JPH072782A - Quinoline derivative, its production and agent containing the derivative as active component - Google Patents

Abstract

PURPOSE:To obtain a new compound having actions to inhibit an acyl transferase and inhibit the production of monocyte-chemotactic protein-1 and useful as an agent for the treatment of hyperlipemia and arteriosclerosis. CONSTITUTION:The compound of formula I [R<1> is H, 1-3C lower alkyl or 1-3C acyl; R<2> and R<3> are 1-3C lower alkyl; R<4> is 6-10C aryl, 3-20C cycloalkyl, cycloalkenyl or group of formula II (R<5> and R<6> are H, 1-6C lower alkyl, etc.; R<7> is H, 1-20C alkyl, 2-20C alkenyl, 6-10C aryl, etc.)], e.g. 1-decyl-N-(1,6,7- trimethyl-2-oxo-1,2,3,4-tetrahydroquinolin-5-yl) cyclopentanecarboxamide. The compound of formula I can be produced by reacting an aminoquinolone compound of formula III with a carboxylic acid compound of the formula R<4>-COOH or its reactive derivative in the presence of a condensation agent (e.g. dicyclohexylcarbodiimide) and an amine (e.g. triethylamine) in a solvent (e.g. dichloromethane) at -20 to +150 deg.C.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a novel quinolone derivative, a method for producing the same, a use as a medicine and a pharmaceutical composition containing the same. More specifically, the present invention relates to a quinolone derivative having an acylamino group at the 5-position and a pharmaceutical composition thereof. -Acceptable acid adduct, a method for producing the same, a pharmaceutical composition containing the same, and use thereof as an antihyperlipidemic, antiarteriosclerotic, and antiinflammatory drug.

[0002]

2. Description of the Related Art It is well known that arteriosclerosis is extremely important as a factor of various cardiovascular diseases, and active research has been conducted with the aim of suppressing the progression of arteriosclerosis or reducing the regression of arteriosclerosis. There is. In particular, although drugs that lower cholesterol in serum and arterial walls and their usefulness have been recognized, ideal drugs with clear clinical effects and few side effects have not been realized.

In recent years, it has been revealed that the accumulation of cholesterol in the arterial wall is an important factor in the progression of arteriosclerosis. Therefore, reducing the amount of cholesterol in blood and suppressing the accumulation of cholesterol in the arterial wall are effective in suppressing the progression and regression of arteriosclerosis.

Cholesterol in food is esterified in the small intestinal mucosa and then taken into the blood as chylomicrons. Cholesterol accumulates as cholesterol esters in the arterial wall. Acyl-CoA: CholesterolA is involved in the production of cholesterol ester in the small intestinal mucosa and arterial wall.
It is known that cyltransferase (ACAT) plays an important role. Therefore, ACAT in the small intestinal mucosa
By inhibiting the esterification and suppressing the esterification, cholesterol absorption is hindered, and the blood cholesterol level can be reduced. In addition, inhibition of ACAT in the arterial wall is expected to suppress cholesterol ester accumulation.

From the above, the ACAT inhibitor is considered to be an effective drug for hyperlipidemia and arteriosclerosis.

Conventionally, as such an ACAT enzyme inhibitor,
For example, urea derivatives (reference: J. Med. Chem., 29
Volume, 1311, 1986, JP-A-63-31676.
No. 1, JP-A-1-93569, etc.) and amide derivatives (references: JP-A-63-54718, JP-A-63-253060, etc.), but the structure is Different from the compound of the invention.

On the other hand, infiltration of monocytes and macrophages is important as one of the mechanisms of inflammatory disease. Also, in the early stage of arteriosclerosis, foaming due to cholesterol ester accumulation in monocyte-derived macrophages is observed. These monocytes,
In a disease involving infiltration of macrophages, Mo, which is a cytokine having a migration and activation effect on monocytes
It has been estimated that nocyte Chemotactic Protein-1 (MCP-1) is involved. Therefore, inhibition of MCP-1 production can be expected to be effective in treating inflammatory diseases and arteriosclerosis. However, a drug based on such a mechanism of action has not yet been developed.

[0008]

DISCLOSURE OF THE INVENTION It is an object of the present invention to provide a novel quinolone derivative having an ACAT enzyme inhibitory action and an MCP-1 production inhibitory action, a method for producing the same and a drug containing the same.

[0009]

The present invention provides the following formula [I]:

[0010]

[Chemical 6]

[Wherein R ¹ represents a hydrogen atom, an unsubstituted or substituted C ₁ to C ₃ lower alkyl group, or an unsubstituted or substituted C ₁ to C ₃ acyl group;
R ² and R ³ each independently represent an unsubstituted or substituted C ₁ to C ₃ lower alkyl group; R ⁴ is an unsubstituted or substituted C ₆ to C ₁₀ aryl group,
A C ₃ to C ₂₀ cycloalkyl or cycloalkenyl group which is unsubstituted or substituted at positions other than 1 or the formula:

[0012]

[Chemical 7]

(Wherein R ⁵ and R ⁶ each independently represent a hydrogen atom or an unsubstituted or substituted C ₁ to C ₆ lower alkyl group, or R ⁵ and R ⁶ are taken together to form C 5 ₃ to C ₇ carbocycle may be formed;
R ⁷ is a hydrogen atom, an unsubstituted or substituted C ₁ to C ₂₀ alkyl group, an unsubstituted or substituted C ₂ to C ₂₀ alkenyl group, an unsubstituted or substituted C ₆ to C ₁₀ aryl group, or Substituted or substituted C
₇ to C ₂₀ arylalkyl group). ] As a quinolone derivative represented by the following and a pharmaceutically acceptable acid adduct thereof, a method for producing the same, a pharmaceutical composition containing the same, and an antihyperlipidemic, antiarteriosclerotic, and antiinflammatory agent Regarding the use of.

In the above formula [I], R ¹ is a hydrogen atom,
It represents an unsubstituted or substituted C ₁ to C ₃ lower alkyl group or an unsubstituted or substituted C ₁ to C ₃ acyl group.

The C ₁ to C ₃ lower alkyl group means a C ₁ to C ₃ chain (straight chain or branched) or cyclic alkyl group, and a preferable specific example thereof is methyl, Examples include ethyl, propyl, isopropyl, cyclopropyl and the like. Further, examples of the substituent of the substituted C ₁ to C ₃ lower alkyl group include a halogen atom, a hydroxyl group, an amino group and the like, and preferable specific examples of such a substituted lower alkyl group Examples include trifluoromethyl and the like.

Further, preferred specific examples of the C ₁ to C ₃ acyl group include formyl, acetyl and propionyl. Further, examples of the substituent of the substituted C ₁ to C ₃ acyl group include a halogen atom, a hydroxyl group, an amino group, and the like. Preferred specific examples of such a substituted acyl group include: Examples include trifluoroacetyl.

R²And R³Are independent of each other
Replaced or substituted C₁To C ₃Represents lower alkyl
You

[0018] R ² and C ₃ lower alkyl group C ₁ to the R ³ is to C ₁ to the R ¹ represents the same definition as C ₃ lower alkyl group, the preferred embodiment also include the same examples.

[0019] R ⁴ is an unsubstituted or substituted C ₆ to C ₁₀ aryl group, unsubstituted or 1-position to C ₃ not substituted by other than C ₂₀ cycloalkyl or cycloalkenyl group, or a group of the formula:

[0020]

[Chemical 8]

Represents a group represented by

Preferred specific examples of the C ₆ to C ₁₀ aryl group here include phenyl, 1-naphthyl, and 2-.
Examples include naphthyl. Further, examples of the substituent of the substituted C ₆ to C ₁₀ aryl group include a halogen atom, a hydroxyl group, a nitro group, a cyano group, a C ₁ to C ₁₄ alkyl group, a C ₁ to C ₁₄ alkoxy group, and a C ₁ to C group.
Examples thereof include a ₁₄ acylamino group, a C ₁ to C ₁₄ mono- or dialkylamino group, a C ₁ to C ₁₄ alkyloxycarbonyl group, a C ₁ to C ₁₄ acyl group, and a C ₁ to C ₁₄ acyloxy group.

Among such substituents, C ₁ to C ₁₄ alkyl groups, C ₁ to C ₁₄ alkoxy groups, C ₁ to C ₁₄
Acylamino group, C ₁ to C ₁₄ mono- or dialkylamino group, C ₁ to C ₁₄ alkyloxycarbonyl group, C ₁ to C ₁₄ acyl group, and C ₁ to C ₁₄ acyloxy group are, for example, methyl, ethyl, propyl. , Isopropyl, butyl, isobutyl, sec-butyl, t
ert-butyl, pentyl, neopentyl, hexyl,
Isohexyl, heptyl, octyl, nonyl, decyl,
Undecyl, dodecyl, tridecyl, tetradecyl, cyclopropyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclopropylmethyl group and other chain (straight or branched) or cyclic C ₁ to C ₁₄ alkyl groups, which are alkyl groups Oxy derivative, carbonylamino derivative, amino derivative, oxycarbonyl derivative, carbonyl derivative, and carbonyloxy derivative.

Further, these substituents are a halogen atom, a hydroxyl group, a C ₁ to C ₁₀ alkoxy group, an unsubstituted or substituted aryloxy group, or a C ₁ to C ₁₂ group.
It may be substituted with a mono- or dialkylamino group. Preferable specific examples of such a substituted aryl group include p-fluorophenyl, m-chlorophenyl,
p-nitrophenyl, m-tolyl, p-decylphenyl, p-methoxyphenyl, p-isohexyloxyphenyl, p-decyloxyphenyl, p- (N-butyl-N-methylamino) phenyl, m-heptanoyl Phenyl, p- (6-isobutyloxyhexyl) phenyl, p- (6-chlorophenoxy) hexyloxy) phenyl and the like.

Preferred specific examples of the C ₃ to C ₂₀ cycloalkyl or cycloalkenyl group which is unsubstituted or substituted at the 1-position are cyclopropyl, cyclopentyl, cyclohexyl, 1-cyclohexene-1-
Yl, 4-hexylcyclohexyl, 4-decyloxycyclohexyl and the like.

R ⁵ and R ⁶ each independently represent a hydrogen atom or an unsubstituted or substituted C ₁ to C ₆ lower alkyl group, or R ⁵ and R ⁶ are taken together to form C ₃ to C ₇ It may form a carbocycle.

Here, the C ₁ to C ₆ lower alkyl group means a C ₁ to C ₆ chain (straight or branched) or cyclic alkyl group, and a preferable specific example thereof is methyl, Ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl,
Pentyl, neopentyl, hexyl, cyclopropyl,
Cyclohexyl, cyclopropylmethyl and the like can be mentioned.

R ⁷ is a hydrogen atom, an unsubstituted or substituted C ₁ to C ₂₀ alkyl group, an unsubstituted or substituted C ₂ to C ₂₀ alkenyl group, an unsubstituted or substituted C ₆ to C ₁₀ aryl group Or an unsubstituted or substituted C ₇ to C ₂₀ arylalkyl group.

Here, the C ₁ to C ₂₀ alkyl group of R ⁷ means a C ₁ to C ₂₀ chain (linear or branched) or cyclic alkyl group, and R ⁷ is C ₁ to C _20. Specific examples of R ⁴ when it is an alkyl group include ethyl, propyl, isopropyl, butyl, isobutyl,
sec-butyl, tert-butyl, pentyl, neopentyl, hexyl, isohexyl, octyl, undecyl, dodecyl, tridecyl, pentadecyl, hexadecyl, heptadecyl, nonadecyl, eicosyl, 1,1-
Dimethylheptyl, 1,1-dimethylundecyl, 1,
1,12,12-Tetramethyltridecyl, 1-methyltridecyl, 1-decylcyclohexyl, 1-decylcyclopentyl, 1-dodecylcyclopropyl, 1-ethyloctyl, cyclopropylmethyl, cyclohexylmethyl, and 1-cyclohexyl- 1-methylethyl and the like can be mentioned.

The C ₂ to C ₂₀ alkenyl group means C
_A C ₂ -C ₂₀ chain (straight or branched) or cyclic alkenyl group is meant, and when R ⁷ is a C ₂ -C ₂₀ alkenyl group, suitable examples of R ⁴ are propenyl, iso Pentenyl, hexenyl, 8-tridecenyl, 8-heptadecenyl, 8,11-heptadecadienyl, 1,1-dimethyl-8-nonenyl, cyclohexenylmethyl and the like can be mentioned.

Preferred examples of R ⁴ when R ⁷ is a C ₆ to C ₁₀ aryl group are benzyl, 1-phenylcyclopentyl, 1-phenylethyl, and 1-
Methyl-1- (2-pyridyl) ethyl and the like can be mentioned.

The C ₇ to C ₂₀ arylalkyl group means an arylalkyl group composed of an aromatic hydrocarbon ring and an alkyl group, or an aromatic cyclic compound containing a hetero atom and an alkyl group, and R ⁷ is C ₇ And preferred examples of R ⁴ when it is a C ₂₀ arylalkyl group are 2-phenylethyl, 8-phenyloctyl, 1,1-dimethyl-11-phenylundecyl, 1-benzylcyclopentyl, 1,1. -Dimethyl-4- (1-methyl-1,2,
3,4-tetrahydroquinolin-6-yl) butyl,
1,1-dimethyl-7-pyridylheptyl, and 2,
2-diphenylethyl and the like can be mentioned.

Further, R⁷May be replaced by
Replaced R⁷As the substituent of, for example, a halogen atom,
Hydroxyl group, nitro group, cyano group, C₁To C_TenAlkyl
Base, C₁To C_TenAlkoxy group, C₆To C_TenAnts
Group, C₁To C _TenAcylamino group, C₁Na
Ishi C_TenMono or dialkylamino group, C₁To C
_TenAlkyloxycarbonyl group, C₁To C_TenAcyl
Group or C₁To C_TenName acyloxy groups
be able to. Furthermore, R⁷The substituent is C ₆No
C_TenWhen it is an aryloxy group, a halogen atom,
Hydroxyl group, nitro group, cyano group, C₁To C₆Alkyl
Base, C₁To C₆An alkoxy group or C₁To C
₆It may be substituted with a mono- or dialkylamino group etc.
Yes. Such a substituted R⁷R including^FourSuitable concrete of
Examples include 6-isobutoxyhexyl, 6- (p-c
Lolophenoxy) hexyl, 5- (p-dimethylamino)
Phenoxy) pentyl, 5-isohexyloxy-1,
1-dimethylheptyl, 7-isobutoxy-1,1-di
Methylheptyl, 7-neopentyloxy-1,1-di
Methylheptyl, 5- (p-chlorophenoxy) -1,
1-dimethylpentyl, 6- (p-chlorophenoxy)
-1,1-Dimethylhexyl, 7- (p-chloropheno
Xy) -1,1-dimethylheptyl, 1,1-dimethyl
-7- (p-tolyloxy) heptyl, 5- (p-te
rt-Butylphenoxy) pentyl, 1,1-dimethyl
-6- (p-dimethylaminophenoxy) hexyl,
1,1-Dimethyl-7- (p-dimethylaminophenoxy
Si) heptyl, 7-isopropylamino-1,1-dime
Cylheptyl, 7- (N-benzyl-N-methylami
No) -1,1-dimethylheptyl, 1,1-dimethyl-
7-piperidinoheptyl, 10-ethoxycarbonylde
Sil, 2- (p-nitrophenyl) ethyl, 7- (p-
Chlorophenyl) -1,1-dimethylheptyl, 4-
(P-isobutylphenyl) -1,1-dimethylbuty
1,1- (3-benzoylpropyl) cyclopentyl,
4- (p-diethylaminophenyl) -1,1-dimethyl
Rubutyl, and 6- (p-ethoxyphenyl) -1,
1-dimethylhexyl and the like can be mentioned.

According to the present invention, the quinolone derivative of the present invention may have a basic group in its molecule, in which case the quinolone derivative of the present invention may be an acid adduct. , For example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, mineral acids such as carbonic acid, citric acid, malic acid, oxalic acid,
Examples thereof include organic acids such as tartaric acid, fumaric acid, and methanesulfonic acid.

According to the present invention, the following compounds may be mentioned as preferred specific examples of the quinolone derivative represented by the above formula [I]. (1) 1-decyl-N- (1,6,7-trimethyl-2
-Oxo-1,2,3,4-tetrahydroquinoline-5
-Yl) cyclopentanecarboxamide (2) 2,2-dimethyl-N- (1,6,7-trimethyl-2-oxo-1,2,3,4-tetrahydroquinolin-5-yl) dodecane amide (3) 8- (4-chlorophenoxy) -2,2-dimethyl-N- (1,6,7-trimethyl-2-oxo-1,
2,3,4-Tetrahydroquinolin-5-yl) octanamide (4) 4- {6- (4-chlorophenoxy) hexyloxy} -N- (1,6,7-trimethyl-2-oxo-
1,2,3,4-Tetrahydroquinolin-5-yl) benzamide (5) N- (1,6,7-trimethyl-2-oxo-
1,2,3,4-Tetrahydroquinolin-5-yl) acetamide (6) 2,2-Dimethyl-N- (1,6,7-trimethyl-2-oxo-1,2,3,4-tetrahydroquinoline -5-yl) propionamide (7) N- (1,6,7-trimethyl-2-oxo-
1,2,3,4-Tetrahydroquinolin-5-yl) cyclohexanecarboxamide (8) 4-Fluoro-N- (1,6,7-trimethyl-
2-oxo-1,2,3,4-tetrahydroquinoline-
5-yl) benzamide (9) N- (6,7-diethyl-1-methyl-2-oxo-1,2,3,4-tetrahydroquinolin-5-yl) acetamide (10) 2,2-dimethyl- N- (6,7-dimethyl-
2-oxo-1,2,3,4-tetrahydroquinoline-
5-yl) dodecanamide (11) N- (1-acetyl-6,7-dimethyl-2-
Oxo-1,2,3,4-tetrahydroquinoline-5-
Yl) -2,2-dimethyldodecane amide (12) 2,2-dimethyl-N- (6,7-dimethyl-
1-Propyl-2-oxo-1,2,3,4-tetrahydroquinolin-5-yl) dodecane amide According to the present invention, the following formula [II]

[0036]

[Chemical 9]

[In the formula, R ¹ to R ³ are the same as defined for R ¹ to R ³ in the above formula [I]. ]
And the following formula [III]

[0038]

[Chemical 10]

[0039] In the formula, R in R ⁴ is the formula [I] ⁴
Is the same as the definition of. ] It is possible to provide a method for producing the quinolone derivative represented by the above formula [I] and a pharmaceutically acceptable acid adduct thereof by reacting with a carboxylic acid represented by the above or a reactive derivative thereof. .

The aminoquinolones represented by the above formula [II] can be produced according to a conventionally known method such as JP-A-61-22644.

The carboxylic acid or its reactive derivative represented by the above formula [III] can be produced according to a conventionally known method.

The production method provided by the present invention is carried out according to the above formula [I
I] of the aminoquinolones represented by the formula [III]
] 1 to 5 equivalents of a carboxylic acid represented by the formula: and a condensing agent such as 1 to 2 equivalents of dicyclohexylcarbodiimide and a basic amine such as triethylamine,
It can be carried out by reacting pyridine, 4-dimethylaminopyridine with 0.1 equivalent to 1.5 equivalents in the presence of a solvent.

The reaction temperature is -20 ° C to 150 ° C, preferably room temperature to 100 ° C, and the reaction time is usually 72 hours or less.

Alternatively, 1 equivalent of an aminoquinolone represented by the above formula [II] and a reactive derivative of a carboxylic acid represented by the above formula [III], for example, 1 equivalent to 5 equivalents of a corresponding carboxylic acid chloride or acid anhydride. It can be carried out by reacting with an equivalent amount in the presence of a solvent. In this case, basic amines such as triethylamine, pyridine, 4-dimethylaminopyridine may be added in an amount of 0.1 to 1.5 equivalents.

The reaction temperature is -20 ° C to 150 ° C, preferably -10 ° C to 100 ° C, and the reaction time is usually 72 hours or less.

As the reaction solvent, for example, dichloromethane,
Halogenated hydrocarbons such as chloroform, aromatic hydrocarbons such as benzene and toluene, ethers such as diethyl ether and tetrahydrofuran, and aprotic polar solvents such as dimethylformamide and dimethylsulfoxide are used.

After completion of the reaction, the desired quinolone derivative represented by the above formula [I] can be isolated by performing usual separation and purification operations such as extraction, recrystallization and chromatography.

Further, they can be converted into a pharmaceutically acceptable acid adduct by a conventional method.

The quinolone derivative provided by the present invention and its pharmaceutically acceptable acid adduct have an ACAT enzyme inhibitory action, and as an ACAT inhibitor and in blood,
It reduces total cholesterol in the liver and arterial wall, and is useful for suppressing the progression of hyperlipidemia and arteriosclerosis and for regression.

Further, the quinolone derivative provided by the present invention and its pharmaceutically acceptable acid adduct are M
It has a CP-1 production inhibitory action, and is useful as an MCP-1 production inhibitor, as well as for relieving or suppressing inflammation and for suppressing the progression or regression of arteriosclerosis.

The quinolone derivative and the pharmaceutically acceptable acid adduct thereof provided by the present invention can be formulated into a pharmaceutical composition by mixing with a carrier that does not interfere pharmacologically. The content of the active ingredient is not particularly limited, but is usually 5 to 70%.

The quinolone derivative provided by the present invention and its pharmaceutically acceptable acid adduct can be administered orally or parenterally.

The dosage form of the oral preparation includes, for example, tablets, powders, granules and capsules.

To obtain a dosage form, for example, excipients such as lactose, starch and crystalline cellulose, binders such as carboxymethylcellulose, methylcellulose and polyvinylpyrrolidone, disintegration of sodium alginate, sodium hydrogen carbonate, sodium laurate and the like. It can be molded by a usual method using the agent. Powders and granules can be formed by the same method. Capsules are formed by filling powders, granules and the like into capsules such as gelatin.

Examples of parenteral agents include suppositories, transdermal agents such as patches, injections and the like.

The dose of the quinolone derivative and the pharmaceutically acceptable acid adduct thereof provided by the present invention varies depending on the degree of disease, the age of the patient, the sex, etc., but is usually 1 mg to 500 mg / adult per adult. Is.

The present invention will be described in detail below with reference to examples.

[0058]

[Reference Example 1] 5-amino-1,6,7-trimethyl-1,2,3,4
-Synthesis of tetrahydroquinolin-2-one Intramolecular cyclization reaction of 3-chloro-N- (3,4-dimethylphenyl) propionamide with aluminum chloride (Reference: JP-A-61-2264), 1,6,7-Trimethyl-5-nitro-1,2,3,4-tetrahydroquinolin-2-one synthesized by N-methylation and nitration was added to 50 ml of a solution of Pd- in 50 ml of methanol.
19 mg of C (5%) was added, and the mixture was stirred under a hydrogen atmosphere for 12 hours and hydrogenated. Pd-C was removed by filtration through Celite, and the solvent was distilled off under reduced pressure to obtain 43 mg of the desired title compound.

[0059]

Example 1 1-decyl-N- (1,6,7-trimethyl-2-oxy
So-1,2,3,4-tetrahydroquinoline-5-i
) Cyclopentanecarboxamide (1)

[0060]

[Chemical 11]

5-amino-1,6,7-trimethyl-
1,2,3,4-tetrahydroquinolin-2-one 43
mg and triethylamine 33mg dichloromethane 2m
92 mg of 1-decylcyclopentanecarboxylic acid chloride was added to the solution l, and the mixture was stirred at room temperature for 5 hours. Add 15 ml of 1N sodium hydroxide aqueous solution and add 20 ml of ethyl acetate.
Extracted at 2. The extract was washed with 20 ml of saturated saline solution,
The extract was dried over anhydrous magnesium sulfate, filtered, concentrated, and purified by silica gel column chromatography (7: 3 hexane / ethyl acetate) to obtain 64 mg of the desired title compound. Physical property value ¹ H NMR (CDCl ₃ ) δ (ppm):
0.88 (t, J = 5.3Hz, 3H), 1.13-
1.43 (m, 16H), 1.43-1.90 (m, 8
H), 2.09-2.34 (m, 2H), 2.14
(S, 3H), 2.22 (s, 3H), 2.47-1.
70 (m, 2H), 2.72-2.96 (m, 2H),
3.33 (s, 3H), 6.73 (s, 1H), 6.7
8 (br.s, 1H). Melting point 114-116 ° C

[0062]

Example 2 Measurement of ACAT enzyme inhibitory activity (rabbit small intestinal mucosa microzo
Measurement of ACAT enzyme inhibitory activity of rabbits ) Preparation of rabbit small intestinal mucosa microsomes and measurement of ACAT enzyme activity were carried out by the method of Salone and Field [Reference; Biochemi
ca et Biophysica, 712, 557 (1982)]
Was slightly improved.

30 mM EDTA, 50 mM KCl,
40 mM phosphate buffer containing 0.1 M sucrose, pH 7.
Rabbit small intestinal mucosa was homogenized with 4 (buffer solution A) and centrifuged at 10,000 xg at 4 ° C for 30 minutes to obtain a supernatant. The supernatant was further centrifuged at 105,000 xg at 4 ° C for 1 hour to obtain a precipitate. The precipitate was resuspended in buffer A to give a microsome fraction.

43 μM bovine serum albumin, 0.5 mg /
A 1% v / v dimethyl sulfoxide solution of each concentration of the test compound (Compound 1 synthesized in Example 1) was added to Buffer A containing ml microsome fraction at 1% v / v, and the mixture was heated at 37 ° C. for 5 minutes.

[0065] then [1- ¹⁴ C] oleoyl CoA
43 μM oleoyl CoA containing (3.7 kB) was added, and the mixture was heated at 37 ° C. for 10 minutes, and then the reaction was stopped by adding chloroform / methanol (2/1) containing 10 mg / ml cholesteryl oleate.

[0066] After stirred with ^[3 H] cholesteryl oleate and 1N hydrochloric acid 0.111KB, cholesteryl oleate extracted into the chloroform layer was separated using thin layer chromatography by measuring the radioactivity ACAT
It was made active. The results are shown in Table 1.

[0067]

[Table 1]

[0068]

Example 3 Measurement of MCP-1 production inhibitory action (MCP-1 gene expression
Measurement of inhibitory action) Peripheral blood-derived cell line THP-1 cells (ATCC registration number TIB203) of acute monocytic leukemia patient was added to RPMI 1640 medium supplemented with 10% fetal bovine serum at 1 × 10 ⁶ cells / ml.
200 μl / well of the cell suspension suspended so that each of the wells was mixed with a 10% dimethyl sulfoxide solution of the compound 1 synthesized in Example 1 was added to each well at a final concentration of 10 ^−5. M and 10 ^-6
M was added in an amount of 2 μl and incubated at 37 ° C. in a 5% CO ₂ incubator for 30 minutes. Then lipopolysaccharide (LPS, E. coli 0111; B4, C
ALBIOCHEM) aqueous solution final concentration of LPS 1
Add 2 μl to make μg / ml, and add 5% CO
_The cells were cultured at 37 ° C for 4 hours in an incubator. Then, the cultured cells were collected by pipetting and
After centrifuging at rpm for 30 seconds to make a cell pellet, R
Using the NA extraction reagent, RNA zol B [registered trademark, manufactured by Cosmo Bio Inc.], the method of P. Chomczynsk et al. (Analytical Biochem., 162, 156-159,
RNA was extracted according to 1987).

Next, the method of Thomas Lion et al. (Analytical B
iochemistry Volume 188, 335-337, 1990
, DIG-dUTP [digoxigenin deoxyuridine triphosphate, manufactured by Boehringa Mannheim Yamanouchi Co., Ltd.] was used to synthesize cDNA, and then human MCP-1 mRNA-derived c was obtained by PCR.
The DNA was amplified. The DNA primer used was
Known human MCP-1 cDNA sequence (T. Yoshimura
Et al., FEBS LETTERS Volume 244, 487-4
5'-AA prepared based on page 93, 1989).
AGTCTCTCGCCGCCCTTCTG and 5'-
TTGGGGTTTGCTTGTCCAGGGTG,
Amplifies the 282 bp length. The amplified sample was subjected to agarose gel electrophoresis, the obtained gel was subjected to Southern blotting, and the obtained nylon membrane was reacted with an alkaline phosphatase-labeled anti-DIG antibody [Boehringa Mannheim Yamanouchi Co., Ltd.], followed by chemiluminescence substrate. Lumi-P
PD ₅₃₀ [made by Boehringa Mannheim Yamanouchi Co., Ltd.]
After 30 minutes had passed, the X-ray film was exposed to light for 20 minutes. It was applied to a densitometer and measured at OD ₆₅₀ nm, and the obtained peak area is shown in Table 2 as the MCP-1 gene expression level.

[0070]

[Table 2]

As shown in Table 2, Compound 1 is MCP-1.
The gene expression was suppressed in a dose-dependent manner.

[0072]

INDUSTRIAL APPLICABILITY According to the present invention, a novel quinolone derivative can be obtained, and antihyperlipidemic, antiarteriosclerotic, and antiinflammatory drugs can be obtained.

Front Page Continuation (72) Inventor Noriaki Endo 4-3-2 Asahigaoka, Hino City, Tokyo Teijin Limited Tokyo Research Center

Claims (14)

[Claims] 1. The following formula [I]: [Wherein, R ¹ is a hydrogen atom, unsubstituted or substituted C
₁ to C ₃ lower alkyl group, or an unsubstituted or substituted C ₁ to C ₃ acyl group; R ² and R
³ are each independently unsubstituted or substituted C ₁
To C ₃ lower alkyl group; R ⁴ represents an unsubstituted or substituted C ₆ to C ₁₀ aryl group, an unsubstituted or substituted C ₃ to C ₂₀ cycloalkyl or cycloalkenyl group other than the 1-position, or a formula : [Chemical 2] (In the formula, R ⁵ and R ⁶ each independently represent a hydrogen atom or an unsubstituted or substituted C ₁ to C ₆ lower alkyl group, or R ⁵ and R ⁶ together form C ₃ to C 6. R ⁷ may form a _7- carbon ring; R ⁷ is a hydrogen atom, an unsubstituted or substituted C ₁ to C ₂₀ alkyl group, an unsubstituted or substituted C ₂ to C ₂₀ alkenyl group, an unsubstituted or substituted C ₆ to C ₁₀ aryl group, or unsubstituted or substituted C ₇ to C ₂₀
Represents an arylalkyl group). ] The quinolone derivative represented by these, and its pharmaceutically acceptable acid addition body. 2. The quinolone derivative according to claim ¹ , wherein R ¹ in the above formula [I] is a hydrogen atom, and a pharmaceutically acceptable acid adduct thereof. 3. The quinolone derivative according to claim ^1, wherein R ¹ in the above formula [I] is a methyl group, and a pharmaceutically acceptable acid adduct thereof. 4. The quinolone derivative according to claim 1, wherein R ² and R ³ in the above formula [I] are methyl groups, and a pharmaceutically acceptable acid adduct thereof. 5. The quinolone derivative according to claim ^2, wherein R ² and R ³ in the above formula [I] are methyl groups, and a pharmaceutically acceptable acid adduct thereof. 6. The quinolone derivative according to claim ^3, wherein R ² and R ³ in the above formula [I] are methyl groups, and a pharmaceutically acceptable acid adduct thereof. 7. The above formula [I], wherein R ⁴ is an unsubstituted or substituted C ₆ to C ₁₀ aryl group.
The quinolone derivative described and a pharmaceutically acceptable acid adduct thereof. 8. The quinolone derivative according to claim 6, wherein R ⁴ in the above formula [I] is a C ₃ to C ₂₀ cycloalkyl or cycloalkenyl group which is unsubstituted or substituted at positions other than the 1-position, and a pharmaceutically acceptable derivative thereof. Acid adducts. 9. In the above formula [I], R ⁴ is represented by the following formula: [Wherein R ⁵ and R ⁶ each independently represent a hydrogen atom or an unsubstituted or substituted C ₁ to C ₆ lower alkyl group, or R ⁵ and R ⁶ are taken together to form C ₃ to C 6 R ⁷ may form a _7- carbon ring; R ⁷ is a hydrogen atom, an unsubstituted or substituted C ₁ to C ₂₀ alkyl group, an unsubstituted or substituted C ₂ to C ₂₀ alkenyl group, an unsubstituted or substituted It represents a C ₆ to C ₁₀ aryl group or an unsubstituted or substituted C ₇ to C ₂₀ arylalkyl group. ])) Is a group represented by
The quinolone derivative described and a pharmaceutically acceptable acid adduct thereof. 10. The following formula [II]: [In the formula, R ¹ to R ³ are the same as the definitions of R ¹ to R ³ in the formula [I]. ] And an aminoquinolone represented by the following formula [III] [In the formula, R ⁴ is the same as the definition of R ⁴ in the above formula [I]. ] It reacts with the carboxylic acid represented by these or its reactive derivative, The manufacturing method of the quinolone derivative and its pharmaceutically acceptable acid adduct of Claim 1 characterized by the above-mentioned. 11. A pharmaceutical composition comprising an effective amount of the quinolone derivative according to claim 1, or a pharmaceutically acceptable acid adduct thereof, and a pharmaceutically acceptable carrier. 12. An antihyperlipidemic agent comprising the quinolone derivative according to claim 1 or a pharmaceutically acceptable acid adduct thereof as an active ingredient. 13. An anti-atherosclerotic agent comprising the quinolone derivative according to claim 1 or a pharmaceutically acceptable acid adduct thereof as an active ingredient. 14. An anti-inflammatory agent comprising the quinolone derivative according to claim 1 or a pharmaceutically acceptable acid adduct thereof as an active ingredient.