JPH0723781A - Modified cgtase, its production and use - Google Patents

Abstract

PURPOSE:To obtain the subject CGTase having high production ratio of gamma- cyclodextrin. CONSTITUTION:This modified CGTase is a cyclomaltodextrin glucanotransferase (CGTase) wherein the 56-site tyrosine residue or phenyl residue in the A region (the histidine residue is taken as the 1-site) is substituted with leucine residue or valine residue. The enzyme can be separated from the cultured product of a host cell transformed with an expression vector containing a DNA coding the modified CGTase.

Description

Detailed Description of the Invention

[0001]

The present invention relates to a modified CGTase gene, a recombinant microorganism carrying the modified CGTase gene,
The present invention relates to a modified CGTase and a method for producing cyclodextrin using the modified CGTase.

[0002]

PRIOR ART Cyclomaltodextrin glucan transferase (CGTase)
otransferase) is from starch to α-cyclodextrin,
It is an enzyme that produces a mixture of various cyclodextrins such as β-cyclodextrin and γ-cyclodextrin, and is classified as a transferase as EC 2.4.1.16. To date, Bacillus, Klebsiella, and Micrococcus
Bacteria belonging to the genus coccus) have been reported as microorganisms that produce this CGTase.

The products from starch, α-cyclodextrin, β-cyclodextrin, and γ-cyclodextrin, have a cyclic structure in which glucose of 6, 7, and 8 residues is α-1,4-bonded, respectively. It is a homo-oligosaccharide taken, and any cyclodextrin retains various hydrophobic substances that serve as hosts in the voids of the cyclic structure to form a stable clathrate compound and imparts hydrophilicity. Since cyclodextrin has this hugging function,
It is a substance that is useful in medicine and other industries and is safe for the body.

Typical α-, β-, and γ-cyclodextrins differ in the diameter of the voids in their cyclic structure by about 6, 7, and 8 angstroms, respectively. Therefore, when comparing these three types of cyclodextrins, it is desirable for the diversity of the host substance that the diameter of the voids is larger, and in order to form a hydrophilic clathrate, the solubility of the substance in water is different. High α- and γ-cyclodextrins are suitable. That is, when these three types of cyclodextrins are compared, the function of γ-cyclodextrin is the highest.

Conventionally, in order to produce this useful γ-cyclodextrin, CGTase is allowed to act on starch as a substrate to produce a mixed solution of various cyclodextrins, and then crystallization separation, chromatographic separation, etc. are carried out. , The main product α
-Or β-cyclodextrin was removed outside the system to prepare a high concentration of γ-cyclodextrin.

To efficiently produce γ-cyclodextrin by this method, for example, JP-A-52-790 is used.
39 and the method disclosed in JP-A-60-227693, there is a method in which a surfactant or the like is added to an enzyme reaction system to change the production ratio of various cyclodextrins to increase the yield of the desired cyclodextrin. . However, this method is not suitable for the production of cyclodextrin used in foods, etc., since there is a possibility that surfactants and the like may remain.

As another method, a CGTase having a higher γ-cyclodextrin production ratio of interest is used to obtain γ
-There is a method for efficiently producing cyclodextrin. That is, CG with a high γ-cyclodextrin production ratio
This is a method for newly separating Tase-producing microorganisms from the natural world. An example of this method is "Starch Science" 33, 137.
-143 (1986) reported by Horikoshi et al., Bacillus subtilis No. 313 strain. According to the report, CGTase produced by this microorganism produces only γ-cyclodextrin using starch as a substrate, but the production efficiency from starch is as low as 3%.

[0008]

DISCLOSURE OF THE INVENTION Since the present inventors produce γ-cyclodextrin useful as a clathrate compound, it was confirmed that it is a substance dangerous to the living body such as the above-mentioned surfactants or it is safe. The present inventors have earnestly studied a method of producing CGTase which has a higher production ratio of γ-cyclodextrin, which is a method that does not use a substance that is not used. Therefore, CGTase with a high production ratio of γ-cyclodextrin
CG with a high production ratio of γ-cyclodextrin by genetically engineering the already obtained CGTase gene, regardless of the method of newly separating the microorganism that produces the
The method of producing Tase was studied.

Comparing the nucleotide sequence of the CGTase gene reported up to now and the deduced amino acid sequence, the number of amino acid residues constituting each was 700 amino acid residues,
Also, at the amino acid level, they all show about 70% agreement with each other. Further, the regions presumed to be the sequences of active amino acid residues that control the binding between CGTase and the starch substrate are presumed to be the A region, the B region, and the C region (Japanese Patent Application Laid-Open No. HEI 5-1951).
41985). Their positions are generally around the 140th residue and the 233rd residue from the amino terminus of the mature enzyme,
It exists near residues 327 and 327, and high homology is observed in these regions. This position is present in the vicinity of the 169th residue, the 262th residue, and the 356th residue from the initial methionine.

The ratios of various cyclodextrins produced by each of CGTases are different, but all produce a mixture of three types of cyclodextrins. Therefore, by modifying a part of the sequence of the amino acid residues of CGTase, CGTa with a high γ-cyclodextrin production ratio was obtained.
It was thought that it is possible to create se, and for this purpose, it is possible to partially modify the DNA sequence of the CGTase gene to create a CGTase gene having a higher γ-cyclodextrin production ratio.

[0011]

[Means for Solving the Problems]

The present inventors have conducted various studies to obtain CGTase having a high production rate of γ-cyclodextrin. As a result, the 56-position tyrosine residue or phenylalanine residue is defined with the histidine residue in the A region of various CGTases as the 1-position. Is replaced by a leucine residue or a valine residue,
It was found that a CGTase enzyme that specifically produces cyclodextrin can be obtained. Accordingly, the present invention provides a modified CGTase in which a tyrosine residue or a phenylalanine residue present at position 56 in the CGTase with the histidine residue in the A region as position 1 is replaced by a leucine residue or a valine residue. .

The origin of the CGTase gene used in the present invention is
Genus Bacillus, Klebsiella
CG of genus or Micrococcus genus
Any microorganism having a Tase gene can be used, but here, genes derived from the alkalophilic Bacillus genus are taken as examples. Various CGTases are disclosed in JP-A-5-41985.
And the invention can be applied to those CGTases.

The alkalophilic Bacillus sp. # 1011 (Microtechnological Research Institute No. 8685) isolated from the soil by the present inventors is a high-producing strain of CGTase, and its CG
The Tase gene has already been cloned by the present inventors from chromosomal DNA on Escherichia coli or Bacillus subtilis plasmid and the nucleotide sequence has been determined [(Appl. Microbiol. Biot
echnol.26.149 (1987), J.Bacteriol.169.4399 (1987),
And JP-A-62-208286]. The plasmid pTUE217 obtained at that time was the CGTase of the above # 1011 strain.
A Saw3AI fragment (5.6 kb) containing the gene was inserted into the BamHI site of E. coli plasmid pBR322 (10.0 kb, its restriction enzyme map is shown in FIG. 1), and the CGTase gene was stably expressed in E. coli. To be done.

In order to change the production ratio of various cyclodextrins produced from starch by this CGTase, the tyrosine residue at the 195th residue from the amino terminus of this enzyme was changed to a leucine residue or a valine residue. D
Modified at NA level. As a result, it was possible to create a CGTase having a γ-cyclodextrin production ratio of 70% or more by modifying the above-mentioned tyrosine residue into a leucine residue or a valine residue.

That is, a modified CGTase gene having a DNA sequence for modifying a tyrosine residue existing near the 195th residue to a leucine residue or a valine residue from the amino terminus of the mature enzyme of CGTase is subjected to site-specific mutation ( Site-Directed M
utagenesis). The tyrosine residue existing near the 195th residue exists between the A region and B region of CGTase.

An example of the modification method will be given below. In the following operation, when the transformant is separated on a plate,
A selective medium containing 1% starch was used to spray the iodine solution on the plate showing the colonies to select the colonies in which the halo (clear ring) was detected. Then, the presence or absence of CGTase activity of the strain was confirmed by thin layer chromatography analysis.

1. Prepared by cutting plasmid pTUE217 (FIG. 1) with restriction enzymes SphI and SmaI.
The 8 kb DNA fragment contains a nucleotide sequence that completely encodes the primary structure from the A region of the CGTase structural gene to the carboxy terminus. This DNA fragment was used as an E. coli filamentous phage plasmid M1 developed by Messing, J.
3mp18 (Purchased from Takara Shuzo Co., Ltd. Methods Enzymol.
101.20 (1983)) SphI-SmaI site,
E. coli BW313 strain (purchased from Takara Shuzo Co., Ltd.

HfrKL16PO / 45 [1syA (61-62)] dut1
ung1 thi-1 relA1 ) was used as a host to prepare ssDNA (single stranded DNA) in which uracil was partially mixed in place of thymine in DNA. this
For ssDNA, the method of Kunkel. TA et al. (Methods Enzymol.
Mutations were introduced according to 4.367 (1987).

That is, the deduced amino acid sequence near the 195th residue from the amino terminus of CGTase is Ile-Tyr-Lys-.
Asn-Leu- Tyr- Asp-Leu-Ala-A
sp-Leu (SEQ ID NO: 1), and this 19
In order to create a modified gene having a DNA sequence for modifying the tyrosine residue existing at the 5th residue into a leucine residue, a valine residue, a phenylalanine residue, or an isoleucine residue by site-directed mutation, Showing Y195
Four kinds of synthetic DNAs of L, Y195V, Y195F, and Y195I were prepared.

Y195L: 5'AAAAACCTGCTCGATCTG
GCT3 '(SEQ ID NO: 2) Y195V: 5'AAAAACCTGGTCGATCTGGCT3' (SEQ ID NO: 3) Y195F: 5'AAAAACCTGTTCGATCTGGCT3 '(SEQ ID NO: 4) Y195I: 5'AAAAACCTGATCGATCTGGCT3' (SEQ ID NO: 5)

DNA synthesis is carried out by Applied Biosystems D
NA Synthesizer model 380A was used and it synthesize | combined by the solid-phase (beta) -cyanoethyl method. Appl for purification of synthetic DNA
Oligonucleotide Purification Gart from ied Biosystems
I used a ridge. The result of introducing these mutations is DN
It was confirmed by the A sequence.

Then, the RF-DNA (replicative form-DN) of 7 kinds of phages introduced with these mutations was used.
A) is alkali-SDS method (Birnboim, HC & Doly, J.N.
nucleoic Acids Res. 7.1513 (1979), and 4 kinds of SphI-AflII fragments (1.8 kb) containing the mutated DNA sequence were prepared. The 1.8 kb DNA fragment (hereinafter referred to as the mutant DNA fragment) was CGTa.
It contains a base sequence that completely encodes the region corresponding to the primary structure from the A region of se to the carboxy terminus. However, this base sequence contains a tyrosine residue at each one of the bases due to site-specific mutation. Has been mutated.

Next, Hi of the above plasmid pTUE217
Prepare the ndIII fragment (5.0 kb). This DNA fragment completely contains the CGTase gene. This DNA fragment was used as an E. coli plasmid p developed by Messing, J.
UC13 (purchased from Takara Shuzo Co., Ltd. Methods Enzymol.10)
1.20 (1983)) HindIII site, lac Z gene and CGTa
A new plasmid pTUE254 was constructed by inserting so that the se gene had the same transcription direction. The CGTase gene on this plasmid is stably expressed in E. coli.

In this new plasmid pTUE254, the SphI site contained in the existing CGTase gene and
The DNA region surrounded by the Afl II site (1.8 kb. This region contains the nucleotide sequence completely encoding the primary structure from the A region of CGTase to the carboxy terminus) was digested. Each of the above four kinds of mutant DNA fragments was inserted therein to construct a plasmid, and E. coli M as a host was constructed.
Transformed into E8417 strain and containing mutant CGTase gene 4
Different types of plasmids were isolated.

In the E. coli ME8417 transformant containing these four types of plasmids, the mutant CGTase gene was stably expressed by SDS-polyacrylamide gel electrophoresis (the molecular weight is 66 kD, which is similar to that of the CGTase of the # 1011 strain). , And Southern blotting,
Furthermore, it was confirmed by detection of cyclodextrin by thin layer chromatography analysis. These four types of plasmids were designated as pY195L, pY195V and pY195, respectively.
F and pY195I.

Mutations created by this site-specific mutation
The CGTase gene has been cloned here into an E. coli transformant, but the host is not limited, and any microorganism such as bacteria such as Bacillus subtilis, actinomycetes, and yeast can be used. It is also possible to integrate and express the chromosomal DNA of these microorganisms including the parent strain.

Purification of mutant CGTase was carried out by the following procedure. Four strains of Escherichia coli ME8 stably retaining plasmids pY195L, pY195V, pY195F and pY195I containing the above-mentioned four types of mutant CGTase genes, respectively.
The 417 transformant was transformed into pY195L-E. coli ME8
417, pY195V-E. coli ME8417, pY
195F-E. coli ME8417, and pY195I
-E. coli ME8417.

For these 4 strains, L-broth medium containing 250 μg / ml ampicillin and 20 μg / tetracycline (tryptone 1%, yeast extract 0.5%, NaC1
0.5%) Cultured in 500 ml, harvested, osmotic
Shock method (Chan, SJ et al. Proc. Natl. Acad. Sci. U.
SA 78.5401 (1981)) to prepare the E. coli periplasmic fraction.

After maintaining the salting-out condition of 25% ammonium sulfate at low temperature for 1 hour, the centrifugation supernatant was preliminarily adjusted to pH 8.0 with Tris-.
Toyopearl HW-55 equilibrated with hydrochloric acid buffer and 25% ammonium sulfate
Column chromatography analysis was carried out on a column filled with F, CGTase was adsorbed on the column, and then CGTase was eluted with a Tris-hydrochloric acid buffer solution of pH 8.0. The starch degrading activity of the enzyme was analyzed by the iodine starch reaction according to Fuwa's method (Fuwa, H. J. Biochem. 41.583 (1954), and the active hula cushion was collected and dialyzed against Tris-hydrochloric acid buffer of pH 8.0 to obtain 4 types. About 30 mg of each purified enzyme preparation of

The starch-degrading activity in this study was as follows: 50 μl of enzyme solution was added to 100 μl of 0.3% starch solution (10 mM sodium phosphate buffer, pH 6.0) at 37 ° C.
After maintaining for 3 minutes, 3.75 ml of an iodine solution (1.7 mM potassium iodide, 0.17 mM iodine, 0.5% hydrochloric acid) was added, and the absorbance at 660 nm was measured. The starch-degrading activity was defined as 1 unit, which is an activity that reduces the absorbance of starch used as a substrate by 1% for 1 minute. As the starch reagent, soluble starch (# 1252) manufactured by Merck was used. The four modified CGTases obtained and the parent strain # 1011 CGTase (wil
The specific activity of the starch degrading activity was analyzed for d type), and the results are shown in Table 1.

As for the CGTase of # 1011 used here, alkalophilic Bacillus sp. # 1011 (Ministry of Industrial Science and Technology No. 8685) was used as polypeptone 1.0% and yeast extract 0.
5%, starch 2%, K ₂ HPO ₄ 0.1%, MgSO ₄ ·
7H ₂ O 0.02%, Na ₂ CO ₃ 1% in a medium (however, only Na ₂ CO ₃ 1% is added after autoclaving separately), aerobically cultured at 40 ° C. for 48 hours, and centrifuged. After being purified and maintained at a low temperature under salting-out conditions of 25% ammonium sulfate for 1 hour, a purified enzyme preparation was obtained and analyzed by the same procedure as the above-mentioned mutant CGTase.

That is, the starch degrading activity of the mutant CGTase in which the tyrosine residue existing at the 195th residue from the amino terminus of CGTase was modified to a leucine residue or a valine residue was
Compared to the parent strain # 1011 wild type CGTase, it was reduced to about one-third. However, 1 from the amino terminus
Mutant CGTa in which the tyrosine residue existing at the 95th residue is modified to a phenylalanine residue or an isoleucine residue
No significant decrease was observed in the starch degrading activity of se.

Next, the production ratio of cyclodextrin produced by these mutant CGTases was analyzed. The ratio of cyclodextrin produced in this study was 17
Amylose (Hayashibara Biochemical Research Laboratories) 1% solution (1
Using 0 mM calcium acetate, pH 6.0) as a substrate, 10
Add purified enzyme at a unit of 1 ml / ml, and at 37 ℃ for 10 minutes ~
After reacting for 6 hours, the enzyme is inactivated by boiling. afterwards,
100 units of glucoamylase manufactured by Seikagaku Corporation was added, and the mixture was reacted at 65 ° C for 1 hour, and a part of the mixture was analyzed by liquid chromatography (LiChrospher 100 manufactured by Merck).
NH ₂ (5 μm) column (250 mmL x 4.5 mmD),
And 70% acetonitrile eluent).
β- and γ-cyclodextrin were quantified.

With respect to the obtained four types of modified CGTases and the parent strain # 1011 CGTase (wild type), the amount of cyclodextrin produced by the enzymatic reaction and the cyclodextrin production ratio were analyzed, and the results are shown in Table 2 and, respectively. It shows in Table 3.

That is, in order to change the production ratio of various cyclodextrins produced from starch by CGTase, the tyrosine residue at the 195th residue from the amino terminus of this enzyme was changed to a leucine residue or a valine residue. The mutant CGTase obtained by modifying the base at the DNA level has a production ratio of γ-cyclodextrin from starch of about 20% as compared with the parent type # 1011 wild type CGTase.
From about 75% to about 67%. In other words, by constructing a mutant CGTase gene obtained by modifying a tyrosine residue existing near the 195th residue from the amino terminus of CGTase to a leucine residue or a valine residue at the DNA level, γ- It has become possible to create a CGTase gene with a higher cyclodextrin production rate.

In addition, the above two strains, pY195L-
E. coli ME8417, and pY195V-E. Coli M
Using a mutant CGTase produced by an E. coli transformed strain of E8417, a reaction solution having a higher production ratio of γ-cyclodextrin was prepared using starch as a substrate.
Γ-Cyclodextrin can be obtained by a known separation and purification method shown in 46600 and the like.

That is, the transformant pY195L- was added to 130 g of 15% corn starch paste solution adjusted to pH 6.0.
50,000 mutations prepared from E. coli ME8417
After adding purified enzyme of CGTase and reacting at 65 ° C for 1 hour, the enzyme is inactivated by boiling. Then, it was treated with glucoamylase, and the reaction solution was purified and concentrated to isolate 4.7 g of β-cyclodextrin crystals.

The remaining sugar solution was passed through a strongly acidic cation exchange resin column previously converted to Na type and chromatographed with water to obtain a cyclodextrin fraction and a glucose fraction. Next, this cyclodextrin fraction was concentrated, passed through a Toyopearl HW-40S column, and chromatographed with water to obtain 500 g of a γ-cyclodextrin fraction having a concentration of 6.0%. As a result of analyzing this fraction by liquid chromatography, the purity of γ-cyclodextrin was 91.4%.

Above, the alkaliphilic Bcillus # 101
Although the effect of the present invention was confirmed using one strain, known CGTase
Have a similar structure and have similar enzymatic properties, the tyrosine residue near the 195th residue from the amino terminus of CGTase was changed to a leucine residue or a valine residue. It is clear that all of the above CGTases bring about the same effects as those specifically described above, that is, increase in the production of γ-cyclodextrin.

In particular, for example, Bacillus circulans
(B.circulans) 〔Nishizawa, M. et al. (1987) DNA 6.255-26
5], B. macerance and B. stearothermophilus
(Sakai, S. et al. (1987) Denpun Kagaku 34.140-147), B. macerans (Takano, T. et al. (1986) J.
Bacteriol.166.1118-1122], Klebsiella pneumoniae (Binder, F. et al. (1986) Gene
47.269-277], Bacillus sp. # 38-2
(Kaneko, T. et al. (1988) J. General Microbiol. 134.97-105
], Bacillus sp. # 17-1 [Kaneko, T.
(1989) J. General Microbiol. 135.3447-3457], Bacillus sp. # 1-1 [Schmid, G. et al. (1988) Pr.
oceedings 4th.Internat.Sympo.Cyclodextrins (Munich,
WestGermany) Kluwer Academic Publishers.pp7-17],
And Bacillus licheniformis
(Hill, D. et al. (1990) Nucleic Acids Research 18.199)

Alkali bacillus represented by
lus) or Klebsiella ( Klebsiella ) genus CGTase A region histidine residue in position 1 position 56 tyrosine residue or phenylalanine residue is # 10
It corresponds to the tyrosine residue of the amino acid residue present at the 195th residue from the amino terminus of CGTase derived from 11 strains, and the amino acid sequences before and after it also correspond to the aforementioned Bacillus sp. # 101.
Since it is the same as that of CGTase derived from one strain,
Also for CGTase, the histidine residue in the A region is defined as the 1st position, and the 56th tyrosine residue or the phenylalanine residue is CGTa derived from the Bacillus sp. # 1011 strain.
Modifications can be made in the same manner as described for se to produce the modified CGTases of the invention. Therefore, the present invention also includes a modified product in which the amino acid residue of the known CGTase is modified as described above. The amino acid sequences of the various CGTase enzymes from the A region to the B region are shown in Tables 1 and 2.

[0043]

[Table 1]

[0044]

[Table 2]

[0045]

EXAMPLES Examples will be described below by way of example. Example 1. Plasmid pTUE containing CGTase gene DNA
Cloning of 217 Alkaliphilic Bacillus sp. # 1011 (Ministry of Industrial Science and Technology), which was newly isolated from the soil by the present inventors.
No. 5, hereinafter referred to as # 1011 strain. ) Is a high-producing strain of CGTase. Already, the cloning of this CGTase gene was carried out by the inventors of the present application in JP-A-62-208286, and Appl. Microbiol. Biotech., 26: 149-.
153 (1987) and J. Bacteriol., 169: 4399-4402 (1987).
Are disclosed in.

That is, the plasmid pTUE202 described in JP-A-62-208286 and Appl.M
icrobiol.Biotech., 26: 149-153 (1987) and J. Bacterio.
l., 169: 4399-4402 (1987), plasmid pTUE202 and plasmid pTUE217 are
Both were obtained by the same method.

Both plasmids were obtained by cloning the CGTase gene DNA of the # 1011 strain (Ministry of Industrial Science and Technology No. 8685) into the BamHI site of the Escherichia coli vector pBR322. The difference between the two was the # 1011 strain. The only difference is the length of the region near the CGTase gene on the chromosomal DNA of. Therefore, the plasmid pTUE2
02 is 9.1 kb, and the plasmid pTUE217 is
It was 10.0 kb. The plasmid pTUE21 is shown in FIG.
7 shows a physical map of 7.

Although any plasmid is possible for the practice of this application, plasmid pTUE217 was used in the examples. The nucleotide sequence of the CGTase gene of the # 1011 strain was determined by the dideoxy chain termination method, and as a result, its structural gene was 2,139.
Open reading frame consisting of bp (71
3 amino acids), its upstream promoter sequence, and SD sequence were observed. (J. Bacteriol., 169: 43 above.
99-4402 (1987)).

Example 2. Using the site-specific mutation plasmid pTUE217 with the restriction enzymes SphI and Sm
The 1.8 kb DNA fragment prepared by cleaving with aI was
SsDN with M13mp1 (Takara Shuzo Co., Ltd.) as a host and uracil partially mixed in the DNA instead of thymine
A was prepared. Mutations were introduced into this ssDNA according to the method of Kunkel, TA et al.

That is, a site-specific modified gene having a DNA sequence that modifies a tyrosine residue existing at the 195th residue from the amino terminus of CGTase into a leucine residue, a valine residue, a phenylalanine residue, or an isoleucine residue is site-specific. Since it is created by dynamic mutation, Y195L, Y195
Four types of synthetic DNA designated V, Y195F, and Y195I were prepared.

Y195L: 5'AAAAACCTGCTCGATCTG
GCT3 '(SEQ ID NO: 2) Y195V: 5'AAAAACCTGGTCGATCTGGCT3' (SEQ ID NO: 3) Y195F: 5'AAAAACCTGTTCGATCTGGCT3 '(SEQ ID NO: 4) Y195I: 5'AAAAACCTGATCGATCTGGCT3' (SEQ ID NO: 5)

The results of introducing these mutations were confirmed by DNA sequencing. Then, the RF-DNAs of the four types of phages into which these mutations were introduced were subjected to alkali-SD.
The SphI-AflII fragment (1.8 kb) of the kind containing the DNA sequence subjected to the mutation was extracted by the S method. Each of the 1.8 kb DNA fragments contains a base sequence that completely encodes the primary structure from the A region of CGTase to the carboxy terminus. One tyrosine residue code is mutated.

Example 3. Construction of mutant CGTase gene, and
And preparation of purified mutant CGTase The plasmid DNA of pTUE217 was digested with the restriction enzyme Hind.
III (manufactured by Takara Shuzo Co., Ltd.) was used to prepare an approximately 5.0 kb HindIII fragment completely containing the CGTase gene. Then, it was inserted into the HindIII site of the sequencing vector pUC13 (3.2 kb, manufactured by Takara Shuzo Co., Ltd.) to construct a new plasmid pTUE254.

In this new plasmid pTUE254, the DNA region surrounded by the SphI site and AflII site contained in the existing CGTase gene was digested.
There, four types of mutant DNAs prepared in Example 2 above
Each fragment was inserted to construct a plasmid, which was transformed into Escherichia coli ME8417 strain as a host, and four types of plasmids containing the mutant CGTase gene were separated.

Each of these four types of plasmids was designated as pY1.
95L, pY195V, pY195F, and pY195
4 kinds of Escherichia coli M, which are called I and stably hold them
The E8417 transformant was transformed with pY195L-E. Coli ME.
8417, pY195V-E.coli ME8417, pY
195F-E. Coli ME8417, and pY195I-
It is called E. coli ME8417.

For these 4 strains, L-containing 250 μg ampicillin / ml and 20 μg tetracycline / ml.
Incubate with 500 ml of Broth medium, collect the bacteria, and
The E. coli periplasmic fraction is prepared by the shock method. Mutant CGTase was purified by salting out with 25% ammonium sulfate and column chromatography analysis of Toyopearl HW-55F.
A variety of purified enzyme preparations were prepared.

Example 4. Specific activity of mutant CGTase and fermentation
Analysis of elementary reaction products Table 3 shows the results of analysis of the specific activities of four types of mutant CGTases.

[Table 3]

Next, the production ratio of cyclodextrin produced by these mutant CGTases was analyzed. Average degree of polymerization 1
7% amylose (Hayashibara Biochemical Laboratories) 1% solution (1
Using 0 mM calcium acetate, pH 6.0) as a substrate, 10
Add purified enzyme at a unit of 1 ml / ml, and at 37 ℃ for 10 minutes ~
After reacting for 6 hours, the enzyme is inactivated by boiling. afterwards,
Add 100 units of glucoamylase and add 1 at 65 ° C.
After reacting for a period of time, a part of the reaction mixture was analyzed by liquid chromatography to quantify α-, β-, and γ-cyclodextrin.

With respect to the obtained four types of mutant CGTases and the parent strain # 1011 CGTase (wild type), the amount of cyclodextrin produced by the enzymatic reaction and the cyclodextrin production ratio were analyzed, and the results are shown in Table 4 and Table 4. 5 shows.

[0060]

[Table 4]

[0061]

[Table 5]

Example 5. Γ-service using mutant CGTase
Production of iclodextrin E. coli transformant pY195L-E. Coli ME8 described above
50,000 units of mutant CGTase prepared from 417
15% adjusted to pH 6.0 with sodium phosphate buffer
It is added to 130 g of corn starch paste solution, reacted at 65 ° C for 1 hour, and then boiled to inactivate the enzyme. Then the pH
It was adjusted to 5.0 and treated with glucoamylase. This reaction solution was purified and concentrated, and crystals of β-cyclodextrin were obtained.
7 g was separated.

The remaining sugar solution was passed through a strongly acidic cation exchange resin (Diaion SK-IBS) column previously converted to Na type, and chromatographed with water to obtain a 4% cyclodextrin fraction and 3 % Glucose fraction was obtained. Then, concentrate the cyclodextrin fraction to 20%,
Pass through a Toyopearl HW-40S column and chromatograph with water to obtain 6.0% γ-cyclodextrin fraction.
00g was obtained. As a result of analyzing this fraction by liquid chromatography, the purity of γ-cyclodextrin was 9
It was 1.4%.

[0064]

[Sequence list]

SEQ ID NO: 1 Sequence length: 11 Sequence type: Amino acid Topology: Linear Sequence type: Peptide

SEQ ID NO: 2 Sequence length: 21 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Synthetic DNA Sequence AAAAACCTGC TCGATCTGGC T 21

SEQ ID NO: 3 Sequence length: 21 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Synthetic DNA Sequence AAAAACCTGG TCGATCTGGC T 21

SEQ ID NO: 4 Sequence length: 21 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Synthetic DNA Sequence AAAAACCTGT TCGATCTGGC T 21

SEQ ID NO: 5 Sequence length: 21 Sequence type: Nucleic acid Number of strands: Single strand Sequence type: Synthetic DNA Sequence AAAAACCTGA TCGATCTGGC T 21

[Brief description of drawings]

FIG. 1 is a diagram showing a restriction enzyme map of plasmid pTUE217.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification number Office reference number FI technical display location (C12N 15/54 C12R 1:07)

Claims (5)

[Claims] 1. In cyclomaltodextrin glucanotransferase (CGTase), the histidine residue in the A region is defined as position 1 and the tyrosine residue or phenylalanine residue at position 56 is replaced by a leucine residue or a valine residue. A modified CGTase characterized in that 2. The CGTase is Bacillus sp.
CGTase derived from 1011 (Microtechnology Research Institute No. 8685), in which the 195th tyrosine residue from the amino terminus is replaced with a leucine residue or a valine residue,
The modified CGTase according to claim 1. 3. The modified CG according to claim 1 or 2.
A method for producing Tase, comprising culturing a host transformed with an expression vector comprising a DNA encoding the modified CGTase, and collecting the modified CGTase from the culture. Method. 4. The modified CG according to claim 1 or 2.
Gene encoding Tase. 5. The modified CG according to claim 1 or 2.
A method for producing γ-cyclodextrin, which comprises allowing Tase to act on starch and separating γ-cyclodextrin from the reaction solution.