JPH07502417A - Rabbit single domain antibodies and their uses - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Rabbit single domain antibodies and their uses Background of the invention With the advent of hybridoma technology, a single species of antibody (which possesses the desired properties against the antigen) Monoclonal antibodies. Also referred to herein as rmAbJ.

) made possible the production of (Kohler, G., and Milstein, C., Nature, 256: 52-52 (1975)). however , hybridoma cultures typically have low production capacity and are unstable. It is believed that

To avoid this problem, techniques to bypass hybridomas have recently been developed. By doing so, the antibody gene is transferred to the lymphocytes of the immunized animal. can be directly cloned and expressed in bacteria. For example, complete The entire antigen-binding molecule was expressed from prokaryotic cells using a two-phage system and It has been secreted. In this system, each phage is isolated from immunized mice. Expressing VDJ or VL gene segments isolated from B cell mRNA obtained from I was able to do it. These two phage systems are present in E. coli. be recombined to co-express the VDJ and VL gene segments. CI (use, et al., 5ci), which becomes a complete antigen-binding molecule ence, 246: 1275-1281 (1989)), in another example. In this case, a mouse immunoglobulin (Ig) H chain single domain antibody is E. was expressed in E. coli and found to be sufficient to bind antigen. o [Ward, et al, Nature, 341:544-546 (+989)).

Antibodies from different species recognize different antigenic epitopes on one antigen. (S. Twining, et al., Biochem, 191: 681-697 (+980)). Until now, domestic rabbits have been exposed to natural or modified antigens. for the production of polyclonal antibodies with high affinity and specificity directed against It was the chosen animal. However, mAbs from this species , 9 were not available until now.

Enzyme-linked immunosorbent assay (ELISA) is a solid-phase immunoassay using antibodies. It has become a general-purpose practical tool in physics and medicine [Endwall, e. tal, , Biochem, Biophys, Acta, 251: 427 (1971)).

These assays are commonly used for rapid diagnosis of disease and are used in research and It has great commercial importance in both human health care and human health care. These assays The main principle of this method is the direct immobilization of antibodies onto plastic (Cattan et al. d Tregaer, 5science, 158:1570-1572 (+ 967)). As a result, simple washing of the plastic solid phase Bound reactants from unbound reactants added stepwise in the process of completion allows separation of reactants from unbound.

Monoclonal antibodies are usually tested in vitro, such as in the sandwich ELISA described above. Used in vitro diagnostics. Unfortunately, monoclonal antibodies Direct absorption onto plastics commonly used as solid phase in LISA assays It has been shown that antigen affinity, that is, antigen capture ability, decreases when (Butler, et al, Mo1ecutar Immun,... 23:971-982 (1986)) a Hydrophobically absorbed by plastic One explanation for this apparent low affinity of monoclonal antibodies may be due to absorption. The induced denaturation may result in a change in the antigen binding site (Sute r and Butler, Immun, Lett, 13:313-316 (1986)). of the capture antibody used in the sandwich ELISA. As a result of absorption-induced loss of antigen capture capacity, the assay loses valuable sensitivity.

To avoid direct interaction of the capture antibody with the solid phase, the streptavidin biotinylated carrier protein adsorbed onto plastic Allows the monoclonal antibody to bind tightly to this solid phase. A method has been developed. Developed by 5uter and Butler This system is called protein-avidin-biotin capture (PABC) system. (Suter and Butler, [mmun, Lett, ditto: 5uter, et at, Molecular Immun,,’26 :221-230 (1989)) o However, the use of the PABC system use may add additional complexity and cost to the assay, therefore, determining appropriate affinity and Sandwich EL [ Technology 1 is to produce antibodies that also have the ability to directly bind to a solid phase in SA. desired.

This allows diagnostic assays to be more sensitive while reducing complexity and cost. This would allow the development of

Summary of the invention According to the present invention, solid phase (e.g. plastic recombinant rabbit heavy chain variable domain or single domain having the ability to bind to antibodies are provided. The present invention further provides that the rabbit single domain antibody of the present invention is a capture antibody. An improved immunological sanitation system that is directly attached to a solid phase as EL [SA-like]. The resulting assay is It is less complex than other systems in use and offers no significant difference in sensitivity. There is no significant decrease.

Brief description of the drawing Figure 1 shows PCR amplification of mRNA (lane 2) isolated from rabbit PBL. from the cloned VDJ gene or the cloned VDJ gene (7. A 2% agarose gel comparing the amplified genes of Section 3) is shown. lane l is the 123 bp standard and its multimer.

Figure 2 shows the results of inhibition experiments using colony plaque lifts. various molar amounts of native protein C (B) (lanes 2-5) or BSA (A) (lane 1). Clones 17.1 (lanes 1-3) and 21.1 (lane 4) when inhibited ~5) Labeled protein to nitrocellulose-binding gene product expressed by Binding of Tin C.

FIG. 3 is a graph showing the specificity of antigen binding as demonstrated by ELISA. nine Loans 21.1 (’A), 17.1 (B), 16.1 (C) and 13 ．． Bacterial supernatants produced by 2(D) were tested for binding to protein C. It was done. The OD obtained is shown as a function of time after induction with IPTG. There is.

detailed description of the invention According to the present invention, solid phase ( A recombinant rabbit single domain antibody that has the ability to bind to (e.g. plastic) provided.

More specifically, the invention provides recombinant rabbit single domain antibodies, their production and use. It is directed towards. Genetic encoded, rabbit heavy chain variable domain or single domain antibody Rearranged genes for example can be cloned or gene synthesized and can be produced by inserting it into an appropriate expression vector. expression vector is then used to transform compatible host cells, which in turn the single domain antibody is expressed and preferably secreted. is allowed.

One method to prepare such gene segments is to combine the following elements: (Huse, et at, 5science, 246:1275- 1281 (Blind 989)).

1. Nucleic acid sequences or DNA containing a substantial part of the immunological repertoire of domestic rabbits isolated, 2. Click the polynucleotide segment containing the Immu11019278 gene. preparing polynucleotide primers for loaning; 3. A gene library containing multiple different genes from this repertoire. Prepare the lee. ■ Then, in a suitable host. express the polynucleotide and 4. target the expressed polypeptide with a preselected activity (e.g. for example, screening for affinity binding to a protein of interest).

Nucleic acid sequences containing a substantial portion of the immunological gene repertoire of domestic rabbits can be used to produce antibodies. Preferably from a heterogeneous population of cells, namely B lymphocytes (B cells). in the circulation of infected, immunized or partially immunized rabbits with the antigen of interest. can be isolated from rearranged B cells found in the spleen or in the spleen. Such a resource Lymphocytes include, for example, peripheral blood lymphocytes (PBL).

Immunization can be performed by conventional methods. The animal's antibody titer is at the desired stage of immunization. can be monitored to determine the desired repertoire enrichment or Responds to bias. Partially immunized animals typically receive only one immunization. cells are collected from them immediately after a response is detected. completely immune The treated animals exhibit a peak titer of antigen to the host animal, usually within 2 to 3 weeks. This can be accomplished with one or more repeated injections at intervals between. Usually the last challenge After 3 to 5 days, the spleen is removed and the spleen cells (approximately 90% of which have been rearranged) are removed. The genetic repertoire of B cells (A) is isolated by standard procedures (A usubel, et at, ”Current Protocols i n Mo1ecular Biology”, eds, John Will ey & 5oz.

NY, ). Any strain of domestic rabbit can be used depending on the desired allotype.

The rabbit immunoglobulin gene is a genomic material containing the gene expressing the variable region. Messenger RNA (mRNA) representing the sample or the transcript of the variable region It can be isolated. Using genomic DNA from sources other than 8928 spheres that have not been rearranged Sometimes, when locating the sequence encoding the variable region, the sequence Care must be taken, as they are separated by a tunnel. This disclosure Based on this, it can be easily performed by skilled craftsmen. Contains appropriate equinone The resulting DNA fragment is isolated, the intron is excised, and the intron is spliced in the proper order and orientation. Using rearranged B cells , alternative techniques are preferred. Because constant (C), diversity (D) and (J) Immunoglobulin gene sites are moved adjacent to each other and This is because the sequence is continuous throughout the variable region (does not include introns). be. When mRNA is used, cells are placed under RNAase inhibiting conditions. Must be dissolved. mRNA is extracted from other RNA by oligo deoxythymidine. separated by chromatography. Next, the complementary strand, cDNA, is reversed. Synthesized on this mRNA template using transcriptase and appropriate primers, RNA- A DNA heteroduplex is created (Gubler, et al., Ge Ne, 25:263-269 (1983)). The second strand of DNA has several For example, one of the methods of (The RNA-DNA heteroduplex was inked with RNAase.) (done by decubating) and using DNA polymerase Thus, or a synthetic oligodeoxynucleo annealed to the 3' end of the first strand. By briming with Tidobrimer and the use of DNA polymerase, can be done.

Isolation of poly8 selective mRNA and first strand cDNA was also performed by Invitrogen, using a commercially available kit from Madison, Wisconsin. can be achieved.

To amplify the DNA homolog encoding vH using PCR reaction reaction amplification two primers must be used for each coding strand of the nucleic acid to be amplified. do not have. The first primer is part of the non-sense (minus or complementary) strand. and conserved nucleotide sequences between the V□ (plus) strands in the repertoire. hybridize. To produce a DNA homologue encoding VH, The first primer therefore contains three parts of the immunoglobulin gene, the CH1 part, the Hin /% blitype (i.e., this (complementary to). J, CHI and hinge portions are preferred. ■8 To produce a DNA homologue encoding VH, the second primer is At the 5° end of the immunoglobulin gene encoding the Conserved nucleotides in the region coding for the framework region selected to hybridize with the sequence. One of the first and second primers or Both may contain nucleotide sequences that define endonuclease restriction sites. can. The site is atypical to the immunoglobulin gene being amplified. and typically appear at or near the 5′ end of the primer. Ru. Use of primers with restriction sites is useful if the DNA has a 5° or 3° overhang. can be cleaved with at least one restriction enzyme leaving a nucleotide that is It has the advantage of saying. The NA of such a blunt end can be taken directly in that way. Compared to fragments, they are more easily cloned into corresponding sites in a vector. this The double-stranded cDNA produced at the end of the cycle is digested with appropriate restriction enzymes (which are can be selected experimentally based on ), Cronin can be easily inserted into vectors. Preferably, the choice of restriction sites is double-stranded (ds ) such that the cDNA is cloned directly into an expression vector.

Preferably, the heavy chain primer pair each has a convenient restriction site for cloning. It consists of the v14 primer and the J, primer. For example, im Kabat database on noglobulins [Kabat, et al. , -3equences of Proteins of Immunolo gical Interesji, 5th Ed, (U, S, Department ment of Health and Human 5 services) (1 991)) to determine the amino acids and codes found in domestic rabbits of the desired allotype. It is possible to analyze the distribution of

v, 4 and J cloned from the domestic rabbit VHal allotype according to the present invention, Analysis of the nucleotide sequences of M, 5 uter revealed a high degree of homology. , et al, J, rmmunol, 1881:1997-200 0 (1990): E, Kabat, et al, “5equenc es of Proteins of Immunologic Intere sji, same as above; L, A, DiPetro, et al, J, [mm unol, 20:14011404 (1990); R, Becker, et al, J. Immunol, 142:1351-1355 (1989); R, S, Becker, et at, Eur, J, [mmunol, 20:397-402 (1990)], these data allows the synthesis of VHal-specific oligonucleotide primers (Table 1). . For example, a 39 base pair 5°■8 primer has two different primers at two positions. Designed to be degenerate with respect to nucleotides. Similarly, 24 base pairs of J, O The oligonucleotide is designed to reverse-brime to the 3' end of the heavy chain variable gene. can do. These primers encode VHal allotypes. PCR using cloned genomic DNA containing the DJ gene segment. (M, 5uter, et al, , J, Im munol,, ibid.].

These primers contain sequences that are precisely complementary to the target sequence to which they anneal. There is no need to have one. For example, by nucleotide variations or due to the introduction of restriction enzyme sites. Therefore, differences may occur. Allows the primer to anneal to double-stranded nucleic acid The annealing mixture can be modified by relaxing the annealing conditions to It is possible to adjust the conditions inside the object.

The DNA polymerase used in this method can be any DNA polymerase known in the art. It may also be an NA polymerase, such as Taq polymerase, or VentO such as polymerase (New England Biolabs, Inc.) Any commercially available product may be used. used for each polymerase The conditions under which this occurs are well known. The polymerase reaction consists of four nucleoside trinucleotides. carried out in the presence of phosphoric acid. These and the polymerase enzymes are already present in the sample. However, it can be supplied freshly for each cycle.

DNA1! The denaturation can be carried out by known methods, such as heating the sample. I can do it. If heating is used to control the process, use appropriate heating The cells were denatured at about 95°C for about 1 minute and incubated at 3°C to 65°C for about 1 minute. Includes kneeling and brimer extension for approximately 2 minutes at approximately 75°C. That's what happens. To ensure that the extension and renaturation are complete, V When using an ENT polymerase, the mixture after the final cycle is preferably The temperature is maintained at about 72°C for about 5 minutes.

The product, double-stranded cDNA, is subjected to gel electrophoresis using, for example, an agarose gel. Therefore, it can be separated from the mixture. However, if you wish, double stranded The cDNA can be used in unpurified form and can be directly cloned or cloned using conventional methods. It can be inserted into an expression vector. This means that if the primer recognizes the restriction enzyme This is especially easy if it includes parts.

For construction of the VDJ gene library, combinatorial bacteriophage Used by Vector CD, Huse, et al, 5science, same as above. can. This system is located at 5tracyte, California, US Commercially available from A. In short, the amplified DNA is e.g. Exchange resin column (Quiagen, Kontron, Switzerland) and ethanol It is purified using precipitation. The purified and ethanol precipitated DNA was Digested with a ~3-fold excess of the appropriate restriction enzyme and repurified as described above. Be vector arm (e.g. λHC2) (D, Huse.

For ligation to et al., 5science, supra], insert The amount of body and vector DNA was determined using the DNA indicator system (1nvitro gen). Various insert/hectare ratios approaching equimolar amounts are , was experimentally ligated, and a partial amount was obtained using the Gigapack Plus II kit. (Stratagene). The resulting library has a titer be measured. Inserts/vectors that yielded the highest titers in test ligations A larger size library can be constructed using a larger size library. obtained Allotype-specific determinant libraries were isolated using allotype-specific antisera. can be assayed for expression. Affinity purified and bio Antibodies (M, 5uter, et al, J, [mmuno Id.] was plated (see below) and then the 126I-labeled stock was plated (see below). After leptavidin treatment, a nitrocellulose filter (Schleiche r and 5chue11. expressed V coupled to (Zurich, Switzerland) CM, 5uter, etc. that can be used to screen DJ genes 　at,,M.

1, [mmunol, 26:221-230 (1989)). It takes In addition, E. coli XL-I Btue cells are sensitive to approximately 10S phage particles. The seeds were dyed at a concentration of 30-35X 103 pfu/150 mm. be done. Re-screening consisted of biotinylated protein C and 126I-labeled stocks. CM performed using leptavidin, 5uter, Mo! , [mmun ol,, ditto].

Expression vector pSWI-VHpolyTag1 was derived from rabbit VDJ gene. Gene [Ward, et, at, Nature, 381:544-546 ( +989)). This plasmid was tested in solid-phase assays. To facilitate the detection of the expressed protein by Staphylococcal protein A. (SpA, Pharmacia, Uppsala, Sweden) mono-Fc binding Fusion proteins can be created using the parts. The coding region of the Fc binding part is PC Amplified by R and cloned in frame into the Pst1 site, the plasmid p Generate SWI-VH3pApolyTagl. psWI-VH3pApoly The fusion protein expressed by Tagl immobilizes the unique Fc-binding portion of 5pA(7). The purified solution was applied to a 96-well microtiter well as described above to Detected by ELISA using 1 g of rabbit and then using a suitable detection system. Ru.

Additionally, in order to immobilize the desired antibody from a starting population of more than 10° protein, the selected Systems for selecting for binding of antibodies, e.g. single domain antibodies, to antigens ( McCafferty, er al.

, Nature, 348:552-554 (1990)). can. For example, fusion proteins between sFv and viral gene concave surface proteins (phage using a system involving the production of filamentous bacteriophages with antibodies) can. The gene ■ protein is responsible for the attachment of the phage to the F pili of the target bacterium. (Kornberg, DNA Replication'' (Freeman , San Francisco) (1980)) However, genes and proteins White indicates polypeptides inserted near the amino terminus without loss of function (antibody s Fv fragments) (Smith, et al. l, 5science, 228:1315-1317 (1985); Parml ey and Sm1th, Gene, 73:305-318 (1988) ;5cottand Sm1th, Gene, 73:305-318 (198 8) ;5cott and Sm1th, 5science, 249:386- 390 (1990); Devlin, et al., 5science, 249: 404-406 (1990)), thus containing functional antibody variable regions on their surface. Replication-suitable phages can be generated that display a wide range of phages. desirable Phage containing functional antibody fragments with a different phenotype are enrichment by multiple rounds of affinity chromatography. (McCafferty, et al., supra).

Antigen binding specificity can be demonstrated by competitive inhibition and ELISA. Conflict The inhibition test was described in D. Huse, et al., 5science, supra. It can be carried out as shown in the table below. In short, for example, protein ) to predetermine biotinylated protein The amount of natural protein X is inhibited by increasing amounts of natural protein X. Immobilized single domain antibody The remaining amount of biotinylated protein bound to nitrocellulose is l! Using li-labeled SA and measured by autoradiography.

Autoradiography obtained by competitive inhibition tests, for example rMco 1000V2.0 image analysis system (Kontron, Munich, Germany) ) can be used to scan. This system is an autoradiograph gray - value and surface area. These values are the binding constants of 5DAb (E, Ward, et a L, Nature, supra; D, Huse, et al., 5science, supra ].

Phagemites from positive clones are cut in vivo using phage R408. (Strataglne, La Jolla, Californ) ia, USA) o Selected clones were developed to OD 600nrn=I and IP induced by TG (Boehringer Mannheim, Germany) for various times.

The supernatant containing secreted proteins was transferred directly to a 96-well Immulon II plate. applied, followed by biotinylated protein X and SA-peroxidizer as described above. ze is added.

The VDJ gene, which encodes a protein with binding activity to a protein of interest, is a polyacrylate Analyzes can be performed by comparing gene sites using lylamide gel electrophoresis. (T, Maniat is.

et al, Molecular Cloning: A Lab.

ratory Manual, Col1d Spring Harbor Lab oratory, USA (1982)) o genes were further analyzed by temperature shift gels. (Diagen, Dusseldorf, Germany). The system allows the determination of single base pair differences in genes and thus CD, Riesner, et al., Electroph.

resis, IO:377-389 (1989)).

Rabbit single toxins obtained by recombinant technology and prokaryotic expression system according to the present invention The main antibody can be used in immunocapture assays, e.g. sandwich ELISA assays. Generates precisely doubled single main antibodies that can be used in multiple applications. This assay In , a single domain antibody is first applied to a plastic solid phase. After washing, anti- A sample containing the source is incubated with a labeled antibody probe. next A detection system is used to determine the presence or absence of an antigen and its concentration. Ru. Alternatively, the single domain antibodies of the invention isolate the antigen of interest from a mixture of molecules. can be used for affinity isolation procedures. single domain The relatively low affinity of these antibodies is due to the fact that the single domain of the antigen is isolated after washing of unreacted molecules. Isolation from antibodies may occur if low affinity ligand-receptor interactions are used. This may be of benefit in affinity isolation as it is more effective.

The following examples of the invention are presented to illustrate the invention and not as a limitation. Served.

Example 1 Preparation of Rabbit Single Domain Antibodies Specific for Protein C is a serum protease that functions to regulate clot-forming ability through activation, Purified human protein C was used as an antigen. Rabbit against VHal allotype Homoconjugates (J, Oudin et al., J. Exp. Med, 112: 107-113 (1960)) is Dr. A. Kelus (Basel I Contributed by n5titute for Immunology, Basel, Switzerland). I received a gift. About 1 year old rabbit M, 5uter, Vet, Med, 28: 414-420. Roughly speaking, each rabbit should be completely frozen. By injecting ctooμg of protein emulsified in an adjuvant into both shoulders. received the dose. Animals were emulsified in complete Freund's adjuvant and administered subcutaneously. The protein C was boosted twice at 3-week intervals using 50 μg of purified protein C. last injection 10 After a day, the rabbits were bled and the serum was assayed using an enzyme-linked immunosorbent assay (ELISA). was assayed for binding to protein C. For this test, serum is precipitated with ammonium sulfate. precipitated (M, 5uter, Vet, Med, supra) and precipitated protein 5μ g/- is 1. J, Butlr, et ai, “Enzyme-Med 1at ed “Immunoassay” (T, T, Ngo, H, M.

Lenhof f, Eds, ) pp, 2451-276, Plenum Pre 96-well microtiter plate, as described by SS, New York. (Immulon I1.Nunc, Denmark). refined Biotinylated protein C (D, R, Gretch, et al., Analyt, Bi ochem, 163270-277 (+985)) applied the antibody. were added to the wells. The bound protein C is a protein bound to peroxidase. Leptavinon (SA) CM, 5uter, J, Immunof, Method S, 84:327-341 (1985)], then substrate CM, 5ute r et al., Immunol.

Lett., 13:313-316 (1986)). I asked. If 10 ng cm-' of protein C is detected by ELISA , I assumed that the rabbit had been successfully immunized.

Identification of primers for amplifying VDJ gene segments VHal allota Analysis of the nucleotide sequences of VH and JH cloned from rabbits of CM, 5uter et al., J. Tmrnunol, which showed a range of homology. ,, supra; E. Kabat, et al., 5 sequences of Prot eins, Vnited 5tates Department of Hea lth and Human 5service, PublicHealth 5 service, National In5 posture of Health, Bethesda, Maryland; L.A., DiPeteo, et al. , J. Immun.

11. 144:1969-1973 (1990); L, A, DiPetro , et al, , Eur, J. Immunol, , 202 1401-1404 (1990); R, Becker, et al, J, Immunol, 142 :1351-1355 (1989): R, S, Becker, et al. Eur, J. Immunol, 20:397-402 (1990)), data allowed the synthesis of VHal-specific oligonucleotide primers (Table 1).

This primer targets the VDJ gene segment encoding the VHalY rotib. Cloned genomic DNA containing, CM, Suter, et al. J. Immunol, supra]. compartmentalized A 350 bp fragment of the same size was amplified, and this molecule was modified with SpA. Vector SWI-VH3pApolyTagl (Ward, Nature, It was expressed during [Ibid.]. In the ELISA, the expressed molecules (7 in clone 4) ) reacted specifically with the VHal-specific alloantiserum as expected, but It did not react with the VHa2-specific alloantiserum used as a control. For this reason, This primer was used to detect the VDJ gene from mRNA obtained from B cells of immunized rabbits. It was subsequently used to amplify the child segments.

Isolation of mRNA or DNA and amplification of VDJ gene segments from B cells Construction of phage library Peripheral blood (PBL) IOJ was purified with protein C in saline. 100 g was injected intravenously and harvested from immunized rabbits 3 days after immunopotentiation. Poly A selection m RNA isolation and first strand synthesis of cDNA by random priming is Invitrogen.

using a commercially available kit from Madison, Wisconsin, USA). It was carried out using The detailed protocol provided by the manufacturer was followed.

(Margin below) - one by one (SEQ ID NO:1) CAG TCG GTG GAG (iAG T CCGGG GGT CGCCTG-G--=-----++ GGAGACGGTGACTAGTGTGCCCCA JH (Sequence identification NO. 3 ) 50 ng of 7'-hui, -RNA-cDNA hybrid was transferred to GeneAm p amplification reagent (Perking Elmer Cetus, Norwalk, Co nnet 1cut, USA) and Taq polymerase (Perkin El mer　Cetus) using a thermal cycler (Techne　PHC-2 , Brouwer, Luzern, Ch), polymerase chain reaction (PCR) was amplified for 3o cycles. Oligonucleotide bly used for PCR mer (100 pmol) is the framework region of VH (5' primer) It is specific for the JH region (3゛ primer) Ta. Melting at 94°C for 30 seconds, annealing at 55°C for 30 seconds, 10 minutes at 72°C. Extended time. An aliquot of the reaction mixture was run on a 2% agarose gel. Gel analysis , showed that a broad hunt of approximately 350 pp was amplified (Fig. 1).

The amplified cDNA was cut with Xhol and 5pel, and the heavy phage vector were cloned unidirectionally in equimolar ratios into 500 ng of TarHC2. 6XI05 A library of recombinant phages was obtained, of which less than 1% were packaged. It was a hackground as determined by the vector alone. Approximately 2X103pf u induced by overlaying a filter soaked with IPTG, and half of the nitrocellulose conjugates are biotinylated anti-VHal-specific allotypes. reacted with antibodies. The other half of the filter was filled with hyotinated anti-Ha2. reacted with specific allotype antibodies. Cloned and expressed VH molecules Approximately 30% of the +25I plots using the VHal-specific allotype antiserum When reacted with SA, autoradiography was positive, indicating VHa2 specificity. When lotype antiserum was used, it was less than 1%.

125 ■ Screening of libraries by protein C library shown to contain single domain antibodies of rabbit VDJ origin. was screened for binding to antigen protein C. amplified library Approximately 0.5 x 106 pfu of - to the rPTG and nitrocellulose filters induced by bound expressed protein. 25 filter power month 251 labeled protein C (specific activity 200 cpm/ng). 30 protein C anti Responsive clones were expressed by autoradiography. 10 clones It was rescreened using biotinylated protein C and 125I SA. positive 3 clones (12°1.17.1 and 16.1 and 1 negative clone (13 , 2) was further analyzed by inhibition test and ELISA.

Antigen binding specificity Phages from protein C-reactive clones were plotted directly onto bacterial growth. (approximately 200 per plot). The plate is then filtered using an IPTG immersion filter. - Buried and incubated for 20 hours at 25°C. After blocking , filters were individually loaded with lOng/m/ of biotinylated protein C and as a control. and incubate with various amounts of natural protein C or bovine serum albumin (BSA). ・It was done. After 2 hours of incubation and washing, the filter pieces were 1251 The cells were incubated with SA and subjected to autoradiography. data( Figure 2) showed specific binding to protein C, but not to BSA. This app The binding constant was calculated to be 10~I07M-' based on the CD, H use, 5science, supra].

Clone 21. ,! , +7.1, 16.1 and 13.2. -dimids were cleaved in vivo and their gene products analyzed by ELISA. It was done. From each phage (21,l, 17°1, 16.1 and 13.1) A single colony containing the truncated plasmid was grown in liquid medium and Culture supernatants induced with TG and containing secreted proteins were placed in a 96-well plate. connected directly to the client. The washed plate was treated with biotinylated protein CC100n/ml, Next, it was incubated with SA-beroxodase. Substrate conversion rate as a function of induction time Shown as numbers (Figure 3). The results show that, except for negative clone 132, clone 21. Confirm inhibition experiments showing specific binding of protein C\I, 17.1 and 16.1. Ru.

Analysis of the VDJ gene encoding sDAb. The cut VDJ gene was measured on a polyacrylamide gel, and the complete clone was The sequence was estimated to be approximately 350 bp long. All clones are mutual, and The previously cloned VDJ gene-F- obtained from a foreign gene insertion rabbit. 4 to 7 (M, 5uter, et al., J. Immunof, supra). When I did, the size was slightly different. Absence of identical clones or temperature soft gel was further tested to confirm the isolation of separate clones from the library. .

Example 2 Contains 5g/ln1 of the purified rabbit single domain antibody obtained in Example 1. 0.1M bicarbonate buffer (pH 9.6)! 00μf to 96-well Boristilemma Added to each well of a microtiter plate. The plates were then incubated at 4°C for 12 hours. Incubated. After incubation, the plate was incubated at 0. 5% Tween 20 in phosphate buffered saline (PBS) (wash buffer).

Add 0.0% Tween 20 to each well of the prepared plate. 5% and skimmed milk Test for protein C levels in PBS (dilution buffer) containing 1% powder A sample was added. The plate was then allowed to stand at room temperature for 1-2 hours. wash the plate Phosphate against protein C was washed with clarification buffer and diluted 1/1000 in dilution buffer. 100μ of atase-labeled polyclonal or monoclonal antibody! each plate Added to. The plate was again left at room temperature for 1-2 hours. After washing with wash buffer, The enzyme activity of the combined phosphatase and labeled antibody is measured by adding an appropriate substrate to each well. The substrate conversion rate is then assayed after 1 hour by measuring spectrophotometrically. mark Regression analysis, in which the value obtained from the semi-liquid is compared with an unknown, determines the quantification of protein C in the sample. Allow.

(Margin below) Arrangement table (1) General information (i) Applicant Near Ebi, Vinyl (ii) Title of the invention: Rabbit single domain antibody and uses thereof (ii) Number of sequences = 3 (iv) Contact address (A) Addressee: Louise, Niss, Pearson; Baxter, Diagnostics, Incorporated (B) Street: Baxter Parkway 1 (C) City: deer field (D) State: Illinois (E) Country: United States of America (F)ZIP:60015 (v) Computer readable format: (A) Media type: Floppy disk (B) Computer: IBM PC computer Patchable (C) Certification System 2 Pc-Dos/Ms-D.

(D) Software: Patent In release number 1゜0, version number No. 1.25 (vi) Current application data: (A) Application number: US 07/894028 (B) Application date: June 5, 1992 (C) Classification: (vi) Agent information (A) Name: Resnick, Davis (B) Registration number: 34235 (C) Document number: DA-4325 (ix)! Air communication information: Speak (A): (617) 523-3400 (B) Telefax + (617) ) 523-6440 (C) Telex: 200291 5TRE UR (2) Distribution Information about column number l: (i) Characteristics of array: (A) Length = 30 base pairs (B) type: Nucleic acid (C) Number of chains: unknown (D) Topology: unknown (x i) Array description/array number l: CAGTCGGTGGAGGAGTCCGGGGGTCGCCTG 30 (2) Information about SEQ ID NO:2: (i) Characteristics of array 2 (A) Length = 37 base pairs (B) type: Nucleic acid (C) Number of chains: unknown (D) Topology: unknown (xi) Sequence description: Sequence number 2: CCCTCGAGATGCAGTCGSGAGGAGTCCGGGRCGCCT G37(2) Information about sequence number 3 (i) Characteristics of array: (A) Length/24 base pairs (B) type: Nucleic acid (C)! Number of In/Unknown (D) Topology unknown (xi) Sequence description Sequence number 3゜ GGAGACGGTGACTAGTGTGCCCCA 24EL I SA: Solid phase fI! i) Binding of protein C to J FIG.3 Tamachi Kenshokan Beef 1*+fw1m+l Alemea N. ρCT/US 93105431F Continuation of front page (72) Inventor Crameri, Leto 276 Daphus Frauenkirch, Hausrusui, Switzerland (72) Inventor Suter, Marc 1 B. Buchliveke, 260 Dafoss-Dorff, Switzerland

Claims (7)

[Claims] 1. A rabbit protein comprising at least a portion of a rabbit immunoglobulin heavy chain variable domain One-domain antibody. 2. 12. The antibody is capable of binding to a solid phase without loss of antigen capture capacity. 1 domestic rabbit single domain antibody. 3. 3. The rabbit single domain antibody of claim 2, wherein the solid phase is plastic. 4. 2. The antibody of claim 1, wherein said antibody has a binding constant of 106 to 107 M-1. One-domain antibody. 5. (i) A rabbit single domain with binding specificity for antigen, directly attached to a solid phase. (ii) the reactant of step (i); and a step of contacting a labeled antibody having binding specificity for the antigen ( iii) measuring the activity of the labeling agent on the bound antibody. A method for assaying antigens in test solutions. 6. 6. The method of claim 5, wherein the antigen is protein C. 7. 6. The method of claim 5, wherein the solid phase is plastic.