JPH07267982A - Oligonucleotide labeled with radioactive or nonradioactive substance for recognizing mutant gene of human-originating cytochrome p450i ic18 - Google Patents

Abstract

PURPOSE:To obtain a novel labeled oligonucleotide which comprises nucleotide of a specific GC content and is useful for detection of mutation of human cytochrome P450II C18 because it recognizes the base sequence of mutant gene of the human cytochrome. CONSTITUTION:A novel oligonucleotide that recognizes the base sequence of mutant gene of human cytochrome P450II C18 where the mutant gene has at least one of mutation at the base number 204 within the exon 2 in the normal wild type of the gene, and the nucleotide includes the mutation site within its recognition area, has 40 to 70% GC content and is labeled with a radioactive or non-radioactive substance. The use of this oligonucleotide as a probe permits prompt and high-accuracy detection of the mutation in the human cytochrome P450II C18 gene which participates in metabolic decomposition of medicines. Thus, the difference in the ability of medicinal metabolism between individuals can be known and the safety dose of a medicine can be decided for individuals.

Description

Detailed Description of the Invention

[0001]

This invention relates to human-derived cytochrome P.
The present invention relates to an oligonucleotide labeled with a radioactive or non-radioactive substance for recognizing a DNA having a nucleotide sequence of a 450IIC18 mutant gene.

[0002]

2. Description of the Related Art Cytochrome P450 is one of the metabolic enzymes in the liver involved in the metabolic decomposition of various medicines, and there are many molecular species. Currently, about 20 types have been confirmed in humans. Among these molecular species, human-derived cytochrome P450IIC18 also includes drugs in vivo (eg, tricyclic antidepressants such as amitriptin and imipramine, antiepileptics such as S-mephenytoin and ethotoin, and proton pumps such as omeprazole). Β such as benzodiazepines, which are minor tranquilizers such as inhibitors and diazepam, and propranolol
-Blockers, barbital hypnotic hypnotics such as hexobarbital, etc.) Metabolic ability has been studied extensively, but the definite drug-metabolizing ability remains unclear. Therefore, the human-derived cytochrome P450IIC18 gene polymorphism (gene
tic polymorphism) and individual differences in drug response were not understood. By the way, genetic polymorphism
If the relationship between polymorphism) and individual differences in drug response is clarified, the occurrence of side effects or conversion into active metabolites can be easily predicted. That is, an enzyme involved in the metabolic decomposition of a drug (in the present invention, human-derived cytochrome P
Means 450IIC18. ), The cause of the genetic polymorphism, for example, due to a mutation in the gene, becomes clear.
By carrying out diagnostic analysis of the presence or absence of such gene mutations before administration of a drug, it is possible to determine a safe dose of a drug that has been difficult to use due to individual differences in drug metabolism ability. It becomes possible, and it becomes possible to use a drug or the like which is converted to an active form by the enzyme for each individual.

[0003]

For this reason, genetic polymorphisms (enzymes) involved in the enzymes involved in the metabolic decomposition of pharmaceuticals are considered.
c polymorphism) and individual differences in drug response, and when the cause is based on mutation of the enzyme gene, what mutation and how the gene mutation is present in the drug There was a problem such as whether to perform diagnostic analysis before administration.

[0004]

[Means for Solving the Problems] In view of the above situation, the present inventors have established a relationship between genetic polymorphisms of enzymes involved in metabolic degradation of drugs and individual differences in drug response. As a result of extensive studies to clarify, it was discovered that the relationship between genetic polymorphism of a specific enzyme and individual difference in drug reaction occurs based on mutation of the enzyme gene. Labeled with a radioactive or non-radioactive substance for diagnostic analysis of the presence or absence of such gene mutation before administration of a drug, that is, human-derived cytochrome P450II
An oligonucleotide labeled with a radioactive or non-radioactive substance consisting of nucleotides having a GC content of 40% or more and 70% or less (hereinafter referred to as the oligonucleotide of the present invention) The present invention has been completed. That is, the present invention relates to human-derived cytochrome P450IIC1.
An oligonucleotide labeled with a radioactive or non-radioactive substance consisting of nucleotides having a GC content of 50% or more and 70% or less (hereinafter referred to as the oligonucleotide of the present invention) Note)) is provided.

The oligonucleotide of the present invention recognizes a DNA having a nucleotide sequence of a mutant gene of human-derived cytochrome P450IIC18 and has a GC content of 40.
Any oligonucleotide may be used as long as it is an oligonucleotide labeled with a radioactive or non-radioactive substance consisting of at least 70% but not more than 70% of nucleotide. Furthermore, for example, a human-derived cytochrome P450IIC18 mutant gene has a mutation in at least base number 204 in exon 2 of its normal wild-type gene, and the mutation site is included in the recognition range as described above. Different oligonucleotides are preferred. The preferred GC content is, for example, 4
It can be 0% or more and 60% or less. Particularly preferably, it can be 40% or more and 50% or less. The number of general nucleotides can be, for example, about 8 or more and about 500 or less. The preferred number of nucleotides can be, for example, about 8 or more and about 100 or less. Particularly preferably,
The number may be about 15 or more and about 50 or less. Specifically, there can be mentioned, for example, an oligonucleotide having a sequence selected from the following sequence group. Specifically, there can be mentioned, for example, an oligonucleotide having a sequence selected from the following sequence group. Sequence group (1) 5'-CTGTGTAATTTGGCCTG-3 '(hereinafter referred to as SEQ ID NO: 1) (2) Corresponds to the nucleotide sequence from nucleotide number 169 to 218 in exon 2 of normal wild-type gene of human-derived cytochrome P450IIC18 Oligonucleotide (50 bp) which is a DNA fragment of the mutant gene (hereinafter, referred to as SEQ ID NO: 2) (3) Bases from base number 169 to 268 in exon 2 of normal wild-type gene of human-derived cytochrome P450IIC18 Oligonucleotide (100 bp), which is a DNA fragment of a mutant gene corresponding to the sequence (hereinafter referred to as SEQ ID NO: 3) (4) Base numbers 169 to 331 in exon 2 of normal wild-type gene of human-derived cytochrome P450IIC18 Mutant gene corresponding to the nucleotide sequence up to and the first to third bases of intron 2 Oligonucleotide (200 bp) which is a DNA fragment consisting of a mutant gene corresponding to the sequence up to the th base (hereinafter referred to as SEQ ID NO: 4) (5) Within exon 2 of human wild-type cytochrome P450IIC18 gene , A mutant gene corresponding to the nucleotide sequence from base number 169 to 331, a mutant gene corresponding to the sequence from the first base to the 191st base of intron 2, and the base number of exon 3 An oligonucleotide (513 bp) which is a DNA fragment consisting of a mutant gene corresponding to the nucleotide sequence from 332 to 481 and the nucleotide sequence GTGGGTGACT (513 bp). The oligonucleotide of the present invention generally has about 100 or less nucleotides. If, for example, β
-It can be obtained by a commercially available automatic DNA synthesizer using the cyanoethylphosphoamidite method or the thiophosphite method. When the number of nucleotides is about 100 or more, human-derived cytochrome P450IIC18
It can be obtained by a usual method such as restriction enzyme treatment or cloning treatment of the mutant gene of.

The oligonucleotides of the present invention are extremely useful for diagnostically analyzing the presence or absence of a mutation in the human-derived cytochrome P450IIC18 gene contained in a sample before administration of a drug. That is, the drug actually metabolized by human-derived cytochrome P450IIC18 specifically,
It is troublesome to examine individual differences in drug-metabolizing ability by the enzyme by carefully examining the amount of the drug to be administered, administering it to a subject, and measuring the amount of its metabolites by advanced techniques and complicated operations. Omitted, PCR using genomic DNA prepared from hair, peripheral blood, oral epithelial cells, etc. as a template and the oligonucleotide of the present invention as a primer
By using the method, it is possible to directly test for the presence or absence of mutation, which makes the test faster, more efficient,
Higher precision and lower cost.

The genomic DNA contained in the sample is, for example, Masahiro Matsumura, “Labo Manual Genetic Engineering”, Maruzen (1988) from any cell tissue from which genomic DNA such as hair, peripheral blood, oral epithelial cells can be collected. ) And TAKARA PCR
It can be prepared by the usual method described in Technical news No. 2, Takara Shuzo (1991.9) and the like. Specifically, for example, in the case of hair, 2-3 hairs are washed with sterilized water and ethanol, and then shredded to a length of 2-3 mm.
BCL-Buffer [10mM Tris-HCl (pH7.5), 5mM MgCl2,0.32M su
Add 200 μl of crose, 1% Triton X-100] and add Prot
Add einase K to a final concentration of 100 μg / ml and SDS to a final concentration of 0.5% (w / v), and mix. Genomic DNA can be obtained by treating this mixture at 70 ° C. for 1 hour and then performing phenol / chloroform extraction. In the case of peripheral blood, genomic DNA can be obtained by extracting from a 10 ml blood sample using DNA Extraction-kit (STRATAGENE). In the case of oral epithelial cells, the cheek is scraped off with a spatula or the like to sample a small amount of oral epithelial cells. A cooled TNM solution [20 mM Tris-HCl (pH 7.5), 0.1 M NaC was added to the obtained sample.
l, 1.5 mM MgCl2], homogenize at ice temperature, and then centrifuge [2000 rpm, 5 min, 4 ° C]. A small amount of cooled TNE solution [10 mM Tris-HCl (pH 7.5), 0.1MN
After lightly rinsing with aCl, 1 mM EDTA], add the same TNE solution and stir at ice temperature. After the suspension, Proteinase K was added to a final concentration of 100 μg / ml and SDS to a final concentration of 0.3% (w / v), and mixed. This mixture at 60 ° C
Genomic DNA can be obtained by performing phenol / chloroform extraction after treatment for 4 hours to overnight.

Genomic DNA prepared in this way
In addition, if necessary, the polymerase chain reaction method (PCR method: Saiki et al., Science, Volume 230,
1350 to 1354 (1985) and Williams et al., Nuclei
c Acids Research, Vol. 18, No. 22, p. 6531-65
See page 35 (1991). ), It is not separated by electrophoresis as it is, or after separation, a human-derived cytochrome P450IIC18 is selectively formed by forming a DNA-DNA hybrid using the oligonucleotide of the present invention as a probe.
The presence or absence of gene mutations can be visually assessed.
As a method for forming a DNA-DNA hybrid, an ordinary point mutation detection method, for example, a dot blot hybridization method using the oligonucleotide of the present invention, RFLP (Restriction Fragment Length Pol) is used.
ymorphism) method and the like. Specifically, the random prime method (Anal. Biochem., 132,6, Anal. Bioc.
hem., 137, 266) and Nick translation method (J. Mol. B.
iol., 113,237, Molecular Cloning, A Laboratory Manua
l 2nd ed.10.6-10.12, Cold Spring Harbor Lab.), etc., to obtain an oligonucleotide of the present invention obtained by pre-labeling with a radioactive or non-radioactive substance, for example, a radioactive nucleotide such as [α- ³² P] dCTP. By using the nick translation method,
Radioactive or biotin-11-dUT labeled with ³² P, etc.
Non-radioactive probe labeled by incorporating biotinylated nucleotide such as P or biotin-14-dATP by nick translation method or random priming method, or an enzyme such as alkaline phosphatase or peroxidase is cross-linked to the base site using glutaraldehyde. The binding and labeling of non-radioactive probes can be made. Dot blot hybridization methods include, for example, a. Genomic DNA is prepared from a specimen (see above). B. If necessary, amplification is carried out using the prepared genomic DNA as a template so that at least the mutation site of human cytochrome P450IIC18 gene is included in the growth range. c. Genomic DNA (amplified) is (1)
Then, the genomic DNA is made into a single-stranded state by heat denaturation for 3 to 5 minutes, and this genomic DNA is nylon filtered (Hybond N
(2) The DNA-immobilized filter obtained above and the above-mentioned probe, that is, the oligonucleotide of the present invention are, for example, 40-50. ℃
Then, the cells are hybridized by incubating for 10 to 20 hours, and only the hybridized probe is detected by various methods. When a radioactive probe labeled with ³² P or the like is used as the probe, the signal is detected by exposing it to an X-ray film as it is. When a non-radioactive probe labeled with a biotinylated nucleotide is used, after the enzyme labeling with biotinylated alkaline phosphatase via streptavidin, the substrates nitrobulu-tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate are added. In addition, the color development or luminescence of the substrate due to the enzymatic reaction is exposed to the X-ray film to detect the signal. Further, when a non-radioactive probe labeled with an enzyme such as alkaline phosphatase or peroxidase is used, in the former, 4-methoxy-4- (3-phosphatephenyl) spiro [1,2-dioxyethane-3,2-adamantane] ( In the latter case, luminol or the like is used as a substrate, and the color development or luminescence of the substrate due to an enzymatic reaction is exposed to an X-ray film to detect a signal. The RFLP method is, for example, a. Preparing genomic DNA from a specimen (see above), b. Prepared genomic DN, if necessary
Using A as a template, at least human-derived cytochrome P45
Amplification is performed so that the mutation site of the 0IIC18 gene is included in the growth range. c. Genomic DNA (amplified)
It is completely cleaved using a restriction enzyme having a nucleotide sequence of the mutation site of the gene (eg, positive recognition ... AATT ..., negative recognition ... ATTT ...) as a recognition site. d. The restriction enzyme-treated genomic DNA is subjected to agarose gel electrophoresis (generally, electrophoresis at a low voltage of about 20 V for about overnight is preferable). If the genomic DNA is amplified in b, this step can be omitted. e.
The restriction enzyme-treated genomic DNA (separated by electrophoresis) is transferred from the agarose gel described above to a nylon filter or a nitrocellulose filter in a capillary manner or electrically to obtain a blot membrane. f. The genomic DNA treated with the restriction enzyme on the blot membrane is (1) made into a single-stranded state by, for example, heat denaturation at 90 to 100 ° C. for 3 to 5 minutes, and dried and then fixed by irradiating with ultraviolet rays. (2) Obtained DN
The A-fixed filter and the above-mentioned probe, that is, the oligonucleotide of the present invention, are mixed at 40 to 50 ° C. for 10
By incubating for -20 hours, hybridization is performed, and only the probe forming the hybrid by various methods is detected, and so on. When a radioactive probe labeled with ³² P or the like is used as the probe, the signal is detected by exposing it to an X-ray film as it is. When using a non-radioactive probe labeled with a biotinylated nucleotide, after enzyme labeling with biotinylated alkaline phosphatase via streptavidin,
Nitroble-tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate, which are substrates, are added, and the color development or luminescence of the substrate due to the enzymatic reaction is exposed to an X-ray film to detect a signal. When a non-radioactive probe labeled with an enzyme such as alkaline phosphatase or peroxidase is used, the former is 4-methoxy-4- (3-phosphatephenyl) spiro [1,
2-dioxyethane-3,2-adamantane] (PP
In D) and the like, in the latter case, luminol or the like is used as a substrate, and the color development or luminescence of the substrate due to an enzymatic reaction is exposed to an X-ray film to detect a signal.

Based on the results of the above-described detection, it is determined whether the detected genomic DNA is caused by the action of a restriction enzyme having the nucleotide sequence of the mutation site as a recognition site, and whether the resulting genomic DNA is cut. Judgment (For example, if a gene preparation whose normal wild type or mutant type is known in advance is simultaneously tested as a control, the judgment can be easily made, and the molecular weight or the number of detected genomic DNAs can be used. Can also be determined.)
Thus, it becomes possible to perform a diagnostic analysis before or after administration of a drug for the presence or absence of a mutation in the human-derived cytochrome P450IIC18 gene. If necessary, a more accurate diagnostic analysis can be performed by combining the results obtained when the various oligonucleotides of the present invention are used alone.

[0010]

The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to these examples.

Example 1 (Preparation of oligonucleotide of the present invention) In a mutant gene having a mutation at base number 204 in exon 2 of human-derived cytochrome P450IIC18 gene, a nucleotide sequence in which the mutation site is included in the recognition range And has a GC content of about 53%, and 1
An oligonucleotide of 7 nucleotides was designed. Based on the designed nucleotide sequence, the oligonucleotide represented by SEQ ID NO: 1 was prepared using an automatic DNA synthesizer (Applied Biosystems: Medel 394). The produced oligonucleotide is a commercially available ECL-
Using the random prime DNA labeling detection system (manufactured by Amersham), the oligonucleotide of the present invention (a non-radioactive probe in which fluorescein as a label is cross-linked to the base site) was obtained. Human-derived cytochrome P
Regarding the nucleotide sequence of the normal wild-type gene of 450IIC18, for example, Mol. Pharmacol., 40,375, Biochem. And
biobhys.res.comm., 194,1 etc., and the nucleotide sequence of the mutant gene thereof is described in the following reference example.

Example 2 (Genome DN contained in sample)
Extraction of A) Peripheral blood was used as a cell tissue from which genomic DNA can be collected. 10 ml of blood was collected and genomic DNA was obtained from the blood obtained by using DNA Extraction-kit (manufactured by Stratagene).
A was extracted. The obtained genomic DNA solution (250 μg as the amount of DNA) was transferred to a plastic tube and stored at 4 ° C. until used in the test.

Example 3 (Method of Diagnostic Analysis of Mutation Using Oligonucleotide of the Present Invention) 5 μg of the genomic DNA obtained in Example 2 was treated with a restriction enzyme Ts.
Using pEI (Tsp509I) (NEW ENGLAND BIOLABS), it was completely cleaved at a reaction temperature of 65 ° C. and a reaction time of 16 hours. The obtained restriction enzyme-treated genomic DNA was separated by 0.8% agarose gel electrophoresis. The electrophoresis conditions were 20 V and 16 hours. The restriction enzyme-treated genomic DNA separated by electrophoresis is subjected to a capillary-type alkaline blotting method (Hybond method) described in Nuc. Acids Res., 3,7207, etc. from the above agarose gel.
A blot membrane was obtained by transferring to a nylon filter (Hybond-N, manufactured by Amersham) using a blotting membrane manual (Amersham). The blotting time was 2 hours. The blot membrane thus obtained was loaded with 2X SSC-buffer (0.3M NaCl, 0.03M Na-ci
After washing lightly with trate, pH 7.0), the blot membrane was washed with 8
Heat treatment at 0 ° C for 10 minutes, air dry on filter paper for 20 minutes,
The genomic DNA that had been treated with the restriction enzyme was immobilized on the blot membrane by irradiating with ultraviolet rays for 2 minutes. Next, EC
D obtained using L detection kit (manufactured by Amersham)
1 ml of a hybridization buffer containing 0.5 M sodium chloride was placed in a hybrid bag against 4 cm ^{2 of the} NA-fixed filter, heat-sealed, and prehybridized at 42 ° C. for 1 hour. Then, the hybridization buffer was replaced with an equal amount, and the probe prepared in Example 1, that is, the oligonucleotide of the present invention was replaced with 10 ng / ml.
And the DNA-immobilized filter was incubated at 60 ° C. for about 16 hours with gentle shaking,
A DNA-DNA hybrid was formed. After completion of the reaction, the DNA-immobilized filter was treated with 0.5 × SS containing 6 M urea and 0.4% by weight SDS per 1 cm ^{2 of the} filter.
C (7.5 mM sodium citrate, 75 mM sodium chloride,
(pH 7.0) After washing, 2 ml was used for washing at 42 ° C. for 10 minutes. Replace the cleaning solution every time for 10 minutes, then 2
Washed for 0 minutes. Then 0.3M sodium chloride was added.
A 03 M sodium citrate (pH 7.0) washing solution was used for 5 minutes at room temperature using the same amount as above. After repeating this washing once, leave the DNA-immobilized filter on the filter paper for 1 minute,
Detection reagent mixture (ECL Direct Labeling Kit;
The probe was allowed to undergo a luminescence reaction by immersing it in Amersham) and shaking it at room temperature for 1 minute. After exposing the X-ray film for 1 hour by the above-mentioned light emission, the X-ray film was developed and the signal was detected. As the size marker, a plasmid pBR322 completely hydrolyzed with a restriction enzyme MspI (manufactured by Nippon Gene) or a lambda DNA completely hydrolyzed with a restriction enzyme Hind III (manufactured by Takara Shuzo Co., Ltd.) was used. As a result, when the sample had a mutation in the human cytochrome P450IIC18 gene and was prepared from a sample having a homozygous mutant, the molecular weight was small (D
Two bands with a small NA chain length) were detected. On the other hand, when the sample was prepared from a sample having a heterozygous mutant type and a normal wild type, three genomic DNAs were detected. Further, when the sample does not have a mutation in the human cytochrome P450IIC18 gene (prepared from a sample having a normal wild type homozygous), one band having a large molecular weight (large DNA chain length) is detected. (See Figure 1).

Reference Example (Human-derived cytochrome P450I
Nucleotide sequence analysis of exon 2 region in IC18 gene) Peripheral blood and hair were used as cell tissues from which genomic DNA could be collected. Take 10 ml of blood and perform DNA Extraction
Genomic DNA was extracted from the blood obtained using -kit (Stratagene). On the other hand, in the case of hair, hair 2
The three bottles were washed with sterilized water and then washed with 100% ethanol. After air-drying at room temperature, shred into 2-3 mm length,
This was transferred to a plastic tube. BCL-Buffer [1
0mM Tris-HCl (pH7.5), 5mM MgCl2, 0.32M sucrose, 1% Tri
ton X-100] 200 μl was added and stirred. After completely suspending, 1 μl of 20 mg / ml Proteinase K (Boehringer Mannheim) solution (final concentration 100 μg / m)
l) and 10 μl of 10% SDS solution (final concentration 0.
5% (W / V)) was gently added to the mixture in small amounts and mixed. After incubating this mixture at 70 ° C. for 1 hour, an equal amount of phenol was added thereto, shaken vigorously, and then centrifuged [3000 rpm, 10 min, 4 ° C.]. After adding 500 μl of 100% ethanol to this, -80
Incubate for 20 minutes at ℃, centrifuge [3000rpm, 10m
in, 4 ° C]. After drying the obtained pellet to 50,
μl of TE solution [10 mM Tris-HCl (pH 7.5), 1 mM EDTA] was dissolved. The obtained genomic DNA solution (in the case of peripheral blood,
A DNA amount of 250 μg, and in the case of hair, a DNA amount of 1.0 pg) was transferred to a plastic tube and stored at 4 ° C. until used in the test. The genomic DNA thus obtained contains 100 pmol of suitable primers,
2.5 units of heat-resistant DNA polymerase (Stratagene: pfu DNA polymerase), 1.0 nmol of 4
Each type of base (dATP, dTTP, dCTP, dGTP) and 0.02 μg
0.01% (wt / v) gelatin containing the above-mentioned genomic DNA,
The polymerase chain reaction was carried out in 10 mM Tris-HCl buffer (pH 8.3) containing 50 mM potassium chloride and 2.5 mM magnesium chloride. The reaction liquid volume was 20 μl, and about 20 μl of mineral oil was added to prevent evaporation of the reaction liquid. Each step in the above polymerase chain reaction was carried out by heating at 94 ° C. for 1 minute in the denaturing step, incubating with the primer for 5 seconds at 50 ° C. in the primer annealing step, and at 75 ° C. for 30 seconds in the extension step by DNA polymerase. The cycle of heat-resistant DNA polymerase treatment was performed 35 times. The (amplified) genomic DNA obtained in this manner was used as a commercially available pU
A plasmid was constructed by ligating to a C118 vector (Takara Shuzo) by a conventional method. The constructed plasmid is competent E. coli HB
-101 (manufactured by Takara Shuzo) was transformed into a clone. Plasmid DNA from 5 clones per sample was analyzed by the alkaline rapid method (Nuclei
c Acids Res., 7,1513), and using this as a template, Taq Dye-deoxy Terminater Cycle Sequencing ki
t (manufactured by Applied Biosystems) and automatic base sequence analyzer (model373 manufactured by Applied Biosystems)
A) was used to determine the nucleotide sequence [basic principle: dideoxy chain terminator method (Science, 214, 120).
Five)〕. The nucleotide sequences were 5'to 3'and 3'to 5'in both directions, and it was confirmed that there was no misreading. as a result,
When peripheral blood and hair are used as the cell tissues, the T of base number 204 is A in the exon 2 region of the human-derived cytochrome P450IIC18 gene.
It was found that there is a sample having a gene having a mutation that is replaced with (see FIG. 2). This is TAT to TAA
It means a codon change of, that is, a mutation from the 69th tyrosine to a stop codon. This indicates that human-derived cytochrome P450I is homozygous for this mutation.
This shows that the IC18 gene cannot be completely translated and the gene expression is abnormal. Furthermore, the nucleotide sequence having this mutation site is from TATTTT to TAATTT.
It was also revealed at the same time that the restriction site TATT of the restriction enzyme TspEI (Tsp509I) can be formed due to the mutation to.

[0015]

INDUSTRIAL APPLICABILITY By using the oligonucleotide of the present invention as a probe, human-derived cytochrome P450II, which is one of the enzymes involved in the metabolic decomposition of pharmaceuticals
It becomes possible to test for the presence or absence of a mutation in the C18 gene, which speeds up the test, increases the efficiency, increases the accuracy, and reduces the cost. Therefore, it becomes possible to easily perform a diagnostic analysis of the presence or absence of a mutation before administration of a drug, and a safe dose of a drug, which has been difficult to use due to individual differences in drug metabolism ability up to now, can be determined. It becomes possible to determine the drug, and it becomes possible to individually use a drug or the like which is converted into an active form by the enzyme.

[0016]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 17 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear sequence CTGTGTAATTTGGCCTG 17

SEQ ID NO: 2 Sequence length: 50 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear sequence TTCTCAAAAG TCTATGGCCC TGTGTTCACT GTGTATTTTG GCCTGAAGCC 50

SEQ ID NO: 3 Sequence length: 100 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear sequence TTCTCAAAAG TCTATGGCCC TGTGTTCACT GTGTATTTTG GCCTGAAGCC CATTGTGGTG 60 TTGCATGGAT ATGAAGCAGT GAAGGAGGCC CTGATTGATC 100

SEQ ID NO: 4 Sequence length: 200 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear sequence TTCTCAAAAG TCTATGGCCC TGTGTTCACT GTGTATTTTG GCCTGAAGCC CATTGTGGTG 60 TTGCATGGAT ATGAAGCAGT GAAGGAGGCC CTGATTGATC ATGGAGTAGAAGAGGAGATTTTGAGAC TGGATGTATC 180 CTGTGTATGT GTACATGTGT 200

[0020]

[Brief description of drawings]

FIG. 1 shows a genomic DNA extracted from a human cell tissue as a sample, which is subjected to restriction treatment with a restriction enzyme having a nucleotide sequence of its mutant gene as a recognition site, and the resulting DNA fragment is electrophoresed. It is a figure which shows the result of having performed the hybridization analysis which used the invention oligonucleotide as a probe. Human-derived cytochrome P45
It can be seen that there are various types of samples containing DNA having the nucleotide sequence of the normal wild type and / or mutant type gene of 0IIC18. Lane A is a sample homozygous for the nucleotide sequence of a normal wild type gene, B
Lane is a sample having a homologous base sequence of a mutant gene, and C lane is a sample having a heterologous base sequence of a normal wild type gene and a mutant type gene.

FIG. 2 is a diagram showing the results of nucleotide sequence analysis of the exon 2 region in human-derived cytochrome P450 IIC18 gene. Of the nucleotide sequence of the exon 2 region in human-derived cytochrome P450IIC18 gene, nucleotide number 204
It can be seen that there is a sample having a gene having a mutation in which T in A is replaced with A. This means a codon change from TAT to TAA, that is, a mutation from the 69th tyrosine to a stop codon.

Claims (2)

[Claims] 1. An oligonucleotide labeled with a radioactive or non-radioactive substance, which recognizes a DNA having a nucleotide sequence of a mutant gene of human cytochrome P450IIC18 and has a GC content of 40% or more and 70% or less. . 2. The human-derived cytochrome P450IIC18 mutant gene has a mutation in at least base number 204 in exon 2 of its normal wild-type gene, and the mutation site is included in the recognition range. An oligonucleotide labeled with the radioactive or non-radioactive substance according to 1.