target RNA5 combination is human chorionic gonadotropin (HCG) and transferrin receptor, either of these genes is , expressed in certain types of maternal cells, but the cells that normally express these genes are does not circulate in the bloodstream, and the single type of maternal cell expresses neither gene. However, the fetal trophoblast expresses these genes simultaneously in the same cell. manifest.

- or more up to 25 bases for the sequence of HCG identified in Table 6B Prepare an oligonucleotide DNA probe and label it with fluorescein. - or more up to 25 bases for the sequence of the TR identified in Table 6B An oligonucleotide DNA probe is prepared and labeled with rhodamine.

Samples of maternal peripheral blood were washed with chilled PBS and placed on microscope slides. As a specimen, mix thoroughly to ensure a single cell suspension. H.G.C. Hybridization is performed as described above with probes for and TR.

The signals emitted from the fetal trophoblast are the green of fluorescein and the green of rhodamine. It is an additive combination of red and produces one 2x signal that appears yellow-orange. vinegar.

1 dog spot As a probe for both strands of DNA as a target for hybridization Use of synthetic oligonucleotides Oligomers prepared for both strands of the DNA target are , compared to the signal emitted by a probe prepared against only one strand of the DNA. , gives about twice as much signal. Moreover, the ability to form hyperprints on both DNA strands allows the amount of DNA and RNA in individual cells to be quantified simultaneously.

Toyokyo■Sarakesa The H9 cell line (ATCC No. 8543) is used in the following experiments. cultured cells were washed with enzyme-free PBS to remove single cells at a concentration that resulted in clearly separated cells. It was made into a suspension. Centrifuge the cells until they form a pellet and discard the supernatant.

Resuspend cells in 40% ethanol, 50% PBS, 10% glacial acetic acid.

Use cells immediately.

Probe GenBank Fluorescence Molecular name Position name Mark @P Robes, Inc., CaL.

H[V-sense chain HUMHB 102 FITC1-3 old V-antis ense chain) IUMHB 102 Rhodamine derivative T488 probe person ,&,hi The old V sequence mentioned above was cut into 30 base oligonucleotides and the DNA Synthesis agent (Applied Biosystem DNA synthesis agent, model 380B ) and recommend A, B, 1. Using reagents, phosphate thioate oligonucleotides and and synthesize. The polysulfide oligonucleotides are then combined with a fluorescent dye and placed on a column. Purify by chromatography and HPLC. 30 salts from nitrogen reductase gene The base oligonucleotide serves as a negative control probe.

hybridization In the hybridization step, 30% formamide, 5×5SC,0,1 6M sodium phosphate buffer, pH 7.4, Iμg/μl sheared DNA, 3% (v/ v) Triton X-100, 5% PEG 400Q, 25mM DTT , 0.4 M guanidine isothiocyanate, 15XFic.

11/PVP, and probe added at a concentration of 2.5 μs/mI. Add the redidase cidin mixture (50 μm) to the cell pellet. hybridi ization for 30 minutes in a humidified atmosphere at 42°C.

car wash After hybridization, cells were placed in a 15-ml conical culture containing 10 μl of wash solution. into the tube. The cleaning solution was at 42°C and 0. I X5SC, 0,4M Guanidine It consists of sothiocyanate and 0.1% Tritonx-ioo (Washing solution #1).

Stir until the cells become a single-cell suspension, then centrifuge at 250Xg for 5 minutes. Ru.

Remove the supernatant and add 10 μl of wash solution #2 to the pellet at 42°C. second washing Stir the purified solution until it forms a single cell suspension.

Centrifuge the cells again at 250Xg for 5 minutes. Remove the supernatant and remove the cell pellet. Counterstain solution in PBS containing 0.0025% Evans Blue 0.2 +i Resuspend in l.

“Flow cytometer” Cells are analyzed on a FAC5TAR device (Becton Djckinson).

The device consists of a 5 watt argon laser coupled to the dye head, a 5 watt argon laser coupled to the dye head, and a 25nm bandpass filter, 584 stop bandpass filter for rhodamine Use a tar. For each sample analyzed, the sample with a negative probe is separated first. analyze. and less than 0,01% of the cells are in the upper right quadrant or the lower right quadrant. Set up the quadrant statue so that it falls down. Next) sample treated with 11V probe sample with the same parameters as the sample analyzed with the negative probe. quartering Set the image correctly, and fill in the two samples (as they are treated the same, so All cell numbers recorded in the right quadrant (0.01% above) are either stranded or raR. Count as positive for both NAs. All cells recorded in the bottom right quadrant The number (0.01% above) counts as positive for DNA only.

1st day Isolation of fetal cells from maternal blood and detection of fetal cell-specific antibodies and DNA probes Used for positive identification of cells 1 day from mother blood Add Percoll 5tock and gradient solution to 9 parts, following manufacturer's recommendations. It was prepared by mixing Percol I with 1 part of 1.5M NaCl.

Density gradient Percoll solutions were prepared according to Table 8.

Density Percoll 5tock solution 0.15 M NaCl total volume 1.0 65 5.15m1 4.85m1 10m11.075 6.00m1 4. 00m1 l0m11.0B5 6.83m1 3.17■l 10m11.1 00 8.09m1 1.91m1 10m1 To concentrate circulating fetal cells , 1On+1 of maternal peripheral blood of women in the first 3 months of pregnancy was collected in 501 conical cultures. 1.100.1.0B, 1.075 of 10m1 each from bottom to top in Ubu and 1.065 g/l density gradient solution on a Percoll discontinuous density gradient. Overlaid on. The gradient solution was centrifuged at 360×g for 30 minutes at room temperature. In this process The blood was divided into several layers. The first and second layers from the top of the gradient fluid are the circulating fetuses. It contained most of the sexual trophoblasts. Collect these layers and dilute to 50ml with PBS. , centrifuged at 500 × g for 5 min at room temperature. PB the pellet enriched with fetal cells. Wash twice with S, centrifuge as above, fix with chilled 75% ethanol, It was used to identify fetal cells and test for genetic disorders as described below.

As shown in Fig. 4, maternal blood cells are distributed over a four-layer Percol 1 discontinuous density gradient tubes A and B) to divide it into several bands as desired. Above tube B Remove bands 1 and 2 from the tube and add PBS (tube C), 500 Centrifuged at xg for 5 minutes. Resuspend cells in PBS and centrifuge twice as above. I let go. Re-incubate the pellet in chilled 75% ethanol at a concentration of 106 cells/ml. Suspend and use on the same day or store at 20°C.

Old sex 6 A, Identification by direct immunofluorescence Approximately 10' maternal blood cells fixed with ethanol and enriched for proliferation of fetal cells were added to 1 Microcentrifuge at 500 rpm for 5 minutes at room temperature. Fetus with 5% pellets 1 x 1 buffer AC 8,01 g containing serum (!l buffer A/FC5) NaCL, 0.20g KCI, 1.44g NagHPO, 10100O distillation, desorption (ionized water) and microcentrifuged as described above.

This wash step was repeated. Add 1 μl of anti-cytokeratin to the final pellet. 1B-FITC (Sigma Chemical Company Catalog No. , F-4772; mouse host, JgG clathrascolon CY-90) Resuspend in 100μ of Buffer A/FC5 and incubate for 1-2 hours in the dark with a reciprocating shaker. Incubate with gentle agitation. The reaction mixture was then prepared as described above. Wash three times with 1 ml of buffer A/FC5 and place the pellet on a glass slide for 7 The cells were centrifuged at 00 rpm for 7 minutes. Fetal cells were counted using a fluorescence microscope.

Figures 6A and 6B show anti-human cytokeratin 1 in maternal peripheral blood, as described above. An image of fetal cells stained with 8-FITC is shown.

Labeling by B1 indirect immunofluorescence As mentioned above, indirect immunofluorescence can be used instead of direct immunofluorescence. Ru.

Cells were first incubated with anti-large cytokeratin (BecLon D) in buffer AF/FC5. Incubate for 40 minutes in a solution of CAM5.2) 17200 from Ickinson. The process is the same as direct immunofluorescence, except for incubating and washing. The first antibody was removed. Cells were then treated with FITC (goat anti-mouse Ig G+IgG); (B.

ehringer Mannheim Bioche+*cals Catal og No. 601-25) for 30 minutes. stop The remaining antibodies were removed by washing as described above.

To detect and genetically test fetal cells in CO maternal blood, anti-cytokeratin sequential testing of Y chromosome DNA probes on fetal cells pre-stained with a specific antibody. Made by Madarasai Dish Additional slides stained with anti-cytokeratin as described above, described below. were collected during the hybridization process.

Once the nib is enclosed Y-chromosome probes are synthetic oligodeoxynucleotides that are complementary to the human Y-chromosome region. It's a chit. Details regarding the preparation and labeling of these probes are provided in Example 1 and Table 1. 2, the hybridization step included 20 μI of hybridization solution. mixture was added to the slide. The mixed liquid is PEG, 25% formamide, 5 X5SC, 11g71 salmon sperm DNA, 15xFic-oft/PVP, 0 ．． 4M guanidine isothiocyanate, 50mM DTT, 5% Trit on X-100, 50tnHEDTA, 50mM NazPO4+ and 20 Contains Y chromosome probe at μg/s I concentration. Place a cover glass and slide The cells were incubated at 85°C for 15 minutes in an insulated container.

backstop After hybridization, slides were washed in a Cap- I put it in a 1 inch jar. Stir the jar until the coverslip falls off, then slide the slide. It was kept in this solution for 2 minutes. This wash solution was removed and wash solution #2 was added. This first The second wash solution was stirred for 1 minute and poured out. Then repeat this final wash 6 times. Ta. Following washing, 8 μm mounting solution was added. cover glass the slides and observed with a fluorescence microscope.

1 friend ■inspection■ Slides were examined using an Olympus BHIO microscope equipped with a fluorescence device using a 40x objective lens. I checked it.

Figure 7 shows fetal cells stained with cytokeratin in maternal peripheral blood (brightly stained Cytoplasma), the cells have one Y chromosome in their nucleus and are Y-stained. The body was positively labeled after hybridization with a rhodamine-labeled Y chromosome probe. It is sex-stained.

2 ships group Separation of trophoblasts from the placenta and chromosome X of their vegetation.

Detection of Y and 18 Trophoblasts are derived from placental tissue, Wang et al., American Jour. naI of Repr-oducLive Iav+unolog+' 16 :8-14 (198B).

The trophoblasts were then fixed in chilled 75% ethanol and antiseptic as described above. stained with itokeratin antibody (Example 6), and also as described above in Example 6. This was followed by hybridization to X, Y and chromosome 18-specific probes.

The origins of probes for chromosomes X, Y and 18 are shown in Example 1.

All DNA probes were labeled with rhodamine derivatives as described in Example 1.

Hybridization, washing and detection were performed as described in Example 1.

Figure 8A shows the results with the X-chromosome probe; 8B shows the Y-chromosome probe. and 8C shows the results with a chromosome-18-specific probe. Cytope Lasma was strongly stained with an anti-cytokeratin antibody labeled with FITC. 8A and 8 The nucleus in B has a single strong light, indicating the presence of - X and Y chromosomes. Ru. The nucleus in 8C has two strong lights, indicating that it has two chromosomes 18. Ru.

Master of fireworks for detecting fetal cell-specific mRNA in cells obtained from amniotic fluid or placenta. Use of fetal cell-specific DNA probes Box I and B” split Cells from amniotic fluid were prepared as described above (Example 1). and thin tissue from the placenta Cells were also prepared as described above (Example 7).

Slides containing normal peripheral mononuclear blood were also prepared as described in Example 2.

1 uni 1■ dish next The fetal cell identification probe is Genetic 5equence Data Ba nk.

The following genes in Table 9 are available from GenBank, version 69.0. Prepared from sequences.

deep red Probe GenBank Fluorescence Name Location name Sign Human cytokeratin HUMCYTOK Fluorescence or rhodamine HCGβ-sa Unit HUMCG3B Fluorescence or rhodamine α-fetoprotein) 1 ．． 0MAFP Fluorescence or Rhodamine Cut into oligonucleotides and use a DNA synthesis agent (Applied Biosys teis DNA synthetic agent, Model 380B) and recommended A, B, 1 ．． It was synthesized as phosphoric acid thioate using reagents. polysulfide oligonucleotides Next, FITC (Molecular, Probes, Inc. logue N.

, 1-2) or rhodamine (Catalog No., T4BB). and purified by column chromatography and HPLC. negative control The HIV probe described in Example 10 was used as the probe.

Hybridization For the hybridization step, add 20 μl of hybridization mix. The combined solution was added to each slide.

The mixed liquid is 31% PEG, 25% formamide, 5X5SC, IB/*1 salmon sperm DNA, 15X Ficoll/PVP, 0.4 M guanidine iso Thiocyanate, 50mM DTT, 5% Triton X-100,50 mM EDTA, 50 iiM NazPO4, and 20 tt g/m1iJ Contains a degree probe.

Place a coverslip on each slide and incubate for 30 minutes at 42°C. Ta.

Washing After hybridization, place the slide in a cup containing 100 d of wash solution #l. -Put it in a 1 inch jar. Stir the jar until the coverslip falls off and slide it. was kept in this solution for 2 minutes. Remove this wash solution and add wash solution #2. Ta. This second wash was stirred for 1 minute and drained. Then repeat this washing 6 times. did. Following washing, 8 μl of Mounting fluid was added. Coverage on slide The specimens were lathed and observed under a fluorescence microscope.

1 person test spot Micrographs were taken with an Olympus BHIO microscope equipped with a fluorescence device, and a Kodak Ekt Exposure using achrome EES-135 (PS 800/1600) film It was exposed to light, then developed with 1600 ASA and photographed. All micrographs taken I always used an exposure time of 20 seconds to allow for direct comparisons.

In each cell in the photo below, bright light (color) is emitted from both the nucleus and cytokeratin. (orange in the color photo) indicates a positive signal. In the photo (color photo) The unstained cells (in red due to counterstaining) are fetal cell identification probes. The maternal cells are negative for the presence of .

As a negative control, we hybridized the old V probe into these amniotic cells and trophoblasts. It was formed by redidization. and there was no bright hybridization signal .

Not only the old probe but all fetal cell identification probes identify normal white blood cells. used in separate hybridization experiments. And these cells are bright There are no bright hybridization signals and all are reasonably negative. It is shown that.

Figure 9A shows samples for analyzing amniocytes (upper panel) and trophoblasts (lower panel). The results obtained using the itokeratin probe are shown.

Figure 9B is for analyzing amniocytes (top panel) and trophoblasts (bottom panel). The results obtained using the HCG probe are shown.

Figure 90 shows α for analyzing amniocytes (top panel) and trophoblast (bottom panel). - Shows the results when using the Feto protein probe.

Back work Anti-cytokeratin antibodies and anti-cytokeratin antibodies were used to detect fetal nutrient 7 obtained from placental tissue. Advantages of using flow cytometry■11 Placental trophic 7 layers were isolated from the placenta on the day of delivery and 75% as described in Example 2. Fixed with cold ethanol. Fixed cells were treated with both as described in Example 6. were also stained with FITC-labeled anti-cytokeratin and isotope control antibodies. The cells were colored and analyzed by flow cytometry.

Flow cytometry and” Cells were collected using Profile II system (Coulter Instrument). s) was analyzed. Equipment is 488 argon laser, 525n layer for FLI A bandpass filter was used. For each sample tested, Samples containing control antibodies were analyzed first and 0.2% of the cells Cent the quadrant image so that less than falls in the top right quadrant.

Samples treated with anti-cytokeratin antibodies were then treated with an isotope control. Analyzed with the same parameters as antibody-treated samples. Accurately set quadrant images. Since we are treating the two samples exactly the same, we can write them in the right quadrant at the top. A cell number of 0.2% or more recorded was counted as positive.

Ura 1 medical publication HIV DNA protein for detecting HIV mRNA in placental fetotrophic layer 7 or amniotic cells. use of robes A modified method as described in Example 7 was used to separate trophoblasts from placental tissue on the day of delivery. Ru. Amniotic cells are obtained by amniocentesis.

The H9HIV cell line and peripheral blood polymorphonuclear cells act as positive and negative cells, respectively. Ru. These cells were washed with nuclease-free PBS and visibly disorganized. Make a unicellular suspension at a concentration that allows these cells to exist. Centrifuge the cells and Drain and decant the supernatant. Cells were placed in 0.5% paraformaldehyde. Resuspend and leave at 4°C for 12-16 hours. After fixation, remove the fixative from the cells. Centrifuge, then wash once with PBS and resuspend in zxssc. cells are straight Use immediately.

1 Dan 21 to Sada Negative control probe, human papillomavirus (HPV) type 16 and tie The sequence of sample 18 (Table 10) was obtained from the published sequence. And Genetic 5equence Data Bank, GenBank, version 6 It was available through 9.0.

1st issue Probe GenBank Fluorescence Name Location name Sign HPV 16 PPH16 fluorescence HPV 18 PPH1B Fluorescence HIV HUMBI+ 102 Fluorescence 20 isolated HPV probes (10 for tIPV type 16 and HPV type 16) 10 pieces for 1B) and 180 pieces (7) HIV probes, several HIV sequences was cut into oligonucleotides of 39 bases and treated with a DNA synthesis agent (Applied Biosystems D NA synthesis agent, Model 1380B) is recommended. A, B, 1. phosphorothioate oligonucleotides using reagents. and synthesize. Phosphorothioate oligonucleotides are then transferred to FITC. Combine and purify by column chromatography and HPLC.

hybridization For the hybridization step, 50 μm hybridization mix The solution was added to the pelleted cells. The mixture is 30% formamide, 5X5SC , 0.16M sodium phosphate buffer, pH 7.0, 1μg/μl sheared DNA, 3 % (v/v) Triron X-100, 5% PEG4000, 25 mM TT, 0.4 M Guanidine Isothi 7N-h 15XFicoll/P Contains VP, 2.5 μg #+Ii probe added at 1 degree. hybridize tion for 30 minutes at 42°C in a humidified atmosphere.

Washing After hybridization, wash the cells with 10 liters of wash solution #1 (heated to 42°C). I put it in the 1511 conical tube I put it in.

Stir until cells form a single-cell suspension, then centrifuge at 250Xg for 5 minutes. did. The supernatant was removed and 10 ml of wash solution #2 (42°C) was added to the pellet. . The second wash was stirred until a single cell suspension was obtained. Cells again at 250Xg Centrifuged for 5 minutes. The supernatant was removed and the cell pellet was washed with 0.0025% Evan. The cells were resuspended in 2 liters of PBS counterstain solution containing S Blue.

“Flow cytometer” Cells were analyzed with the Profile I system as described previously. The device is 48 80 ■ Argon laser, compared with 525 stop band pass filter for FLI For each sample tested, use a 635 nm bandpass filter for staining. Samples containing negative probes were analyzed first. and cell 0 ．． The quadrant images were centered such that less than 0.01% fell in the top right quadrant. Next A sample analyzed with a positive probe is completely different from a sample analyzed with a negative probe. Analyzed using the same parameters. Accurately set the quadrant images and fit the two samples in their entirety. Since they are treated in the same way, the number of cells recorded in the upper right quadrant (0,0 1% or more) were counted as positive.

1 trip±day Synthesis of oligonucleotins labeled with multiple reporter groups In order to obtain maximum sensitivity, preferred embodiments of the invention include fluorescent moieties such as fluorescent moieties. Oligonucleotides labeled with multiple reporter moieties using a top probe. This example describes how to prepare such a probe. Ru.

200 μg of dried oligonucleotides were added to a 100 μm 25011IM Tris Make the first solution by dissolving it in a buffer pH 7.4. 1mg iodoacetamide Mix luorescein with 100 μm dry DMF to make 200 μl reaction mixture. Ru. Mix the two solutions together - stir late. This will remove the acetate from the reaction mixture. The ratio of amidofluorescein to oligonucleotide is 1:5. lll Mix 1 g of iodoacetamide fluorescein in 100 μm DMF again. Ru. Then, mix this 100μI into the 200μM reaction mixture. another 10 Add 0 ul of 25011 IM Tris buffer to the 400 μm reaction mixture and Continue treatment for another 6 hours. Labeled oligonucleotides were added to ethanol and 3M acetic acid. Precipitate with soda. This unpurified product was then put into a PD-10 column, and the unreacted Collect the desired fractions excluding the dye. The liquid part is removed by vacuum.

The unpurified product is then purified by high performance liquid chromatography (HPLC).

Ura-use Masuku The example steps on probes for two strands of a DNA target can be modified as follows: (1) 416 separate probes, each designed as 30 bases in length ( 208 were synthesized for type 16 and 208 for type 18).

However, both contain probes for one strand of each of the two HPV targets. , to create probes corresponding to those 416 separate oligonucleotides. plus 416 additional oligos against the second strand of both HPV targets. Make a nucleochit probe. The probe for the first strand was How to write them on the map relative to the second probe strand As a result, 1/2 of each first probe strand ( 15 nucleotide) is complementary (nucleotide 172) of a certain second probe strand. (in the read array). and the other half of the first probe strand (15 nucleotides). ) would be complementary to the other part of the second probe strand. Probe star Staggering occurs due to the short overlap (10 nuclei). The second strand probe does not hybridize much with the second strand probe. It means to say ruu. On the contrary, probes corresponding to one strand Approximately twice as much hybridization is detected compared to when only .

(2) Applied probe Biosystems (ABI) DN A synthetic agent Model 1380B and recommended A, B, 1. Using reagents, four sulfur Phosphorothioate oligonucleotides of up to 30 bases with yellow atoms Synthesize as The sulfur atoms are located as follows: one is the re-terminus of the probe 5 ', the second is between nucleotides 7 and 8 (counting from the 5' end); the third is between 2 Between nucleotides 2 and 23: and the fourth is between nucleotides 29 and 30. It is between the cuts. The sulfur atoms of the polysulfide oligonucleotides are then dyed with fluorescent dye iodine. Doacetamide fluorescein and can be synthesized in large amounts). : 200 μg of dried oligonucleotides at 10 Dissolve in 0 μl of 250 dL-Lys buffer pH 7.4 to make the first solution. . Next, the iodoacetamide fluorescein of IB was dried to a thickness of 100 μm. MF (for example, 100% DMF) to form the second solution. These two solutions Mix together and stir until late. - After an overnight incubation, the labeled oligo Nucleotides are precipitated with ethanol and 3M sodium acetate. This unrefined product is Then put it into a PD-10 column to remove unreacted dye. Collect the desired fractions. liquid The shaped parts are removed using a vacuum. The unpurified product was then subjected to HPLC (high performance heavy liquid chromatography). Refined with fee).

(3) Create a negative control probe in the same manner as steps (1) and (2).

(4) The hybridization mixture was modified as follows: 1.5% PEG was used in place of 31% PEG and 21% formamide was used in place of 31% PEG. Instead, 30% formamide was used and contained 10% DMSO (10% v/v). and 5% (v/v) vitamin E. Apply 50 μI high to the slide. Instead of adding the hybridization mixture, add 40 μl of the mixture to a 5 μm square. Add 5 μl of pyrrolidinone to the lens and slide 50 μl of the mixture. Add to. For every 100ul of hybridization mixture, add 5μl of IM (Add 1 mol’J DTT and 5 μl of proteinase K (1 mg/ml) solution. It is useful to learn. The hybridization reaction was then carried out at, for example, 42°C. for 5 minutes at 95°C, then 2 minutes at 42°C. Approximately 0.05% or 0.10% aurin trichloride is added to the ization mixture solution. It is also useful to add rubonic acid (ATA).

(5) Instead of adding 8 μl of antifade/Hoechst to the slide, 8 μl Add the following solutions = 1 volume of solution B is added to 9 volumes of solution A, but solution A is 0.01% 1.4 diphenylamine (anti-fading) plus discharge dyeing Hoechst (#33258; 1 ug/l) plus (50% (V/V) in glycerol) 0.0025% Evans Blue (in 50% (v/v) glycerol) Lass 50% (v/v) 1 x PBS (0,136M NaCl, 0.003 M KCI, 0.008 M NazHPOn.

0.001M KH,PO,) and solution B is a mixture of dodecyl alcohol. combined solution.

Implementation ■ Super DNA probe and in situ test to determine the presence of the Philadelphia chromosome ・The pros and cons of using hybridization ■Star l Peripheral blood or bone marrow white blood cells obtained from patients with chronic myeloid leukemia are Spread the cells onto a glass slide using the cell spin method.

pu"72zu 1" pull 1 Several 25 base synthetic oligonucleotide probes were prepared using the DNs listed in the table below. Prepared from A sequence.

person■ Probe Chromosome GenBank Name Detected positional salt BCR22HUMBCR Pue: Goi l [ζl Geki Oligodeoxynucleotides were synthesized and labeled as described in Example 1.

Vibrator 1 DazeSion Cells on slides for hybridization process? if <, 31% PE G, 30% formamide, 5xSSC, 0.1M sodium phosphate buffer, p) I 7.4. Low molecular weight denatured salmon or herring spermatozoon D of 100μs/m1 NA, 10% (v/v) Triton X-100, 10% DMS0.15X Ficl/PVP, 0.4M guanidine isothiocyanate, 10m M DTT, and 0.025 M EDTA added at a concentration of 20 μg/ml. A 20 to 25 μm hybridization mixture with a probe was used.

Place a coverslip and heat the slides at 95°C for 5 minutes and cool to 42°C. and incubate at that temperature for 25 minutes.

Cleaning inspection ■ Washing and detection were performed as in Example 1.

Chronic myeloid leukemia is associated with a characteristic chromosomal translocation between chromosomes 9 and 22, and This is the so-called Philadelphia chromosome, 229+. [Reference: Rowly, J.D. : In myeloid genetic leukemia identified by quinacrine fluorescence method and Giemsa staining method, A new consistent chromosomal abnormality, Nature 243:290 (1973); Heisterkam PN, et al.: Structural organization and ph translocation of the bcr gene Its role in. Nature 315 Near 5B (1985)] BCR remains The probe for the gene breaks the cluster containing both the 5' and 3' ends of the gene. It is prepared to have a span corresponding to the necrotic area, so when translocation occurs, there is a There are three dots of light. One bright spot indicates an unaffected chromosome. and the two weaker dots represent the non-translocated 5’ bcr gene, while the second The weaker point represents the 3' end of the bcr gene translocated to chromosome 9.

In another configuration, the sequence from the c-abl gene translocated to chromosome 22 is Obtained and prepared as described above. Label these sequences with a second fluorescent moiety and added to the hybridization solution. Now, when a translocation occurs, one positive sig The null (representing the 5' end of the bcr gene that still remains on chromosome 22) is represented in one color. (e.g. green). And another positive signal (c- translocated to chromosome 22) A second color (e.g. red) appears adjacent to the second color (representing the abl gene).

back flames Detection of fragile X chromosomes in amnion and peripheral blood mononuclear cells Toyokyo ■ Hand-made Dilute 2 ml of amniotic fluid to Ihl with PBS and centrifuge for 10 minutes at 1200 rpm. do. The obtained cell pellet was immersed in an 800 μm ethanol-methanol mixture (V/V , 3:1). 200 μl of sample was placed on each slide using a cell spin method. put. In addition, approximately 5,000 peripheral blood mononuclear cells obtained from a normal male were , place the cells on a glass slide using the spin method.

1 uni 1 ■ dish made As described in Example 1, the sum of 25-base numbers consisting of SEQ 10 NO: 3: The oligonucleotides are synthesized and labeled.

Hybridization and ´° Perform hybridization, washing and detection as described in Examples 1 and 13. .

Fragile X syndrome is caused by a specific DNA fragment (long It is caused by a mutation that increases the size of the CGP (containing unique repeats of CGP).

References, e.g. Francois Rousseau, M.D., et al., N. Engl. J Med, 325:1673-1681 (1991).

Following the steps previously described, upon amplification of the CGG DNA fragment, the signal There is an increase in intensity. Quantify the signal using one of a number of image analysis methods.

and to determine whether amplification of the fragile X chromosome, e.g. CCG, is present. Compare with normal controls. Such an image analysis method is, for example, Meridia. ACAS 570.n Instruments, Okemos, Ml; Perseptive Systems, Inc., League C1 ty, TX Instruments; and Applied Imagine g, 5anta C1ara, CA.

Including.

Fact 1 basis Enrichment of fetal nucleated red blood cells in maternal blood using a direct negative selection method A sample consisting of 201 maternal peripheral blood was diluted to 351 with buffer A and 50 151) Iist in 11 conical tubes.

Overlay on paque-1083. Centrifuge the tube at 700Xg for 30 minutes. and then assemble the middle layer into a new 5011 conical tube and buffer the volume. Set it to 401 with liquid A. Connect the conical tube and run 1000 rpm for 10 minutes (20 Centrifuge at 0xg).

The cell pellet was resuspended in 1 ml of Buffer B and pre-washed with anti-CD-45 mix with coated immunomagnetic beads.

The bead/cell mixture was allowed to react for 10 minutes, during which time any unwanted white blood cells were allowed to react with the beads. Accordingly, nucleated red blood cells (NRBCs) remain in solution. magnetic particle concentrator Work the sides of the reaction tube. The magnetic beads and the compounded substance are Collect on the side of the reaction tube adjacent to the tube. Pour the supernatant containing NRBCs. removed, cells spun, fixed in 80% ethanol for 5 min, and incubated in 5i tu　Used for hybridization.

! 1LLfi Enrichment of fetal nucleated red blood cells in maternal blood using another direct negative selection method Follow the steps of Example 15, but with the following modifications: Anti-CD-45 coated immunochemistry. Instead of using magnetic beads, monoclonal antibodies against various components of maternal blood A mixture containing antibody-coated immunomagnetic beads is added to platelets from the subject as well as Non-fetal cells are used to efficiently remove fetal target cells leaving behind.

Five bodies■five■ Is a particular antibody or mixture of antibodies suitable for use in accordance with the invention? To decide whether or not to do so, try the following steps: As in Example 4, samples of umbilical cord blood are subjected to density separation. 1ml loose Resuspend the soft layer in buffer B. 50 μm of this cell suspension was subjected to cell spin, and 3: 1 Prepare control slides by soaking and fixing in ethanol/methanol. . Remove lXl0' cells from the soft layer resuspension described above and bind to magnetic beads. Prepare test slides by adding 20 μg of the antibody to be tested. As described in Example 6 Prepare cells as described above. Microscopic examination of the slides was performed as in Example 6 and each slide was Determine the ratio of fetal nucleated red blood cells to total cells on the id. Moshi exam slip If the ratio of the slide is between 75% and 125% of the ratio corresponding to the control slide. Therefore, antibodies can be used. For example, an acceptable result is a control ID has 5NRBCs per 10,000 cells and the corresponding test slide is to have 4NRBCs per 10,000 cells.

SIL huge Enrichment of fetal nucleated red blood cells in maternal blood using indirect negative selection A sample of 201 maternal peripheral blood was diluted to 361 with buffer A and 5011 samples were diluted to 361 with buffer A. Overlay on 15m1 of old 5topaquc-1083 in the nicultube. Chu The tube was centrifuged at 700 x g for 30 minutes, and the middle layer (soft layer) was placed in a new conical culture tube. Collect in a tube. The volume is then made up to 40 ml with buffer A. tube for 10 minutes 20 Centrifuge at 0xg. Resuspend the cell pellet in solution containing monoclonal antibodies. become cloudy The monoclonal antibody was anti-CD-45 in a reaction solution with a volume of 1−+al, or are anti-CD-45, anti-CD-34, anti-CD-12, anti-CD-31, and anti-CD-4 It is a mixture of monoclonal antibodies selected from the group consisting of 4. Cells with antibodies 4 Incubate for 30 minutes at °C. The mixture was then microcentrifuged for 5 minutes at 500 ρ. Separate and aspirate the supernatant. Transfer the cell pellet to 1400 ml of reaction buffer. , Cui buffer A) and resuspend the pellet in 1 ml buffer B. Then thin The cell suspension was added to a pre-washed ben coated with goat anti-mouse IgG. ds) and allow the mixture to react for 10 minutes, during which time unnecessary cells (white blood cells) Most of the cells (globules and red blood cells) react with the beads, resulting in cell/bead complexes. complex The reaction solution is then removed by a magnetic particle concentrator, which transfers the complexes to the reaction tube. gather on one side of the block. The supernatant containing NRBCs was directly poured into the slide to make slides. Place on a cell spinner.

The slides were fixed with 80% ethanol and fluorescent in 5iLu hybridase Use for

1 ship based Detection of fetal nucleated red blood cells enriched from maternal blood and simultaneous detection of chromosomal abnormalities The slides prepared according to Examples 15, 16 and 17 were transferred to the embryonic organ as in Example 3. A probe for moglobin cell mRNA and a probe for macrochromosome as in Example 4. Hybridize on the slide in one step using the probe.

FIG. 10 shows fetal hemoglobin cell mRNA as described in Example 4, part B. DNA probes of the opposite sex and for macrochromosomes X and Y as described in Example 4, Part A. Fetal nucleated red blood cells are shown simultaneously hybridized to the probe. Green The cytoplasm contains I (fluorescein-labeled probe for bF mRNA). The signal is derived from the cell, indicating that the cell is a fetal nucleated red blood cell. . The green dots on the vegetation indicate X staining from a fluorescein-labeled probe for the X chromosome. It is a signal for color bodies. The red dots on the vegetation are rhodamine markers for the Y chromosome. This is a signal for the Y chromosome from the identification probe.

Implementation 5■ Detection of enriched fetal nucleated red blood cells from maternal blood using indirect immunofluorescence techniques Another step of fetal cell detection is to perform the steps of Example 18 modified as follows. This is an alternative to using a DNA probe for fetal hemoglobin mRNA. The fetal hemoglobin protein (Accurate Chemical, ca. Enrichment using monoclonal antibodies against T, no, IRX G-11149) The cells were fixed in 2% paraformaldehyde for 2 hours, and the fixative was removed by washing. Then react with anti-HbF antibody diluted 1:100 for 30 minutes. addition The amount of antibody is 220 Mg per million fetal red blood cells in the sample. . Excess antibody is removed by washing cells twice with PBS. Next, selective anti-HbF bound to antibody (Buro-Path, Ltd.) and treated with alkaline phos77tase. Stain the cells for 30 minutes with an i:loO diluted solution of the monoclonal antibody to be labeled. do. Excess antibody was removed by washing with PBS, and Vector was used as a substrate. Add Red (Vector Chemical Co.) to the cells. after that Remove excess substrate by washing with the stem knob. Cells were spun onto a glass slide. and used for in 5 itu hybridization as in Example 18.

Disaster ■Takeshi Enrichment of fetal cells in maternal blood by lysis of maternal red blood cells Maternal blood analyte 0.07 Treat with 5M KCI for 15 minutes at 37°C.

This process selectively lyses maternal red blood cells and eliminates all nuclear cells present in the sample. Leave it intact. The lysate is then treated with anti-CD-45 or further Generally, maternal blood cells are coated with one or more antibodies directed against surface antigens. bead. The mixture was then reacted with ) Remove the beads along with the cells from the mixture with a magnetic particle collector. The remaining liquid is basically contains fetal nucleated red blood cells, which can be prepared in cell spin slides as described previously. Use for making. This process is carried out entirely in automated equipment.

The foregoing description of preferred embodiments of the invention has been presented for purposes of illustration and description. It is something. They do not cover the entire invention and limit the invention to the scope of the disclosure. There is no disclosure whatsoever. and many modifications and variations have been made in reference to the foregoing teachings. Of course, it is also possible. Use specific examples to best explain the principles and applications of the invention. , and those skilled in the art (those skilled in the art) can use it to explain various things using various specific examples. The modifications have been selected and described in order to best utilize the invention.

It is believed that the scope of the invention is defined by the claims appended hereto.

In maternal blood for in situ hybridization Fetal cell enrichment and identified sequence list (1) General information (i) Applicant: Asgari 9 Mortezza Prashad, Nagindra cubenge. michael lee (1. Name of the invention: In-situ (IN 5TTU) hybridization maternal blood for Enrichment and identification of fetal cells in fluid (iii) Number of arrays: 21 (iv) Contact information (^) Addressee: James F., Attorney Weiler (B) City: One Riverway, Chute (D) State: Texas (E) Country: United States CF) Postal code Near 7056 (V) Computer readout format (A) Media format: Furonobi disk (B) Computer: IBM and PC compatible Type (C) O3: PC-DO3/MS-DO3 (D) Software: Word Par Effect 5.1 (vi) Data of the present application (A) Application number: (B) Application date: 1993.7.19 (C) Patent classification: (vi) Attorney/Agent Information (^) Name: Eyler, James F (B) Registration number: i6,04 0 (C) Reference/Content abstract number: D-5507CIPCT (ix) Telephone information (A) Telephone: Near 13-626-8646 (B) Fax: Near 13-963 -5853 (2) SEQ ID No. 1 information (i) Sequence characteristics (A) Length: 24 base pairs (B) Type: Nucleic acid (C) Strandness: Single (D) Phase: Straight line (11) Molecular format: DNAC genomic) (iii) Assumption 2N○ (1■) Antisense 2N0 (xi) Sequence description: SEQ ID No, IATCGAGTAGT GGT ATTTCACCGGC (2) SEQ ID No. 2 information (1) Array characteristics (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Strandness: Single (D) Phase: Straight line (11) Molecular format: DNA (genomic) (iii) Assumption 2N0 (1v) Antisense = NO (vi) Sequence description: SEQ ID No, 2TACGCTCGAT CCAG CTATCA GCCGT (2) SEQ ID No. 3 information (1) Array characteristics (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Strandness: Single (D) Phase: Straight line (11) Molecular format: DNA (genomic) (iii) Assumption -NO (1■) Antisense: N.

(xi) Sequence description: SEQ ID No, 3CGGCGGCGGCGGCG GCGGCG GCGGC (2) SEQ ID No. 4 information (1) Array Characteristic (A) Length = 443 base pairs (B) Type: Nucleic acid (C) Strandness: Single (D) Phase: Straight line (11) Molecular format: DNA (genomic) (iii) Assumption: N (xi) Sequence description: SEQ IDNo, 4ATGGGTCATT TCACA GAGGA GGACAAGGCT ACTATCACAA...GTGGA AGATG CTGGAGGAGA AACCCTGGGA AGCTCCTG GT...GGTTCTTTGA CAGCTTTGGCAACCTGTCC T CTGCCTCTGC...TCAAGGCACA TGGCAAGAAG GTGCTGACTTCCTTGGGAGA...ATCTCAAGGG 　CACCTTTGCCCAGCTGAGTG　AACTGCACTG　・・ ・CTGAGAACTT CAAGCTCCTG GGAAATGTGCTG GTGACCGT・・・・AAGAATTCACCCCTGAGGTG C AGGCTTCCT　GGCAGAAGAT　・　・・CCCTGTCCTC CAGATACCACTGA ・ ・ ・ ・ GCCTGTGGGG CAAGGTGAAT 60・・・TGTCTACCCA TGGACC CAGA 120・・・CATCATGGGCAACCCCAAAG 1 80・・・TGCCATAAAG CACCTGGATG 240・・ ・TGACAAGCTG CATGTGGATC300・・・TTT GGCAATCCATTTCGGCA 360・・・・GGTGACTGG A GTGGCCAGTG 420 (2) SEQ I D No. 5 information ( i) Sequence characteristics (A) Length = 25 base pairs (B) Type: Nucleic acid (C) Strandness: Single (D) Phase: Straight line (ii) Molecular format: cDNA to mRNA (iii) Assumption 2N (xi) Sequence description: SEQ 10 No, 5TCAGTGGTAT CTGG AGGACA GGGCA (2) SEQ ID No. 6 information (i) Sequence characteristics (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Strandness: Single (D) Phase: Straight line (11) Molecular format: cDNA to mRNA (■) Assumption: N (xi) Sequence description: SEQ ID No, 6CTGGCCACTCCAGT CACCAT CTTCT (2) SEQ ID No. 7 information (1) Array Characteristic (A) Length = 25 base pairs (B) Type: Nucleic acid (C) Strandness: Single (D) Phase: Straight line (11) Molecular format: cDNA to mRNA (ij) Assumption: N (xi) Sequence description: SEQ ID No, 7GCCAGGAAGCCTGC ACCTCA GGGGT (2) SEQ ID No. 8 information (i) Sequence characteristics (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Strandness: Single (D) Phase: Straight line (11) Molecular format: cDNA to mRNA (iii) Assumption: N (xi) Sequence description: SEQ ID No, 8GAATTCTTTG CCG AAATGGA TTGCC (2) SEQ ID No. 9 information (1) Arrangement Column characteristics (A) Length = 25 base pairs (B) Type: Nucleic acid (C) Strandless: Single (D) Phase: Straight line (11) Molecular format: cDNA to mRNA (iii) Assumption: N (xi) Sequence description: SEQ ID No, 9AAAACGGTCA CCA GCACATT TCCCA (2) SEQ ID No. 10 information (1) Array characteristics (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Strandness: Single (D) Phase: Straight line (ii) Molecular format: cDNA to mRNA (iii) Assumption: N (xi) Sequence description: SEQ ID No, 10GGAGCTTGAA GT TCTCAGGA TCCAC (2) SEQ TD No. 11 information (1) Distribution Column characteristics (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Strandness: Single (D) Phase; straight line (11) Molecular format: cDNA to mRNA (iii) Assumption 2N (xi) Sequence description: SEQ ID No, 11ATGCAGCTTG TC ACAGTGCA GTTCA (2) SEQ ID No. I2 information (i ) array characteristics (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Strandness: Single (D) Phase: Straight line (11) Molecular format: cDNA to mRNA (ji) Assumption: N (xi) Sequence description: SEQ ID No, 12CTCAGCTGGG CA AAGGTGCCCTTGA (2) SEQ ID No. 13 information (1) Array characteristics (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Strandness: Single (D) Phase: Straight line (II) Molecular format: cDNA to mRNA (iii) Assumption 2N (xi) Sequence description: SEQ ID No, 13GATCCATCCAG GT GCTTTATG GCA Ding C (2) SEQ T D No. 14 information (1 ) array characteristics (A) Length = 25 base pairs (B) Type: Nucleic acid (C) Strandness: Single (D) Phase: Straight line (11) Molecular format: cDNA Muo mRNA (iii) Assumption 2N (xi) Sequence description: SEQ ID No. 14 CCCAAGGAA GTC AGCACCT TCTTG (2) SEQ ID No. 15 information (1) Array characteristics (A) Length: 25 base pairs (i) Sequence characteristics (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Strandness: Single (D) Phase: Straight line (ii) Molecular format: cDNA to mRNA (ij) assumption 2N (xi) Sequence description: SEQ ID No, 19GCTTCCCAGG GTT TCTCCTCCAGCA (2) SEQ ID No. 20 information (i) Arrangement Column characteristics (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Strandness: Single (D) Phase: Straight line (ii) Molecular format: cDNA to mRNA (1j) Assumption: N (xi) Sequence description: SEQ rD No, 20TCTTCCACAT TC ACCTTGCCCAC^(2) SEQ ID No. 21 information (i) Array characteristics (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Strandness: Single (D) Phase: Straight line (ii) Molecular format: cDNA to mRNA (ii) Assumption 2N (xi) Sequence description: SEQ ID No, 21GGCTTGTGAT AGT AGCCTTGTCCTCFIG, IA-1 FIG, IB-1 FIG, 6A FIG, 6B FIG. 7 FIG, 8A FIG.88 FIG, 8C FIG. 9A-I FIG, 9A-2 Copy and translation of amendment) Submission (Article 184-8 of the Patent Law) January 17, 1995 Day

Claims (68)

[Claims] 1. A method for identifying fetal cells in a subject comprising the following steps; Collecting a specimen containing fetal cells; Concentrate (enrich) the number of fetal cells in the subject; and Although it does not exist in adult cells (non-fetal cells), it does not exist in fetal cells. marker detection, the method is performed on cells with substantially intact cell membranes. and target nucleic acid by in situ hybridization. Detection is performed. 2. The sample is derived from maternal peripheral blood, umbilical cord blood, placental tissue, villi, and amniotic fluid. The method according to claim 1, wherein the method is selected from the group consisting of: 3. 2. The method according to claim 1, wherein the sample is maternal peripheral blood. 4. The fetal cells identified are the trophoblast and the fetal nucleated erythro. The method according to claim 1, wherein the method is selected from the group consisting of red blood cells. 5. the marker is a fetal cell antigen, and the fetal cell is The fetal cell antigen is detected using antibodies and ligand binding. Globin, cytokeratin, β-subunit of chorionic gonadotropin, chorionic hormone Matmanmotropapin (lactation hormone), pregnancy-specific glycoprotein and alpha-feline The target nucleic acid is selected from a group of peptides consisting of target proteins, and the target nucleic acid is NA, virus-derived DNA, mRNA. Consists of hnRNA and chromosomal DNA 2. The method of claim 1, wherein the method is selected from the group. 6. The fetal cells are detected using a fluorescently labeled antibody to cytokeratin. The method according to claim 5. 7. the marker and the target nucleic acid are not present in adult cells normally present in the subject; The method according to claim 1, wherein the mRNA is present in fetal cells. 8. The mRNA is fetal hemoglobin mRNA, embryonic hemoglobin mRNA , cytokeratin mRNA, chorionic gonadotropin β-subunit mRNA, chorionic somatolactation hormone mRNA, pregnancy-specific glycoprotein mRNA, α-F selected from the group consisting of protein mRNA and transferrin receptor mRNA. 8. The method according to claim 7, wherein the method is disclosed. 9. A second target nucleic acid is simultaneously detected by said in situ hybridization. 9. The method according to claim 8, wherein the method comprises: 10. The second target nucleic acid is virus-derived RNA, virus-derived DNA, mR Claim 9 selected from the group consisting of NA, hnRNA and chromosomal DNA. Method described. 11. 10. The method of claim 9, further comprising the following steps; meter and record the amount of fluorescent label detected. 12. If the sample is from maternal peripheral blood, umbilical cord blood, placental tissue, villi, or amniotic fluid. 12. The method according to claim 11, wherein the method is selected from the group consisting of: 13. The fetal cells to be identified are selected from the group consisting of trophoblasts and fetal nucleated red blood cells. 12. The method according to claim 11. 14. The fetal cell mRNA includes fetal hemoglobin mRNA, cytokeratin mRNA, ciliary gonadotropin β-subunit mRNA, chorionic somatolactation Hormone mRNA, pregnancy-specific glycoprotein mRNA and α-fetoprotein mR 12. The method of claim 11, wherein the material is selected from the group consisting of NA. 15. In situ hybridization is performed in aqueous suspension, where Fluorescently labeled oligonucleotide probes are introduced into the hybridization and then pass the cells through a flow cytometer and measure the amount of fluorescent label detected. 2. The method of claim 1, including the step of recording. 16. 16. The method according to claim 15, further comprising the step of selecting fetal cells from other cells. Law. 17. The fetal cells identified are selected from the group consisting of trophoblasts and fetal nucleated red blood cells. 16. The method according to claim 15, wherein the method is disclosed. 18. The fetal cells are detected using an antibody against the fetal cell antigen, and the antigen is detected therein using an antibody against the fetal cell antigen. is the β-subunit of fetal hemoglobin, cytokeratin, and chorionic gonadotropin. fetal globin, chorionic somatolactin hormone, pregnancy-specific β-glycoprotein and The method according to claim 15, wherein the protein is selected from the protein group consisting of . 19. The 1 n situ hybridization comprises the steps of: The method described in Section 1. (i) containing at least one reagent selected from the group consisting of precipitating agents and cross-linking agents; fixing the fetal cells in a medium that (ii) The fixed analyte is treated with a denaturing agent, a hybrid stabilizer, a buffer, a selective membrane, etc. the pore-forming agent and the target nucleotide sequence to be detected, at least substantially at least one synthetic oligonucleotide having a nucleotide sequence complementary to contact the hybridization solution containing the hybrid probe. The contact may be carried out under hybridization conditions in which at least one detectable label is present ; (iii) and detecting hybridization using the label. 20. The hybridization conditions are at a temperature of about 15°C to about 99°C for about 5 minutes. 20. The method of claim 19, wherein the method is for about 240 minutes. 21. the medium further selected from the group consisting of analogs of fluorescent dyes; 20. The method of claim 19, comprising: 22. 22. The method of claim 21, wherein the fluorescent dye analog is aurintricarboxylic acid. . 23. The fetal cells identified are selected from the group consisting of trophoblasts and fetal red blood cells. 20. The method according to claim 19. 24. The nucleic acid is selected from the group consisting of virus, chromosome, DNA or mRNA. 20. The method according to claim 19. 25. Is the virus human immunodeficiency virus, hepatitis virus, or herpes virus? 20. The method of claim 19, wherein the method is selected from the group consisting of: 26. The chromosomes are X chromosome, Y chromosome, chromosome 1, chromosome 13, chromosome 16, A claim selected from the human chromosome group consisting of chromosome 18 and chromosome 21 19. The method described in 19. 27. The label may be a radioactive label, a fluorophore, a chemiluminescent 20. The method according to claim 19, which is selected from the group consisting of: Law. 28. The label is fluorescein, coumarin, rhodamine, rhodamine derivative and phycoerythrin. . 29. At least two nucleic acids therein must be assayed simultaneously in the same sample. The method according to claim 19. 30. 21. The method of claim 20, wherein said method is completed within about 5 minutes to about 30 minutes. Method. 31. 20. The method of claim 19, wherein the nucleic acid is characterized by genetic abnormality. 32. 32. The method of claim 31, wherein said genetic abnormality is a deletion. 33. Deletion there creates a probe capable of hybridization to the target sequence. 33. The method of claim 32, wherein the method is identified by detecting the absence of binding. 34. The method according to claim 31, wherein the genetic abnormality is addition or amplification. . 35. The additions therein are directed against repeating segments of polynucleotides in chromosomes. 35. The method of claim 34, wherein the method is identified by detecting the binding of a labeled probe to . 36. The person according to claim 31, wherein the genetic abnormality is a translocation or rearrangement. Law. 37. 37. The method of claim 36, wherein the translocation is identified in the steps of: Labeled probe for the marker region of the polynucleotide part of the translocated chromosome binding of the labeled probe; and detecting the binding of the labeled probe. 38. 37. The method of claim 36, wherein the translocation is identified in the steps of: binding of a first labeled probe to a marker region of a chromosome that is not translocated; binding of a second labeled probe to the region of the second chromosome to be translocated; and Detection of binding between one probe and the second probe. 39. Nucleic acid in fetal cells with substantially intact cell membranes, consisting of the following steps: A method for detecting the presence of by cell nucleic acid assay; (i) A denaturing agent, a hybrid stabilizer, a buffer solution, selective membrane pores, etc. forming agent, and the specificity target nucleotide sequence to be detected, at least substantially at least one synthetic oligonucleotide having complementary nucleotide sequences; contact with the medium containing the probe. This contact causes at least one detectable fluorescence (ii) carried out under hybridization conditions in the presence of a dye label; and Hybridization is detected using the label. 40. The hybridization therein is carried out at a temperature of about 15°C to about 90°C; 40. The method of claim 39, wherein the time period is from about 5 minutes to about 240 minutes. 41. 40. The method of claim 39, wherein the medium further comprises a fixative. 42. 40. The method of claim 39, wherein the medium further comprises an analog of a fluorescent dye. 43. 43. The fluorescent dye analogue of claim 42, wherein the fluorescent dye analogue is aurintricarboxylic acid. Method. 44. In this method, a target nucleotide sequence of approximately 75 bases is determined by visual microscopic observation. 40. The method according to claim 39, wherein the method is detectable. 45. The nucleic acid is selected from the group consisting of viruses, chromosomes, DNA and RNA. The method according to claim 39. 46. The viruses include human immunodeficiency virus, hepatitis virus and herpes virus. 46. The method of claim 45, wherein the method is selected from the group consisting of: 47. The chromosomes are X chromosome, Y chromosome, chromosome 1, chromosome 13, chromosome 16, The person according to claim 45, which is selected from the group consisting of chromosome 18 and chromosome 21. Law. 48. The label is selected from the group consisting of radioactive labels, fluorophores, chemiluminescent labels, and enzyme labels. 40. The method of claim 39, wherein the method is disclosed. 49. The label is fluorescein, coumarin, rhodamine, rhodamine derivative and phycoerythrin. Method. 50. 39. At least two nucleic acids are assayed simultaneously in the same sample. Method described. 51. 41. A method according to claim 40, wherein the temperature therein is between 40<0>C and 50<0>C. 52. 41. The method of claim 40, wherein the temperature there is 85<0>C. 53. The method according to claim 40, wherein the method is completed within about 5 minutes to about 30 minutes. Law. 54. 40. The method of claim 39, wherein the nucleic acid is characterized by genetic abnormality. 55. 55. The method of claim 54, wherein the genetic abnormality is a deletion. 56. The deletion prevents the binding of a hybridizable probe to the target sequence. 56. The method of claim 55, wherein the method is identified by detecting the absence of a combination. 57. 55. The method of claim 54, wherein the genetic abnormality is addition or amplification. 58. The addition is a target for polynucleotide repeat segments of the chromosome. 58. The method of claim 57, wherein the method is identified by detecting binding of a specific probe. 59. 55. The method of claim 54, wherein the genetic abnormality is a translocation or rearrangement. 60. 60. The method of claim 59, wherein the translocation is identified in the steps of: binding of a first labeled probe to a marker region of a chromosome that is not translocated; binding of a second labeled probe to the second chromosomal region to be translocated; and detection of binding between the first probe and the second probe. 61. 60. The method of claim 59, wherein the translocation is identified in the steps of: Labeled probe for the marker region of the polynucleotide part of the translocated chromosome binding of the labeled probe; and detection of binding of the labeled probe. 62. A kit for identifying fetal cells in a subject, comprising: A means for concentrating (enriching) the number of fetal cells; and a means for detecting the presence of the fetal cells. 63. The means for concentrating the fetal cells is density gradient centrifugation. Density gradient centrifugation was performed on silica coated with colloidal polyvinylpyrrolidone, non-coated with The use of a density gradient mixture selected from the group consisting of ionic polysaccharides and Nycodenz The kit according to claim 62. 64. The means for detecting the fetal cells is a target for antigens on the surface of fetal cells. Detection of binding of natural antibodies, staining of fetal cell peptides, and detection of fetal cell mRNA. Detection of binding of synthetic oligonucleotide probes with specificity 63. The kit of claim 62, wherein: 65. The means to detect fetal cells is to stain fetal cell peptides. , and the fetal cell peptide is fetal hemoglobin. t. 66. or a fluorescently labeled antibody against cytokeratin or fetal hemoglobin. 65. The kit according to claim 64. 67. A kit for detecting fetal cell nucleic acid in a subject consisting of the following components; Hybridization containing denaturants, hybrid stabilizers, buffers and pore formers solution; Supply of synthetic oligonucleotide probes, which probes are hybridized with target nucleic acids. is possible. 68. further comprising a detectable label capable of detecting hybrid formation. 68. The kit of claim 67.