JPH07303485A - Hcv anti-sense rna, manifestation vector containing the same, and therapeutic agent for hcv-involved disease containing the rna or manifestation vector - Google Patents

Abstract

PURPOSE:To obtain the subject new RNA having anti-sense activity of hepatitis C virus (HCV) genome to 5'-nontranslational region, inhibiting in vivo HCV proliferation through suppressing the manifestation of HCV's structural protein, thus useful as e.g. a therapeutic agent for HCV-involved diseases. CONSTITUTION:This new HCV anti-sense RNA has a nucleotide sequence of formula I, II, III, IV, V or VI, having anti-sense activity of HCV genome to a fractional sequence of 5'-non-translational region and inhibiting in vivo proliferation of HCV through suppressing the manifestation of HCV's structural gene, thus being useful as a therapeutic agent for HCV-involved diseases such as hepatitis, hepatocirrhosis and hepatoma. This anti-sense RNA is obtained by transfer reaction, using a RNA polymerase, of a template DNA, the aimed amplified nucleotide sequence produced by polymerase chain reaction using a set of primers suitable for obtaining the aimed nucleotide sequence complementary to the fractional sequence of HCV's 5'-non-translational region.

Description

Detailed Description of the Invention

[0001]

The present invention relates to hepatitis C virus (H
The present invention relates to an antisense RNA against a partial sequence of the 5'untranslated region of the CV) genome, an expression vector carrying the RNA, and a therapeutic agent for HCV-related diseases containing the RNA or the expression vector.

[0002]

2. Description of the Related Art A gene complementary to a gene is used to interfere with transcriptional control or translation initiation of the gene,
So-called antisense drugs have been studied using antisense DNA and antisense RNA (for review, see Biotechniqes 6 , p.958-976 (1988) and TIBTE).
CH 10 , p. 152-158 (1992)). Regarding antisense DNA, for example, HIV RRE (Rev resposive element)
About complementary oligodeoxinucleotide phosphorothi
Oate (S-ODN) inhibits Rev activity and has been shown to be effective as a therapeutic drug in vitro (Ge Li et al., Journal of Vir.
ology. 67 , p.6882-6888 (1993)). In general, antisense drugs are prepared by chemical synthesis into oligonucleotides of several tens of bases, which are then labeled with an appropriate DDS (drug delivery system).
It is carried into the body by m) and treated by controlling the expression of specific genes. Several derivatives have been attempted to enhance the stability of the introduced gene, but generally the effect is temporary, and frequent administration is required. Although methods using liposomes have been attempted for DDS, there are still many problems with methods for increasing the introduction efficiency and tissue specificity of the antisense drug. Antisense RNA is the target gene
Complementary coding with mRNA inhibits the translation process, but this is RNA- rather than DNA-RNA with antisense DNA.
Since RNA has stronger binding, more specific inhibition can be expected. However, RNA is easily degraded and is difficult to handle. Therefore, a method of introducing it into cells by incorporating it into a retrovirus vector was devised (Nishikura, K. and
J. Murray, Molecular and Cellular Biology. 7 , p.63
9-649 (1987)). Regarding retrovirus vectors, there are problems such as low infection efficiency, the risk that the transgene will be integrated at a random site in the chromosome of the infected cell, and the gene can be introduced only into dividing cells. The introduction of antisense RNA by retroviral vector can be applied only to limited cells and tissues such as bone marrow cells. In addition, it is not possible to directly administer it to the body, and an operation of introducing the retrovirus vector into the collected cells, propagating it, and then returning it to the body (ex vivo
o Administration) is required, and there is a risk of contamination with pathogenic bacteria, etc. during that time, and much time and labor are required from cell collection from the patient to returning to the body.

[0003]

DISCLOSURE OF THE INVENTION Problems to be Solved by the Invention Currently, there is no effective treatment for hepatitis C virus-infected patients except administration of interferon. However, in this treatment C
Two groups of hepatitis virus, namely groups
There is a difference in effect between I and Group II, and all C
Not applicable to hepatitis C virus infection. Recently, Kanai et al. (Kanai, K. et al .: Lancet. 339 , p.1543
(1992)) and Yoshioka, K. et al .: Hepatolo
gy. 16 , p. 293-299 (1992)) reported that they genotype by PCR and show different responses to interferon treatment. Ohara (Japanese Clinical 51
No. 2 p.86-91) examines group classification and treatment effects for patients with chronic hepatitis. Only 11% of the group I hepatitis C virus-infected patients had a normal ALT value for more than 6 months, whereas the group
87% of hepatitis II virus-infected patients showed a marked effect, and the remaining
It was reported that 13% was also effective (temporarily normalized ALT value) and no ineffective cases were observed. 50% of effective cases and ineffective cases of group I hepatitis C virus infection
It was 39%, and as a result of quantifying the amount of virus in blood by PCR method, it was recognized that the one with lower virus amount tended to be more effective.

Therefore, in the case of a patient having a high viral load excreted in the blood, some treatment is required to reduce the viral load.

[0005]

The present invention is devised as a complementary therapeutic method that enables more effective treatment such as interferon therapy by temporarily suppressing the viral load in hepatitis C virus-infected persons. It was done. Specifically, a partial region of the untranslated region (5'UTR) existing at the 5'end of hepatitis C virus is incorporated as an antisense RNA into an appropriate vector such as a viral vector to control an appropriate promoter. By in vivo expression in and, the expression of the structural protein of hepatitis C virus is suppressed, that is, the replication of the virus is suppressed.

The present invention provides an antisense RNA against a partial sequence of the 5'untranslated region of the hepatitis C virus (HCV) genome. For example, such antisense R
NA is selected from the group consisting of the nucleotide sequences shown in SEQ ID NOs: 1, 2, 3, 4, 5 and 6.

Specific antisense RNAs have R
NA-AS1 ', RNA-AS3, RNA-AS3',
RNA-AS5, RNA-RS6 and RNA-AS15
And is complementary to a partial sequence of the nucleotide sequence of the HCV 5'UTR shown in Figure 1 and has an inverted sequence. In Figure 1, RNA-AS1 'is HCV5'UT
In the sequence complementary to positions 78 to 215 of R (designated AS1 '), RNA-AS3 contains HCV 5'UTR at position 10
The sequence complementary to 1-170 (designated AS3) contains RN
A-AS3 'is HCV5'UTR positions 101-240
RNA-AS is added to the sequence (referred to as AS3 ') complementary to
5 is a sequence complementary to positions 131 to 200 of HCV 5'UTR (referred to as AS5), and RNA-AS6 is HCV.
A sequence complementary to positions 163-231 of the 5'UTR (AS
6) and RNA-AS15 is HCV5'U.
Sequences complementary to the TR positions 122 to 308 (referred to as AS15) correspond to the respective opposite orientations.

The antisense RNA of the present invention is a clone containing the 5'UTR of HCV, such as clone 2-1 (Ts
ukiyama-Kohara et al., Journal of Virology: 66 , p.1476-
1483 (1992)) and is complementary to the nucleotide sequence of interest (eg, AS
1, AS1 ', AS3, AS3', AS5, AS6, A
Polymerase chain reaction (eg HA Erlich, PC, PC) using a set of primers suitable for obtaining S15 etc.
R Technology, Stockton Press, 1989), and can be prepared through the transcription reaction by RNA polymerase using the amplified target nucleotide sequence obtained as a template DNA. Furthermore, the obtained antisense RN
A is purified by a known method such as gel electrophoresis. These preparation methods are described in detail in the Examples below, and reference is made thereto.

The antisense RNA of the present invention comprises the 5'UTR of HCV and a structural region (eg, core gene region, E1).
A plasmid containing a gene region, NS1 gene region [eg, plasmid pKIV (Tsukiyama-Kohara et al., Jour.
nal of Virology 66 , p.1476-1483 (1992)] in an in vitro translation experiment using RNA synthesized from DNA obtained by treating with restriction enzyme as a template.
It was found to cause strong translational inhibition of HCV structural proteins. That is, the antisense RNA of the present invention can significantly reduce the expression of HCV structural protein in vivo, and is therefore useful for suppressing the growth of HCV in vivo.

Therefore, the present invention further provides a therapeutic agent for HCV-related diseases, which comprises the above antisense RNA as an active ingredient.

In the present specification, "HCV-related disease" means H
It means diseases such as hepatitis, cirrhosis and liver cancer caused by CV.

Since RNA is generally easily degraded in vivo, it can be stably administered by being encapsulated in a pharmaceutically acceptable substance such as liposome. For example, electrostatic charge multilamellar liposomes are known to have low cytotoxicity (Yagi et al., BBRC 196 , p.1042-1048 (199).
3)), and it is also possible to introduce a gene by encapsulating an antisense RNA or an antisense gene expression vector described below.

Therefore, the present invention also relates to a therapeutic agent for HCV-related diseases, which comprises an antisense RNA encapsulated in liposome as an active ingredient.

Alternatively, the RNA gene can be expressed in vivo by incorporating the antisense RNA into an expression vector having an operable promoter. As the vector, a virus vector is preferable, and an adenovirus vector is more preferable. Adenovirus vectors generally efficiently infect non-dividing cells,
It is able to produce large amounts of gene products, provides long-lasting transient expression of the target gene for weeks to months, and unlike retroviruses, does not have a mechanism for active chromosomal integration. , Has the advantage that it does not interfere with the normal functioning of genes in the host cell. Furthermore, in v
In vivo administration is possible, and it can be directly introduced into a specific tissue or cell by using an endoscope or the like.

Therefore, the present invention also provides an expression vector carrying an antisense RNA in an expressible manner. Also provided is a therapeutic agent for HCV-related diseases, which comprises the expression vector as an active ingredient.

As used herein, "to be expressible" means that antisense RNA can be expressed in vivo.
For that purpose, an operable promoter is included in the vector.

As a promoter used for expression, a CAG promoter having a strong promoter activity (Niwa et al., Gen
e 108 , p.193-200 (1991)), EF-1α promoter (Kim et al., Gene 91 , p.217-223 (1990)), SRα promoter (Takebe et al., Mol. Cell. Biol. 8 , p. 466 (19
88)), RSV LTR promoter (Cullen Methods
Enzymol. 152 , p.684-704 (1987)), CMV immediat
e early promoter (Seed and Aruffo, Proc. Natl.
Acad. Sci. USA 84 , p.3365-3369 (1987)), SV40
early promoter (Rigby In Williamson (Ed.), Gene
tic Engineering, Vol. 3 , Academic Press, London,
p.83-141 (1982)), SV40 late promoter (Gh
eysen and Fiers, J. Mol. Appl. Genet .1 , p.385-394
(1982)), adenovirus late promoter (Kaufm
an et al., Mol. Cell. Biol. 9 , p.946 (1989)), herpes simplex TK promoter, human serum albumin promoter, α-fetoprotein promoter (Gutierrez
Et al., Lancet 339 , p.715-721 (1992)) and any commonly used promoter may be used.

Saito et al. Are described in detail in the experimental medicine separate volume, Biomanual Series 4, “Gene Transfer and Expression / Analysis in Animal Cells,” Yodosha (1993), regarding the method for producing the expression vector of the present invention, particularly the recombinant virus. It has been described, and the recombinant virus of interest can be prepared by referring to this.

As a method for introducing a gene into the body, when a recombinant virus is used, for example, a method of expressing an antisense gene or a method of utilizing a fusion (virosome) of Sendai virus and liposome (Nakanishi et al., No. 113)
(Japan Society of Pharmaceutical Sciences (1993)), a method using a so-called gene gun in which antisense genes are coated on metal microparticles and bombarded at high speed (TM Klein et al.,
Bio / Technology 10 , p.286-291 (1992)) is used.

When preparing a pharmaceutical preparation, the antisense RNA or expression vector of the present invention can be mixed with a pharmaceutically acceptable carrier or diluent to obtain a pharmaceutical preparation.
In addition, the therapeutic agent of the present invention may optionally contain a known therapeutic agent for hepatitis, cirrhosis, liver cancer and the like.

As the dose, HC in vivo is used.
The amount is not particularly limited as long as it can suppress the replication of V, but in the case of antisense RNA, it is preferably 1 pg / kg (body weight) / Day to 1 g / kg / Day, preferably 1 μg / kg / Day to 1
mg / kg / Day, 10 ^{6 for} recombinant viral vector
-10 ⁸ PFU is suitable.

As an administration method, a method of directly introducing the gene into the liver by using a physical means such as a catheter can be considered. However, in order to further introduce the gene into the liver, B. Good et al. (Virology: 163 , p.251-254 (198
8)) A method of coupling an antibody against transferrin with a viral vector, or a method of asialating a viral envelope glycoprotein, which utilizes binding to an asialoglycoprotein receptor that is specifically present in hepatocytes (B. Salmons et al. Review of Human Gene Therapy: 4 , p.129
-141 (1993)) may be used.

Regarding virulence, for example, when adenovirus is used as a vector, it can be considered that there is no cytotoxicity when a vaccine strain is used as a parent strain because of the background that adenovirus has already been used as a vaccine.
Adeno-associated virus is known to integrate into human chromosome 19q, but is not cytotoxic.
The method using liposomes has already been clinically applied in the United States, but it is expected that the method has lower cytotoxicity than the method using the above-mentioned virus as a vector.

[0024]

Example 1 Synthesis of antisense RNA 1. Synthesis of oligonucleotides 16 kinds of oligonucleotides containing a part of 5'UTR of hepatitis C virus (HCV) were synthesized using β-amidite method to synthesize DNA by Cyclone ^TM. Plus Synthesizer (Millipore Japan)
Was synthesized by. The synthesized oligonucleotide has the following sequence.

[0025]

[Table 1] AS15 5'-cggggtaccttccgcagaccacta- 3 'AS13 5'-ccggaattcggcgttagtatgagt- 3'AS1'55'-cggggtacctctccaggcattgag- 3 'AS35 5'-cggggtacctggcaattccggtgt-3ga ASc 5acc-cc '-ataggtaccagtcttgcgggggca- 3' AS55 5'-cggggtaccgggttaatccaagaa- 3 'AS53 5'-ccggaattcatagtggtctgcgga- 3' AS65 5'-tatggtaccgggggcacgcccaaa- 3 'AS63 5'-ccggaattcaattgccaggacgac- 3' AS153 5'-gggagagccatagtggtctg- 3 '2. template DNA Using the plasmid clone 2-1 containing 5'UTR of HCV, gene amplification was performed under the following conditions.

[0026]

[Table 2] 60 μl distilled water 10 μl 10 × Pfu buffer # 2 (200 mM Tris-HCl (pH8.2), 100 mM KCl, 60 mM (NH ₄ ) ₂
SO ₄ , 15mM MgCl ₂ , 1% Triton X-100) 1 μl Clone 2-1 DNA (0.1 mg / ml) 10 μl Primer A (10 pmol / μl) 10 μl Primer B (10 pmol / μl) 8 μl dNTP mixture (10 mM) 1 μl Pfu DNA Polymerase (2.5 units / μl) (St
ratagene, Catalog # 600135) Put 100 μl in total into a 0.5 ml assist tube, mix by pipetting, and then add mineral oil (Sigma,
(Catalog # M5904) is overlaid, then 94 ℃ 5 minutes, 45 ℃ 5
After keeping the temperature at 72 ° C for 2 minutes, the reaction of 94 ° C for 1 minute, 45 ° C for 1 minute and 72 ° C for 1 minute was repeated 30 times, and finally the reaction at 72 ° C for 7 minutes was performed.
The combination of primer A and primer B and the name of the resulting reaction product are as follows.

[0027]

[Table 3] Primer A Primer B Reactant AS15 AS13 AS1 AS1′5 AS13 AS1 ′ AS35 AS33 AS3 AS3′5 AS33 AS3 ′ AS55 AS53 AS5 AS65 AS63 AS6 Reactants are left at −80 ° C. for 10 minutes and then thawed and thawed. After removing the mineral oil, 1 μl of etaprecipitate (manufactured by Wako Pure Chemical Industries) and 3 M sodium acetate solution (manufactured by Wako Pure Chemical Industries) 3
After adding μl and 220 μl of ethanol and mixing well, the mixture was centrifuged at room temperature at 15,000 rpm for 15 minutes and collected as a precipitate. It was dissolved in 70 μl TE (10 mM Tris-HCl, 1 mM EDTA pH 8.0) and 45 μl was cleaved with a restriction enzyme under the following conditions. Reaction solution (200mM Tris-acetate, 100mM magnes
ium acetate, 500mM potassiumacetate, 10mM DTT (pH
7.9 at 25 ° C)), 20 units of each of the restriction enzymes EcoRI and KpnI were further added, and the mixture was reacted at 37 ° C for 6 hours. This was separated by 4% Nusieve ^™ GTG Agarose (Takara Shuzo) gel electrophoresis, and only the reaction product of the desired length was cut out from the gel, and the BIO 101 MERMAID ^™ kit was used.
Was used to recover the DNA. The method was according to the manual attached to the kit, and 20 μl of DNA solution was obtained as the final product. The obtained DNA was ligated with pBluescript ^R II SK (-) 50 ng digested with the restriction enzymes EcoRI and KpnI under the same conditions as above using a DNA Ligation kit manufactured by Takara Shuzo Co., Ltd. according to the protocol and subjected to ligation reaction at 16 ° C for 30 minutes. . The gene amplification reaction was again carried out using 1 μl of the 75 μl reaction solution under the same conditions as above. However, primer A is M13 Se
quencing primer M4 (5′-gttttcccagtcacgac-3 ′) (10pm
ol / μl) (manufactured by Takara Shuzo Co., Ltd.) and used the same primer B as the primer used for the first gene amplification for obtaining the reaction product used for the ligation reaction. The products obtained from these reactions are in the form in which the DNA obtained by the first gene amplification is ligated downstream of the promoter of bacteriophage T7. After agarose gel electrophoresis of these by the same operation, DNA purpose of using the MERMAID ^TM kit
The fragments were collected. The names and fragments of the DNA obtained by the first gene amplification and the DNA obtained by this gene amplification, and the length of the transcript (RNA product) obtained by in vitro translation using T7 RNA polymerase Is as follows.

[0028]

[Table 4] First product Second product DNA length RNA length AS1 T7-AS1 157bp 94base AS1 ′ T7-AS1 ′ 226bp 163base AS3 T7-AS3 158bp 95base AS3 ′ T7-AS3 ′ 227bp 164base AS5 T7- AS5 158bp 95base AS6 T7-AS6 158bp 95base For the second product, after removing the mineral oil by the same procedure as above, phenol / chloroform extraction was performed and 1/10 volume of 5M sodium acetate solution and 2 Add a volume of ethanol, leave it at -20 ° C for 30 minutes, and centrifuge at 15,000 rpm for 15 minutes to recover the DNA.
It was dissolved in 30 μl of RNase-free distilled water. RNase-free
Diethylpyrocarbonate (DEPC) (manufactured by Sigma) was added to the distilled water to a final concentration of 0.05%.
It was prepared by allowing it to stand overnight at 37 ° C and then autoclaving at 120 ° C for 45 minutes. The concentration of the second product obtained was 20 μg / ml, 7 μl each (from 0.5 pmole)
Equivalent to 1.4 pmole) in vitro translation template DN
Used as A.

Clone 2-1 DNA (5 μg) was added to 10 × SmaI buffer (100 mM Tris-HCl (pH8.0), 70 mM MgCl ₂ , 70 mM).
2-mercaptoethanol, 200 mM KCl, 0.1% BSA) 5 μ
Add l and distilled water to make 50 μl of the restriction enzyme SmaI 20 u
After incubating with nits at 37 ℃ for 6 hours to digest, 4% Nusie
Separation was carried out using ve ^™ GTG agarose gel, the SmaI fragment of 187 bp was excised from the gel, and DNA was recovered by the same procedure as above using the MERMAID ^™ kit. pBluescript II SK (-)
3 μg of 10 × H buffer (500 mM Tris-HCl (pH 7.5), 1
00mM MgCl ₂ , 10mM Dithiothreitol, 1000mM NaCl) 5
Add 20 μl of distilled water to 50 μl, and add 20 units of restriction enzyme.
Takara Shuzo DNA with 50 ng digested with HincII
Ligation kit was used for incubation at 16 ° C for 30 minutes to perform ligation reaction, and M13 sequencing primer M4, M13 Reverse prim
er RV gene amplification with 100 pmol each, 438
A bp product was obtained. Add this to M13 sequencing p
T7-AS15 was obtained by gene amplification with 100 pmol of each of rimer M4 and AS153. By the same operation, it was used as a template DNA for in vitro translation. Antisense in Figure 1 and Table 5
The region used as RNA is shown.

[0030]

[Table 5] Table 5 shows the types of primers used when the template DNA used for in vitro translation was prepared by gene amplification, the 5'UTR region of hepatitis C virus contained in the template DNA, and the 5'end derived from the vector. , The length of the region added to the 3'end, and the length of the RNA product synthesized by T7 RNA polymerase. The base number is according to FIG.

3. Synthesis of antisense RNA Antisense RNA is an in vitro transcrip manufactured by Ambion.
It was prepared using an option kit (MEGAscript ^™ T7 kit, catalog # 1334). The reaction conditions are shown below.

[0032]

[Table 6] 2 μl 10x Transcription buffer (with kit) 2 μl 75mM ATP Solution (with kit) 2 μl 75mM CTP Solution (with kit) 2 μl 75mM GTP Solution (with kit) 2 μl 75mM UTP Solution (with kit) 7 μl Template DNA 2 μl Enzyme Mix (included in kit) 1 μl cloned T7 RNA polymerase (200 units / μl)
(Ambion Co., Catalog # 2085) A total of 20 μl of the reaction solution was dispensed into a 0.5 ml assist tube and kept warm at 37 ° C. for 6 hours. Add 1 μl of RNase-free DNase I (provided with the kit) to each sample and incubate at 37 ° C for 15 minutes to decompose the template DNA. Then, 115 μl of RNase-free distilled water and 15 μl of A
mmonium acetate Stop Solution (included in the kit) was mixed well, and the protein was removed by phenol / chloroform extraction and chloroform extraction. 150 μl of isopropanol was added, mixed well, left at -20 ° C for 30 minutes, and centrifuged at 15,000 rpm for 15 minutes to precipitate RNA. After washing the precipitate with 70% ethanol, 20 μl
RNase-free was dissolved in distilled water. The concentration and purity of each RNA product are shown below. The RNA concentration is 3 at an absorbance of 1.0 at 260 nm.
Calculated as 5 μg / ml, for purity 260 nm and 280
It is generally known that pure RNA is between 1.7 and 2.1 depending on the ratio of absorbance at nm. Obtained R
The NA was around 1.8 and there was no problem with the purity.

[0033]

[Table 7] RNA RNA concentration RNA purity (OD ₂₆₀ / OD ₂₈₀ ) AS1-RNA 5.57 mg / ml 1.84 AS1'-RNA 6.07 mg / ml 1.84 AS3-RNA 5.62 mg / ml 1.84 AS3'-RNA 5.72 mg / ml 1.85 AS5-RNA 5.48 mg / ml 1.79 AS6-RNA 5.09 mg / ml 1.87 AS15-RNA 8.16 mg / ml 1.83 2 μl loading buffe for 2 μl RNA sample
After adding r (included in the kit) and incubating at 95 ℃ for 3 minutes, 1 mg
/ Ml Add 1 μl of ethidium bromide (EtBr) to 8M
Separation was performed by urea / 5% polyacrylamide gel electrophoresis, and it was confirmed that RNA of the correct length was synthesized.

Example 2 In vitro translation experiment 1. Preparation of mRNA 5'UTR of HCV, core gene region, E1 gene region, NS1
Plasmid pKIV containing the gene region (nucleotide numbers 9 to 1772) (Ohara et al., Journal of Virology. 66 , p. 1476)
-1483 (1992)) has the above HCV gene region inserted downstream of the T7 promoter, and can artificially synthesize RNA by T7 RNA polymerase. Restriction enzyme Sal
10 μg of plasmid DNA was digested with I under the following conditions.

[0035]

[Table 8] 25 μl 10 × H buffer (500 mM Tris-HCl (pH 7.5), 100 mM MgCl ₂ , 10 mM Dithio
threitol, 1000 mM NaCl) 220 μl DNA solution 5 μl Restriction enzyme SalI (6 units / μl) A total of 250 μl was dispensed into a 1.5 ml assist tube and reacted at 37 ° C. for 4 hours. After confirming by agarose gel electrophoresis that the DNA was completely digested and linearized,
13 μl 10% SDS, 2.6 μl Proteinase K (20 mg /
ml) (Stratagene, Catalog # 300140) is added to remove RNase contained in trace amounts during restriction enzyme and DNA recovery.
Decomposed by reaction at 37 ° C for 1 hour. Proteinase K was removed by phenol / chloroform extraction, and 26.5 μl of
Add 5M sodium acetate solution and 530 μl ethanol, mix well, leave at -20 ° C for 30 minutes, then rotate 15,000 rpm.
DNA was recovered as a precipitate by centrifugation for 15 minutes.
After washing with 70% ethanol, it was dissolved in 30 μl of RNase-free distilled water. The DNA concentration was 0.2 mg / ml, and 8 μl (corresponding to 0.5 pmole) was used as the DNA template and the MEGAscript ^™ kit was used to perform the same procedure as described above.
NA was synthesized. The obtained RNA is further
Translation into protein was performed by in vitro translation. RNA synthesis was performed under the following conditions.

[0036]

[Table 9] 2 μl 10 × Transcription Buffer 2 μl 75mM ATP Solution 2 μl 75mM CTP Solution 2 μl 75mM GTP Solution 2 μl 75mM UTP Solution 8 μl DNA template 2 μl Enzyme Mix Total 20 μl of reaction solution in 0.5 ml assist tube The mixture was dispensed and kept at 37 ° C for 6 hours. After reaction, 1 μl RNase-free
The template DNA was decomposed by adding DNase I and incubating at 37 ° C for 15 minutes. 30 μl RNase-free distilled water, 25
Add μl LiCl Solution (included in the kit), and then -20 ℃
After leaving it for 30 minutes, RNA was collected as a precipitate by centrifugation at 15,000 rpm for 15 minutes at 4 ° C. The precipitate was washed with 70% ethanol and then dissolved in 20 μl of RNase-free distilled water. The obtained RNA concentration and purity were as follows.

[0037]

[Table 10] RNA RNA concentration RNA purity (OD ₂₆₀ / OD ₂₈₀ ) mRNA-KIV 7.25 mg / ml 1.7 The obtained RNA was confirmed by electrophoresis by the formaldehyde method. The method is shown below. 0.8 g Seakem ^TM GTG
Add 73 ml of distilled water to agarose (manufactured by Takara Shuzo Co., Ltd.), heat to dissolve agarose well, and then cool to 60 ° C. 10 × Gel Running Buffer (0.2M MOPS (pH7.0), 50m
Add 10 ml of M sodium acetate, 5 mM EDTA (pH8.0) and 16.2 ml of 37% formaldehyde in the hood, mix well and pour on a gel preparation table to prepare a gel. The electrophoretic sample was prepared as follows.

[0038]

[Table 11] 3.5 μl RNA 2.0 μl 10 × Gel Running Buffer 3.5 μl formaldehyde 10.0 μl Deionized formamide Total 19 μl was dispensed into 0.5 ml assist tube, and 68 ° C 5
After incubating for 1 minute, add 1 μl of 1 mg / ml EtBr and add 68 ° C 1
Incubate for 5 minutes, then place on ice for 5 minutes. 2 μl Loading
Buffer (50% glycerol, 1mM EDTA, 0.4% bromophenol
blue, 0.4% xylene cyanol), and run on the 0.8% agarose / 2.2M formaldehyde gel at 50V,
It was confirmed that RNA was synthesized correctly.

2. In vitro translation experiment was carried out using the mRNA prepared in 1.
Stratagene Invitro Express ^TM translation ki
t (catalog # 200360) was used. The reaction conditions were according to the attached protocol, and the experiment was conducted in the following procedure.

0.5 μg of 1.5 μg mRNA (about 2.5 pmole)
Dispense into an assist tube and add RNase-free distilled water.
After making 5 μl and incubating at 68 ℃ for 30 seconds, rab of the above kit
The bitreticulocyte lysate was thawed quickly, 20 μl of this was added to the tube containing the mRNA, mixed gently and allowed to react at 30 ° C for 1 hour. After reaction 25
μl 2 × SDS-PAGE buffer (0.125M Tris-HCl (pH 6.
8), 4% SDS, 20% glycerol, 10% 2-mercaptoethanol, 0.002% bromophenol blue) was added and the mixture was kept at 95 ° C for 5 minutes and separated by 15% -25% SDS-polyacrylamide gel. After running the gel, transfer it to a PVDF membrane (Immobilon ^TM -P Transfer membranes: Nippon Millipore) with SDS transfer buffer (48 mM Tris (hydroxymethyl) aminomethane, 39 mM glycine, 0.0375% SDS) Sartorius Sartoblot Transcribed using ^R II-S. Transcription was performed at 300 mA for 30 minutes. Western blotting was performed using a protein-transferred PVDF membrane in T-TBS buffer (0.05% Tween80, 20 mM Tris-H) containing 5% skim milk (Difco) and 2.5% bovine serum albumin (BSA).
After incubating in Cl (pH7.5), 500mM NaCl) at 4 ℃ overnight to inhibit non-specific protein adsorption, rabbit anti-HCV core protein antiserum was diluted with antibody (1% skim milk, 0.5%). B
SA, T-TBS) at room temperature in a 1000-fold diluted solution
Reacted for hours. After washing with T-TBS, biotinylated anti-rabbit Ig antibody (manufactured by Amersham) was diluted 1000 times with an antibody diluent, and reacted at room temperature for 1 hour. After washing with T-TBS, streptavidin-labeled biotinylated peroxidase complex (Amersham) was added.
Reaction was carried out at room temperature for 15 minutes in a solution diluted 000-fold with antibody diluent. After thorough washing with T-TBS, HCV core protein was detected using an ECL detection kit manufactured by Amersham, and a band of 22 Kd was detected.

Example 3 Inhibition of translation by antisense RNA
Harm experiment Antisense RNA, RNA-AS1, RNA-AS for a part of the region of HCV 5'UTR when translating mRNA in vitro
1 ', RNA-AS3, RNA-AS3', RNA-AS5, RNA-AS6, RNA-AS15
Each of the 7 kinds of
The total volume of 5 μl was added so as to be 0, and 2.
In vitro translation was performed in the same manner as in. 15-25% SDS-PAG
After separation with E, transfer to a PVDF membrane and Western blotting were performed. As a result, in the samples to which RNA-AS15 and RNA-AS1 'were added, the remarkable 22Kd band of HCV core protein was observed, and strong translational inhibition occurred. RNA-AS
Translation inhibition was also observed at 3 '(Fig. 2). The following experiments were performed for other antisense RNAs.

In vitro translation experiment of ³⁵ S-labeled Amersham rabbit reticulocyte lysa using mRNA-KIV
An in vitro translation experiment of ³⁵ S-methionine label with te (N150) was performed.

The composition of the reaction solution is shown below.

[0044]

[Table 12] 17.5 μl Amino acid-depleted lysate (Amersham
N.150) 1.6 μl 2M potassium acetate solution 1.25 μl 1mM amino acid mixture minus L-methi
onine 0.5 μl 1.25 pmol mRNA-KIV 2.15 μl 125 pmol antisense RNA 2 μl ³⁵ SL-methionine (ICN 51001H;> 1000 C
i / mmol) After reacting at 25 ° C for 1 hour at 30 ° C, 2 μL of the reaction solution was added to 98 μL of 1N NaOH / 2% H ₂ O ₂ and the mixture was added at 37 ° C for 10 hours.
After reacting for minutes, 900 μl of 25% TCA (trichloroacetic acid) / 2% casamino acid was added, and the mixture was allowed to stand on ice for 30 minutes. The precipitated reaction product was filtered through a glass filter, and its radioactivity was measured with a liquid scintillator to compare the translation inhibitory effects. As a negative control, in vitro translation was carried out without adding mRN-KIV, and the value was subtracted from the value of each sample as a background. The radioactivity when only mRNA-KIV was added was defined as 1, and the inhibition of translation by the addition of antisense RNA was shown as a relative ratio. As a result, R
RNA-AS1 ′, RNA-AS except NA-AS1
3, RNA-AS3 ', RNA-AS5, RNA-AS
The translation inhibitory effect was observed in all of 6 (Table 1
3).

[0045]

[Table 13] In Table 13, count is a value measured by a liquid scintillation counter, and mRNA- is used as a negative control.
The value obtained by subtracting the value obtained by in vitro translation without addition of KIV from the value of each sample as a background is shown, and the unit is cpm. The relative ratio to the value without addition of antisense RNA is further shown.

Example 4 Preparation of Recombinant Adenovirus For the method of preparing recombinant adenovirus, see Experimental Medicine Separate Volume, Biomanual Series 4, “Gene Transfer and Expression / Analysis in Animal Cells,” Yodosha (1993) Saito. Et al. Describe the detailed methods, and those skilled in the art can easily make them by following these methods.

A method for producing a vector for expressing antisense RNA-AS15 will be specifically described below, but the types of promoter and adenovirus used are not limited to these, and other ones may be used.

Method for producing recombinant adenovirus AS15 Clone 2-1 (Tsukiyama-Kohara et al. Journal of
Virology: 66 , p.1476-1483 (1992)) 0.1 μg was added to Pfu po together with 100 pmol of each primer having the following sequence.
Gene amplification was performed using lymerase under the reaction conditions described above to obtain a DNA fragment into which a recognition site by the restriction enzyme EcoRI was introduced at both ends.

[0049]

[Table 14] Primer EcoAS153 5′-CGGAATTCGGGAGAGCCATAGTG-3 ′ Primer EcoAS155 5′-CGGAATTCGGGGCACTCGCAAGC-3 ′ 1 μg of the obtained DNA fragment was added to 10 × EcoRI buffer (1000 mM Tris-HCl (pH7.5), 70 mM MgCl ₂ , 70 mM). 2-
Mercaptoethanol, 500 mM NaCl, 0.1% BSA) 5 μl
50 ml of distilled water and restriction enzyme EcoRI 10 units
After incubating for 2 hours at 37 ℃ as a μl and digesting, 4% Nus
It was separated on an ieve ^™ GTG agarose gel, a 197 bp DNA fragment was excised from the gel, and the DNA was recovered by the same procedure as above using the MERMAID ^™ kit.

The vector pCAGGS (Niwa et al., Gene: 108 , p.193-200) in which the CAG promoter was incorporated.
(1991)) 2 μg was digested with the restriction enzyme EcoRI under the same conditions as above, and the ligation reaction was performed with the above DNA fragment having the sequence of AS15 using DNA Ligation kit (Takara Shuzo) to downstream the CAG promoter. To EcoRI
A vector pCAG-AS15 in which the sequence of AS15 shown in Sequence 6 was inserted via the recognition site could be produced. pC
5 μg of DNA of AG-AS15 was added to 10 × H buffer 5
Add μl and distilled water, add 20 units each of restriction enzymes SalI and HindIII to 50 μl and incubate at 37 ° C. for 6 hours for digestion, and blunt the ends of the DNA according to the protocol using the DNA Blunting kit manufactured by Takara Shuzo. I went.

Adenovirus expressing cosmid cassette pA
dexlw (Saito et al., Experimental Medicine separate volume, Biomanual Series 4, “Gene transfer and expression / analysis in animal cells”, Yodosha (1993)) 5 μg was distilled with restriction enzyme SwaI (Boehringer) with 5 μl of 10 × H buffer. Add water,
The restriction enzyme SwaI 12 units was added to make 50 μl and the mixture was kept warm at 25 ° C. for 2 hours for digestion, followed by phenol / chloroform extraction and purification using a G-25 column manufactured by Pharmacia. 1 μg of SwaI-digested pAdexlw and 0.2 μg of the blunt-ended DNA fragment were precipitated with ethanol, and then 5 μl of TE (10 mM Tris-HCl, 1 mM EDTA (pH 8.
0)), 0.7 μl 10 × L buffer,
0.3 μl 10 mM ATP, 1 μl T4 DNA L
The reaction was carried out overnight at 15 ° C. with igase. 0.5μ
DNA Lig was prepared by adding l 2 M NaCl, 4 μl 10 × H buffer, and 34 μl distilled water and incubating at 70 ° C for 10 minutes.
The ase was heat inactivated. The restriction enzyme SwaI 20 units was added, and after reaction at 25 ° C. for 1 hour, phenol / chloroform extraction was performed, and the DNA ligated with the G-25 column was recovered. 50 μl DNA solution was further added with 6 μl 10 × H buffer and 20 units SwaI, and again at 25 ° C. for 2
Digested for hours. 1 μl of this is GI from Stratagene
Using GAPACK XL, packaging was carried out at a scale of 1/4 of the usage in the protocol to obtain the target cosmid pAdex-CAGAS15. Recombinant adenovirus Ad-CAGAS1 was prepared by the method described in Saito et al.
Got 5.

[0052]

INDUSTRIAL APPLICABILITY The present invention provides a structural protein of hepatitis C virus proliferating in the liver by administering antisense RNA, for example, by encapsulating it in a liposome or incorporating it in a virus vector, directly into the inflamed liver. 5'UTR of hepatitis C virus gene that controls the expression of Escherichia coli
(5'-side non-translated region of hepatitis C virus) is complementarily coded to induce a disorder in the structural gene expression control region accompanied by steric hindrance and inhibit the growth of hepatitis C virus. By limiting the amount of hepatitis C virus, more effective treatment with interferon is possible.

[0053]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 138 Sequence type: Nucleic acid Number of strands: Single-stranded Topology: Linear Sequence type: Other nucleic acid Antisense: Yes Sequence CUCCAGGCAU UGAGCGGGUU AAUCCAAGAA AGGACCCGGU CGUCCUGGCA AUUCCGGUGU 60 ACUCACCGGU UCCGCAGUC ACCCUGGCGA GGGGGUCCUG GAGGCUGCAC 120 GACACUCAUA CUAACGCC 138 SEQ ID NO: 2 Sequence length: 70 Sequence type: Nucleic acid Number of strands: Single-stranded topology: Linear Sequence type: Other nucleic acid Antisense: Yes sequence UGGCAAUUCC GGUGUACUCA CCGGUUCCGC AGACCCCCUAU GGCU GGAGGGGGGG 60 UCCUGGAGGC 70 SEQ ID NO: 3 Sequence length: 140 Sequence type: Nucleic acid Number of strands: Single-stranded Topology: Linear Sequence type: Other nucleic acid Antisense: Yes Sequence CAGUCUCGCG GGGGCACGCC CAAAUCUCCA GGCAUUGAGC GGGUUAAUCC AAGAAAGGAC 60 CCGGUCGUCC UGGCAAUUCC GGUGUACUCA CCGGUUCCGC AGACCACUAU GGCUCUCCCG 120 GGAGGGGGGG UCCUGGAGGC 140 SEQ ID NO: 4 of sequence Length: 70 Sequence type: Nucleic acid Number of strands: Single stranded Topology: Linear Sequence type: Other nucleic acid Antisense: Yes Sequence GGGUUAAUCC AAGAAAGGAC CCGGUCGUCC UGGCAAUUCC GGUGUACUCA CCGGUUCCGC 60 AGACCACUAU 70 SEQ ID NO: 5 Sequence length : 69 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Antisense: Yes sequence GGGGGCACGC CCAAAUCUCC AGGCAUUGAG CGGGUUAAUC CAAGAAAGGA CCCGGUCGUC 60 CUGGCAAUU 69 SEQ ID NO: 6 Sequence length: 186 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acids Antisense: Yes Sequence GGGGCACUCG CAAGCACCCU AUCAGGCAGU ACCACAAGAGUC CUUC CCUGUCACUCCCUCCAGAUCGAC GUCUCGC UCUCCC 186

[Brief description of drawings]

FIG. 1 shows the hepatitis C virus clone 2-1.
The 5'UTR sequence and the antisense RNA region are shown. The stem-loop I shown above the sequence of clone 2-1 5'UTR
I, III, IV are Brown, E. et al. (Nucleic Acids Research.
20 , p.5041-5045 (1992)), which is a classification of regions by the secondary structure prediction of hepatitis C virus 5'UTR.
The stem-loops A, B, C, D, E, and F shown at the bottom of the array are Tsuki.
yama-Kohara, K. et al. (Journal of Virology. 66 , p.1476-
1483 (1992)).

FIG. 2 This figure shows the results of an in vitro translation experiment of ³⁵ S-labeled co detected by Western blotting using a rabbit anti-core protein polyclonal antibody.
It is a photograph showing a band of re protein.

Claims (5)

[Claims] 1. An antisense RN against a partial sequence of the 5'untranslated region of the hepatitis C virus (HCV) genome.
A. 2. A C selected from the group consisting of the nucleotide sequences shown in SEQ ID NOs: 1, 2, 3, 4, 5 and 6.
An antisense RNA against a partial sequence of the 5'untranslated region of the hepatitis C virus (HCV) genome. 3. The antisense RN according to claim 1 or 2.
An expression vector carrying A so that it can be expressed. 4. The antisense RN according to claim 1 or 2.
A therapeutic agent for HCV-related diseases, which comprises A as an active ingredient. 5. A therapeutic agent for HCV-related diseases, which comprises the expression vector according to claim 3 as an active ingredient.